Team:LMU-Munich/Inverter

From 2012.igem.org

Latest revision as of 14:11, 26 October 2012

• Home
• Team
• Project
  • Why Beadzillus?
  • Bacillus Introduction
  • Bacillus BioBrickBox
  • GerminationSTOP
  • Sporobeads
  • Data
  • Applications
• Extras
  • Attributions
  • Collaborations
  • Registry
  • Bacillus Strains
  • Special: Inverter
  • Achievements
• Safety
  • Project Safety
  • Release for application
• Lab Notebook
  • Weekly Journal
  • Protocols
• Human Practice
  • SynBio Day
  • Students Practical Course
  • CAS SynBio Conference
  • Berlin Conference
• Sponsors

Last year, the LMU-Munich iGEM team designed a metal-sensing device. This device links metal sensing promoters to a visual output. However, it turned out that some of the promoters that respond to metal ions are negatively regulated. For this purpose, the LMU-Munich 2011 Team started a project to convert a positive input signal into a negative output or vice versa.

Since such a genetic part would be a very beneficial tool, Julia, who also participated in iGEM 2011, continued the work from last year and got some great results.

• To get an explanation of how it works and see the results: Data and Results
• How to compose your individual Inverter, by fusions PCRs and 3A assemblies is explained here: Construct your own Inverter

Theory and Results

The main component of the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823040 Inverter] is the small RNA RyhB, which natively translationally inhibits the upstream fused region uof_CGU of the fur gene by binding to it and therefore masking Shine Dalgarno sequence.

Fig. 1: Organization of fur mRNA and base-pairing between uof and RyhB. The uof and fur reading frames are depicted by white and black arrows, respectively. The sequence comprising nt −110 to +12 is enlarged. The putative SD sequences and start codons of uof and fur are boxed. The -GG- to -GGAGG- mutation in the putative SD of uof is indicated.

We aimed at using this system to build our inverter (Fig. 2). For a proof of principle, the promoter to be inverted, was the arabionose-inducible P_BAD (PCR of [http://partsregistry.org/Part:BBa_I0500 BBa_I0500]), which regulates the expression of the small RNA RyhB (PCR of pURyhB) ([http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1852835/ Vecerek B., Bläsi U., 2007]). RyhB itself translationally inhibits uof_CGU (upstream of fur) (PCR of pRuof_CGU-lacZ) ([http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1852835/ Vecerek B., Bläsi U., 2007]) by binding and masking the Shine Dalgarno sequence. If uof_CGU is translationally fused to a reporter, in this case lacZα (PCR from pRuof_CGU-lacZ from [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1852835/ Vecerek B., Bläsi U., 2007]), expression of the β-galactosidase is translationally repressed. The repression of the reporter is dependent on the concentration of RyhB, and therefore the induction of the P_BAD promoter. consequently, the induction of the P_BAD promoter is inverted to a negative output of the reporter.

Fig. 2: Design and functional principle of the Inverter switch.

The β-galactosidase assay below shows the function of this Inverter. 1 mM IPTG is always present, so that the Reporter is fully induced. When grown with increasing amounts of arabinose in the medium, RyhB is produced and inhibits uof_CGU and consequently the fused reporter in a concentration-dependent manner.

But since the P_BAD promoter lacks the repressor binding sites, it is leaky and always produces a bit RyhB. Therefore there is always a repression of the reporter. Consequently, we got only a small signal without Arabinose (minimal repression) and the P_BAD promoter is generally poorly titratable.

In order to use the Inverter for the promoters and output of choice, it has to be constructed by fusion PCR (see next section).

Fig. 3: β-Galactosidase assay of Inverter with lacZα as reporter. The higher the arabinose concentration, the higher the translational repression of uofCGU-lacZα

Construct your own Inverter

1. Primer design:

• Promoter (which you would like to invert): BB-suffix + Promoter primer forward (a), GTCTTCCTGATCGCGAGACA + Promoter reverse primer from -10 (b)
• RyhB: TGTCTCGCGATCAGGAAGAC (RyhB fwd) (c), BB-suffix + AAAGCCAGCACCCGGCTGGCTAAG (RyhB rev) (d)
• uof: BB-prefix + GTGGTTTTCATTTAGGCGTG (Uof fwd) (e), Output/Reporter forward primer + GTTATCAGTCATGCGGAATC (uof rev) (f)
• Output/Reporter: Forward primer without BB-prefix (g), Reverse primer with BB-suffix (h)

• basic PCRs: Promoter (a+b), RyhB (c+d), uof (e+f), Output/Reporter (g+h)
• Fusion PCRs: ~ 200 ng equimolar with forward primer of the front and reverse primer of the back fusion part: promoter to RyhB (a+d) and uof to Output/Reporter (e+h)

• 3A assembly of Output/Reporter with a constitutive/inducible promoter like [http://partsregistry.org/Part:BBa_R0011 BBa_R0011]
• 3A assembly of promoter + RyhB with product of step above