"
Team:Trieste/parts
From 2012.igem.org
(Difference between revisions)
Samarisara (Talk | contribs) |
Drikicmarija (Talk | contribs) |
||
| (5 intermediate revisions not shown) | |||
| Line 9: | Line 9: | ||
<div id="box_main"> <!-- start box_main --> | <div id="box_main"> <!-- start box_main --> | ||
<div class="box_contenuti"> | <div class="box_contenuti"> | ||
| - | <h2>List of the | + | <h2>List of the Submitted Parts </h2> |
<h3>Click on the code of each part to have more information about the Biobrick, its construction, the results obtained and the relative link to the Registry.</h3> | <h3>Click on the code of each part to have more information about the Biobrick, its construction, the results obtained and the relative link to the Registry.</h3> | ||
</br> | </br> | ||
| Line 101: | Line 101: | ||
<thead> | <thead> | ||
<tr> | <tr> | ||
| - | <th>Name</th> | + | <th> Name</th> |
| - | <th>Seq 5'--> 3'</th> | + | <th> Seq 5'--> 3'</th> |
| - | <th>Notes</th> | + | <th> PCR Notes</th> |
</tr> | </tr> | ||
</thead> | </thead> | ||
| Line 116: | Line 116: | ||
<tr><td>T5EcoFw</td> <td>CGAATTCATGAGATCTAAATCATAAAAAATTTATTTGCT</td> <td>95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr> | <tr><td>T5EcoFw</td> <td>CGAATTCATGAGATCTAAATCATAAAAAATTTATTTGCT</td> <td>95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr> | ||
<tr><td>T5XhoRev</td> <td>TCTCGAGTTAGGATCCTTTCTCCTCTTTCTCTAGTAATA</td> <td>95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr> | <tr><td>T5XhoRev</td> <td>TCTCGAGTTAGGATCCTTTCTCCTCTTTCTCTAGTAATA</td> <td>95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr> | ||
| + | <tr><td>Muta1/2FW</td> <td>ATACTACGACGGTAAATGGT</td> <td>95° 5' | 30x (93° 30'' | 45° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr> | ||
| + | <tr><td>Muta1/2REV</td> <td>TACATCAGTATCGGTAGCAT</td> <td>95° 5' | 30x (93° 30'' | 45° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr> | ||
| + | <tr><td>Muta7/8FW</td> <td>GACCAAGCGATAACCGGATG</td> <td>95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr> | ||
| + | <tr><td>Muta7/8REV</td> <td>GTGAGATGATGGCCACGATT</td> <td>95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr> | ||
| + | <tr><td>Muta9/10FW</td> <td>GCGAGGTAACCTCGAACATG</td> <td>95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr> | ||
| + | <tr><td>Muta9/10REV</td> <td>CGGCGTATCGATAATTCACG</td> <td>95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
| Line 145: | Line 151: | ||
Follow us also: | Follow us also: | ||
<a href="https://www.facebook.com/IGEMUNITS?ref=ts" target="_blank"><img src="https://static.igem.org/mediawiki/2012/f/f4/Ico_fb.png" alt="Facebook" class="fb" /></a> | <a href="https://www.facebook.com/IGEMUNITS?ref=ts" target="_blank"><img src="https://static.igem.org/mediawiki/2012/f/f4/Ico_fb.png" alt="Facebook" class="fb" /></a> | ||
| - | <a href="https://twitter.com/ | + | <a href="https://twitter.com/iGEMTrieste" target="_blank"><img src="https://static.igem.org/mediawiki/2012/2/21/Ico_twitter.png" alt="twitter" class="tw" /></a> |
</div> | </div> | ||
</div> | </div> | ||
Latest revision as of 12:03, 26 October 2012
The Jolly JoCare
a safe probiotic platform for protein expression
Parts Overview
More
List of the Submitted Parts
Click on the code of each part to have more information about the Biobrick, its construction, the results obtained and the relative link to the Registry.
| Name | Type | Description | ||
| BBa_K875001 | Regulatory | T5 Cumate Operator | ||
| BBa_K875002 | Regulatory | T5 Lac Operator | ||
| BBa_K875003 | Composit | CymR | ||
| BBa_K875004 | Composit | T5LacO-LPP-OmpA-scFv | ||
| BBa_K875005 | Composit | T5LacO-LPP-OmpA-SIP | ||
| BBa_K875006 | Composit | T5LacO-LPP-PelB-scFv | ||
| BBa_K875007 | Composit | T5 LacO-LPP-PelB-SIP | ||
| BBa_K875008 | Coding | IPTG inducible Tse2 toxin | ||
| BBa_K875009 | Coding | LL 37 - Cathelicidin | ||
| BBa_K875020 | Composit | β-Glucosidase |
Primers
| Name | Seq 5'--> 3' | PCR Notes |
|---|---|---|
| Vr | ATTACCGCCTTTGAGTGAGC | 95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞ |
| Vf2 | TGCCACCTGACGTCTAAGAA | 95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞ |
| GlmSTn7Fw | GCATGTGGAAGAGGTGATTG | 95° 5' | 30x (93° 30'' | 53.8° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| GlmSTn7Rev | ACTTTATTGTTCGCCCACA | 95° 5' | 30x (93° 30'' | 53.8° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| B0015XhoRev | ACTCGAGATTACTAGTTATAAACGCAGAAAGGCCCACCC | 95° 5' | 30x (93° 30'' | 58° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| B0015EcoFw | CGAATTCATCAGATCTCCAGGCATCAAATAAAACGAAAGG | 95° 5' | 30x (93° 30'' |58° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| T5EcoFw | CGAATTCATGAGATCTAAATCATAAAAAATTTATTTGCT | 95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| T5XhoRev | TCTCGAGTTAGGATCCTTTCTCCTCTTTCTCTAGTAATA | 95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| Muta1/2FW | ATACTACGACGGTAAATGGT | 95° 5' | 30x (93° 30'' | 45° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| Muta1/2REV | TACATCAGTATCGGTAGCAT | 95° 5' | 30x (93° 30'' | 45° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| Muta7/8FW | GACCAAGCGATAACCGGATG | 95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| Muta7/8REV | GTGAGATGATGGCCACGATT | 95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| Muta9/10FW | GCGAGGTAACCTCGAACATG | 95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| Muta9/10REV | CGGCGTATCGATAATTCACG | 95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
