"
Team:Carnegie Mellon/Bio-Submitted
From 2012.igem.org
| Line 146: | Line 146: | ||
<h3 class="pre-experiment">Measured strength of the hybrid T7Lac promoters</h3> | <h3 class="pre-experiment">Measured strength of the hybrid T7Lac promoters</h3> | ||
| - | + | <p> | |
We have measured both RNA and protein expression levels of the designed T7Lac promoters using fluorogen-activated biosensors (see details in Methods & Results). These experimental results were analyzed using a mathematical model that we developed in MATLAB (see details in Model). Based on the analysis, we obtained the following properties of the new T7Lac promoters with respect to the wild-type T7Lac promoter. | We have measured both RNA and protein expression levels of the designed T7Lac promoters using fluorogen-activated biosensors (see details in Methods & Results). These experimental results were analyzed using a mathematical model that we developed in MATLAB (see details in Model). Based on the analysis, we obtained the following properties of the new T7Lac promoters with respect to the wild-type T7Lac promoter. | ||
| - | + | </p> | |
<table border="1"> | <table border="1"> | ||
Revision as of 13:53, 2 October 2012
Submitted Parts
We have submitted three T7Lac promoter parts to the registry. The followings show the sequences of these constructs.
BBa_K613007: TAATACGACTCACTATAGGGAGAGGAATTGTGAGCGGATAACAA
(BBa_K921000) Mutant I: TAATGCGACTCACTATAGGACAATTGTGGGCGGACAACAATTCCAA
(BBa_K921001) Mutant II: TAATACGACTCACTACAGGGCGGAATTGTGAGCGGATAACAATTCCAA
(BBa_K921002) Mutant III: CAATCCGACTCACTAAAGAGAGAATTGTGAGCGGATAACAATTCCAA
Predicted strength of the hybrid T7Lac promoters
Expected promoter strength of the mutants (relative to BBa_K613007):Mutant I: <100%
Mutant II: ~100%
Mutant III: ~50%
Expected LacI leaky expression of different mutants:
Mutant I: More than average
Mutant II: Average
Mutant III: Average
Measured strength of the hybrid T7Lac promoters
We have measured both RNA and protein expression levels of the designed T7Lac promoters using fluorogen-activated biosensors (see details in Methods & Results). These experimental results were analyzed using a mathematical model that we developed in MATLAB (see details in Model). Based on the analysis, we obtained the following properties of the new T7Lac promoters with respect to the wild-type T7Lac promoter.
| Promoter | Mutant I | Mutant II | Mutant III |
|---|---|---|---|
| Transcription Strength | 97% | 72% | 127% |
| Translational Efficiency | 6% | 6% | 94% |
| RNA degradation constant (assumed) | 100% | 100% | 100% |
| Protein degradation constant (fit) | 4% | 6% | 60% |
