Team:BAU-Indonesia

From 2012.igem.org

(Difference between revisions)
 
(91 intermediate revisions not shown)
Line 1: Line 1:
{{Team:BAU-Indonesia/css}}
{{Team:BAU-Indonesia/css}}
-
{{Team:BAU-Indonesia/css_gone}}
 
{{Team:BAU-Indonesia/nivo-slider}}
{{Team:BAU-Indonesia/nivo-slider}}
 +
{{Team:BAU-Indonesia/css_gone}}
-
__NOTOC__
 
-
<html>
 
-
<head>
+
-
<script src='http://ajax.googleapis.com/ajax/libs/jquery/1.7.1/jquery.min.js' type='text/javascript'></script>
+
<html xmlns="http://www.w3.org/1999/xhtml">
-
<script src='http://reader-download.googlecode.com/files/jquery.easing.1.3.js' type='text/javascript'></script>
+
    <head>
 +
   
 +
        <meta http-equiv="content-type" content="text/html; charset=utf-8" />
 +
        <title>Metamorphosis Design Free Css Templates</title>
 +
        <meta name="keywords" content="" />
 +
        <meta name="description" content="" />
 +
        <link href="styles.css" rel="stylesheet" type="text/css" media="screen" />
 +
<link rel="stylesheet" href="nivo-slider.css" type="text/css" media="screen" />
 +
       
 +
    </head>
 +
   
 +
    <script type="text/javascript" src="https://sites.google.com/site/mariozoner/gb-mario/jquery-1.3.2.js"></script>
-
<script type='text/javascript'>
+
<script type="text/javascript">
-
$(document).ready(function () {
+
$(function() {
-
    $('div.jimgMenu ul li a').hover(function() {
+
var d=300;
-
          if ($(this).is(':animated')) {
+
$('#navigation a').each(function(){
-
              $(this).addClass("active").stop().animate({width: "310px"}, {duration: 450, easing: "easeOutQuad", complete: "callback"});
+
$(this).stop().animate({
-
          } else {
+
'marginTop':'-80px'
-
              $(this).addClass("active").stop().animate({width: "310px"}, {duration: 400, easing: "easeOutQuad", complete: "callback"});
+
},d+=150);
-
          }
+
});
-
    }, function () {
+
 
-
          if ($(this).is(':animated')) {
+
$('#navigation > li').hover(
-
              $(this).removeClass("active").stop().animate({width: "78px"}, {duration: 400, easing: "easeInOutQuad", complete: "callback"})
+
function () {
-
          } else {
+
$('a',$(this)).stop().animate({
-
              $(this).removeClass("active").stop(':animated').animate({width: "78px"}, {duration: 450, easing: "easeInOutQuad", complete: "callback"});
+
'marginTop':'-2px'
-
          }
+
},200);
-
    });
+
},
 +
function () {
 +
$('a',$(this)).stop().animate({
 +
'marginTop':'-80px'
 +
},200);
 +
}
 +
);
});
});
</script>
</script>
-
</head>
 
<style>
<style>
-
.jimgMenu {
+
*Navigasi*/
-
  position:relative;
+
ul#navigation { position:fixed; margin:0px; padding:0px; top:-20px; left:370px; list-style:none; z-index:999999; width:675px; font:normal 16px Electrolize,Sans-Serif bold; -webkit-animation:2s fxhompinav ease-in-out; -moz-animation:2s fxhompinav ease-in-out; -ms-animation:2s fxhompinav ease-in-out; animation:2s fxhompinav ease-in-out; }  
-
  width:630px;
+
-
  height:200px;
+
-
  overflow:hidden;
+
-
  margin:10px;
+
-
}
+
-
.jimgMenu ul {
+
ul#navigation li { width:95px; display:inline; float:left; margin:0 0 0 2px; }
-
  list-style:none;
+
ul#navigation li a { display:block; float:left; margin-top:-74px; width:95px; height:28px; background-color: rgba(0, 0, 0, 0.6);
-
  margin:0px;
+
background: rgba(0, 0, 0, 0.6);
-
  padding:0px;
+
color: rgba(0, 0, 0, 0.6); background-repeat:no-repeat; background-position:50% 150px; border:2px solid #b9b9b9; -webkit-box-shadow:0 1px 2px rgba(0, 0, 0, 0.5); -moz-box-shadow:0 1px 2px rgba(0, 0, 0, 0.5); box-shadow:0 1px 2px rgba(0, 0, 0, 0.5); -moz-border-radius:0px 0px 10px 10px; -webkit-border-bottom-right-radius:10px; -webkit-border-bottom-left-radius:10px; -khtml-border-bottom-right-radius:10px; -khtml-border-bottom-left-radius:10px; border-radius:0px 0px 10px 10px; color:#333333; text-decoration:none; text-align:center;color:#f1f1f1; text-shadow:0 1px 1px #000; padding-top:95px; -webkit-transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; -moz-transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; -o-transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; }  
-
  display:block;
+
-
  height:200px;
+
-
  width:1340px;
+
-
}
+
-
.jimgMenu ul li {
+
ul#navigation li a:hover { margin-top:-3px; background-position:100% -5px; color:#7b7b7b; position:relative; }  
-
  float:left;
+
-
}
+
-
.jimgMenu ul li a {
+
ul#navigation li a:hover:after { content:""; width:0px; height:0px; position:absolute; top:100%; left:45%; margin-top:2px; border-width:5px; border-style:solid; border-color:transparent transparent lime transparent; }
-
  text-indent:-1000px;
+
-
  background:#FFFFFF none repeat scroll 0%;
+
-
  border-right:2px solid #fff;
+
-
  cursor:pointer;
+
-
  display:block;
+
-
  overflow:hidden;
+
-
  width:78px;
+
-
  height:200px;
+
-
}
+
-
.jimgMenu ul li.satu a {background:url(http://3.bp.blogspot.com/-tV_WbAALyr8/ThKqb8arAiI/AAAAAAAAAXE/pT9KuebBecY/s1600/landscapes.jpg) repeat scroll 0%;}
+
ul#navigation li:nth-child(1) a { background-image:url(https://static.igem.org/mediawiki/2012/c/cb/Asyu.png); }
-
.jimgMenu ul li.dua a   {background:url(http://3.bp.blogspot.com/--Dw4kWyM3yo/ThKqfxFZvtI/AAAAAAAAAXM/1L5ODPu0OcU/s1600/people.jpg) repeat scroll 0%;}
+
ul#navigation li:nth-child(2) a { background-image:url(https://static.igem.org/mediawiki/2012/b/be/Asyu2.png); }
-
.jimgMenu ul li.tiga a {background:url(http://4.bp.blogspot.com/-Uib-i2TNAsc/ThKqd6uDB6I/AAAAAAAAAXI/p89exio6t8E/s1600/nature.jpg) repeat scroll 0%;}
+
ul#navigation li:nth-child(3) a { background-image:url(https://static.igem.org/mediawiki/2012/1/18/Pr.jpg); }
-
.jimgMenu ul li.empat a {background: url(http://4.bp.blogspot.com/-53TyMk779WE/ThKqY4c6BkI/AAAAAAAAAXA/rPFPPg0J8lc/s1600/abstract.jpg) repeat scroll 0%;}
+
ul#navigation li:nth-child(4) a { background-image:url(https://static.igem.org/mediawiki/2012/d/da/Icon_dna.png); }
-
.jimgMenu ul li.lima a {background: url(http://4.bp.blogspot.com/-m0l4jFx9_TM/ThKqhmjUqmI/AAAAAAAAAXQ/wAPNi03KSn0/s1600/urban.jpg) repeat scroll 0%;min-width:310px;}
+
ul#navigation li:nth-child(5) a { background-image:url(https://static.igem.org/mediawiki/2012/6/68/Edu-science-icon.png); }
 +
ul#navigation li:nth-child(6) a { background-image:url(https://static.igem.org/mediawiki/2012/0/00/Asyu5.png); }
 +
ul#navigation li:nth-child(7) a { background-image:url(https://static.igem.org/mediawiki/2012/1/19/Attributions2.png); }
 +
ul#navigation li:nth-child(8) a { background-image:url(https://static.igem.org/mediawiki/2012/0/0a/Medal-icon.png);
 +
}
 +
@-webkit-keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;} } @-moz-keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;} } @-ms-keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;} } @keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;}
 +
/*Navigasi*/
 +
</style>
 +
   
 +
<script language='javascript' src='https://sites.google.com/site/tutorialseoblogger/file/jquery_mini.js'></script>
 +
<script language='javascript' src='https://sites.google.com/site/tutorialseoblogger/file/jquery.dimensions.js'></script>
 +
 +
    <body>
 +
        <div id="bg_top">
 +
        <div id="wrap_bg">
 +
              <div id='floatMenu'>
 +
<ul class='menu1'>
 +
<img src="https://static.igem.org/mediawiki/2012/1/19/Maskot_tim_iGEM_IPB.png"/>
 +
<li><a href='http://ipb.ac.id/' target="_blank" title='IPB'> Bogor Agricultural University </a></li>
 +
<li><a href='http://fmipa.ipb.ac.id/' target="_blank" title='FMIPA'> Faculty of Mathematics and Natural Sciences </a></li>
 +
<li><a href='http://biology-ipb.org/' target="_blank" title='Biology'> Department of Biology </a></li>
 +
<li><a href='http://cs.ipb.ac.id/' target="_blank" title='CS'> Department of Computer Science</a> </li>
 +
<li><a href='#' onclick='MGJS.goTop();return false;'> Back to top </a></li>
 +
</ul>
 +
<script language='javascript'>
 +
var name = "#floatMenu";
 +
var menuYloc = null;
 +
$(document).ready(function(){
 +
menuYloc = parseInt($(name).css("top").substring(0,$(name).css("top").indexOf("px")))
 +
$(window).scroll(function () {
 +
offset = menuYloc+$(document).scrollTop()+"px";
 +
$(name).animate({top:offset},{duration:500,queue:false});
 +
});
 +
});
 +
</script>
 +
</div>
 +
           
 +
            <ul id="navigation" style="margin:40px 0 0 220px">
 +
<li class="nav1"><a href="https://2012.igem.org/Team:BAU-Indonesia">Home</a></li>
 +
<li class="nav2"><a href="https://2012.igem.org/Team:BAU-Indonesia/Team">Team</a></li>
 +
<li class="nav3"><a href="https://2012.igem.org/Team:BAU-Indonesia/Project">Project</a></li>
 +
<li class="nav4"><a href="https://2012.igem.org/Team:BAU-Indonesia/Parts">Parts</a></li>
 +
<li class="nav5"><a href="https://2012.igem.org/Team:BAU-Indonesia/Modeling">Modeling</a></li>
 +
<li class="nav6"><a href="https://2012.igem.org/Team:BAU-Indonesia/Notebook">Notebook</a></li>
 +
<li class="nav7"><a href="https://2012.igem.org/Team:BAU-Indonesia/Attributions">Attributions</a></li>
 +
<li class="nav8"><a href="https://2012.igem.org/Team:BAU-Indonesia/Achievements">Achievement</a></li>
-
h1.firstHeading { display: none; }
+
</ul>
 +
<img style="margin-left:-900px" src="https://static.igem.org/mediawiki/2012/archive/9/90/20120909091254%21BAU-Indonesia_logo.png" />         
 +
  <div id="wrap">
-
p {text-align: justify;}
+
        <div id="header">
 +
<div id="prew_box">
 +
<div id="wrapper">
 +
        <div id="slider-wrapper">       
 +
            <div id="slider" class="nivoSlider">
 +
<img src="https://static.igem.org/mediawiki/2012/b/bd/Header2projek_copy.jpg" alt="" />
 +
<img src="https://static.igem.org/mediawiki/2012/d/d4/Header1_tim.jpg" alt="" />
 +
                <img src=" https://static.igem.org/mediawiki/2012/e/e8/Header1.jpg" alt="" />
 +
                <img src="https://static.igem.org/mediawiki/2012/4/48/Header9.jpg" alt=""/>
 +
                <img src="https://static.igem.org/mediawiki/2012/e/e8/Header4.jpg" alt="" />
 +
<img src="https://static.igem.org/mediawiki/2012/8/8c/Header3.jpg" alt="" />
 +
                <img src="https://static.igem.org/mediawiki/2012/0/07/Header8.jpg" alt="" />
-
a:link { color: #00b0e6; text-decoration: none}
+
            </div>       
-
a:visited { color:#00b0e6; text-decoration: none}
+
        </div>
-
a:hover { color:#f29400; text-decoration: none}
+
-
a:active { color:#f29400; text-decoration: none}
+
-
#bodyContent { padding: 10px auto; width: 910px; margin: auto; clear: none; }
+
<script type="text/javascript" src="http://wiki-rian.googlecode.com/files/jquery-1.4.3.min.js"></script>
-
table#team_members { text-align: justify; border: 0; }
+
    <script type="text/javascript" src="http://wiki-rian.googlecode.com/files/jquery.nivo.slider.pack.js"></script>
-
table#team_members h2, table#team_members h3 { clear: both; }
+
   
 +
    <script type="text/javascript">
 +
    $(window).load(function() {
 +
        $('#slider').nivoSlider();
 +
    });
 +
    </script>
 +
</div>
 +
 +
</div>
 +
 +
</div> <div style="clear: both"></div>
 +
<div id="content" style="background:url(https://static.igem.org/mediawiki/2012/6/67/A.jpg)">
-
/*-----------------------------------------------------------------------------------------------*/
+
<!--                  
-
div.MenuBar ul li ul.DropDownMenu {
+
<div class="verticalaccordion">
-
  display: none; /* Hides all drop-down menus. */
+
<ul>
 +
    <li>
 +
      <h3>Daftar isi</h3>
 +
        <div id="isinya">isi konten di sini bisa juga dengan java script atau yang lainnya</div>
 +
    </li>
 +
    <li>
 +
      <h3>F1</h3>
 +
        <div id="isinya">pokonya apa saja isi di sini terserah mau di isi apa</div>
 +
    </li>
 +
    <li>
 +
      <h3>Free Dfloaf</h3>
 +
        <div id="isinya">isi apa saja terserah sobat</div>
 +
    </li>
 +
    <li>
 +
      <h3>Free Dosfs</h3>
 +
        <div id="isinya">isi konten  di sini bisa dengan gambar atau yang lainnya</div>
 +
    </li>
 +
</ul>
 +
</div>
 +
      --
 +
<div id="left_column">
 +
<!-- Start left news box -->
 +
<div class="left_news_box">
 +
<div class="left_news_top"></div>
 +
<div class="left_news_bg">
 +
<h2><b>All About iGEM </h2><h3>International Genetically Engineered Machine</b></h3>
 +
<div class="text">
 +
<img src="https://static.igem.org/mediawiki/2012/4/43/IGEM_basic_Logo_white_stylizedada.png"/>
 +
<p style="text-align:justify"><b>iGEM is one of the most prestigious of international genetic
 +
  competition for students of optimizing innovation and creativity for a
 +
  better life. This time, Indonesia is participating by the team which
 +
  is come from Bogor Agricultural University. 10 undergraduate students
 +
  and 2 faculty advisor (link to profile team) have a passion in
 +
  environmental molecular science. BAU-Indonesia is a team that has a purpose to
 +
  degrade plastic on the ground such as : PET, PE, PP and PVC. Indonesia
 +
  is still active in the use of these kinds of plastic but the
 +
  degradation itself is still not effective and efficient. The existence
 +
  of plastic waste in the river will spread to the sea or ocean. If it's
 +
  not being eliminated or degraded, Earth would be fulfilled with a pile
 +
  of plastic either at terrestrial or water that will disturb the living
 +
  system. It can kill living organism which is started from microbe,
 +
  plant, animal, and human. Based on those reasons, BAU-Indonesia team will make
 +
  the solution to get the plastic degradation enzyme from bacteria,
 +
    especially the enzyme to degrade PE and PET. </b></p>
 +
 +
 +
    </div>
 +
<div class="clear"></div>
 +
</div>
 +
<div class="left_news_bot"></div>
 +
</div>
 +
<!-- End left news box -->
 +
 +
<!-- Start left news box -->
 +
<div class="left_news_box">
 +
<div class="left_news_top"></div>
 +
<div class="left_news_bg">
 +
<h2><b>Project Background</b></h2>
 +
<div class="text"><h3><b>Introduction</b></h3>
 +
<p style="text-align:justify"><b>Polyethylene is a synthetic polymer that made of long chain monomers of ethylene. It is a thermoplastic commodity mostly used for packaging. About 140 million tonnes of synthetic polymers are produced worldwide annually with their utility escalating at a rate of 12% per annum (Shimao 2001). The most widely used plastics used in packaging are polyethylene (LDPE, MDPE, HDPE and LLDPE), polypropylene (PP), polystyrene (PS), polyvinyl chloride (PVC), polyurethane (PUR), poly(ethylene terephthalate) (PET), poly (butylene terephthalate) (PBT). Polyethylene are resistant against microbial attack, since during their short time of presence in nature evolution could not design new enzyme structures capable of degrading synthetic polymers (Mueller 2006).  In order to manage the utility of these polymers in the nature, there are two ways: one is to exploit the microorganisms in degrading polyethylene and the other is to develop artificial polymers susceptible to biodegradation. Subsequently, to gain large-scale acceptance these man-made biodegradable polyethylene should retain all the essential properties of utility by the consumer and when discarded in the environment should demonstrate their degradability more rapidly than the conventional ones (El-Shafei et al. 1998).
 +
<br> Nanda et al. (2010) have reported natural and synthetic PE degradation activity of Pseudomonas sp. that isolated from sewage sludge and household garbage dump. The degradation activity from each Pseudomonas sp. isolates were different between natural and synthetic PE 31,4%-46,2% and 29,1% - 16,3% respectively in loss weight. Some kind of enzymes had a PE degradation activity reported by Guebitz  and Cavaco-Paulo (2008) cutinase. Cutinase has recently received much attention because of its potential application for surface modification and degradation of aliphatic and aromatic polyesters, especially polyethylene terephthalate (PET), which is a synthetic aromatic polyester composed of terephthalic acid (TPA) and ethylene glycol) ; however, the number of cutinases, which have been studied regarding PET modification, is still limited, and this limitation may result in the delay of the research toward the practical use of cutinases. Bogor Agricultural University (IPB) iGEM team project is making a synthetic bacteria that can degrade plastic ecspecially PE/PET with a novel degrading enzymes.<b>
-
}
+
</p>
-
/*
+
<br>
-
li:hover works in IE7 and FF2.
+
<h3><b>References</b></h3>
-
a:hover works in IE6 and FF2.
+
<p style="text-align:justify">
-
a:hover breaks li:hover in FF2.
+
<b>El-Shafei HA, El-Nasser NHA, Kansoh AL, Ali AM .1998. Biodegradation of disposable polyethylene by fungi and Streptomyces species. Polym. Degrad. Stab. 62: 361 - 365.<br><br>
-
*/
+
-
div.MenuBar ul li:hover ul.DropDownMenu li ul.SideMenu,
+
Guebitz GM, Cavaco-Paulo A. 2008. Enzymes go big: surface hydrolysis and functionalization of synthetic polymers. Trends Biotechnol. 26:32–38.<br><br>
-
div.MenuBar ul li a:hover ul.DropDownMenu li a ul.SideMenu {
+
-
  display: none; /* Hides all side menus. */
+
-
}
+
-
/*------------------------------------------------------------------------------------- Menu Bar */
+
-
div.MenuBar {
+
-
  font: arial, helvetica, sans-serif;
+
-
  height: 30px;
+
-
  width: 910px;
+
-
  /*width: 100%*/
+
-
  margin: 0;
+
-
  border-top: 0;
+
-
  border-right: 0;
+
-
  border-left: 0;
+
-
  padding: 0;
+
-
  background: black;
+
-
 
+
-
}
+
-
div.MenuBar ul {
+
-
  font: arial, helvetica, sans-serif;
+
-
  text-align: center;
+
-
  list-style-type: none;
+
-
  margin: 0.5em auto;
+
-
  border: 0;
+
-
  padding: 0;
+
-
  background: black;
+
-
}
+
-
div.MenuBar ul li {
+
-
  font: arial, helvetica, sans-serif;
+
-
  display: block;
+
-
  padding: 0;
+
-
  margin: 0;
+
-
  font-size: 1.3em;
+
-
  float: left;
+
-
  background: black;
+
-
  text-align: center;
+
-
  width: 107px;
+
-
  position: relative; /* Sets the positioning context for each drop-down menu. */
+
-
}
+
-
div.MenuBar ul li a {
+
Shimao, M (2001). Biodegradation of plastics. Curr. Opin. Biotechnol. 12: 242 - 247.<br><br>
-
  font: arial, helvetica, sans-serif;
+
-
  display: block;
+
-
  background: black;
+
-
  height: 22px; /* Keep height + padding-top + padding-bottom sync with the menu bar height. */
+
-
  color: #ffffff;
+
-
  padding-top: 4px;
+
-
  padding-bottom: 4px;
+
-
  padding-left: 1em; /* Sets the left space between top-level items. */
+
-
  padding-right: 1em; /* Sets the right space between top-level items. */
+
-
  text-decoration: none;
+
-
}
+
-
/*------------------------------------------------------------------------------ Drop-Down Menus */
+
Mueller RJ. 2006. Biological degradation of synthetic polyesters—enzymes as  potential catalysts for polyester recycling. Proc Biochem 41:2124–8.<br><br>
-
div.MenuBar ul li:hover ul.DropDownMenu,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu {
+
-
  display: block;
+
-
  width: 10em; /* Drop-down menu width.
+
-
                  Use MenuTailor.css to customize. */
+
-
  height: 1em;
+
-
  padding: 1px; /* Sets the drop-down menu "effective border" width. */
+
-
  position: absolute;
+
-
  top: 23px; /* Places the drop-down menu under the menu bar.
+
-
                Keep it sync with the menu bar height. */
+
-
  left: 0; /* Aligns the drop-down menu to its top-level item. */
+
-
  background-color: black; /* Selected item. */
+
-
  color: #FFFFFF;
+
-
}
+
Nanda S, Snigdha S, Abraham J.2010. Studies on the biodegradation of natural and synthetic polyethylene by Pseudomonas spp. J. Appl. Sci. Environ. Manage. Vol. 14 (2) 57 – 60.<br>
-
div.MenuBar ul li:hover ul.DropDownMenu li a,
+
<b>
-
div.MenuBar ul li a:hover ul.DropDownMenu li a {
+
-
  width: 10em; /* Keep it sync with the drop-down menu width.
+
-
                            Use MenuTailor.css to customize. */
+
-
  height: 1em;
+
-
  padding-left: 0;
+
-
  padding-right: 0;
+
-
  background-color: black; /* Selected item. */
+
-
  color: #FFFFFF;
+
-
}
+
-
ul.DropDownMenu li a span {
+
-
  display: block;
+
-
  padding-left: 0.75em; /* Sets the left space of each drop-down menu item. */
+
-
  padding-right: 0.25em; /* Sets the right space of each drop-down menu item. */
+
-
  text-align: right; /* Aligns the >> symbol to the right. */
+
-
}
+
-
ul.DropDownMenu li a span span {
+
-
  float: left; /* Aligns the text (back) to the left. */
+
-
  font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
+
-
  height: 20px;
+
-
  color: #FFFFFF;
+
-
}
+
-
/*----------------------------------------------------------------------------------- Side Menus */
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
+
-
  display: block;
+
-
  width: 11em; /* Side menu width.
+
-
                  Use MenuTailor.css to customize. */
+
-
  padding: 1px; /* Sets the side menu "effective border" width. */
+
-
  position: absolute;
+
-
  top: -1px; /* Aligns the side menu to its drop-down menu item.
+
-
                Keep it sync with the side menu "effective border" width. */
+
-
  left: 13em; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width.
+
-
                            Use MenuTailor.css to customize. */
+
-
}
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
+
-
  width: 11em; /* Keep it sync with the side menu width.
+
-
                            Use MenuTailor.css to customize. */
+
-
  font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
+
-
  left: 13em; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width.
+
-
                            Use MenuTailor.css to customize. */
+
-
}
+
-
div.MenuBar ul li ul.DropDownMenu li ul.SideMenu li a span {
+
-
  padding-left: 1.5em; /* Sets the left space of each side menu item. */
+
-
  padding-right: 0.5em; /* Sets the right space of each side menu item. */
+
-
  text-align: left;
+
-
  font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
+
-
  left: 13em; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width.
+
-
                            Use MenuTailor.css to customize. */
+
-
}
+
-
/*----------------------------------------------------------------------------- Browser Specific */
+
-
* html div.MenuBar ul li a {
+
-
  float: left; /* Required for IE55 and IE6.
+
-
                            Breaks O9.
+
-
                            Hidden (* html) from non-IE browsers. */
+
-
}
+
-
* html ul.DropDownMenu li a:hover {
+
-
  cursor: hand; /* Required for IE55.
+
-
                  Hidden (* html) from non-IE browsers. */
+
-
}
+
-
ul.DropDownMenu li a:hover {
+
-
  cursor: pointer; /* Required for IE6 and IE7.
+
-
                      Hidding it (* html) from non-IE browsers breaks IE7!
+
-
}
+
-
* html div.MenuBar a:hover {
+
-
  text-decoration: none; /* Required for IE55 and IE6.
+
-
                            Hidden (* html) from non-IE browsers. */
+
-
}
+
-
* html div.MenuBar ul li table,
+
-
* html div.MenuBar ul li table td {
+
-
  border: 0; /* Required for IE55 and IE6.
+
-
                Hidden (* html) from non-IE browsers. */
+
-
}
+
-
/*------------------------------------------------------------------------------- Default Colors */
+
-
div.MenuBar {
+
-
  background-color: Menu;
+
-
  border-bottom: 1px solid ButtonShadow;
+
-
}
+
-
div.MenuBar a {
+
-
  background-color: Menu; /* Top-level unselected items. */
+
-
  color: MenuText;
+
-
}
+
-
div.MenuBar ul li:hover a,
+
-
div.MenuBar ul li a:hover {
+
-
  color: #ea7f16;
+
-
  background-color: Highlight; /* Top-level selected item. */
+
-
  color: HighlightText;
+
-
}
+
-
/*...............................................................................................*/
+
-
div.MenuBar ul li:hover ul.DropDownMenu,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu {
+
-
  background-color: ButtonShadow; /* Sets the drop-down menu "effective border" color. */
+
-
}
+
-
div.MenuBar ul li:hover ul.DropDownMenu li a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a {
+
-
  background-color: Menu;  Drop-down menu unselected items.
+
-
                            Sets the drop-down menu "effective background" color. */
+
-
  color: MenuText;
+
-
}
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover {
+
-
  background-color: Highlight; /* Drop-down menu selected item. */
+
-
  color: HighlightText;
+
-
}
+
-
/*...............................................................................................*/
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
+
-
  background-color: ButtonShadow; /* Sets the side menu "effective border" color. */
+
-
}
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
+
-
  background-color: Menu; /* Side menu unselected items.
+
-
                            Sets the side menu "effective background" color. */
+
-
  color: MenuText;
+
-
}
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {
+
-
  background-color: Highlight; /* Side menu selected item. */
+
-
  color: HighlightText;
+
-
}
+
-
/*-----------------------------------------------------------------------------------------------*/
+
-
/*Script-Free 3-Level Menu 1.2 Tailor
+
-
  www.CesarDaniel.info
+
-
/*-------------------------------------------------------------------------------------- General */
+
-
body {
+
-
  background: white;
+
-
  color: black;
+
-
  margin: 0;
+
-
  border: 0;
+
-
  padding: 0;
+
-
}
+
 +
</p>
-
div.MenuBar {
+
</div>
-
  font: 13px arial, helvetica, sans-serif;
+
<div class="clear"></div>
-
}
+
</div>
-
div.MenuBar ul {
+
<div class="left_news_bot"></div>
-
  font: 13px arial, helvetica, sans-serif; /* Required for IE55. */
+
</div>
-
}
+
<!-- End left news box -->
-
/*--------------------------------------------------------------------------------------- Colors */
+
</div>
-
div.MenuBar {
+
<div id="right_column">
-
  background-color: black; /* Selected item. */
+
<!-- Start right news box -->
-
  color: #FFFFFF;
+
<div class="right_news_box">
-
  border-bottom: 1px solid ButtonShadow;
+
<div class="right_news_top"></div>
-
}
+
<div style="width:auto" class="right_news_bg">
-
div.MenuBar a,
+
<h2><b>Abstract</b></h2><p>==Plastic Terminator==</p>
-
div.MenuBar ul li:hover ul.DropDownMenu li a,
+
<div class="text">
-
div.MenuBar ul li a:hover ul.DropDownMenu li a,
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
+
<p style="text-align:justify"><b>Indonesia is known as the 4th highest population densities around the world. Nowadays, 1.5 million tons/year from human activity which is used in the world is PET. PET is a thermoplastic polymer resin, not easily degraded naturally. Based on this background, the BAU-Indonesia team designs a plasmid which is contains of encoding cutinase degrading enzymes of producing PET. <br>The early stage of this project was done by the preservation of plastic waste bacteria from landfills at Galuga. The bacteria were cultured in liquid media which is contained yeast extract powder and PET enrichment. The result of this preservation will be followed by the isolation of DNA and PCR with Cutinase F primer'ACGCGCCGGGCGTCACCGAGCA'3 and R 5'ACGCGTCGTGCCGTCAGGGCCA'3. Cutinase gen that were amplified will be inserted to plasmid pSB1C3. The recombinant plasmid which contained the cutinase gene will be introduced into E. coli. Finally it will be used as PET biodegradator product. </b></p>
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
+
-
  background-color: black; /* Selected item. */
+
</div>
-
  color: #FFFFFF;
+
<div class="clear"></div>
-
}
+
<div class="text">
-
div.MenuBar ul li:hover a,
+
-
div.MenuBar ul li a:hover,
+
</div>
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover a,
+
<div class="clear"></div>
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover,
+
</div>
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,
+
<div class="right_news_bot"></div>
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {
+
</div>
-
  background-color: #00b0e6; /* Selected item. */
+
<!-- End right news box -->
-
  color: #FFFFFF;
+
-
}
+
<!-- Start right news box -->
-
div.MenuBar ul li:hover ul.DropDownMenu,
+
<div class="right_news_box">
-
div.MenuBar ul li a:hover ul.DropDownMenu,
+
<div class="right_news_top"></div>
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
+
<div class="right_news_bg">
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
+
<h2><b>Wise Words</b></h2>
-
  background-color: ButtonShadow; /* Sets the drop-down and side menus "effective border" color. */
+
<div class="text">
-
}
+
<p class="italic_style" style="text-align:justify">&quot;We don't afraid of failure
-
/*--------------------------------------------------------------------------------------- Widths */
+
We dare to take risks
-
/*
+
        to achieve success
 +
We are extraordinary people
 +
        with a brave fight
 +
        to try new things
 +
For us, risk doesn't mean anything...
 +
For us, failure is not a failure
 +
Success for us is created because we got a lot of failure.<br><br>
-
/*
+
With this failure,
-
Menu Bar 1
+
we find identity
-
Drop-Down Menu #2
+
We believe the Lord bless the way that we live in this moment,
-
*/
+
because we dare to fail !<br><br>
-
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4,
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4 li a,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4 li a {
+
-
  width: 11em; /* Drop-down menu width. */
+
-
}
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5,
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5 li a,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5 li a {
+
-
  width: 12em; /* Drop-down menu width. */
+
-
}
+
-
/*...............................................................................................*/
+
We just need to find a way
-
/*
+
the most appropriate way to achieve success<br><br>
-
Menu Bar 1
+
-
Drop-Down Menu #2
+
-
Side Menu #1
+
-
*/
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 {
+
-
  left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width. */
+
-
}
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1,
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1 li a,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 li a {
+
-
  width: 10em; /* Side menu width. */
+
-
}
+
-
/*...............................................................................................*/
+
-
/*
+
-
Menu Bar 1
+
-
Drop-Down Menu #2
+
-
Side Menu #2
+
-
*/
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 {
+
-
  left: 15.5em  !important; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width. */
+
-
}
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2,
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2 li a,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 li a {
+
-
  width: 10em; /* Side menu width. */
+
-
}
+
-
/*...............................................................................................*/
+
-
/*
+
-
Menu Bar 1
+
-
Drop-Down Menu #2
+
-
Side Menu #3
+
-
*/
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 {
+
-
  left: 15.5em  !important; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width. */
+
-
}
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3,
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3 li a,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 li a {
+
-
  width: 10em; /* Side menu width. */
+
-
}
+
-
/*...............................................................................................*/
+
-
</style>
+
We get much rejection
 +
because that is what makes
 +
us be more motivated<br><br>
 +
All failures are
 +
good lesson for us<br><br>
-
<body>
+
We still believe
-
<div class='jimgMenu'>
+
There is a chance
-
     <ul>
+
     to learn ... to search ...
-
          <li class='satu'><a href='#'>Landscapes</a></li>
+
and serving the best&quot;</p>
-
          <li class='dua'><a href='#'>People</a></li>
+
<div class="read"><a>Odop for Us</a></div>
-
          <li class='tiga'><a href='#'>Nature</a></li>
+
</div>
-
          <li class='empat'><a href='#'>Abstract</a></li>
+
<div class="clear"></div>
-
          <li class='lima'><a href='#'>Urban</a></li>
+
-
    </ul>
+
<div class="clear"></div>
-
</div>
+
</div>
-
<div class='MenuBar' id="navi">
+
<div class="right_news_bot"></div>
-
<ul>
+
</div>
-
<li>
+
<!-- End right news box -->
-
<a href="https://2012.igem.org/Team:BAU-Indonesia" style="color: white">Home
+
</div>
-
<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
<div class="clear"></div>
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
</div>
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
<div id="footer">
-
</li>
+
<!--footer begins -->
-
<li>
+
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Team" style="color: white">Team<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
-
+
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
</li>
+
-
<li>
+
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Project" style="color: white">Project<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
-
+
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
<ul class="DropDownMenu" id="MB1-DDM1">
+
<div class="row-top">
-
+
<div class="row-padding">
-
<li><a href="https://2012.igem.org/Team:BAU-Indonesia/ProjectDesc"><span><span>Project Description</span></span></a></li>
+
<div class="wrapper">
-
<li><a href="https://2012.igem.org/Team:BAU-Indonesia/Abstract"><span><span>Abstract</span></span></a></li>
+
-
+
<div class="col-3">
-
</ul>
+
<h2><b>Follow Us: <b/></h2>
-
</li>
+
<ul class="list-services">
-
 
+
-
<li>
+
<li class="item-2"><a href="https://twitter.com/BAU_INDONESIA" target="_blank">Twitter (BAU-INDOESIA)</a></li>
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Parts" style="color: white">Parts<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
</ul>
-
+
</div>
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
</li>
+
-
<li>
+
</div>
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Modeling" style="color: white">Modeling<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
</div><div class="clear"></div>
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
-
+
  </div>
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
</div>
-
</li>
+
-
<li>
+
  </div>
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Notebook" style="color: white">Notebook<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
        </div>
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
        </div>
-
+
    </body>
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
</li>
+
-
<li>
+
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Safety" style="color: white">Safety<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
-
+
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
</li>
+
-
        <li>
+
-
<a "href=https://2012.igem.org/Team:BAU-Indonesia/Attributions" style="color: white">Attributions<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
-
+
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
</li>
+
-
 
+
-
+
-
</ul>
+
-
 
+
-
</div>
+
-
<div id="header_bottom"><img src="https://static.igem.org/mediawiki/2008/e/ef/Navi_bg.gif" alt="" / ></div>
+
-
</body>
+
</html>
</html>

Latest revision as of 22:40, 26 September 2012


Metamorphosis Design Free Css Templates

All About iGEM

International Genetically Engineered Machine

iGEM is one of the most prestigious of international genetic competition for students of optimizing innovation and creativity for a better life. This time, Indonesia is participating by the team which is come from Bogor Agricultural University. 10 undergraduate students and 2 faculty advisor (link to profile team) have a passion in environmental molecular science. BAU-Indonesia is a team that has a purpose to degrade plastic on the ground such as : PET, PE, PP and PVC. Indonesia is still active in the use of these kinds of plastic but the degradation itself is still not effective and efficient. The existence of plastic waste in the river will spread to the sea or ocean. If it's not being eliminated or degraded, Earth would be fulfilled with a pile of plastic either at terrestrial or water that will disturb the living system. It can kill living organism which is started from microbe, plant, animal, and human. Based on those reasons, BAU-Indonesia team will make the solution to get the plastic degradation enzyme from bacteria, especially the enzyme to degrade PE and PET.

Project Background

Introduction

Polyethylene is a synthetic polymer that made of long chain monomers of ethylene. It is a thermoplastic commodity mostly used for packaging. About 140 million tonnes of synthetic polymers are produced worldwide annually with their utility escalating at a rate of 12% per annum (Shimao 2001). The most widely used plastics used in packaging are polyethylene (LDPE, MDPE, HDPE and LLDPE), polypropylene (PP), polystyrene (PS), polyvinyl chloride (PVC), polyurethane (PUR), poly(ethylene terephthalate) (PET), poly (butylene terephthalate) (PBT). Polyethylene are resistant against microbial attack, since during their short time of presence in nature evolution could not design new enzyme structures capable of degrading synthetic polymers (Mueller 2006). In order to manage the utility of these polymers in the nature, there are two ways: one is to exploit the microorganisms in degrading polyethylene and the other is to develop artificial polymers susceptible to biodegradation. Subsequently, to gain large-scale acceptance these man-made biodegradable polyethylene should retain all the essential properties of utility by the consumer and when discarded in the environment should demonstrate their degradability more rapidly than the conventional ones (El-Shafei et al. 1998).
Nanda et al. (2010) have reported natural and synthetic PE degradation activity of Pseudomonas sp. that isolated from sewage sludge and household garbage dump. The degradation activity from each Pseudomonas sp. isolates were different between natural and synthetic PE 31,4%-46,2% and 29,1% - 16,3% respectively in loss weight. Some kind of enzymes had a PE degradation activity reported by Guebitz and Cavaco-Paulo (2008) cutinase. Cutinase has recently received much attention because of its potential application for surface modification and degradation of aliphatic and aromatic polyesters, especially polyethylene terephthalate (PET), which is a synthetic aromatic polyester composed of terephthalic acid (TPA) and ethylene glycol) ; however, the number of cutinases, which have been studied regarding PET modification, is still limited, and this limitation may result in the delay of the research toward the practical use of cutinases. Bogor Agricultural University (IPB) iGEM team project is making a synthetic bacteria that can degrade plastic ecspecially PE/PET with a novel degrading enzymes.


References

El-Shafei HA, El-Nasser NHA, Kansoh AL, Ali AM .1998. Biodegradation of disposable polyethylene by fungi and Streptomyces species. Polym. Degrad. Stab. 62: 361 - 365.

Guebitz GM, Cavaco-Paulo A. 2008. Enzymes go big: surface hydrolysis and functionalization of synthetic polymers. Trends Biotechnol. 26:32–38.

Shimao, M (2001). Biodegradation of plastics. Curr. Opin. Biotechnol. 12: 242 - 247.

Mueller RJ. 2006. Biological degradation of synthetic polyesters—enzymes as potential catalysts for polyester recycling. Proc Biochem 41:2124–8.

Nanda S, Snigdha S, Abraham J.2010. Studies on the biodegradation of natural and synthetic polyethylene by Pseudomonas spp. J. Appl. Sci. Environ. Manage. Vol. 14 (2) 57 – 60.

Abstract

==Plastic Terminator==

Indonesia is known as the 4th highest population densities around the world. Nowadays, 1.5 million tons/year from human activity which is used in the world is PET. PET is a thermoplastic polymer resin, not easily degraded naturally. Based on this background, the BAU-Indonesia team designs a plasmid which is contains of encoding cutinase degrading enzymes of producing PET.
The early stage of this project was done by the preservation of plastic waste bacteria from landfills at Galuga. The bacteria were cultured in liquid media which is contained yeast extract powder and PET enrichment. The result of this preservation will be followed by the isolation of DNA and PCR with Cutinase F primer'ACGCGCCGGGCGTCACCGAGCA'3 and R 5'ACGCGTCGTGCCGTCAGGGCCA'3. Cutinase gen that were amplified will be inserted to plasmid pSB1C3. The recombinant plasmid which contained the cutinase gene will be introduced into E. coli. Finally it will be used as PET biodegradator product.

Wise Words

"We don't afraid of failure We dare to take risks to achieve success We are extraordinary people with a brave fight to try new things For us, risk doesn't mean anything... For us, failure is not a failure Success for us is created because we got a lot of failure.

With this failure, we find identity We believe the Lord bless the way that we live in this moment, because we dare to fail !

We just need to find a way the most appropriate way to achieve success

We get much rejection because that is what makes us be more motivated

All failures are good lesson for us

We still believe There is a chance to learn ... to search ... and serving the best"