Team:BAU-Indonesia/Modeling
From 2012.igem.org
(Difference between revisions)
(3 intermediate revisions not shown) | |||
Line 4: | Line 4: | ||
- | |||
<html xmlns="http://www.w3.org/1999/xhtml"> | <html xmlns="http://www.w3.org/1999/xhtml"> | ||
<head> | <head> | ||
Line 59: | Line 58: | ||
ul#navigation li:nth-child(2) a { background-image:url(https://static.igem.org/mediawiki/2012/b/be/Asyu2.png); } | ul#navigation li:nth-child(2) a { background-image:url(https://static.igem.org/mediawiki/2012/b/be/Asyu2.png); } | ||
ul#navigation li:nth-child(3) a {background-image:url(https://static.igem.org/mediawiki/2012/1/18/Pr.jpg); } | ul#navigation li:nth-child(3) a {background-image:url(https://static.igem.org/mediawiki/2012/1/18/Pr.jpg); } | ||
- | ul#navigation li:nth-child(4) a { background-image:url(https://static.igem.org/mediawiki/2012/ | + | ul#navigation li:nth-child(4) a { background-image:url(https://static.igem.org/mediawiki/2012/d/da/Icon_dna.png); } |
ul#navigation li:nth-child(5) a { background-image:url(https://static.igem.org/mediawiki/2012/6/68/Edu-science-icon.png); } | ul#navigation li:nth-child(5) a { background-image:url(https://static.igem.org/mediawiki/2012/6/68/Edu-science-icon.png); } | ||
ul#navigation li:nth-child(6) a { background-image:url(https://static.igem.org/mediawiki/2012/0/00/Asyu5.png); } | ul#navigation li:nth-child(6) a { background-image:url(https://static.igem.org/mediawiki/2012/0/00/Asyu5.png); } | ||
Line 81: | Line 80: | ||
<ul class='menu1'> | <ul class='menu1'> | ||
<img src="https://static.igem.org/mediawiki/2012/1/19/Maskot_tim_iGEM_IPB.png"/> | <img src="https://static.igem.org/mediawiki/2012/1/19/Maskot_tim_iGEM_IPB.png"/> | ||
+ | |||
<li><a href='#' onclick='MGJS.goTop();return false;'> Back to top </a></li> | <li><a href='#' onclick='MGJS.goTop();return false;'> Back to top </a></li> | ||
</ul> | </ul> | ||
Line 97: | Line 97: | ||
</div> | </div> | ||
- | + | <ul id="navigation" style="margin:40px 0 0 220px"> | |
<li class="nav1"><a href="https://2012.igem.org/Team:BAU-Indonesia">Home</a></li> | <li class="nav1"><a href="https://2012.igem.org/Team:BAU-Indonesia">Home</a></li> | ||
<li class="nav2"><a href="https://2012.igem.org/Team:BAU-Indonesia/Team">Team</a></li> | <li class="nav2"><a href="https://2012.igem.org/Team:BAU-Indonesia/Team">Team</a></li> | ||
Line 126: | Line 126: | ||
</div> | </div> | ||
</div> | </div> | ||
- | |||
<script type="text/javascript" src="http://wiki-rian.googlecode.com/files/jquery-1.4.3.min.js"></script> | <script type="text/javascript" src="http://wiki-rian.googlecode.com/files/jquery-1.4.3.min.js"></script> | ||
Line 166: | Line 165: | ||
</div> | </div> | ||
--> | --> | ||
- | <div id="left_column"> | + | <div id="left_column" style="width:auto"> |
<!-- Start left news box --> | <!-- Start left news box --> | ||
<div class="left_news_box"> | <div class="left_news_box"> | ||
<div class="left_news_top"></div> | <div class="left_news_top"></div> | ||
<div class="left_news_bg"> | <div class="left_news_bg"> | ||
- | <h2> | + | <h2><b>Modeling</b></h2> |
- | <div class="text"> | + | <br> <div class="text"> |
- | + | ||
- | + | ||
- | + | <h4 style="text-align:center"> | |
- | + | Biobrick parts that we have been using is <b> Coming Soon </b> (in progress) because the Protein Coding Site (Cutinase gene) is in sequencing process. so we're not be able to post our parts.<br> | |
- | + | We use cutinase gene (LC cutinase) which is homolog with Thermobifidafuscacutinase. We align some cutinase gene that we got from the gene bank, and create the DNA primer from it. Our forward primer is | |
- | + | 5' AACCCCTACGAGCGCGGCCCC 3' and our reverse primer is5' AGAACGGGCAGGTGGAGCGGT 3'.<br> | |
- | + | We use strong constitutive promoter, and we cut it from PET 14 plasmids then we'll connect it to the plasmid vector pSB1C3. We use the strong constitutive promoter because we want the enzyme secreted continuously.<br> | |
- | + | We just use one modul, <b>The Degradation Modul </b><br><br><br> | |
+ | <img src="https://static.igem.org/mediawiki/2012/0/0c/Biobrick_design_PAKE.png" /> | ||
+ | </h4><br> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | </div> | ||
<div class="clear"></div> | <div class="clear"></div> | ||
</div> | </div> | ||
Line 187: | Line 193: | ||
<!-- End left news box --> | <!-- End left news box --> | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
</div> | </div> | ||
+ | |||
<div class="clear"></div> | <div class="clear"></div> | ||
</div> | </div> | ||
- | |||
<div id="footer"> | <div id="footer"> | ||
<!--footer begins --> | <!--footer begins --> | ||
Line 264: | Line 204: | ||
<div class="row-padding"> | <div class="row-padding"> | ||
<div class="wrapper"> | <div class="wrapper"> | ||
- | <div class="col- | + | |
- | <h2> | + | <div class="col-3"> |
- | + | <h2><b>Follow Us: <b/></h2> | |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
<ul class="list-services"> | <ul class="list-services"> | ||
- | <li class="item- | + | |
- | + | <li class="item-2"><a href="https://twitter.com/BAU_INDONESIA" target="_blank">Twitter (BAU-INDOESIA)</a></li> | |
- | + | ||
</ul> | </ul> | ||
</div> | </div> | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
</div> | </div> | ||
</div><div class="clear"></div> | </div><div class="clear"></div> | ||
- | + | ||
- | + | ||
- | + | ||
</div> | </div> | ||
</div> | </div> |
Latest revision as of 22:37, 26 September 2012