Team:BAU-Indonesia/Abstract

From 2012.igem.org

(Difference between revisions)
(Created page with "__NOTOC__ <html> <style> h1.firstHeading { display: none; } p {text-align: justify;} a:link { color: #00b0e6; text-decoration: none} a:visited { color:#00b0e6; text-decorati...")
 
(5 intermediate revisions not shown)
Line 1: Line 1:
-
__NOTOC__
+
{{Team:BAU-Indonesia/css}}
-
<html>
+
{{Team:BAU-Indonesia/nivo-slider}}
 +
{{Team:BAU-Indonesia/css_gone}}
-
<style>
+
<html xmlns="http://www.w3.org/1999/xhtml">
-
h1.firstHeading { display: none; }
+
    <head>
 +
   
 +
        <meta http-equiv="content-type" content="text/html; charset=utf-8" />
 +
        <title>Metamorphosis Design Free Css Templates</title>
 +
        <meta name="keywords" content="" />
 +
        <meta name="description" content="" />
 +
        <link href="styles.css" rel="stylesheet" type="text/css" media="screen" />
 +
<link rel="stylesheet" href="nivo-slider.css" type="text/css" media="screen" />
 +
       
 +
    </head>
 +
   
 +
    <script type="text/javascript" src="https://sites.google.com/site/mariozoner/gb-mario/jquery-1.3.2.js"></script>
-
p {text-align: justify;}
+
<script type="text/javascript">
 +
$(function() {
 +
var d=300;
 +
$('#navigation a').each(function(){
 +
$(this).stop().animate({
 +
'marginTop':'-80px'
 +
},d+=150);
 +
});
-
a:link { color: #00b0e6; text-decoration: none}
+
$('#navigation > li').hover(
-
a:visited { color:#00b0e6; text-decoration: none}
+
function () {
-
a:hover { color:#f29400; text-decoration: none}
+
$('a',$(this)).stop().animate({
-
a:active { color:#f29400; text-decoration: none}
+
'marginTop':'-2px'
-
 
+
},200);
-
#bodyContent { padding: 10px auto; width: 910px; margin: auto; clear: none; }
+
},
-
 
+
function () {
-
table#team_members { text-align: justify; border: 0; }
+
$('a',$(this)).stop().animate({
-
table#team_members h2, table#team_members h3 { clear: both; }
+
'marginTop':'-80px'
-
 
+
},200);
-
 
+
-
/*-----------------------------------------------------------------------------------------------*/
+
-
div.MenuBar ul li ul.DropDownMenu {
+
-
  display: none; /* Hides all drop-down menus. */
+
-
 
+
-
}
+
-
/*
+
-
li:hover works in IE7 and FF2.
+
-
a:hover works in IE6 and FF2.
+
-
a:hover breaks li:hover in FF2.
+
-
*/
+
-
div.MenuBar ul li:hover ul.DropDownMenu li ul.SideMenu,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a ul.SideMenu {
+
-
  display: none; /* Hides all side menus. */
+
-
}
+
-
/*------------------------------------------------------------------------------------- Menu Bar */
+
-
div.MenuBar {
+
-
  font: arial, helvetica, sans-serif;
+
-
  height: 30px;
+
-
  width: 910px;
+
-
  /*width: 100%*/
+
-
  margin: 0;
+
-
  border-top: 0;
+
-
  border-right: 0;
+
-
  border-left: 0;
+
-
  padding: 0;
+
-
  background: black;
+
-
 
+
-
}
+
-
div.MenuBar ul {
+
-
  font: arial, helvetica, sans-serif;
+
-
  text-align: center;
+
-
  list-style-type: none;
+
-
  margin: 0.5em auto;
+
-
  border: 0;
+
-
  padding: 0;
+
-
  background: black;
+
-
}
+
-
div.MenuBar ul li {
+
-
  font: arial, helvetica, sans-serif;
+
-
  display: block;
+
-
  padding: 0;
+
-
  margin: 0;
+
-
  font-size: 1.3em;
+
-
  float: left;
+
-
  background: black;
+
-
  text-align: center;
+
-
  width: 107px;
+
-
  position: relative; /* Sets the positioning context for each drop-down menu. */
+
}
}
 +
);
 +
});
 +
</script>
-
div.MenuBar ul li a {
+
<style>
-
  font: arial, helvetica, sans-serif;
+
*Navigasi*/
-
  display: block;
+
ul#navigation { position:fixed; margin:0px; padding:0px; top:-20px; left:370px; list-style:none; z-index:999999; width:675px; font:normal 16px Electrolize,Sans-Serif bold; -webkit-animation:2s fxhompinav ease-in-out; -moz-animation:2s fxhompinav ease-in-out; -ms-animation:2s fxhompinav ease-in-out; animation:2s fxhompinav ease-in-out; }  
-
  background: black;
+
-
  height: 22px; /* Keep height + padding-top + padding-bottom sync with the menu bar height. */
+
-
  color: #ffffff;
+
-
  padding-top: 4px;
+
-
  padding-bottom: 4px;
+
-
  padding-left: 1em; /* Sets the left space between top-level items. */
+
-
  padding-right: 1em; /* Sets the right space between top-level items. */
+
-
  text-decoration: none;
+
-
}
+
-
/*------------------------------------------------------------------------------ Drop-Down Menus */
+
ul#navigation li { width:95px; display:inline; float:left; margin:0 0 0 2px; }
-
div.MenuBar ul li:hover ul.DropDownMenu,
+
ul#navigation li a { display:block; float:left; margin-top:-74px; width:95px; height:28px; background-color: rgba(0, 0, 0, 0.6);
-
div.MenuBar ul li a:hover ul.DropDownMenu {
+
background: rgba(0, 0, 0, 0.6);
-
  display: block;
+
color: rgba(0, 0, 0, 0.6); background-repeat:no-repeat; background-position:50% 150px; border:2px solid #b9b9b9; -webkit-box-shadow:0 1px 2px rgba(0, 0, 0, 0.5); -moz-box-shadow:0 1px 2px rgba(0, 0, 0, 0.5); box-shadow:0 1px 2px rgba(0, 0, 0, 0.5); -moz-border-radius:0px 0px 10px 10px; -webkit-border-bottom-right-radius:10px; -webkit-border-bottom-left-radius:10px; -khtml-border-bottom-right-radius:10px; -khtml-border-bottom-left-radius:10px; border-radius:0px 0px 10px 10px; color:#333333; text-decoration:none; text-align:center;color:#f1f1f1; text-shadow:0 1px 1px #000; padding-top:95px; -webkit-transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; -moz-transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; -o-transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; }
-
  width: 10em; /* Drop-down menu width.
+
-
                  Use MenuTailor.css to customize. */
+
-
  height: 1em;
+
-
  padding: 1px; /* Sets the drop-down menu "effective border" width. */
+
-
  position: absolute;  
+
-
  top: 23px; /* Places the drop-down menu under the menu bar.
+
-
                Keep it sync with the menu bar height. */
+
-
  left: 0; /* Aligns the drop-down menu to its top-level item. */
+
-
  background-color: black; /* Selected item. */
+
-
  color: #FFFFFF;
+
-
}
+
ul#navigation li a:hover { margin-top:-3px; background-position:100% -5px; color:#7b7b7b; position:relative; }  
-
div.MenuBar ul li:hover ul.DropDownMenu li a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a {
+
-
  width: 10em; /* Keep it sync with the drop-down menu width.
+
-
                            Use MenuTailor.css to customize. */
+
-
  height: 1em;
+
-
  padding-left: 0;
+
-
  padding-right: 0;
+
-
  background-color: black; /* Selected item. */
+
-
  color: #FFFFFF;
+
-
}
+
-
ul.DropDownMenu li a span {
+
-
  display: block;
+
-
  padding-left: 0.75em; /* Sets the left space of each drop-down menu item. */
+
-
  padding-right: 0.25em; /* Sets the right space of each drop-down menu item. */
+
-
  text-align: right; /* Aligns the >> symbol to the right. */
+
-
}
+
-
ul.DropDownMenu li a span span {
+
-
  float: left; /* Aligns the text (back) to the left. */
+
-
  font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
+
-
  height: 20px;
+
-
  color: #FFFFFF;
+
-
}
+
-
/*----------------------------------------------------------------------------------- Side Menus */
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
+
-
  display: block;
+
-
  width: 11em; /* Side menu width.
+
-
                  Use MenuTailor.css to customize. */
+
-
  padding: 1px; /* Sets the side menu "effective border" width. */
+
-
  position: absolute;
+
-
  top: -1px; /* Aligns the side menu to its drop-down menu item.
+
-
                Keep it sync with the side menu "effective border" width. */
+
-
  left: 13em; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width.
+
-
                            Use MenuTailor.css to customize. */
+
-
}
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
+
-
  width: 11em; /* Keep it sync with the side menu width.
+
-
                            Use MenuTailor.css to customize. */
+
-
  font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
+
-
  left: 13em; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width.
+
-
                            Use MenuTailor.css to customize. */
+
-
}
+
-
div.MenuBar ul li ul.DropDownMenu li ul.SideMenu li a span {
+
-
  padding-left: 1.5em; /* Sets the left space of each side menu item. */
+
-
  padding-right: 0.5em; /* Sets the right space of each side menu item. */
+
-
  text-align: left;
+
-
  font: 12px arial, helvetica, sans-serif; /* Required for IE55. */
+
-
  left: 13em; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width.
+
-
                            Use MenuTailor.css to customize. */
+
-
}
+
-
/*----------------------------------------------------------------------------- Browser Specific */
+
-
* html div.MenuBar ul li a {
+
-
  float: left; /* Required for IE55 and IE6.
+
-
                            Breaks O9.
+
-
                            Hidden (* html) from non-IE browsers. */
+
-
}
+
-
* html ul.DropDownMenu li a:hover {
+
-
  cursor: hand; /* Required for IE55.
+
-
                  Hidden (* html) from non-IE browsers. */
+
-
}
+
-
ul.DropDownMenu li a:hover {
+
-
  cursor: pointer; /* Required for IE6 and IE7.
+
-
                      Hidding it (* html) from non-IE browsers breaks IE7!
+
-
}
+
-
* html div.MenuBar a:hover {
+
-
  text-decoration: none; /* Required for IE55 and IE6.
+
-
                            Hidden (* html) from non-IE browsers. */
+
-
}
+
-
* html div.MenuBar ul li table,
+
-
* html div.MenuBar ul li table td {
+
-
  border: 0; /* Required for IE55 and IE6.
+
-
                Hidden (* html) from non-IE browsers. */
+
-
}
+
-
/*------------------------------------------------------------------------------- Default Colors */
+
-
div.MenuBar {
+
-
  background-color: Menu;
+
-
  border-bottom: 1px solid ButtonShadow;
+
-
}
+
-
div.MenuBar a {
+
-
  background-color: Menu; /* Top-level unselected items. */
+
-
  color: MenuText;
+
-
}
+
-
div.MenuBar ul li:hover a,
+
-
div.MenuBar ul li a:hover {
+
-
  color: #ea7f16;
+
-
  background-color: Highlight; /* Top-level selected item. */
+
-
  color: HighlightText;
+
-
}
+
-
/*...............................................................................................*/
+
-
div.MenuBar ul li:hover ul.DropDownMenu,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu {
+
-
  background-color: ButtonShadow; /* Sets the drop-down menu "effective border" color. */
+
-
}
+
-
div.MenuBar ul li:hover ul.DropDownMenu li a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a {
+
-
  background-color: Menu;  Drop-down menu unselected items.
+
-
                            Sets the drop-down menu "effective background" color. */
+
-
  color: MenuText;
+
-
}
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover {
+
-
  background-color: Highlight; /* Drop-down menu selected item. */
+
-
  color: HighlightText;
+
-
}
+
-
/*...............................................................................................*/
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
+
-
  background-color: ButtonShadow; /* Sets the side menu "effective border" color. */
+
-
}
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
+
-
  background-color: Menu; /* Side menu unselected items.
+
-
                            Sets the side menu "effective background" color. */
+
-
  color: MenuText;
+
-
}
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {
+
-
  background-color: Highlight; /* Side menu selected item. */
+
-
  color: HighlightText;
+
-
}
+
-
/*-----------------------------------------------------------------------------------------------*/
+
-
/*Script-Free 3-Level Menu 1.2 Tailor
+
-
  www.CesarDaniel.info
+
-
/*-------------------------------------------------------------------------------------- General */
+
-
body {
+
-
  background: white;
+
-
  color: black;
+
-
  margin: 0;
+
-
  border: 0;
+
-
  padding: 0;
+
-
}
+
 +
ul#navigation li a:hover:after { content:""; width:0px; height:0px; position:absolute; top:100%; left:45%; margin-top:2px; border-width:5px; border-style:solid; border-color:transparent transparent lime transparent; }
-
div.MenuBar {
+
ul#navigation li:nth-child(1) a { background-image:url(https://static.igem.org/mediawiki/2012/c/cb/Asyu.png); }
-
  font: 13px arial, helvetica, sans-serif;
+
ul#navigation li:nth-child(2) a { background-image:url(https://static.igem.org/mediawiki/2012/b/be/Asyu2.png); }
-
}
+
ul#navigation li:nth-child(3) a {background-image:url(https://static.igem.org/mediawiki/2012/1/18/Pr.jpg); }
-
div.MenuBar ul {
+
ul#navigation li:nth-child(4) a { background-image:url(https://static.igem.org/mediawiki/2012/4/4e/Asyu3.png); }
-
  font: 13px arial, helvetica, sans-serif; /* Required for IE55. */
+
ul#navigation li:nth-child(5) a { background-image:url(https://static.igem.org/mediawiki/2012/6/68/Edu-science-icon.png); }
-
}
+
ul#navigation li:nth-child(6) a { background-image:url(https://static.igem.org/mediawiki/2012/0/00/Asyu5.png); }
-
/*--------------------------------------------------------------------------------------- Colors */
+
ul#navigation li:nth-child(7) a { background-image:url(https://static.igem.org/mediawiki/2012/1/19/Attributions2.png); }
-
div.MenuBar {
+
ul#navigation li:nth-child(8) a { background-image:url(https://static.igem.org/mediawiki/2012/0/0a/Medal-icon.png);
-
  background-color: black; /* Selected item. */
+
}
-
  color: #FFFFFF;
+
-
  border-bottom: 1px solid ButtonShadow;
+
-
}
+
-
div.MenuBar a,
+
-
div.MenuBar ul li:hover ul.DropDownMenu li a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a,
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a {
+
-
  background-color: black; /* Selected item. */
+
-
  color: #FFFFFF;
+
-
}
+
-
div.MenuBar ul li:hover a,
+
-
div.MenuBar ul li a:hover,
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover a,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover,
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu li a:hover,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu li a:hover {
+
-
  background-color: #00b0e6; /* Selected item. */
+
-
  color: #FFFFFF;
+
-
}
+
-
div.MenuBar ul li:hover ul.DropDownMenu,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu,
+
-
div.MenuBar ul li:hover ul.DropDownMenu li:hover ul.SideMenu,
+
-
div.MenuBar ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu {
+
-
  background-color: ButtonShadow; /* Sets the drop-down and side menus "effective border" color. */
+
-
}
+
-
/*--------------------------------------------------------------------------------------- Widths */
+
-
/*
+
-
/*
+
@-webkit-keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;} } @-moz-keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;} } @-ms-keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;} } @keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;}
-
Menu Bar 1
+
/*Navigasi*/  
-
Drop-Down Menu #2
+
-
*/
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4,
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM4 li a,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM4 li a {
+
-
  width: 11em; /* Drop-down menu width. */
+
-
}
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5,
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu#MB1-DDM5 li a,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu#MB1-DDM5 li a {
+
-
  width: 12em; /* Drop-down menu width. */
+
-
}
+
-
 
+
-
/*...............................................................................................*/
+
-
/*
+
-
Menu Bar 1
+
-
Drop-Down Menu #2
+
-
Side Menu #1
+
-
*/
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 {
+
-
  left: 15.5em !important; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width. */
+
-
}
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1,
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM1 li a,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM1 li a {
+
-
  width: 10em; /* Side menu width. */
+
-
}
+
-
/*...............................................................................................*/
+
-
/*
+
-
Menu Bar 1
+
-
Drop-Down Menu #2
+
-
Side Menu #2
+
-
*/
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 {
+
-
  left: 15.5em  !important; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width. */
+
-
}
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2,
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM2 li a,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM2 li a {
+
-
  width: 10em; /* Side menu width. */
+
-
}
+
-
/*...............................................................................................*/
+
-
/*
+
-
Menu Bar 1
+
-
Drop-Down Menu #2
+
-
Side Menu #3
+
-
*/
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 {
+
-
  left: 15.5em  !important; /* Places the side menu to the right of the drop-down menu.
+
-
                            Keep it sync with the drop-down menu width. */
+
-
}
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3,
+
-
div.MenuBar#navi ul li:hover ul.DropDownMenu li:hover ul.SideMenu#MB1-DDM2-SM3 li a,
+
-
div.MenuBar#navi ul li a:hover ul.DropDownMenu li a:hover ul.SideMenu#MB1-DDM2-SM3 li a {
+
-
  width: 10em; /* Side menu width. */
+
-
}
+
-
/*...............................................................................................*/
+
</style>
</style>
 +
   
 +
<script language='javascript' src='https://sites.google.com/site/tutorialseoblogger/file/jquery_mini.js'></script>
 +
<script language='javascript' src='https://sites.google.com/site/tutorialseoblogger/file/jquery.dimensions.js'></script>
 +
 +
    <body>
 +
        <div id="bg_top">
 +
        <div id="wrap_bg">
 +
   
 +
              <div id='floatMenu'>
 +
<ul class='menu1'>
 +
<img src="https://static.igem.org/mediawiki/2012/1/19/Maskot_tim_iGEM_IPB.png"/>
 +
<li><a href='https://2012.igem.org/Team:BAU-Indonesia/ProjectDesc' target="_blank" title='projectdesc'> Project Description </a></li>
 +
<li><a href='https://2012.igem.org/Team:BAU-Indonesia/Safety' target="_blank" title='abstract'> Safety </a></li>
 +
<li><a href='https://2012.igem.org/Team:BAU-Indonesia/Abstract' target="_blank" title='abstract'> Abstract </a></li>
 +
<li><a href='#' onclick='MGJS.goTop();return false;'> Back to top </a></li>
 +
</ul>
 +
<script language='javascript'>
 +
var name = "#floatMenu";
 +
var menuYloc = null;
 +
$(document).ready(function(){
 +
menuYloc = parseInt($(name).css("top").substring(0,$(name).css("top").indexOf("px")))
 +
$(window).scroll(function () {
 +
offset = menuYloc+$(document).scrollTop()+"px";
 +
$(name).animate({top:offset},{duration:500,queue:false});
 +
});
 +
});
 +
</script>
 +
</div>
 +
           
 +
      <ul id="navigation" style="margin:40px 0 0 220px">
 +
<li class="nav1"><a href="https://2012.igem.org/Team:BAU-Indonesia">Home</a></li>
 +
<li class="nav2"><a href="https://2012.igem.org/Team:BAU-Indonesia/Team">Team</a></li>
 +
<li class="nav3"><a href="https://2012.igem.org/Team:BAU-Indonesia/Project">Project</a></li>
 +
<li class="nav4"><a href="https://2012.igem.org/Team:BAU-Indonesia/Parts">Parts</a></li>
 +
<li class="nav5"><a href="https://2012.igem.org/Team:BAU-Indonesia/Modeling">Modeling</a></li>
 +
<li class="nav6"><a href="https://2012.igem.org/Team:BAU-Indonesia/Notebook">Notebook</a></li>
 +
<li class="nav7"><a href="https://2012.igem.org/Team:BAU-Indonesia/Attributions">Attributions</a></li>
 +
<li class="nav8"><a href="https://2012.igem.org/Team:BAU-Indonesia/Achievements">Achievement</a></li>
-
<body>
+
</ul>
-
<div id="header"><img src="https://static.igem.org/mediawiki/2012/9/90/BAU-Indonesia_logo.png" alt="Team Heidelberg" /></div>
+
            <img style="margin-left:-900px" src="https://static.igem.org/mediawiki/2012/archive/9/90/20120909091254%21BAU-Indonesia_logo.png" />
-
<div class='MenuBar' id="navi">
+
            <div id="wrap">
-
<ul>
+
        <div id="header">
-
<li>
+
-
<a href="https://2012.igem.org/Team:BAU-Indonesia" style="color: white">Home
+
<div id="prew_box">
-
<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
<div id="wrapper">
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
        <div id="slider-wrapper">      
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
            <div id="slider" class="nivoSlider">
-
</li>
+
<img src="https://static.igem.org/mediawiki/2012/b/bd/Header2projek_copy.jpg" alt="" />
-
<li>
+
<img src="https://static.igem.org/mediawiki/2012/d/d4/Header1_tim.jpg" alt="" />
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Team" style="color: white">Team<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
                <img src=" https://static.igem.org/mediawiki/2012/e/e8/Header1.jpg" alt="" />
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
                <img src="https://static.igem.org/mediawiki/2012/4/48/Header9.jpg" alt=""/>
-
+
                <img src="https://static.igem.org/mediawiki/2012/e/e8/Header4.jpg" alt="" />
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
<img src="https://static.igem.org/mediawiki/2012/8/8c/Header3.jpg" alt="" />
-
</li>
+
                <img src="https://static.igem.org/mediawiki/2012/0/07/Header8.jpg" alt="" />
-
<li>
+
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Project" style="color: white">Project<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
-
+
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
<ul class="DropDownMenu" id="MB1-DDM1">
+
            </div>       
 +
        </div>
 +
<script type="text/javascript" src="http://wiki-rian.googlecode.com/files/jquery-1.4.3.min.js"></script>
 +
 
 +
    <script type="text/javascript" src="http://wiki-rian.googlecode.com/files/jquery.nivo.slider.pack.js"></script>
 +
   
 +
    <script type="text/javascript">
 +
    $(window).load(function() {
 +
        $('#slider').nivoSlider();
 +
    });
 +
    </script>
 +
</div>
-
<li><a href="https://2012.igem.org/Team:BAU-Indonesia/ProjectDesc"><span><span>Project Description</span></span></a></li>
 
-
<li><a href="https://2012.igem.org/Team:BAU-Indonesia/Abstract"><span><span>Abstract</span></span></a></li>
 
-
 
-
</ul>
 
-
</li>
 
-
<li>
+
</div>
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Parts" style="color: white">Parts<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
</div> <div style="clear: both"></div>
-
+
<div id="content" style="background:url(https://static.igem.org/mediawiki/2012/6/67/A.jpg)">
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
</li>
+
-
<li>
+
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Modeling" style="color: white">Modeling<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
-
+
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
</li>
+
-
<li>
+
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Notebook" style="color: white">Notebook<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
-
+
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
</li>
+
-
<li>
+
-
<a href="https://2012.igem.org/Team:BAU-Indonesia/Safety" style="color: white">Safety<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
-
+
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
</li>
+
-
        <li>
+
-
<a "href=https://2012.igem.org/Team:BAU-Indonesia/Attributions" style="color: white">Attributions<!--[if gt IE 6]><!--></a><!--<![endif]-->
+
-
<!--[if lt IE 7]><table border="0" cellpadding="0" cellspacing="0"><tr><td><![endif]-->
+
-
+
-
<!--[if lte IE 6]></td></tr></table></a><![endif]-->
+
-
</li>
+
-
</ul>
+
 +
<!--                   
 +
<div class="verticalaccordion">
 +
<ul>
 +
    <li>
 +
      <h3>Daftar isi</h3>
 +
        <div id="isinya">isi konten di sini bisa juga dengan java script atau yang lainnya</div>
 +
    </li>
 +
    <li>
 +
      <h3>F1</h3>
 +
        <div id="isinya">pokonya apa saja isi di sini terserah mau di isi apa</div>
 +
    </li>
 +
    <li>
 +
      <h3>Free Dfloaf</h3>
 +
        <div id="isinya">isi apa saja terserah sobat</div>
 +
    </li>
 +
    <li>
 +
      <h3>Free Dosfs</h3>
 +
        <div id="isinya">isi konten  di sini bisa dengan gambar atau yang lainnya</div>
 +
    </li>
 +
</ul>
</div>
</div>
-
<div id="header_bottom"><img src="https://static.igem.org/mediawiki/2008/e/ef/Navi_bg.gif" alt="" / ></div>
+
      --> 
-
</body>
+
<div id="left_column" style="width:auto">
 +
<!-- Start left news box -->
 +
<div class="left_news_box">
 +
<div class="left_news_top"></div>
 +
<div class="left_news_bg">
 +
<h2><b>Abstract == Plastic Terminator ==</b></h2>
 +
<div class="text">
 +
  <h4>Indonesia is known as the 4th highest population densities around the world. Nowadays, 1.5 million tons/year from human activity which is used in the world is PET. PET is a thermoplastic polymer resin, not easily degraded naturally. Based on this background, the BAU-Indonesia team designs a plasmid which is contains of encoding cutinase degrading enzymes of producing PET. The early stage of this project was done by the preservation of plastic waste bacteria from landfills at Galuga. The bacteria were cultured in liquid media which is contained yeast extract powder and PET enrichment. The result of this preservation will be followed by the isolation of DNA and PCR with Cutinase F primer'ACGCGCCGGGCGTCACCGAGCA'3 and R 5'ACGCGTCGTGCCGTCAGGGCCA'3. Cutinase gen that were amplified will be inserted to plasmid pSB1C3. The recombinant plasmid which contained the cutinase gene will be introduced into E. coli. Finally it will be used as PET biodegradator product.</h4>        
 +
              </div>
 +
<div class="clear"></div>
 +
</div>
 +
<div class="left_news_bot"></div>
 +
</div>
 +
<!-- End left news box -->
 +
 +
 +
</div>
 +
 +
<div class="clear"></div>
 +
</div>
 +
 +
<div id="footer">
 +
<!--footer begins -->
 +
 
 +
<div class="row-top">
 +
<div class="row-padding">
 +
<div class="wrapper">
 +
<div class="col-1">
 +
<h2>Address:</h2>
 +
<dl class="address">
 +
<dt>&nbsp;</dt>
 +
</dl>
 +
</div>
 +
<div class="col-2">
 +
<h2>Follow Us:</h2>
 +
<ul class="list-services">
 +
<li class="item-1"><a href="#">Facebook</a></li>
 +
<li class="item-2"><a href="#">Twitter</a></li>
 +
<li class="item-3"><a href="#">LinkedIn</a></li>
 +
</ul>
 +
</div>
 +
<div class="col-3">
 +
<h2>Why Us:</h2>
 +
<ul class="list-1">
 +
<li><a href="#">Lorem ipsum dolor</a></li>
 +
<li><a href="#">Aonsect adipisic</a></li>
 +
<li><a href="#">Eiusmjkod tempor</a></li>
 +
<li><a href="#">Incididunt ut labore</a></li>
 +
</ul>
 +
</div>
 +
<div class="col-4">
 +
<div class="indent3"></div>
 +
</div>
 +
</div>
 +
</div><div class="clear"></div>
 +
<div id="footer_bottom">
 +
 +
</div>
 +
  </div>
 +
</div>
 +
 +
  </div>
 +
        </div>
 +
        </div>
 +
    </body>
</html>
</html>
-
 
-
 
-
== Plastic Terminator ==
 
-
 
-
 
-
Indonesia is known as the 4th highest population densities around the world. Nowadays, 1.5 million tons/year from human activity which is used in the world is PET. PET is a thermoplastic polymer resin, not easily degraded naturally. Based on this background, the BAU-Indonesia team designs a plasmid which is contains of encoding cutinase degrading enzymes of producing PET. The early stage of this project was done by the preservation of plastic waste bacteria from landfills at Galuga. The bacteria were cultured in liquid media which is contained yeast extract powder and PET enrichment. The result of this preservation will be followed by the isolation of DNA and PCR with Cutinase F primer'ACGCGCCGGGCGTCACCGAGCA'3 and R 5'ACGCGTCGTGCCGTCAGGGCCA'3. Cutinase gen that were amplified will be inserted to plasmid pSB1C3. The recombinant plasmid which contained the cutinase gene will be introduced into E. coli. Finally it will be used as PET biodegradator product.
 

Latest revision as of 11:24, 26 September 2012


Metamorphosis Design Free Css Templates

Abstract == Plastic Terminator ==

Indonesia is known as the 4th highest population densities around the world. Nowadays, 1.5 million tons/year from human activity which is used in the world is PET. PET is a thermoplastic polymer resin, not easily degraded naturally. Based on this background, the BAU-Indonesia team designs a plasmid which is contains of encoding cutinase degrading enzymes of producing PET. The early stage of this project was done by the preservation of plastic waste bacteria from landfills at Galuga. The bacteria were cultured in liquid media which is contained yeast extract powder and PET enrichment. The result of this preservation will be followed by the isolation of DNA and PCR with Cutinase F primer'ACGCGCCGGGCGTCACCGAGCA'3 and R 5'ACGCGTCGTGCCGTCAGGGCCA'3. Cutinase gen that were amplified will be inserted to plasmid pSB1C3. The recombinant plasmid which contained the cutinase gene will be introduced into E. coli. Finally it will be used as PET biodegradator product.

Retrieved from "http://2012.igem.org/Team:BAU-Indonesia/Abstract"