Team:ZJU-China/project.htm

In cells, engineered multi-enzyme pathways are common and are often physically and spatially organized, thus leading to the high output efficiency. But engineered synthetic pathways utilizing non-homologous enzymes often suffer from low efficiency of production caused by relative lack of spatial organization. RNA scaffold is designed to co-localize enzymes through interactions between binding domains on the scaffold and target peptides fused to each enzyme in engineered biological pathways in vivo. The scaffold allows efficient channeling of substrates to products over several enzymatic steps by limiting the diffusion of intermediates thus providing a bright future for solving the problem.

 

ZJU-China aims to design and realize tunable RNA scaffolds to accelerate biological pathways and control them on and off. In order to achieve the object, we added an aptamer structure on RNA scaffold as a switch to regulate biological pathways by micromolecular ligands. Then we can control the all-or-none binding relationship between the enzymes and the scaffold by the absence and the presence of a special ligand.

 

We demonstrated RNA scaffold do make the split GFPs get closer and fluoresce. As was expected, the riboscaffold with a theophylline aptamer can be regulated by theophylline in the range of 0-0.5mM IPTG. A scaffold library was also desired. By changing the sequence of MS2 aptamer binding site, we made the fluorescent decreased. The mutations with different arm length decrease the fluorescent intensity of split GPF by extending the distance between two split GFP parts FA and FB. It provides a series of half-on scaffolds.

 

Besides, we aimed to find some application for RNA scaffold to make the production of the multi-enzyme pathways more efficient. We have been working on the pathway of the production of IAA from tryptophan and the result will be gained soon later.

 

In cells, engineered multi-enzyme pathways are common and are often physically and spatially organized, thus leading to the high output efficiency. But engineered synthetic pathways utilizing non-homologous enzymes often suffer from low efficienty of production caused by relative lack of spatial organization. Thus important issue lies in the method to increase the efficiency of the multi-enzyme pathways.

 

Protein scaffolds can be designed to make enzymes closed through interactions between binding domains on the scaffold and target peptides fused to each enzyme. However, protein scaffold is usually large, has limit binding sites, and is hard to be engineered in architecture. DNA can be designed to self-assemble in vitro into many and varied nanostructures. However, DNA scaffold is hard to be controlled and might cause some potential problems in vivo. By contrast, RNA scaffold shows great advantages. For instance, RNA is more flexible, whose structures are varied, thus leading to their ease to splice. RNA scaffold is able to be controlled and has a satisfactory regulating efficiency. RNA scaffold works fast, because it doesn’t need translation like protein scaffold. Camille J. Delebecque and his colleagues have designed and assembled RNA structures and used them to speed up the reaction of hydrogen production. And that is what our project based on.

 

 

Fig.1 The function of binding enzymes together of RNA scaffold illustrated by comic. The yellow girl is called “Syn”, the blue boy “Bio”. They represent non-homologous enzymes utilized in engineered synthetic pathways. Usually, they are far away from each other in E.coli, due to lack of spatial organization. But when RNA scaffold designed comes into E.coli, enzymes can be co-localized through interaction between binding domains on scaffold and target peptides fused each enzymes. That is to say, Syn and Bio can live together!

 

Backround

Camille J. Delebecque and his colleagues have designed and assembled RNA structures and used them as scaffolds for the spatial organization of bacterial metabolism (Camille J. Delebecque et al. 2011). Scaffold D0 consists of PP7 and MS2 aptamer domains that bind PP7 and MS2 fusion proteins. As told above, our project is based on the existing scaffold D0. In order to make sure that we can do further work on it, we planned to repeat the work about scaffold D0.

&nbsp

Design

&nbsp

&nbsp

Fig.1 How RNA scaffold works. FA and FB represent two halves of EGFP. FA and MS2 are connected with a linker of 30bp. FB and PP7 did the same. The purple scaffold is scaffold D0. MS2 and PP7 can specifically bind to two stem-loops on scaffold, thus FA and FB get closer and fluoresce under excitation.

&nbsp

Method

&nbsp

Two plasmids (pCJDFA and pCJDFB) respectively comprising the gene of half split EGFP (fragment A and fragment B) and MS2 or PP7 protein were constructed by overlap extension

PCR. (See the Overlap PCR protocal)

&nbsp

1. pCJDFA

T7 Promoter

RBS

FA

MS2

Terminators

&nbsp

2. pCJDFB

T7 Promoter

RBS

FB

PP7

Terminators

&nbsp

3. pCJDD0

T7 Promoter

RBS

Scaffold D0

Terminators

&nbsp

They were transformed with the pCJDD0 (plasmid with scaffold D0) into BL21-star-(DE3).

Results

&nbsp

Contrasted to the fluorescence intensity (FI) of the E.coli which only express FA-MS2 and FB-PP7 fusion proteins, the fluorescence intensity of the E.coli with scaffold D0 was obviously increased. Thus, it was possible for us to carry out our development and reformation of RNA scaffold.

&nbsp

Fig.2 FI of Split GFPs without or with RNA scaffold. A. BL21*(DE3) transformed with pCJDFA and pCJDFB. B. BL21*(DE3) transformed with pCJDFA, pCJDFB and pCJDD0. The contrast of FI obviously shown that RNA scaffold D0 could bind split GFPs together, so that split GFPs could fluoresce. (Pictures were obtained with Olympus fluoview fv1000 confocal laser scanning microscope, using a 60X objective.)

Fig3. FI/OD of different combination of D0, FA and FB.

Riboscaffold -- Clover

 

Summary

 

On the fundament that RNA scaffold in vivo has been achieved, we aimed to design and assemble controllable scaffolds. A designed theophylline aptamer was added on the original scaffold D0 in order to produce an interaction with MS2 aptamer in the absence of theophylline, thus disturbing the bind of MS2 aptamer and corresponding protein. However in the presence of theophylline, the interaction would disappear with the change of theophylline aptamer. We called these controllable scaffolds 'clovers'. Three versions of clover were designed, which have different interaction sites and different relative positions between the theophylline and MS2 aptamers.

 

As a preliminary experiment, we use theophylline of different concentrations to test two existing parts, which consist of the gene of a theophylline aptamer and a fluorescent protein.

 

Clover version two has been synthesized; it was co-transformated into E.coli with Fa-MS2 and Fb-PP7 fusion proteins. As a result, in a certain range of theophylline concentration, the fluorescent intensity has a positive correlation with it, which means controllable scaffold is achieved. Besides, to our surprise, the fluorescent could reach a higher intensity than the original scaffold D0, which means our clover, makes lovers closer!

 

More future work will be done in the next period. We are going to synthesize clover version one and version three, which seem to have a better control effect. A comparison will be made to find the best design principle of controllable RNA scaffold. We believe that more RNA scaffolds with higher efficiency and better regulative effect will be designed and applied.

 

Design

 

We thought to add another aptamer onto the scaffold and construct an interaction between it and the MS2 aptamer, such that it could disrupt the binding of MS2 protein and the MS2 aptamer.

 

We thought about the well-known theophylline aptamer. The aptamer is a single RNA hairpin that binds theophylline in an inner loop region with high affinity. Previous studies have shown mutations in the loop region were tolerated as long as the loop structure was preserved. This allowed us to mutate the loop of the theophylline aptamer to create an interaction between the theophylline aptamer and the MS2 aptamer. The interaction inhibits the binding function of MS2 aptamer in the absence of theophylline. However, when theophylline is added, the fold of the loop is changed and thus the interaction will disappear, leading to the binding of MS2 aptamer and corresponding protein.

 

Fig.1 The control mechanism of the theophylline aptamer.

 

Since the reformed scaffolds consist of three aptamers, just like clovers, we call them 'clover'.

 

Fig.2 Our designed scaffolds are named 'clover'.

 

Three versions of 'clover' were designed.

 

Fig.3 Three version of clovers. Version one and version two have adjacent MS2 and theophylline aptamer, while vesion three has separated ones. Version one has an interaction between the loop of theophylline aptamer and the loop of MS2 aptamer, while version two and version three have an interaction between the loop of theophylline aptamer and the stem of MS2 aptamer.

 

Original scaffold D0:

 

The base sequence of original scaffold D0:

 

GGGAGGACTCCCACAGTCACTGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGTTCGCACTTCTCTCGTATTCGATTCCC

 

Fig.4 The secondary (left) and the tertiary(right) structure of D0.

 

Clover version 1

 

The interaction is between the loop of theophylline aptamer and the loop of the MS2 aptamer.

 

And the theophylline aptamer is just beside the MS2 apatamer.

 

The base sequence of clover version 1:

 

GGGGUCCUCGGUGAUACCAGCAUagugacuAUGCCCUUGGCAGCACCGAGGAGGACTCCCACagtcactGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGTTCGCACTTCTCTCGTATTCGCCCC

 

Fig.5 The secondary (left) and the tertiary (right) structure of clover version 1.

 

Clover version 2

 

The interaction is between the loop of the theophylline aptamer and the stem of the MS2 apatamer. And the theophylline aptamer is just beside the MS2 apatamer.

 

The base sequence of clover version 2:

 

GGGGUCCUCGGUGAUACCAGCugacuguggCCCUUGGCAGCACCGAGGAGGACTCccacagtcaCTGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGTTCGCACTTCTCTCGTATTCGCCCC

 

Fig.6 The secondary (left) and the tertiary (right) structure of clover version 2.

 

Clover version 3

 

The interaction is between the loop of the theophylline aptamer and the stem of the MS2 apatamer. Although the theophylline and the MS2 apatamer is separated by the PP7 aptamer in the base sequence, they are closed according to the three- dimensional structure prediction.

 

The base sequence of clover version 3:

 

GGGGUCCUCGGUGAUACCAGCugacuguggCCCUUGGCAGCACCGAGGACUGGGCACAGAAGAUAUGGCUUCGUGCCCAGUCGAAUACGAGGAAGUGUUCGCACUUCACCUGGGACUCccacagucaCUGGGGAGUCCCAGGUUCUCGUAUUCGCCCC

 

Fig.7 The secondary (left) and the tertiary (right) structure of clover version 3. Although the theophyline and MS2 aptamers are separated as the secondary structure showed, in the tertiary structure, the theophyline aptamer obviously fold towards the MS2 aptamer.

 

Fig.8 A contrast between clover version 3 and a scaffold including a theophyline aptamer without a complementary site with MS2 aptamer. It can be easily noticed that in clover version 3, the theophyline aptamer obviously fold towards the MS2 aptamer, which indicates the interaction between the complementary sites in the theophyline and MS2 aptamers. In contrast, the scaffold without complementary sites in the two aptamers shows no approach of the theophyline aptamer to the MS2 aptamer.

 

Preparation: Characterize parts in registry

 

To make tentative steps in order to fix the theophylline concentration of our clover coexpression experiment, we test some theophylline riboswitches tagged with fluorescent proteins.

 

BioBrick Part K537009:

 

To characterise the theophylline riboswitches (part K537009, iGEM11_WITS_CSIR_SA), we quantified their activation at different theophylline concentrations (0 mM, 1 mM, 5 mM, 10 mM and 20 mM) over 2 hours using fluorometry.

 

Competent E. coli (strain DH5a) cells were transformed with plasmid vectors containing the "Promoter-Theophylline riboswitch -Venus-Double terminator". The bacterial colony appeal pink.

 

Cultured until the mid-log phase of growth, a different concentration of theophylline was added to each culture for induction. The activation of the riboswitch was detected as a fluorescent response as a result of increased translation of the fluorescent protein Venus, in the presence of the activator. Before fluorescence assay, we wash the culture with PBS.

 

A Synergy hybrid reader was used to excite the cultures at 505 nm and the intensity of the emission was detected at 535 nm. Empty bacteria were used to correct for auto fluorescence (IGEM11_WITS_CSIR_SA offered exciting at 514nm and emission at 528nm, but 514&528 is too close for our machine to detect.)

 

We have two end points of the OD 630 of each sample.

 

"Fluorescence intensity / OD" increases greatly with theophylline concentration.

 

Fig.9 The 5 different concentration of theophylline comparision on part K537009 theophylline robswitch tagged with venus YFP. Excitation at 505nm and emission at 535nm. Up to 20mM theophylline, cells didn't show side effects and YFP production is proportioned with theophylline concentration, showing that K537009 is an effective riboswitch which can be regulated by theophylline.

 

Fluorescence Microscope could also show this part work beautifully.

 

Except for the difference that though K537009 is an YFP, we excite it at 532nm (green light) and it glow red.

 

 

Fig.10 The 5 different concentration of theophylline comparision on part K537009 theophylline riboswitch tagged with venus YFP. The brightfield (BF) images in the right column depict all bacterial cells. The venus images in the left column depict bacterial cells which emitted fluorescence. We excite it at 532nm (green light) and it glow red, seeing the obvious trend that when adding more theophylline, cells showing Veuns appeal more.

 

BioBrick Part K411003:

 

This is a"pLAC promotor,Theophylline-inducible Riboswitch, GFP+Terminator" part made by 2010 NYMU-Taipe. We make similar tests as K537009 at different theophylline concentrations (0 mM, 0.1mM, 0.3mM, 0.5 mM,1mM,5mM,10mM and 20mM) over 2 hours using fluorometry.

 

Synergy hybrid reader detects effective effects of theophylline on GFP production.

 

 

Fig.11 The 8 different concentration of theophylline comparision on part K411003 theophylline robswitch tagged with GFP. Excitation at 480nm and emission at 535nm. Up to 10mM theophylline, cells didn't show obvious side effects and GFP production is proportioned with theophylline concentration, showing that K411003 is an effective riboswitch which can be regulated by theophylline. When theophylline concentration is beyond a certain degree (about 10 mM), it somewhat affect cell growth and GFP production.

 

Through Fig9 and Fig11 we find that when theophylline concentration scale is 0-1mM (especially 0-0.5mM); the response of fluorescence protein to theophylline is more significant with bigger slope. So we decided to carry out our clover 2 characterization with theophylline concentration scale 0-1mM.

 

Characterization

 

We characterize clover 2(Part K738002) we designed in split GFP methods.

 

Clover 2 is synthesized by Genscript and is a regulatory and tunable RNA scaffold with a theophylline aptamer. As we design it, when theophylline is added, MS2 aptamer will be free to combine FA tagged MS2 protein and closer with PP7 aptamer thus give out increasing light. We use fluorescence microscope, confocal microscopy and microplate reader to test our riboscaffold clover 2. For microplate hybrid reader experiments, fluorescence intensity/ OD 630 are used to be measurement criteria for comparison of the ability of give out light in microplate hybrid reader test.

 

Scaffold

 

We use fluorescence complementation to detect 3D comformational change of our riboscaffold clover 2. Green fluorescent protein (GFP) split into two halves (FA and FB) fused to the PP7 or MS2 aptamer binding proteins was used. Cells expressing FA and FB alone or clover 2 without the split GFPs displayed little fluorescence. However, the coexpression of clover 2 with the split GFPs showed increased fluorescence. Thus, our RNA scaffold clover 2 served as docking sites to promote protein-protein interactions in cells.

 

We make a series of cotransformation containing D0,clover2,FA,FB,FA+D0,FB+D0,FB+clover 2,FA+FB,and FA+FB+D0 & FA+FB+clover2. At mid-log phase we low-temperature-induced the E.colis by adding IPTG (0.2mM & 1mM) at 20 degree. After 5 hours, strains containing clover 2 were adding 0.5mM Theophylline. Successfully results are shown as we expected that, strains expressing only RNA scaffolds almost don't give out light, strains expressing FA+FB give out medium light and strains containing RNA scaffold &FA+FB emit a powerful beam after excitation.

 

To our surprise, the RNA scaffold clover 2 serves as a more effective scaffold than the origin D0, whose luminescence efficiency is 124.67% and performs better than D0 by 39.5%.

 

(Formula: `luminescence \quad efficiency=\frac{\frac{FI}{OD(FA+FB+scaffold)-\frac{FI}{OD(FA+FB)}}}{\frac{FI}{OD(FA+FB)}}`

 

Regulate and control by Theophylline

 

To characterise the theophylline tuned RNA scaffold clover 2 (part K738002), we quantified their activation at different theophylline concentrations (0 mM,0.1mM, 0.2 mM, 0.3mM, 0.4 mM, 0.5 mM, 0.6 mM, 0.7 mM,1 mM) over a period of time using fluorometry. Competent E. coli (strain BL21*DE3) cells were transformed with plasmid vectors containing the riboscaffold and were cultured until the mid-log phase of growth, then 0.2mM IPTG were added. After 3 hours, a different concentration of theophylline was added to each culture for induction. 2 hours later, we use PBS to wash the culture and prepare for following tests. The regulatory effect of the Theophylline aptamer was detected as a fluorescent response as a result of increased release of the MS2 aptamer. MS2 aptamer will be free to combine MS2 protein tagged FA and be closer with PP7 aptamer when Theophylline adding. A Synergy Hybrid Reader was used to excite the cultures at 480 nm and the intensity of the emission peak was detected at 535 nm. 3 replications were taken each culture, and 4 repeated experiment.

 

We find that up to a certain point (0.5 mM), a positive correlation exists between the GFP production and theophylline concentration, indicating that at first MS2 aptamer and theophylline aptamer are interacting(through specific base pairing) and close, when theophylline goes in, MS2 aptamer combines FA+MS2 and interact with FB+PP7 on PP7 aptamer thus give out fluorescence light. More theophylline, more light. SAS software results show significant variation(P-value<0.05) between 0mM theophylline and 0.5mM theophylline (optimum theophylline concentration to make clover 2 work) effects on clover 2.

 

It turns out that our riboscaffold clover 2 can be regulated and controlled through conformational change by theophylline. This scaffold, by theophylline management, could have a variety of functions, more than accelerate the reaction, but whether to accelerate or not, the degree of acceleration and even reduce the reaction rate.

 

Results

 

Scaffold

 

Fig.12 Fluorescence microscopy. The (BL21*DE3) of the E. coli were transformed with FA+FB, FA+FB+ original RNA scaffold D0, and FA+FB+ our designed RNA scaffold clover 2(0.5 mM theophylline adding). As expected, strains without RNA scaffold did not fluoresce. Upon the existence of RNA scaffold, many of the cells emitted fluorescence indicating a substantial amount of split GFP combination is permitted because of the function of RNA scaffold. The brightfield images in the right column depict all bacterial cells. The GFP images in the left column depict bacterial cells which emitted fluorescence.

 

Fig.13 Synergy Hybrid Microplate Reader controlled experiments. The BL21*DE3 of the E. coli were transformed with figure showing plasmids. (0.5 mM theophylline was adding in strains containing clover 2).

`luminescence \quad efficiency \quad of \quad clover 2=\frac{\frac{FI}{OD(FA+FB+clover 2)}-\frac{FI}{OD(FA+FB)}}{\frac{FI}{OD(FA+FB)}}=\frac{53425-23779}{23779}=125\%`

 

`luminescence \quad efficiency \quad of \quad D0=\frac{\frac{FI}{OD(FA+FB+clover 2)}-\frac{FI}{OD(FA+FB)}}{\frac{FI}{OD(FA+FB)}}=\frac{38288-23779}{23779}=61\%`

 

The original intention of our designing RNA scaffold clover 2 is to create a regulatory scaffold which can tune its conformation thus have various functions. To our surprise, clover version 2, when adding optimal Theophylline concentration 0.5mM, happens to be a more powerful scaffold which helps two halves of GFP’s combination and give out light strongly.

One possible reason is in clover version 2, distance between MS2 aptamer and PP7 aptamer is closer than in D0 (showing in Fig.4 and Fig.6), so that when binding phage coat proteins, FA and FB on clover version 2 were set closer than on D0. We submit the inference that when RNA scaffold binds enzymes, clover version 2 draws two enzymes nearer than D0 thus has more ability to accelerate the enzymatic reaction.

late and control by Theophylline

When the concentration of Theophylline is in the range from 0mM to 0.5mM, the concentration of Theophylline and the resulting fluorescence intensity are directly proportional.

Theophylline concentration beyond certain extent will be hazardous to cells and how it affects cells depends on strain type. The study by NYMU Taipei 2010 alerted adding more than 4mM of Theophylline would cause E. coli to die. In our experiments, we find that after adding more than 0.5mM, the Theophylline spectrum curve would be invalid. As a result, we pick up data with concentrations below 0.5mM to analyze as the E. coli cell would be unstable or the regulation of the Theophylline aptamer would not be accurate.

Fig.14 origin data of clover 2 regulatory tests. First line of each form is different treatments of Theophylline concentration and data in table cells are fluorescence intensity/ OD. Fig.15 7 tests of fluorescence/ OD change over theophylline concentration. There’s evident positive correlation in between. Then we build several SAS models to analyze data between 0-0.5mM Theophylline concentrations of treatments, choosing” clover version 2: different treatments versus blocks” test 5-7 to run a SAS model. P-value shows that Theophylline concentrations have significant impact on fluorescence intensity of clover version 2 and almost no impact on D0. That is to say, our designed RNA scaffold clover version 2 can be regulated and controlled by Theophylline within 0-0.5mM not for random errors or common phenomenon in RNA scaffolds. If you want more details about SAS source programs and software computational results, please click here [code].

 

In previous work, FA and FB are used to indicate the efficiency of riboscaffold. In order to further prove the function of riboscaffold, we plan to substitute FA, FB with functional enzymes or protein substrates like ferredoxin in hydrogen producing pathway respectively.

 

Considering the availability of material and abundant parts distributed by iGEM, we search the 2012 kit plate1-5 to find optimal pathways. After a pre-selection, six pathways are on candidate list. For sake of experimental feasibility, we perform a further selection based on several caritas as follows:

 

1. Product is easy to detect and measure;

 

2. Substrate is easy to get;

 

3. Product is beneficial to human;

 

4. The length of amino acid sequence of enzyme is optimal to be fusion protein;

 

5. Two proteins involved in the basic pathway.

 

Candidate list:

 

1. Salicylate pathway (Group: iGEM2006_MIT)

 

Assessment:

 

The characterization method of gas chromatography is difficult to perform. First, what can be analyzed is methyl salicylate production, that is to say, another enzyme should be co-transformed to E.coli too, which will increase cell’s burden and reduce the ratio of successful co-transformation. Second, it is not convenient for us to borrow the relative machine.

 

2. Pyocyanin pathway (Group: iGEM2007_Glasgow)

 

Assessment:

 

Through there are exactly two enzymes involved in this pathway, but the source of material, phenazine-1-carboxylic acid (PCA), is not mentioned. And it not easy to measure the amount of pyocyanin.

 

3. Lycopene pathway (Group: iGEM2009_Cambridge)

 

Assessment:

 

Lycopene is visible red and its substrate, FPP, is colorless. So measurement is quite feasible. But there are at least three proteins in this pathway, which will increase the burden of cell. But in future work, we could have a try.

 

4. Holo- α -phycoerythrocyanin pathway (Group: iGEM2004_UTAustin)

 

Assessment:

 

Heme is metabolic product of E.coli and Holo-α-phycoerythrocyanin is blue. But at least 5 proteins should be expressed in E.coli.

 

5. BPA degradation pathway (Group: iGEM2008_University_of_Alberta)

 

Assessment:

 

Bisphenol A is degraded by BisdA and BisdB. But BPA is toxic to cells.

 

6. IAM pathway (Group: iGEM2011_Imperial)

 

Assessment:

 

Five pathways described above all have some drawbacks, finally, only one pathway left, IAM pathway. The two-step IAM pathway generates indole-3-acetic acid (IAA) from the precursor tryptophan. IAA tryptophan monooxygenase (IaaM) catalyses the oxidative carboxylation of L-tryptophan to indole-3-acetamide, which is hydrolysed to IAA and ammonia by indoleacetamide hydrolase (IaaH).

Applications of RNA Scaffold & Aptamers

 

1. RNA aptamers take place of fluorescent proteins

 

Some RNA aptamers can bind fluorophores, such as 4-hydroxybenzlidene imidazolinone (HBI), 3,5-dimethoxy-4-hydroxybenzylidene imidazolinone (DMHBI), 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI), resembling the fluorophore in GFP, and then these RNA-fluorophore complexes enable to emit different colors of fluorescence comparable in brightness with fluorescent proteins.

 

These RNA-fluorophore complexes could be used to tag RNAs in living cells to reveal the intracellular dynamics of RNA, including RNA-RNA and RNA-protein interactions.

 

[Reference: Jeremy S. Paige, Karen Y. Wu, Samie R. Jaffrey, RNA Mimics of Green Fluorescent Protein science, 2011 vol 333, 642-646]

 

2. kinetic investigation of RNA hybridizations and foldings

 

By introducing fluorophores like 1-ethynylpyrene into the 2-position of RNA adenosine, through an intermolecular interaction of the pyrene residues in twofold labelled RNA, single and double strands can be distinguished by their fluorescence spectrum changes.

 

With this fluorescence shift, one can distinguish between single-stranded and double-stranded RNA during thermal denaturation. This behavior could be used for the time resolved investigation of RNA hybridizations and folding by fluorescence spectroscopy.

 

[Reference: Josef Wachtveitlb, Joachim W. Engels, ect. RNA as scaffold for pyrene excited complexes, Bioorganic & Medicinal Chemistry 16 (2008) 19-26]

 

3. Medicine & health

 

To date, many groups have successfully identifi ed aptamers with a variety of functions, including inhibitory and decoy-like aptamers, regulatable aptamers, multivalent/agonistic aptamers, and aptamers that act as delivery vehicles. Each of these classes of aptamers has potential applications in therapeutics and/or diagnostics.

 

Inhibitory aptamers：The most extensively characterized inhibitory aptamer is the RNA aptamer that targets VEGF. This aptamer was approved by the FDA in December 2004, for the treatment of wet age-related macular degeneration (AMD)

 

Decoy-like aptamers：By mimicking the target sequence of the proteins, aptamers can act as decoys to inhibit binding of transcriptional factors such as HIV-tat, NF-κB, and E2F to their cognate sequences on DNA and thus prevent transcription of target genes and may result in powerful therapeutics for treating many human pathologies

 

Multivalent aptamers: A bivalent aptamer targeting HIV has also been described and consists of 2 separate RNA aptamers that bind to 2 distinct stem-loop structures within the HIV 5′UTR: the HIV-1 TAR element and the dimerization initiation site. Similarly, bivalent aptamers targeting thrombin have been engineered as a way to increase the avidity of the aptamer for its target and enhance the anticoagulation effect

 

Aptamers as delivery tools: Several groups have reported linking siRNAs to aptamers as a way to specifi cally deliver siRNAs to target cells. Aptamers are also being utilized to deliver toxins, radioisotopes, and chemotherapeutic agents encapsulated in nanoparticles.

 

[Reference: Kristina W. Thiel and Paloma H. Giangrande, Therapeutic Applications of DNA and RNA Aptamers. Oligonucleotides, 2009, Volume 19, Number 3, 209-222]

 

4. Regular of gene expression

 

Aptamers are small oligonucleic acid molecules that can be selected in vitro against nearly any target of choice. And they often show remarkable binding affinity and specificity, and consequently have a huge potential for application. One of their usages is to play a role in activating gene expression.

 

Some RNA aptamers can specifically bind some transcriptional regulator. For example, people have selected one RNA aptamer that can bind TetR, which usually binds on operator sequence and repress gene expression. So once the RNA aptamer binds to the transcriptional regulator, the targeting gene-expression is activated.

 

[Reference: Anke Hunsicker, Markus Steber, ect. An RNA Aptamer that Induces Transcription, Chemistry & Biology, 2009,Volume 16, Issue 2, 173–180]