Team:Potsdam Bioware/Lab/Labjournal/July

From 2012.igem.org

(Difference between revisions)

Latest revision as of 19:27, 25 September 2012

back to UP12_Lab journal

AID

2012-07-02

Topic: Overnight culture of CMV and polyA carrying cells

Investigators: Mario, Tom S.

Time: 2012-07-02

AIM: Preparation of wild type AID

Materials:

LB medium

Chloramphenicol 25 mg/mL stock solution in 70 % EtOH

Plasmids: pSB1C3 with CMV; pSB1C3 with Poly-A

Method:

Inoculation of cell sample each in 5 ml LB medium

shaking over night at 37 °C, 300 rpm, approx. 16 hours

Further tasks:

Miniprep

2012-07-03

Topic: Glycerolstocks, Miniprep and preparative digestion

Investigators: Basia, Tom S., Chris, Mario

Time: 2012-07-03

Aim: Preparation of wildtype AID

Materials:

Glycerol

Miniprep Kit

overnight culture (pSB1C3 with CMV); overnight culture (pSB1C3 with Poly-A)

CMV: Restriction enzymes (SpeI, PstI); NEB buffer 2

Poly-A: Restriction enzymes (Poly A: PstI, XbaI); NEB buffer 3

Method:

Glycerol stock: 500 µL Glycerol 99,8 % + 500 µL overnight cultures --> put in -80 °C freezer

Miniprep (both over night culture (pSB1C3 with CMV) and over night culture (pSB1C3 with Poly-A)

preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL NEB (2 or 3) buffer

Results:

DNA - concentrations via nanodrop:

pcDNA5 (AG) = 642,9 ng/µL

pcDNA5 (good) = 729,1 ng/µL

pcDNA5 (bad) = 705,4 ng/µL

pSB1C3 with CMV = 311,9 ng/µL

pSB1C3 with Poly-A = 360,3 ng/µL

Topic: Separation of cut DNA fragments via gel electrophoresis

Investigators: Chris, Mario

Time: 2012-07-03

Aim Separation of cut DNA fragments via gel electrophoresis

Materials:

gel electrophoresis material

cut samples:

CMV: Restriction enzymes (SpeI, PstI); NEB buffer 2

Poly-A: Restriction enzymes (PstI, XbaI); NEB buffer 3

Method:

samples:

- 30 µL CMV cut with SpeI and PstI + 7,5 µL loading dye

- 30 µL polyA + 7,5 µL loading dye

gel electrophoresis conditions:

30 µL of each sample into one big slot

V = 120 V

duration roughly 50 minutes

Results:

Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tubes

Further Tasks:

Gel Extraction

2012-07-04

Gel Extraction of CMV and polyA

Investigators:

Mario, Tom S.

Aim:

Gel Extraction of CMV and polyA

Materials:

centrifuge, Nucleo Spin and PCR clean up - Kit, thermo block, nanodrop

Molecular weight calculator online resource: http://www.encorbio.com/protocols/Nuc-MW.htm

multiplicate with factor 2 when DNA is double stranded

Method:

extract DNA: according to the manual

Results:

DNA-concentrations via nanodrop:

CMV = 106,8 ng/µL -> 63,7 nM (with mass conc. of 1676525,6 Da)

polyA = 15,1 ng/µL -> 48,5 nM (with mass conc. of 311550 Da)

location: -20 °C freezer, topmost drawer

ready DNA for Ligation

Further tasks:

ligation of fragments

Topic: Overnight culture of AID carrying cells

Investigators: Sascha

Time: 2012-07-04

Materials:

LB medium

ampicillin 100 mg/ ml stock solution

glycerol stocks E. coli XL1 blue with plasmids: pSB1C3 with AID

Method:

Inoculation of cell sample in 5 ml LB medium

shaking overnight at 37°C, 300 rpm, approx. 16 hours

Further tasks:

Miniprep

2012-07-05

Topic: Miniprep and preparative digestion

Investigators: Chris

Time: 2012-07-05

Materials:

Miniprep Kit

over night culture (pSB1A3 with AID)

AID: Restriction enzymes (XbaI, PstI); NEB buffer 3

Method:

Miniprep according to the manual

preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL NEB 3 buffer

Results:

DNA - concentrations via nanodrop:

pSB1A3 with AID = 85,5 ng/µL

Topic: Separation of cut DNA fragments via gel electrophoresis

Investigators: Mario, Tom S.

Time: 2012-07-05

Aim Separation of cut DNA fragments via gel electrophoresis

Materials:

gel electrophoresis material

cut samples:

AID: Restriction enzymes (XbaI, PstI); NEB buffer 3

Method:

samples:

- 30 µL AID cut with XbaI and PstI + 7,5 µL loading dye

gel electrophoresis conditions:

30 µL of each samples into one big slot converted

V = 120 V

duration roughly 65 minutes

Results:

Marked fragment was cut out of the gel and transferred into 1,5 mL Eppendorf tube

Further Tasks:

Gel extraction

Gel extraction of AID

Investigators:

Mario, Tom S.

Aim:

Gel extraction of AID

Materials:

centrifuge, Nucleo Spin and PCR clean up - Kit, thermo heater, nanodrop

Method:

Gel extraction according to the manual

Results:

DNA-concentrations via nanodrop:

AID = 9,2 ng/µL -> 23,8 nM (with mass conc. of 386864,4 Da)

location: -20 °C freezer, topmost drawer

ready DNA for Ligation

Further tasks:

ligation of fragments

Ligation of CMV (Insert + backbone) and AID (insert)

Investigators:

Mario, Tom S.

Aim:

Ligation of CMV (Insert + backbone) and AID (insert)

Materials:

T4 DNA-Ligase, samples(CMV + AID)

Method:

DNA Fragment ligation: according to the manual

sample preparation:

1 µL (CMV Fragment) c=106,8 ng/µL(63,9 nM) -> 6,4 nmol

6 µL (AID Fragment) c=9,2 ng/µL(23,8 nM) -> 14,3 nmol

1 µL (T4 DNA-Ligase)

2 µL (DNase free water)

incubation of sample 1,5 h at 22 °C

Results:

location: -20 °C freezer, topmost drawer

ready DNA Transformation

Further tasks:

Transformation

2012-07-06

Topic: Transformation of ligated sample

Investigators: Mario, Tom S.

Time: 2012-07-06

Materials:

Bunsen burner, Agar Plate with Chloramphenicol, 37 °C heat block, centrifuge

ligated sample (compare last step 07-05-2012)

icebox

competent E. coli cells (XL 1)

Method:

Transformation via manual

Plate incubation start: 1:30 pm

Results:

grown colonies

Further tasks:

picking clones

2012-07-07

Overnight culture of pSB1C3+CMV+AID carrying cells

Investigators: Chris

Time: 2012-07-07 6pm

Materials:

LB medium, chloramphenicol 25 mg/ ml stock solution, plates with E. coli XL1 blue with plasmids: pSB1C3+CMV+AID

Method: picking clones (2 per plate->Nr.1-6) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

glycerolstocks & Miniprep

2012-07-08

Topic: Glycerol stocks, Miniprep

Investigators: Basia

Time: 2012-07-08 11:00am

Materials:

Glycerol

Miniprep Kit

6x overnight culture (pSB1C3 with CMV+AID);

Method:

Glycerol stock: 500 µL Glycerol 99,8 % + 500 µL overnight cultures --> put in -80 °C freezer

Miniprep (all 6 over night cultures (pSB1C3 with CMV+AID)

Results:

6 Cryostocks are stored in the igem box in the -80°C freezer and Plasmids are stored in -20°C in the 4th drawer on styrofoam rack

2012-07-09

Topic: Measuring DNA-concentration of plasmids from 2012-07-08

Investigators: Mario, Tom S.

Time: 2012-07-09

Materials:

Plasmids: pSB1C3 with CMV+AID (samples: 1, 2, 3, 4, 5, 6)

Nanodrop

NE-buffer

Method:

2 µL of each DNA-sample onto nanodrop (Ne-buffer blank)

Results:

DNA-concentrations:

1 = 290 ng/µL

2 = 361,2 ng/µL

3 = 316,8 ng/µL

4 = 360,5 ng/µL

5 = 392,5 ng/µL

6 = 390 ng/µL

Further tasks:

restriction enzyme digestion with XbaI und PstI

Topic: preparative digestion

Investigators: Mario, Tom S.

Time: 2012-07-09

Materials:

Plasmids: pSB1C3 with CMV+AID (samples: 1, 2, 3, 4, 5, 6)

Restriction enzymes (XbaI and PstI)

NE3-buffer

Method:

heat block (37 °C)

sample preparation: each DNA 25 µL + 3 µL NE3-buffer + 1 µL XbaI + 1 µL PstI

incubation of samples for 4 h at 37 °C

Results:

none

Further tasks:

gel electrophoresis

Topic: Separation of cut DNA fragments via gel electrophoresis

Investigators: Mario, Tom S.

Time: 2012-07-09

Aim Separation of cut DNA fragments via gel electrophoresis

Materials:

gel electrophoresis material

cut samples:

AID: Restriction enzymes (XbaI, PstI); NEB buffer 3

CMV: Restriction enzymes (XbaI, PstI); NEB buffer 3

AID+CMV: Restriction enzymes (XbaI, PstI); NEB buffer 3

Method:

samples:

- 10 µL AID cut with XbaI and PstI + 2,5 µL loading dye

gel electrophoresis conditions:

10 µL of each sample into one big well

V = 120 V

duration roughly 95 minutes

Results:

Further Tasks:

overnight culture with AID+CMV sample 1, 2 and 3

Topic: Overnight culture of AID+CMV carrying cells

Investigators: Basia, Tom S.

Time: 2012-07-09, 17:30

Materials:

LB medium

chloramphenicol 25 mg/ ml stock solution

glycerol stocks E. coli XL1 blue with Plasmids: pSB1C3 with AID+CMV of sample 1,2 and 3,

Method:

Inoculation of cell samples in 3 ml LB medium

shaking over night at 37°C, 300 rpm

Further tasks:

Miniprep, preparative digestion, Plasmid ligation with polyA

2012-07-10

Topic: Miniprep of CMV+AID carrying plasmids

Investigators: Tom S., Mario

Time: 2012-07-10

Materials:

samples(CMV + AID: 1, 2, 3) - for detailed info check lab day 2012-07-09

Miniprep Kit

overnight culture (pSB1C3 with AID + CMV: samples 1, 2, 3,)

Method:

Plasmid isolation via Kit (check manual)

concentration measurement via nanodrop (2 µL sample)

Results:

DNA - concentrations via nanodrop:

AID + CMV (1) = 303,2 ng/µL

AID + CMV (2) = 366,6 ng/µL

AID + CMV (3) = 378,5 ng/µL

Further Tasks:

preparative digestion (use sample #3; samples 1 and 2 for back up in -20 °C freezer topmost drawer)

fragment cut

2012-07-11

Topic: preparative digestion

Investigators: Tom S.

Time: 2012-07-11 09:00

Materials:

pSB1C3 Vector with CMV+AID

Restriction enzymes (SpeI, PstI); Fast Digest Green Buffer

Method:

preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)

further tasks:

Gel electrophoresis

Topic: Gel electrophoresis of cut pSB1C3 (CMV + AID) fragments

Investigators: Tom S.

Time: 2012-07-11 11:00

Materials:

cut sample (CMV + AID, PstI + SpeI)

Gel electrophoresis material

Method:

sample preparation: none

loading into wll: 30 µL

duration: 70 minutes

Results:

one band

Further Tasks:

Gel extraction

Topic: Gel extraction and measurement of DNA concentration

Investigators: Chris, Mario

Time: 2012-07-11 13:00 - 14:00

Materials:

Analytic Jena gel extraction kit

measurement of DNA concentration via nanodrop

Method:

Gel extraction via manual

Results:

DNA concentration via nanodrop: 98.7 ng/µL
-->2051640 Da (2051,64 kDa)--> c=48.1 nM

Further Tasks:

Ligation of fragment with Poly-A

Topic: Ligation CMV+AID in pSB1C3 (cut:Spe1 and Pst1) with hGH-polyA (cut:Xba1 and Pst1)

Investigators: Chris, Mario

Time: 2012-07-11 16:45 - 17:30

Materials:

digested fragments: CMV+AID in pSB1C3 (cut:Spe1 and Pst1) c=48.1 nM , hGH-polyA (cut:Xba1 and Pst1) c= 15,1 ng/µL -> 48,5 nM

Method:

mix 1µL CMV+AID in pSB1C3 (cut:Spe1 Pst1) c=48.1 nM, 3µL hGH-polyA (cut:Xba1 Pst1) c=48.5 nM, 1µl T4 Ligase, 1µ 10x Buffer,4 µL H20

incubate 1.5 h

Results:
not visible

Further Tasks:

Transformation

Topic: Transformation of XL1 Blue with CMV+AID+hGH-polyA in pSB1C3

Investigators: Chris

Time: 2012-07-11 finished:18 Uhr

Materials:

LB medium, E. coli XL1 Blue, ligation product (CMV+AID+hGH-polyA), agar-LB-paltes with 1:1000 chloramphenicol

Method:

transformation - standard operating procedures

Results:
two plates with transformed E. coli (CMV+AID+polyA)

Further Tasks:

picking colonies & inoculate 5 ml overnight culture

2012-07-12

Overnight culture of pSB1C3 CMV+AID+hGH-polyA, CMV+AID, CMV, hGH-polyA and pSB1A3 AID carrying cells

Investigators: Tom S.

Time: 2012-07-12 6pm

Materials:

LB medium, chloramphenicol 25 mg/ ml stock solution, plates with E. coli XL1 blue with plasmids: pSB1C3+CMV+AID, glycerol stocks: pSB1C3 with AID+CMV, CMV, hGH-polyA and pSB1A3 with AID

Method: picking clones(3 per plate->Nr.1-6) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours, samples from glycerolstocks in 3 ml LB + 3 µL chloramphenicol or 3µL Amp

Further tasks:

glycerol stocks & Miniprep

Topic: Planing BBa_K929001

Investigators: Tom S., Chris, Basia, Rico, Mario, Kevin

Aim: planing how to digest and ligate the vectors for BBa_K929001

Material: Genious

Results:

pSB1C3 with CMV -> (cut with SpeI and XbaI) 2072 bp (pSB1C3 backbone) + 662 bp (rest)

PCR-amplificate -> (cut with SpeI and XbaI) 597 bp (modified AID insert)

Further tasks:

design and ordering of primers, practical part

Primer design and ordering for BBa_K929001

Investigators: Tom S., Rico

Time: 2012-07-12 7pm

Primer (forward) with XbaI recognition site, kozak consensus sequence, NLS:

ATCTAGAGCCGCCACCATGGGACCCAAGAAGAGGAAGGTGATGGACAGCCTCTTGATGAACCGGAGG

Primer (reverse, complement)with AgeI and SpeI recognition site:

CCACTAGTATTAACCGGTGGGCAAAAGGATGCGCCGAAGC

2012-07-13

Mini Prep of WT Plasmids, nanodrop

Investigators: Tom S., Mario

Time: 2012-07-13 10am

Materials:

Miniprep Kit

Overnight culture of AID-WT tranfected E. coli strains

Method: Kit via manual

Results:

DNA-concentrations via nanodrop:

WT-AID 1: 387,2 ng/µL

WT-AID 2: 453,0 ng/µL

WT-AID 3: 415,8 ng/µL

WT-AID 4: 445,5 ng/µL

WT-AID 5: 474,1 ng/µL

WT-AID 6: 645,1 ng/µL

AID: 393,5 ng/µL

CMV: 188,0 ng/µL

CMV+AID 221,9 ng/µL

hGH 318,2 ng/µL

Further tasks:

digestion and gelelectrophoresis

Topic: preparative digestion

Investigators: Tom S.

Time: 2012-07-11 09:00

Materials:

pSB1C3 Vectors with CMV+AID+hGH-polyA, AID, CMV, hGH, CMV+AID

Restriction enzymes (SpeI, PstI); Fast Digest Green Buffer

Method:

preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)

further tasks:

Gel electrophoresis

2012-07-16

Gel electrophoresis of cut ligation samples (WT AID - CMV+AID+hGH-polyA)

Investigators: Tom S.

Time: 2012-07-16;

Materials:

gel electrophoresis equipment

samples

Method:

loading wells with 10 µL of each cut sample (ca. 600-800 ng DNA per sample)

gel ectrophoresis standard operating procedure

Results:

Further tasks:

sequencing

2012-07-23

Topic: PCR of AID+NLS+Kozak sequence

Investigators:

Basia, Tom S.

Aim:

amplification of the AID with inserted Kozak sequence and NLS sequence via PCR

Materials:

Phusion, template (AID insert), Primers designed by Tom S. and Rico on 12.07.2012, dNTPs, Polymerase)

PCR clean-up kit

Method:

polymerase chain reaction

Mastermix

reagent	volume [µL]
HF Phusion buffer 5x	10
dNTPs	1
Primer (Forward)	1,25
Primer (Reverse)	1,25
DNA (Plasmid)	1,0
Phusion Polymerase	0,5
water	35,0

Program

step	Temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	5	17
annealing + elongation	72	45	17
denaturation	98	5	17
elongation	72	25	17
final elongation	72	600	1
cooling	4	∞	1

Results:
125ng/µl - 1st sample, 135ng/µl 2nd sample

Further tasks:

digestion + agarose gel electrophoresis

Primer design and ordering for sequencing BBa_K929001 and BBa_K929003

Investigators: Tom S., Rico

Time: 2012-07-23

Primer bind on pSB1C3-vector (left next to backbone-prefix):

GGCGTATCACGAGGCAG

Primer (reverse, complement) bind on pSB1C3-vector (right next to backbone-suffix):

CGAGTCAGTGAGCGAGG

2012-07-25

Topic: preparative digestion

Investigators: Tom S.

Time: 2012-07-25 08:30

Materials:

pSB1C3 Vector with CMV

2 PCR-products - AID without NES, with NLS+Kozak Sequence (theoretically the same) (SpeI, XbaI; Fast Digest); Fast Digest Green Buffer

Method:

preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)-> for the pSB1C3 backbone

preparative digestion: 18 µL DNA + 1 µL of each enzyme + 2 µL Fast Digest Green Buffer (incubation for 2 h)-> for the PCR-products

Topic: Separation of cut DNA fragments via gel electrophoresis

Investigators: Tom S.

Time: 2012-07-25

Aim Separation of cut DNA fragments via gel electrophoresis

Materials:

gel electrophoresis material

Method:

cut samples:

pSB1C3 backbone: Restriction enzymes (XbaI, SpeI; Fast Digest); Fast Digest buffer

PCR-products (AID without NES, with NLS+Kozak Sequence): Restriction enzymes (XbaI, SpeI; Fast Digest); Fast Digest buffer

wells loaded with 30 or 22 µL of digested samples via gel electrophoresis - standard operating procedure

gel electrophoresis conditions:

V = 120 V

duration roughly 50 minutes

Results:

Marked fragment was cut out of the gel and transferred into 1,5 mL Eppendorf tube

Further Tasks:

Gel extraction

Gel extraction of pSB1C3 backbone and modified AID insert (AID without NES, with NLS+Kozak Sequence)

Investigators:

Tom S.

Aim:

Gel extraction of pSB1C3 backbone and modified AID insert

Materials:

centrifuge, Nucleo Spin and PCR clean up - Kit, thermo heater, nanodrop

Method:

DNA extraction: according to the manual

Results:

DNA-concentrations via nanodrop:

pSB1C3 backbone = 83,6 ng/µL -> 65,7 nM (with mass conc. of 1273,3 kDa)

PCR-product 1 = 74,0 ng/µL -> 201,5 nM (with mass conc. of 367,18 kDa)

PCR-product 1 = 77,5 ng/µL -> 211,1 nM (with mass conc. of 367,18 kDa)

location: -20 °C freezer, topmost drawer

ready DNA for ligation

Further tasks:

ligation of fragments

Ligation of PCR-product (AID without NES, with NLS+Kozak Sequence) and pSB1C3 backbone

Investigators:

Tom S.

Aim:

Ligation of PCR-product and pSB1C3 backbone

Materials:

T4 DNA-Ligase, samples(PCR-product 1 and 2 + pSB1C3 backbone)-> PCR products 1 and 2 are theoretically the same

Method:

DNA Fragment ligation: according to the manual

sample preparation:

2 µL (PCR-product) c=75,8 ng/µL(206,4 nM)-> 41,3 nM

2 µL (pSB1C3 backbone) c=83,6 ng/µL(65,7 nM) -> 13,2 nM

1 µL (T4 DNA-Ligase)

1 µL 10x T4 DNA Ligase Buffer

4 µL (DNase free water)

incubation of sample 1,5 h at 22°C

Results:

samples ligated

location: -20 °C freezer, topmost drawer

ready DNA for transformation

Further tasks:

Transformation

Topic: Transformation of ligated sample

Investigators: Tom S.

Time: 2012-07-25

Materials:

Bunsen Burner, Agar Plate with Chloramphenicol, 37 °C heater, centrifuge

ligated sample (compare last step 25-07-2012)

icebox

competent E. coli cells (XL 1)

Method:

Transformation via manual

Plate incubation start: 5:00 pm

Results:

ready for growing mutants to pick clones

Further tasks:

picking clones

2012-07-26

picking clones & inoculation

Investigators: Sascha

Time: 2012-07-27 6 pm

Materials:

LB medium, chloramphenicol 25 mg/ ml stock solution, plates with E. coli XL1 blue with plasmids: pSB1C3+pcr-products(AID with NLS,without NES+Kozak sequence), glycerol stocks: pSB1C3 with CMV

Method: picking clones(3 per plate) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours, samples of glycerol stocks in 5 ml LB + 5 µL chloramphenicol

Further tasks:

glycerolstocks & Miniprep

2012-07-27

Miniprep

Investigators: Tom S.

Time:

2012-07-03 8 am

Materials:

Glycerol, Miniprep Kit, over night culture (pSB1C3 with CMV); overnight culture (pSB1C3 with modified AID)

Method:

Glycerol stock: 300 µL Glycerol 99,8 % + 700 µL over night cultures --> put in -80 °C freezer

Miniprep (both overnight culture (pSB1C3 with CMV) and overnight cultures (pSB1C3 with PCR 1 colony 1-3 and PCR 2 colony 1-3)

Results:

DNA - concentrations via nanodrop:

PCR1 C1= 163.7 ng/µL

PCR1 C2= 154.7 ng/µL

PCR1 C3= 165.5 ng/µL

PCR2 C1= 117.1 ng/µL

PCR2 C2= 164.7 ng/µL

PCR2 C3= 94,4 ng/µL

CMV= 144.2 ng/µL

Further tasks:

preparative digestion

Topic: preparative digestion

Investigators:Chris

Time: 2012-07-27 11:30

Materials:

pSB1C3 Vector with CMV (SpeI, PstI; Fast Digest); Fast Digest Green Buffer

PCR 1 C 3 and PCR 2 C 2 in pSB1C3 vector(PstI, XbaI; Fast Digest); Fast Digest Green Buffer

Method:

preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2,5 h)

Topic: Separation of cut DNA fragments via gel electrophoresis

Investigators: Tom S.

Time: 2012-07-27

Aim: Separation of cut DNA fragments via gel electrophoresis

Materials:

gel electrophoresis material

cut samples:

digested CMV: Restriction enzymes (SpeI, PstI; Fast Digest); Fast Digest buffer

digested PCR-products: Restriction enzymes (PstI, XbaI; Fast Digest); Fast Digest buffer

Method:

samples:

loading wells with 30µl of digested samples via gel electrophoresis, standard operating procedure

gel electrophoresis conditions:

30 µL of each samples into one big well

V = 120 V

duration 72 minutes

Results:

Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tube for gel extraction

Further Tasks:

Gel extraction

Gel extraction of digested CMV+backbone and PCR-products (AID without NES, with NLS+Kozak sequence) insert

Investigators:

Tom S.

Aim:

Gel extraction of digested CMV+backbone and PCR-products insert

Materials:

centrifuge, Nucleo Spin and PCR clean up - Kit, heat block, nanodrop

Method:

extraction of DNA: according to the manual

Results:

DNA-concentrations via nanodrop:

CMV+backbone = 85,6 ng/µL -> 50,9 nM (with mass conc. of 1681,3 kDa)

PCR 1 C 3 = 33,7 ng/µL -> 89,1 nM (with mass conc. of 378,3 kDa)

PCR 2 C 2 = 29,4 ng/µL -> 77,7 nM (with mass conc. of 378,3 kDa)

location: -20 °C freezer, topmost drawer

ready DNA for Ligation

Further tasks:

ligation of fragments

2012-07-28

Ligation of PCR-products(AID without NES, with NLS+Kozak sequence) and CMV+backbone

Investigators:

Basia

Aim:

Ligation of PCR-products and CMV+backbone

Materials:

T4 DNA-Ligase, samples(PCR 1 C 3 or PCR 2 C 2 and CMV+backbone)

Method:

DNA fragment ligation: according to the manual

sample preparation:

4 µL PCR 1 C3 c=33,7 ng/µL(89,1 nM)-> 35,6 nM; (for the other sample 4µL PCR 2 C 2 c=29,4 ng/µL(77,7 nM)-> 31,1 nM

2 µL (CMV+backbone) c=85,6 ng/µL(50,9 nM) -> 10,2 nM

1 µL (T4 DNA-Ligase)

1 µL 10x T4 DNA Ligase Buffer

2 µL (DNase free water)

incubation of sample 1,5 h at 22°C

Results:

location: -20°C freezer, topmost drawer

ready DNA Transformation

Further tasks:

Transformation

Topic: Transformation of ligated sample

Investigators: Basia

Time: 2012-07-28 12:30

Materials:

Bunsen Burner, Agar Plate with Chloramphenicol, 37°C heat block, centrifuge

ligase sample (from last step 28.07.2012)

icebox

competent E. coli cells (XL 1 Blue)

Method:

Transformation according to the manual

Plate incubation start: 14:30 pm

Results:

ready mutants to pick clones

Further tasks:

picking clones

2012-07-29

Overnight culture of E. coli containing plasmids with PCR products (AID without NES, with NLS+Kozak sequence) and CMV promoter

Investigators: Basia

Time: 2012-07-29 7 pm

Materials:

LB medium, chloramphenicol 25 mg/ ml stock solution, plates with E. coli XL1 blue with plasmids: CMV+PCR1C3 and CMV+PCR2C2

Method: picking clones(2 per plate) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

glycerol stocks & Miniprep

2012-07-30

Topic: Transformation of BBa_E0040 (wild-type GFP) from Distribution Plate 1 Kit 2012

Investigators: Chris

Time: 2012-07-30 10:30

Materials:

Bunsen Burner, Agar Plate with ampicillin, icebox, competent E. coli cells (XL 1 Blue)

Method:

Transformation according to the manual

Plate incubation start: 13:30 pm

Results:

ready mutants to pick clones

Further tasks:

picking clones

Glycerol stocks & miniprep of CMV+AID without NES, with NLS+Kozak sequence containing plasmids

Investigators: Tom S.

Time:

2012-07-03 8:30 am

Materials:

Glycerol, Miniprep Kit, overnight cultures (CMV+PCR1C3C1-2; CMV+PCR2C2C1-2)

Method:

Glycerol stock: 300 µL Glycerol 99,8 % + 700 µL overnight cultures --> put in -80 °C freezer

Miniprep overnight cultures (CMV+PCR1C3C1-2; CMV+PCR2C2C1-2) procedure according to the manual

Results:

DNA concentrations via nanodrop:

PCR1C3 C1= 389,5 ng/µL

PCR1C3 C2= 394,3 ng/µL

PCR2C2 C1= 409,8 ng/µL

PCR2C2 C2= 383,4 ng/µL

Further tasks:

preparative digestion with PCR1C3 C2 and PCR2C2 C1

Topic: preparative digestion

Investigators:Chris

Time: 2012-07-30 11:00

Materials:

pSB1C3 Vector with hGH-PolyA (XbaI, PstI; Fast Digest); Fast Digest Green Buffer

PCR1C3 C2 and PCR2C2 C1 in pSB1C3 vector - AID without NES, with NLS+Kozak sequence+CMV(PstI, SpeI; Fast Digest); Fast Digest Green Buffer

Method:

preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)

Topic: Separation of cut DNA fragments via gel electrophoresis & Gel extraction

Investigators: Chris

Time: 2012-07-30

Aim: Separation of cut DNA fragments via gel electrophoresis

Materials:

gel electrophoresis material

cut samples:

digested hGH-PolyA: Restriction enzymes (XbaI, PstI; Fast Digest); Fast Digest buffer

digested PCR-products: Restriction enzymes (PstI, SpeI; Fast Digest); Fast Digest buffer

Method:

gel ectrophoresis - standard operating procedure

gel electrophoresis conditions:

30 µL of each samples into one big slot

V = 120 V

duration roughly 60 minutes

Results:

Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tubes

Gel Extraction:

final concentrations:

CMV+PCR1C3C2(3318 nt, MW=2048.48 kDa) : 188.1 ng/µl (91.8 nM)

CMV+PCR2C2C1 : 182.2 ng/µl (88.9 nM)

hGH-polyA (495 nt, MW=305.4 kDa): 26.1 ng/µl (85 nM)

Further Tasks:

Ligation, transformation

2012-07-31

Topic: Planing BBa_K929003

Investigators: Tom S., Chris, Basia, Rico, Mario, Kevin

Aim: planing how to digest and ligate the vectors for BBa_K929003

Material: Genious

Results:

pSB1C3 with CMV+ mod. AID (without NES, with NLS) -> cut with AgeI and SpeI, 3322 bp - pSB1C3 backbone with CMV + mod. AID, 14 bp - rest

eGFP -> cut with SpeI and NgoMIV, 731 bp - eGFP insert, 2074 bp - pSB1C3 backbone

pSB1C3 with CMV+ mod. AID + eGFP -> cut with Spe1 and Pst1, 4035 bp - pSB1C3 backbone with CMV + mod. AID+eGFP, 18 bp - rest

hGH-polyA -> cut with Xba1 and Pst1, 505 bp - hGH-polyA insert, 2053 - pSB1C3 backbone

Further tasks:

practical part

inoculation of GFP in pSB1A2 (BBa_E0040) & eGFP (from Sven eGFP in pSB1C3 in RFC 25-like [http://partsregistry.org/Part:BBa_K404316 BBa_K404316]

Investigators: Tom S., Chris

Time: 2012-07-31 3pm

Materials:

LB medium, chloramphenicol 25 mg/ ml stock solution, ampicillin stock solution, plates with E. coli XL1 blue with plasmid: GFP in pSB1A2 (BBa_E0040), glycerol stock from Sven: eGFP in pSB1C3 in RFC 25

Method: picking clones (1 per plate from 2 plates) GFP in pSB1A2 (BBa_E0040) and inoculation in 5 ml LB medium + 5µl ampicillin stock, 2 times inoculation of glycerol stock (eGFP in pSB1C3 in RFC 25) in 5mL LB medium + 5µL chloramphenicol stock, shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

glycerol stocks & Miniprep

preparation of WT-AID & modified AID (without NES, with NLS) in pSB1C3 for sequencing & send to GATC

Investigators: Tom S., Chris

Time: 2012-07-31 7pm

Materials:

20 µl primer c=10µM for each sequencing, 20 µl sample with concentration around 70 ng/µl

Method: mark the samples with bar code stickers & order the sequencing from GATC, put the cups into the orange boxes

samples:

sample	barcode	primer	sample	barcode	primer
WT AID clone 1 (Cmv+WtAID+PolyA in pSB1C3)	CC0697	forward pSB1C3	WT AID clone 1	CC0709	reverse pSB1C3
WT AID clone 2	CC0698	forward pSB1C3	WT AID clone 2	CC0710	reverse pSB1C3
WT AID clone 3	CC0699	forward pSB1C3	WT AID clone 3	CC0711	reverse pSB1C3
WT AID clone 4	CC0700	forward pSB1C3	WT AID clone 4	CC0712	reverse pSB1C3
WT AID clone 5	CC0701	forward pSB1C3	WT AID clone 5	CC0713	reverse pSB1C3
WT AID clone 6	CC0702	forward pSB1C3	WT AID clone 6	CC0714	reverse pSB1C3
PCR1 C1 (modified AID- Kozak sequence+NLS+AID without NES+Age1-restriction site in pSB1C3)	CC0703	forward pSB1C3	PCR1 C1	CC0715	reverse pSB1C3
PCR1 C2	CC0704	forward pSB1C3	PCR1 C2	CC0716	reverse pSB1C3
PCR1 C3	CC0705	forward pSB1C3	PCR1 C3	CC0717	reverse pSB1C3
PCR2 C1	CC0706	forward pSB1C3	PCR2 C1	CC0718	reverse pSB1C3
PCR2 C2	CC0707	forward pSB1C3	PCR2 C2	CC0719	reverse pSB1C3
PCR2 C3	CC0708	forward pSB1C3	PCR2 C3	CC0720	reverse pSB1C3

Further tasks:

alignment

Antikörper

2012-07-06

Sequencing of pcDNA5-FRT and pOG44 by GATC

Investigators: Sascha

Aim: Sequencing of invitrogen vectors pcDNA5-FRT and pOG44

Materials:

Geneious

Lablife Sequences of pcDNA5-FRT and pOG44

GATC

Method: forward sequencing using GATC-CMV-forward-primer

pcdna5frt_cmv_forward-CMV-F

pog44_cmv_forward-CMV-F

Further tasks: checking sequences

Primer-design for assembly-PCR, generating geneconstruct: scFv-TEV-TMD-EYFP

Investigators: Sascha

Aim: Design of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP

Materials:

Lablife Sequences of pcDNA5-FRT and pOG44

Databases

Oligocalc

Wordpad

Method:

P1_Signalp_N-term

P2_Signalp_C-term

P3_TMD-N-term

P4_TMD-C-term/N-YFP

P5_YFP-N-term/TMD-C-term

P6_YFP-C-term

P7_Gesamtanfang

P8_Gesamtende

Further tasks:

checking primer with Geneious

adapt primer to NEB-Phusion-polymerase conditions

2012-07-07

Primer-design for assembly-PCR, generating geneconstruct: scFv-TEV-TMD-EYFP

Investigators: Sascha

Aim: Design of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP

Materials:

Lablife Sequences of pcDNA5-FRT and pOG44

Databases

Oligocalc

Wordpad

Method: forward sequencing using GATC-CMV-forward-primer

P1_Signalp_N-term

P2_Signalp_C-term

P3_TMD-N-term

P4_TMD-C-term/N-YFP

P5_YFP-N-term/TMD-C-term

P6_YFP-C-term

P7_Gesamtanfang

P8_Gesamtende

Further tasks:

checking primer with Geneious

adapt primer to NEB-Phusion-polymerase conditions

2012-07-10

Checking of Sequencing of GATC-results of pcDNA5-FRT and pOG44

Investigators: Sascha

Aim: Control of pcDNA5-FRT- and pOG44-sequences

Materials:

Geneious

Lablife Sequences of pcDNA5-FRT and pOG44

GATC-viewer

NCBI BLASTn

Results:

sequences are correct

2012-07-12

ordering of primer for assembly-PCR, generating geneconstruct: scFv-TEV-TMD-EYFP

Investigators: Sascha, Maria

Aim: ordering of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP

Materials:

Lablife Sequences of pcDNA5-FRT and pOG44

Databases

Oligocalc

Wordpad

Geneious

NEB-Calculator for high-fidelity Phusion-polymerase

Method: forward sequencing using GATC-CMV-forward-primer

P1_Signalp_N-term

P2_Signalp_C-term

P3_TMD-N-term

P4_TMD-C-term/N-YFP

P5_YFP-N-term/TMD-C-term

P6_YFP-C-term

P7_Gesamtanfang

P8_Gesamtende

Further tasks:

extension-assembly-pcr

2012-07-15

Retransformation with scFv, transmembrane domain and YFP

Investigators: Maria

Aim: Retransformation with scFv anti-EGFR, transmembrane domain BBa_KI157010, YFP BBa_E0030

Date/Time: 15th July 2012, 2:30 – 4:30 pm

Materials: competent E. coli cells XL1 Blue, Biobricks BBa_K157010 and BBa_E0030, scFv anti-EGFR, 42°/37° C shaker, centrifuge

Method: see transformation protocol

Results: colonies on Amp plates with scFv-, transmembrane domain- and YFP- plasmid

Further tasks: picking clones and overnight culture (16th July)

2012-07-16

Topic: Overnight culture of scFv, YFP and transmembrane domain carrying cells

Investigators: Maria

Time: 2012-07-16; 6:30 - 7 pm

Materials:

LB medium

Amp. 25 mg/ ml stock solution

Plasmids: scFv; BBa-KI57000 with transmembrane domain; pSB1AK3 with YFP

Method:

Inoculation of cell sample each in 5 ml LB medium with Amp

shaking over night at 37°C, 300 rpm, approx. 17 hours

Further tasks:

Miniprep

2012-07-17

Topic: Mini Prep of YFP and transmembrane domain

Investigators: Stefan, Tarek, Kerstin

Time: 2012-07-17; 2 - 3.30 pm

Materials:

overnight cultures from 2012-07-16

GeneJET Plasmid Miniprep Kit (Thermo Scientific)

Plasmids: BBa-KI57000 with transmembrane domain; pSB1AK3 with YFP

Method:

Miniprep according to Kit

Note:

overnight culture of retransformation of scFv did not grow --> Resistance was not known in scFv vector, screening was done with ampicillin

Further Tasks:

PCR to produce sp-scFv-tmd-yfp construct

2012-07-20

Topic: extension-assembly-pcr of scFv-TEV-TMD-EYFP geneconstruct

Investigators: Stefan, Sascha

Materials:

Materials:
scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP

P1_Signalp_N-term

P2_Signalp_C-term

P3_TMD-N-term

P4_TMD-C-term/N-YFP

P5_YFP-N-term/TMD-C-term

P6_YFP-C-term

P7_Gesamtanfang

P8_Gesamtende

Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer

Method:

50µl PCR mix of each plasmid= 10µl HF-Buffer; 1µl dNTPs(10mM); forward and reverse primer each 2,5µl (10µM); template DNA: 1µl of 200ng/µl scFv --> 200ng, 5µl of BBa_E0030 with EYFP (46,3ng/µl--> ca. 230ng),5µl of BBa-KI57000 with transmembrane domain (43,9ng/µl --> ca. 230ng); Phusion DNA polymerase 0,5µl; nclease-free water ad to 50µl

PCR-program: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 11´´ at 72°C; final-Elongation 10´at 72°C; 30 cycles

Further Tasks:

gelextraction

assembly-pcr

2012-07-26

Planning the antibody construct for genesynthesis

Investigators: Maria

Aim: construct with scFv 425bla, LoxP and TEV recognition site, E-YFP

Date/Time: 26th July 2012, 2 - 5 pm

Materials: Geneious

Results: antibody construct RCF25

Topic: extension-pcr of scFv-TEV-TMD-EYFP geneconstruct

Investigators: Sascha

Materials:
scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP

P1_Signalp_N-term

P2_Signalp_C-term

P3_TMD-N-term

P4_TMD-C-term/N-YFP

P5_YFP-N-term/TMD-C-term

P6_YFP-C-term

Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer

Method:

50µl PCR mix of each plasmid= 10µl HF-Buffer; 1µl dNTPs(10mM); forward and reverse primer each 2,5µl (10µM); template DNA: 1µl of 200ng/µl scFv--> 200ng, 5µl of BBa_E0030 with EYFP (46,3ng/µl--> ca. 230ng),5µl of BBa-KI57000 with transmembrane domain (43,9ng/µl --> ca. 230ng); Phusion DNA polymerase 0,5µl; nclease-free water ad to 50µl

PCR-program: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 11´´ at 72°C; final-Elongation 10´at 72°C; 30 cycles

Further Tasks:

gelelectrophoresis

Topic: gelelectrophoresis of extended genes after extension-pcr

Investigators: Sascha

Aim: separation of extended genes scFv-TEV, TEV-TMD, EYFP in 1% agarosegel

Materials:

agarose

1xTAE-buffer

10xFD Green Buffer

extended genes

Method:

1% agarosegel

70 min at 105V

Results:

Further Tasks:

gelextraction

Topic: gelextraction of extended genes after extension-pcr

Investigators: Sascha

Aim: gelextraction of extended genes(scFv-TEV, TEV-TMD, EYFP) out of 1% agarosegel

Method:

DNA extracted according to the manual

Results: concentration measuremnt using nanodrop

concentrations of extended scFv:

concentrations of extended TMD:

concentrations of extended EYFP:

Further Tasks:

assembly-pcr

Topic: assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct

Investigators: Sascha

Aim: assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct

Materials:
scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP

P7_Gesamtanfang (forward-primer)

P8_Gesamtende (reverse-primer)

Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer

Method:

first assembly-pcr-mix--> 150:50: 10µl HF-Buffer; 1µl dNTPs(10mM); 5µl of extended TMD (30ng/µl --> 150ng), 5µl of extended EYFP (10ng/µl --> 50ng), 2µl of extended scFv (25ng/µl --> 50ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase

second assembly-pcr-mix--> 90:30: 10µl HF-Buffer; 1µl dNTPs(10mM); 2,5µl of extended TMD (30ng/µl --> 90ng), 3µl of extended EYFP (10ng/µl --> 30ng), 1µl of extended scFv (25ng/µl --> 25ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase

PCR-program to let the extended genes prime each other: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 15 cycles

after annealing of extended genes to each other 2,5µl of primer forw_P7_Gesamtanfang and primer rev_P8_Gesamtende were added

PCR-prgram with end-primers: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 57°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 27 cycles

Gelelectrophoresis at 105V for 75`

Results:

extraction of wrong 1100bp DNA-bond

Further Tasks:

assembly-pcr

extraction of correct DNA (1701bp)

2012-07-28

Topic: assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct

Investigators: Sascha, Tarek

Aim: assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct

Materials:
scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP

P7_Gesamtanfang (forward-primer)

P8_Gesamtende (reverse-primer)

Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer

Method:

first assembly-pcr-mix--> 90:30: 10µl HF-Buffer; 1µl dNTPs(10mM); 2,5µl of extended TMD (30ng/µl --> 90ng), 3µl of extended EYFP (10ng/µl --> 30ng), 1µl of extended scFv (25ng/µl --> 25ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase

second assembly-pcr-mix--> 140:20: 10µl HF-Buffer; 1µl dNTPs(10mM); 1µl of extended TMD (140ng/µl --> 140ng), 12,5µl of extended EYFP (1,6ng/µl --> 20ng), 4,8µl of extended scFv (4,2ng/µl --> ca. 20ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase

PCR-program to let the extended genes prime each other: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 15 cycles

after annealing of extended genes to each other 2,5µl of primer forw_P7_Gesamtanfang and primer rev_P8_Gesamtende were added

PCR-prgram with end-primers: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 57°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 27 cycles

Gelelectrophoresis at 105V for 85`

Results:

extraction of correct DNA (1701bp)

Further Tasks:

digestion of pcDNA5-FRT and geneconstruct scFv-TEV-TMD-EYFP

ligation of plasmid and insert

2012-07-31

Planning and reviewing the antibody construct for genesynthesis

Investigators: Maria

Aim: construct with scFv 425bla, LoxP and TEV recognition site, mVenus

Date/Time: 27th July 2012, 3 - 5 pm

Materials: Geneious

Results: antibody construct RCF25

2012-07-31

Construct for genesynthesis with human scFv 425-72000

Investigators: Maria

Aim: construct with human scFv 425-72000, LoxP and TEV recognition site, mVenus

Date/Time: 27th July 2012, 3 - 5 pm

Materials: Geneious

Results: antibody construct RCF25

Virus

02.07.2012

Topic: PCR

Investigators: Xenia and Kathi

Aim:

to test the primer

amplification of the cap and VP-region, insertion of kozak-, Sortasemotive-, mycTag- and restiction sites Sequence

Materials:

new primer combination (prr_VP2_pstI_Temp68 and prf_XbaI_kozak_So rtlN_myc_VP2 [c= 10 µM])

Method:

polymerase chain reaction

Mastermix

reagenz	volumen [µL]
HE buffer	5
dNTPs (NEB)	1.25
Primer (prr_VP2_pstI_Temp68)	1.0
Primer (prf_XbaI_kozak_So rtlN_myc_VP2)	1.0
DNA (Plasmid)	1.0
Phusion polymerase	1.0
water	33.75

program

step	temperature [°C]	duration [s]	cycles
denaturation	95	120	1
denaturation	95	30	30
annealing	68	60	30
elongation	72	60	30
final elongation	72	60	1
cooling	4	∞	1

Results:

Further tasks:

agarose gel electrophoresis

04.07.2012

Topic: gel electrophoresis

Investigator: Laura

Aim:

measurement of DNA-concentration of pcr product and DARPin+cmv plasmid

test pcr product and DRAPin+cmv plasmid

Materials:

pcr product (02.07.) and DARPin+cmv Plasmid (Sven)

Method:

agarose gel electrophoresis

nanodrop

Results:

DNA-concentrations:

- pcr-prduct: 266.1 ng/µL

- plasmid: 441.4 ng/µL

gel electrophoresis

- pcr product present but concentration too high --> next time better: serial dilution of pcr product!

IMPORTANT!: Our primer is wrong! we have put the C-terminal sortase-motiv into our primer, but we just need the N-terminal sortase-tag (glycin-rests)

further tasks:

design new primer

04.07.2012

Topic: Primer design - Cloning: Change the C-terminal Sortase-Tag against the N-terminal

Investigators:Tobias and Xenia

Aim:

Change the C-terminal sortase-tag against the N-terminal

Materials:

prf_XbaI_kozak_SortaseMotivN_myc_VP2

Method: Geneious

Results:

prf_Xba1 koz_GGGGG_VP2 (forward primer)

prf_XbaI_koz_GGGGG_myc_VP2 (forward primer)

the sortase-tag was changed in both primers and prf_Xba1 koz_GGGGG_VP2 contain no myc-tag

Further tasks:

PCR

11.07.2012

Topic: PCR - Cloning: PCR using the new forward primers

Investigators: Kathi and Laura

Aim:

PCR using the both new forward primer (prf_Xba1 koz_GGGGG_VP2 and prf_XbaI_koz_GGGGG_myc_VP2)

gel electrophoresis

Materials:

prf_Xba1 koz_GGGGG_VP2 (FP 1)--> myc-

prf_XbaI_koz_GGGGG_myc_VP2(FP2)--> myc+

prr_VP2_pstI_Temp68 (RP)

Method:

PCR (PCR protocol: 02.07.2012)

gel electropohoresis: : 2.1 and 0.5 µL pcr product of primer pair myc+ and myc- loaded on gel

Results:

gel electrophoresis: pcr product at 2000 bp present, primer dimer obvious

Further tasks:

ligation

12.07.2012

Topic: PCR

Investigators: Xenia and Laura

Aim:

test the primer using different annealing temperatures to get the right sequence of 2000 bp

Materials:

primer combination:

prr_VP2_pstI_Temp68 and prf_XbaI_koz_GGGGG_VP2 (FP1)-> myc-

prr_VP2_pstI_Temp68 (RP) and prf_XbaI_koz_GGGGG_myc_VP2(FP2)--> myc+

Method:

polymerase chain reaction

Mastermix

reagenz	volumen [µL]
HF buffer	5
dNTPs (NEB)	1.25
Primer (prr_VP2_pstI_Temp68)	1.0
Primer (prf_XbaI_kozak_So rtlN_myc_VP2)	1.0
DNA (Plasmid)	1.0
Phusion Polymerase	1.0
water	33.75

Program

step	Temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	10	30
annealing	64; 68; 70; 72	40	30
elongation	72	40	30
final elongation	72	300	1
cooling	4	∞	1

Results:

Further tasks:

agarose gel electrophoresis

13.07.2012

Topic: gel electrophoresis of the pcr product

Investigators:Xenia and Mario

Aim:gel electrophoresis of the pcr product (12.07.2012)

material and method:

gel electrophoresis

samples:

- 4 µL dest. Wasser + 1 µL pcr sample + 1 µL loading dye

Results:

The fragment should have the size of 2000 bp, but the band is by 3000 bp

Further Tasks:

test digestion

2012-17-07

Topic: test digestion

Investigators: Tobias

Materials:

pcr products of 02-07 and 12-07-2012 (Ta= 70°C)

restriction enzymes (FastDigest XbaI, PstI)

Method:

digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL green-buffer + 17 µL water

Results:

caused on the gel qualtity: repetition of the digestion

Further Tasks:

Digestion

2012-18-07

Topic: preperative digestion an gel extraction of pcr fragments

Investigators: Tobias and Laura

Materials:

pcr-products of 02-07-2012 and 12-07-2012 (Ta= 64 °C and 68 °C)

restriction enzymes (FastDigest (FD) XbaI, PstI)

Method:

digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL FD green-buffer + 17 µL water

Results:

2012-27-07

Topic: digestion of pcr fragments and plasmid

Investigators: Tobias

Materials:

pcr-products of 12-07-2012

plasmid (P10_pSB1C3_001_CMV_DARPin_ML_VP2/3_587KO_6xHis)

restriction enzymes (FastDigest (FD) XbaI, PstI, SpeI)

Method:

digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL FD green-buffer + 17 µL water

Results:

2012-01-08

Topic: Sequencing of pcr-pruducts

Investigator: Tobias

Materials:

PCR-products of 12-07-2012 (+myc and-myc)

Primer: prr_VP2_pstI_Temp68

Method:

GATC

@@ Line 1: / Line 1: @@
 {{:Team:Potsdam_Bioware/header}}
-<html>
-<div class="box_round gradient_grey">
+<div class="box_round white_bg">
-<h2><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=1" title="Edit section: AID">edit</a>]</span> <span class="mw-headline" id="AID">AID</span></h2>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=2" title="Edit section: 2012-07-02">edit</a>]</span> <span class="mw-headline" id="2012-07-02"><p style="background-color: rgb(240, 20, 70);">2012-07-02</p></span></h3>
+[[UP12_Labjournal|back to UP12_Lab journal]]
+==AID==
+===<p style="background-color: rgb(240, 20, 70);">2012-07-02</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Overnight culture of CMV and polyA carrying cells</p>
-<p><b>Investigators:</b> Mario, Tom S. <br />
-</p><p><br />
+<b>Investigators:</b> Mario, Tom S. <br>
-</p><p><b>Time:</b> 2012-07-02<br />
-</p><p><br />
+<br>
-</p><p><b>AIM:</b> Preparation of wild type AID<br />
-</p><p><br />
+<b>Time:</b> 2012-07-02<br>
-</p><p><b>Materials:</b><br />
-</p>
+<br>
-<ul><li> LB medium <br />
-</li></ul>
+<b>AIM:</b> Preparation of wild type AID<br>
-<ul><li> Chloramphenicol 25 mg/mL stock solution in 70&nbsp;% EtOH<br />
-</li></ul>
+<br>
-<ul><li> Plasmids: pSB1C3 with CMV; pSB1C3 with Poly-A
-</li></ul>
+<b>Materials:</b><br>
-<p><br />
-</p><p><b>Method:</b><br />
+* LB medium <br>
-</p><p>Inoculation of cell sample each in 5 ml LB medium <br />
-</p><p>shaking over night at 37 °C, 300 rpm, approx. 16 hours <br />
+* Chloramphenicol 25 mg/mL stock solution in 70 % EtOH<br>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+* Plasmids: pSB1C3 with CMV; pSB1C3 with Poly-A
-</p>
-<ul><li> Miniprep <br />
+<br>
-</li></ul>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=3" title="Edit section: 2012-07-03">edit</a>]</span> <span class="mw-headline" id="2012-07-03"><p style="background-color: rgb(240, 20, 70);">2012-07-03</p></span></h3>
+<b>Method:</b><br>
+Inoculation of cell sample each in 5 ml LB medium <br>
+shaking over night at 37 °C, 300 rpm, approx. 16 hours <br>
+<br>
+<b>Further tasks:</b><br>
+* Miniprep <br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-03</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Glycerolstocks, Miniprep and preparative digestion</p>
-<p><b>Investigators:</b> Basia, Tom S., Chris, Mario <br />
-</p><p><br />
+<b>Investigators:</b> Basia, Tom S., Chris, Mario <br>
-</p><p><b>Time:</b> 2012-07-03<br />
-</p><p><br />
+<br>
-</p><p><b>Aim:</b> Preparation of wildtype AID<br />
-</p><p><br />
+<b>Time:</b> 2012-07-03<br>
-</p><p><b>Materials:</b><br />
-</p>
+<br>
-<ul><li> Glycerol <br />
-</li></ul>
+<b>Aim:</b> Preparation of wildtype AID<br>
-<ul><li> Miniprep Kit<br />
-</li></ul>
+<br>
-<ul><li> overnight culture (pSB1C3 with CMV); overnight culture (pSB1C3 with Poly-A)
-</li></ul>
+<b>Materials:</b><br>
-<ul><li> CMV: Restriction enzymes (SpeI, PstI); NEB buffer 2
-</li></ul>
+* Glycerol <br>
-<ul><li> Poly-A: Restriction enzymes (Poly A: PstI, XbaI); NEB buffer 3
-</li></ul>
+* Miniprep Kit<br>
-<p><br />
-</p><p><b>Method:</b><br />
+* overnight culture (pSB1C3 with CMV); overnight culture (pSB1C3 with Poly-A)
-</p><p>Glycerol stock: 500 µL Glycerol 99,8&nbsp;% + 500 µL overnight cultures --&gt; put in -80 °C freezer
-</p><p><br />
+* CMV: Restriction enzymes (SpeI, PstI); NEB buffer 2
-</p><p>Miniprep (both over night culture (pSB1C3 with CMV) and over night culture (pSB1C3 with Poly-A)
-</p><p><br />
+* Poly-A: Restriction enzymes (Poly A: PstI, XbaI); NEB buffer 3
-</p><p>preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL NEB (2 or 3) buffer
-</p><p><br />
+<br>
-</p><p><br />
-</p><p><b>Results:</b><br />
+<b>Method:</b><br>
-</p><p>DNA - concentrations via nanodrop:<br />
-</p><p>pcDNA5 (AG) = 642,9 ng/µL <br />
+Glycerol stock: 500 µL Glycerol 99,8 % + 500 µL overnight cultures --> put in -80 °C freezer
-</p><p>pcDNA5 (good) = 729,1 ng/µL <br />
-</p><p>pcDNA5 (bad) = 705,4 ng/µL <br />
+<br>
-</p><p>pSB1C3 with CMV = 311,9 ng/µL <br />
-</p><p>pSB1C3 with Poly-A = 360,3 ng/µL <br />
+Miniprep (both over night culture (pSB1C3 with CMV) and over night culture (pSB1C3 with Poly-A)
-</p>
+<br>
+preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL NEB (2 or 3) buffer
+<br>
+<br>
+<b>Results:</b><br>
+DNA - concentrations via nanodrop:<br>
+pcDNA5 (AG) = 642,9 ng/µL <br>
+pcDNA5 (good) = 729,1 ng/µL <br>
+pcDNA5 (bad) = 705,4 ng/µL <br>
+pSB1C3 with CMV = 311,9 ng/µL <br>
+pSB1C3 with Poly-A = 360,3 ng/µL <br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Separation of cut DNA fragments via gel electrophoresis</p>
-<p><b>Investigators:</b> Chris, Mario <br />
-</p><p><br />
+<b>Investigators:</b> Chris, Mario <br>
-</p><p><b>Time:</b> 2012-07-03<br />
-</p><p><br />
+<br>
-</p><p><b>Aim</b> Separation of cut DNA fragments via gel electrophoresis<br />
-</p><p><b>Materials:</b><br />
+<b>Time:</b> 2012-07-03<br>
-</p><p>gel electrophoresis material<br />
-</p><p>cut samples:
+<br>
-</p>
-<ul><li> CMV: Restriction enzymes (SpeI, PstI); NEB buffer 2
+<b>Aim</b> Separation of cut DNA fragments via gel electrophoresis<br>
-</li></ul>
-<ul><li> Poly-A: Restriction enzymes (PstI, XbaI); NEB buffer 3
+<b>Materials:</b><br>
-</li></ul>
-<p><br />
+gel electrophoresis material<br>
-</p><p><b>Method:</b><br />
-</p><p>samples:<br />
+cut samples:
-</p><p>- 30 µL CMV cut with SpeI and PstI + 7,5 µL loading dye<br />
-</p><p>- 30 µL polyA + 7,5 µL loading dye<br />
+* CMV: Restriction enzymes (SpeI, PstI); NEB buffer 2
-</p><p><br />
-</p><p>gel electrophoresis conditions:<br />
+* Poly-A: Restriction enzymes (PstI, XbaI); NEB buffer 3
-</p><p>30 µL of each sample into one big slot<br />
-</p><p>V = 120 V<br />
+<br>
-</p><p>duration roughly 50 minutes<br />
-</p><p><br />
+<b>Method:</b><br>
-</p><p><b>Results:</b><br />
-</p><p><a href="https://static.igem.org/mediawiki/2012/f/f5/UP12_digest_2012-07-03.jpg" class="image"><img alt="UP12 digest 2012-07-03.jpg" src="https://static.igem.org/mediawiki/2012/f/f5/UP12_digest_2012-07-03.jpg" width="300" height="284" /></a><a href="https://static.igem.org/mediawiki/2012/9/96/UP12_ladder.jpg" class="image"><img alt="UP12 ladder.jpg" src="https://static.igem.org/mediawiki/2012/9/96/UP12_ladder.jpg" width="150" height="294" /></a><br />
+samples:<br>
-</p><p><br />
-</p><p>Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tubes<br />
+- 30 µL CMV cut with SpeI and PstI + 7,5 µL loading dye<br>
-</p><p><br />
-</p><p><b>Further Tasks:</b><br />
+- 30 µL polyA + 7,5 µL loading dye<br>
-</p><p>Gel Extraction
-</p>
+<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=4" title="Edit section: 2012-07-04">edit</a>]</span> <span class="mw-headline" id="2012-07-04"><p style="background-color: rgb(240, 20, 70);"> 2012-07-04</p></span></h3>
+gel electrophoresis conditions:<br>
+µL of each sample into one big slot<br>
+V = 120 V<br>
+duration roughly 50 minutes<br>
+<br>
+<b>Results:</b><br>
+[[file:UP12_digest_2012-07-03.jpg|300px]][[file:UP12_ladder.jpg|150px]]<br>
+<br>
+Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tubes<br>
+<br>
+<b>Further Tasks:</b><br>
+Gel Extraction
+===<p style="background-color: rgb(240, 20, 70);"> 2012-07-04</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Gel Extraction of CMV and polyA</p>
-<p><b>Investigators:</b>
-</p><p>Mario, Tom S. <br />
+<b>Investigators:</b>
-</p><p><br />
-</p><p><b>Aim:</b>
+Mario, Tom S. <br>
-</p><p>Gel Extraction of CMV and polyA
-</p><p><br /><br />
+<br>
-</p><p><b>Materials:</b>
-</p><p>centrifuge, Nucleo Spin and PCR clean up - Kit, thermo block, nanodrop
+<b>Aim:</b>
-</p><p><br />
-</p><p>Molecular weight calculator online resource: <a href="http://www.encorbio.com/protocols/Nuc-MW.htm" class="external free" rel="nofollow">http://www.encorbio.com/protocols/Nuc-MW.htm</a><br />
+Gel Extraction of CMV and polyA
-</p><p>multiplicate with factor 2 when DNA is double stranded<br />
-</p><p><b>Method:</b>
+<br><br>
-</p><p>extract DNA: according to the manual
-</p><p><br /><br />
+<b>Materials:</b>
-</p><p><b>Results:</b><br />
-</p><p>DNA-concentrations via nanodrop:<br />
+centrifuge, Nucleo Spin and PCR clean up - Kit, thermo block, nanodrop
-</p><p>CMV = 106,8 ng/µL -&gt; 63,7 nM (with mass conc. of 1676525,6 Da)<br />
-</p><p>polyA = 15,1 ng/µL -&gt; 48,5 nM (with mass conc. of 311550 Da)<br />
+<br>
-</p><p>location: -20 °C freezer, topmost drawer
-</p><p><br />
+Molecular weight calculator online resource: http://www.encorbio.com/protocols/Nuc-MW.htm<br>
-</p><p>ready DNA for Ligation
-</p><p><br />
+multiplicate with factor 2 when DNA is double stranded<br>
-</p><p><b>Further tasks:</b><br />
-</p><p>ligation of fragments
+<b>Method:</b>
-</p>
+extract DNA: according to the manual
+<br><br>
+<b>Results:</b><br>
+DNA-concentrations via nanodrop:<br>
+CMV = 106,8 ng/µL -> 63,7 nM (with mass conc. of 1676525,6 Da)<br>
+polyA = 15,1 ng/µL -> 48,5 nM (with mass conc. of 311550 Da)<br>
+location: -20 °C freezer, topmost drawer
+<br>
+ready DNA for Ligation
+<br>
+<b>Further tasks:</b><br>
+ligation of fragments
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Overnight culture of AID carrying cells</p>
-<p><b>Investigators:</b> Sascha <br />
-</p><p><br />
+<b>Investigators:</b> Sascha <br>
-</p><p><b>Time:</b> 2012-07-04<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p><p>LB medium <br />
+<b>Time:</b> 2012-07-04<br>
-</p><p>ampicillin 100 mg/ ml stock solution<br />
-</p><p>glycerol stocks <i>E. coli</i> XL1 blue with plasmids: pSB1C3 with AID
+<br>
-</p><p><br />
-</p><p><b>Method:</b><br />
+<b>Materials:</b><br>
-</p><p>Inoculation of cell sample in 5 ml LB medium <br />
-</p><p>shaking overnight at 37°C, 300 rpm, approx. 16 hours <br />
+LB medium <br>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+ampicillin 100 mg/ ml stock solution<br>
-</p><p>Miniprep <br />
-</p>
+glycerol stocks <i>E. coli</i> XL1 blue with plasmids: pSB1C3 with AID
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=5" title="Edit section: 2012-07-05">edit</a>]</span> <span class="mw-headline" id="2012-07-05"><p style="background-color: rgb(240, 20, 70);">2012-07-05</p></span></h3>
+<br>
+<b>Method:</b><br>
+Inoculation of cell sample in 5 ml LB medium <br>
+shaking overnight at 37°C, 300 rpm, approx. 16 hours <br>
+<br>
+<b>Further tasks:</b><br>
+Miniprep <br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-05</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Miniprep and preparative digestion</p>
-<p><b>Investigators:</b> Chris <br />
-</p><p><br />
+<b>Investigators:</b> Chris <br>
-</p><p><b>Time:</b> 2012-07-05<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p><p>Miniprep Kit<br />
+<b>Time:</b> 2012-07-05<br>
-</p><p>over night culture (pSB1A3 with AID)
-</p><p>AID: Restriction enzymes (XbaI, PstI); NEB buffer 3
+<br>
-</p><p><br />
-</p><p><b>Method:</b><br />
+<b>Materials:</b><br>
-</p><p>Miniprep according to the manual
-</p><p><br />
+Miniprep Kit<br>
-</p><p>preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL NEB 3 buffer
-</p><p><br />
+over night culture (pSB1A3 with AID)
-</p><p><br />
-</p><p><b>Results:</b><br />
+AID: Restriction enzymes (XbaI, PstI); NEB buffer 3
-</p><p>DNA - concentrations via nanodrop:<br />
-</p><p>pSB1A3 with AID = 85,5 ng/µL <br />
+<br>
-</p>
+<b>Method:</b><br>
+Miniprep according to the manual
+<br>
+preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL NEB 3 buffer
+<br>
+<br>
+<b>Results:</b><br>
+DNA - concentrations via nanodrop:<br>
+pSB1A3 with AID = 85,5 ng/µL <br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Separation of cut DNA fragments via gel electrophoresis</p>
-<p><b>Investigators:</b> Mario, Tom S. <br />
-</p><p><br />
+<b>Investigators:</b> Mario, Tom S. <br>
-</p><p><b>Time:</b> 2012-07-05<br />
-</p><p><br />
+<br>
-</p><p><b>Aim</b> Separation of cut DNA fragments via gel electrophoresis<br />
-</p><p><b>Materials:</b><br />
+<b>Time:</b> 2012-07-05<br>
-</p><p>gel electrophoresis material<br />
-</p><p>cut samples:<br />
+<br>
-</p><p>AID: Restriction enzymes (XbaI, PstI); NEB buffer 3
-</p><p><br />
+<b>Aim</b> Separation of cut DNA fragments via gel electrophoresis<br>
-</p><p><b>Method:</b><br />
-</p><p>samples:<br />
+<b>Materials:</b><br>
-</p><p>- 30 µL AID cut with XbaI and PstI + 7,5 µL loading dye<br />
-</p><p><br />
+gel electrophoresis material<br>
-</p><p>gel electrophoresis conditions:<br />
-</p><p>30 µL of each samples into one big slot converted<br />
+cut samples:<br>
-</p><p>V = 120 V<br />
-</p><p>duration roughly 65 minutes<br />
+AID: Restriction enzymes (XbaI, PstI); NEB buffer 3
-</p><p><br />
-</p><p><b>Results:</b><br />
+<br>
-</p><p><a href="https://static.igem.org/mediawiki/2012/b/ba/UP12_digest_2012-07-05.jpg" class="image"><img alt="UP12 digest 2012-07-05.jpg" src="https://static.igem.org/mediawiki/2012/b/ba/UP12_digest_2012-07-05.jpg" width="300" height="393" /></a><br />
-</p><p><br />
+<b>Method:</b><br>
-</p><p>Marked fragment was cut out of the gel and transferred into 1,5 mL Eppendorf tube<br />
-</p><p><br />
+samples:<br>
-</p><p><b>Further Tasks:</b><br />
-</p><p>Gel extraction
+- 30 µL AID cut with XbaI and PstI + 7,5 µL loading dye<br>
-</p>
+<br>
+gel electrophoresis conditions:<br>
+µL of each samples into one big slot converted<br>
+V = 120 V<br>
+duration roughly 65 minutes<br>
+<br>
+<b>Results:</b><br>
+[[file:UP12_digest_2012-07-05.jpg|300px]]<br>
+<br>
+Marked fragment was cut out of the gel and transferred into 1,5 mL Eppendorf tube<br>
+<br>
+<b>Further Tasks:</b><br>
+Gel extraction
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Gel extraction of AID</p>
-<p><b>Investigators:</b>
-</p><p>Mario, Tom S. <br />
+<b>Investigators:</b>
-</p><p><br />
-</p><p><b>Aim:</b>
+Mario, Tom S. <br>
-</p><p>Gel extraction of AID
-</p><p><br /><br />
+<br>
-</p><p><b>Materials:</b>
-</p><p>centrifuge, Nucleo Spin and PCR clean up - Kit, thermo heater, nanodrop
+<b>Aim:</b>
-</p><p><br /><br />
-</p><p><b>Method:</b>
+Gel extraction of AID
-</p><p>Gel extraction according to the manual
-</p><p><br /><br />
+<br><br>
-</p><p><b>Results:</b><br />
-</p><p>DNA-concentrations via nanodrop:<br />
+<b>Materials:</b>
-</p><p>AID = 9,2 ng/µL -&gt; 23,8 nM (with mass conc. of 386864,4 Da)<br />
-</p><p>location: -20 °C freezer, topmost drawer
+centrifuge, Nucleo Spin and PCR clean up - Kit, thermo heater, nanodrop
-</p><p><br />
-</p><p>ready DNA for Ligation
+<br><br>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+<b>Method:</b>
-</p><p>ligation of fragments
-</p>
+Gel extraction according to the manual
+<br><br>
+<b>Results:</b><br>
+DNA-concentrations via nanodrop:<br>
+AID = 9,2 ng/µL -> 23,8 nM (with mass conc. of 386864,4 Da)<br>
+location: -20 °C freezer, topmost drawer
+<br>
+ready DNA for Ligation
+<br>
+<b>Further tasks:</b><br>
+ligation of fragments
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Ligation of CMV (Insert + backbone) and AID (insert)</p>
-<p><b>Investigators:</b>
-</p><p>Mario, Tom S. <br />
+<b>Investigators:</b>
-</p><p><br />
-</p><p><b>Aim:</b>
+Mario, Tom S. <br>
-</p><p>Ligation of CMV (Insert + backbone) and AID (insert)
-</p><p><br /><br />
+<br>
-</p><p><b>Materials:</b>
-</p><p>T4 DNA-Ligase, samples(CMV + AID)
+<b>Aim:</b>
-</p><p><br /><br />
-</p><p><b>Method:</b>
+Ligation of CMV (Insert + backbone) and AID (insert)
-</p><p>DNA Fragment ligation: according to the manual<br />
-</p><p>sample preparation:
+<br><br>
-</p>
-<ul><li> 1 µL (CMV Fragment) c=106,8 ng/µL(63,9 nM) -&gt; 6,4 nmol
+<b>Materials:</b>
-</li></ul>
-<ul><li> 6 µL (AID Fragment) c=9,2 ng/µL(23,8 nM) -&gt; 14,3 nmol
+T4 DNA-Ligase, samples(CMV + AID)
-</li></ul>
-<ul><li> 1 µL (T4 DNA-Ligase)
+<br><br>
-</li></ul>
-<ul><li> 2 µL (DNase free water)
+<b>Method:</b>
-</li></ul>
-<p><br />
+DNA Fragment ligation: according to the manual<br>
-</p><p>incubation of sample 1,5 h at 22 °C<br /> <br />
-</p><p><b>Results:</b><br />
+sample preparation:
-</p><p>location: -20 °C freezer, topmost drawer
-</p><p><br />
+* 1 µL (CMV Fragment) c=106,8 ng/µL(63,9 nM) -> 6,4 nmol
-</p><p>ready DNA Transformation
-</p><p><br />
+* 6 µL (AID Fragment) c=9,2 ng/µL(23,8 nM) -> 14,3 nmol
-</p><p><b>Further tasks:</b><br />
-</p><p>Transformation
+* 1 µL (T4 DNA-Ligase)
-</p>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=6" title="Edit section: 2012-07-06">edit</a>]</span> <span class="mw-headline" id="2012-07-06"><p style="background-color: rgb(240, 20, 70);">2012-07-06</p></span></h3>
+* 2 µL (DNase free water)
+<br>
+incubation of sample 1,5 h at 22 °C<br> <br>
+<b>Results:</b><br>
+location: -20 °C freezer, topmost drawer
+<br>
+ready DNA Transformation
+<br>
+<b>Further tasks:</b><br>
+Transformation
+===<p style="background-color: rgb(240, 20, 70);">2012-07-06</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Transformation of ligated sample</p>
-<p><b>Investigators:</b> Mario, Tom S. <br />
-</p><p><br />
+<b>Investigators:</b> Mario, Tom S. <br>
-</p><p><b>Time:</b> 2012-07-06<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-06<br>
-<ul><li> Bunsen burner, Agar Plate with Chloramphenicol, 37 °C heat block, centrifuge<br />
-</li></ul>
+<br>
-<ul><li> ligated sample (compare last step 07-05-2012)
-</li></ul>
+<b>Materials:</b><br>
-<ul><li> icebox
-</li></ul>
+* Bunsen burner, Agar Plate with Chloramphenicol, 37 °C heat block, centrifuge<br>
-<ul><li> competent <i>E. coli</i> cells (XL 1)
-</li></ul>
+* ligated sample (compare last step 07-05-2012)
-<p><br />
-</p><p><b>Method:</b><br />
+* icebox
-</p><p>Transformation via manual
-</p><p><br />
+* competent <i>E. coli</i> cells (XL 1)
-</p><p>Plate incubation start: 1:30 pm
-</p><p><br />
+<br>
-</p><p><br />
-</p><p><b>Results:</b><br />
+<b>Method:</b><br>
-</p><p>grown colonies
-</p><p><br />
+Transformation via manual
-</p><p><b>Further tasks:</b><br />
-</p><p>picking clones
+<br>
-</p>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=7" title="Edit section: 2012-07-07">edit</a>]</span> <span class="mw-headline" id="2012-07-07"><p style="background-color: rgb(240, 20, 70);">2012-07-07</p></span></h3>
+Plate incubation start: 1:30 pm
+<br>
+<br>
+<b>Results:</b><br>
+grown colonies
+<br>
+<b>Further tasks:</b><br>
+picking clones
+===<p style="background-color: rgb(240, 20, 70);">2012-07-07</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Overnight culture of pSB1C3+CMV+AID carrying cells</p>
-<p><b>Investigators:</b> Chris<br />
-</p><p><br />
+<b>Investigators:</b> Chris<br>
-</p><p><b>Time:</b> 2012-07-07 6pm <br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b>
-</p><p>LB medium, chloramphenicol 25 mg/ ml stock solution, plates with <i>E. coli</i> XL1 blue with plasmids: pSB1C3+CMV+AID <br />
+<b>Time:</b> 2012-07-07 6pm <br>
-</p><p><br />
-</p><p><b>Method:</b> picking clones (2 per plate-&gt;Nr.1-6) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours<br />
+<br>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+<b>Materials:</b>
-</p><p>glycerolstocks &amp; Miniprep
-</p>
+LB medium, chloramphenicol 25 mg/ ml stock solution, plates with <i>E. coli</i> XL1 blue with plasmids: pSB1C3+CMV+AID <br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=8" title="Edit section: 2012-07-08">edit</a>]</span> <span class="mw-headline" id="2012-07-08"><p style="background-color: rgb(240, 20, 70);">2012-07-08</p></span></h3>
+<br>
+<b>Method:</b> picking clones (2 per plate->Nr.1-6) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours<br>
+<br>
+<b>Further tasks:</b><br>
+glycerolstocks & Miniprep
+===<p style="background-color: rgb(240, 20, 70);">2012-07-08</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Glycerol stocks, Miniprep</p>
-<p><b>Investigators:</b> Basia<br />
-</p><p><br />
+<b>Investigators:</b> Basia<br>
-</p><p><b>Time:</b> 2012-07-08 11:00am<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p><p>Glycerol <br />
+<b>Time:</b> 2012-07-08 11:00am<br>
-</p><p>Miniprep Kit<br />
-</p><p>6x overnight culture (pSB1C3 with CMV+AID);
+<br>
-</p><p><br />
-</p><p><b>Method:</b><br />
+<b>Materials:</b><br>
-</p><p>Glycerol stock: 500 µL Glycerol 99,8&nbsp;% + 500 µL overnight cultures --&gt; put in -80 °C freezer
-</p><p><br />
+Glycerol <br>
-</p><p>Miniprep (all 6 over night cultures (pSB1C3 with CMV+AID)
-</p><p><br />
+Miniprep Kit<br>
-</p><p><br />
-</p><p><b>Results:</b><br />
+x overnight culture (pSB1C3 with CMV+AID);
-</p><p>6 Cryostocks are stored in the igem box in the -80°C freezer and Plasmids are stored in -20°C in the 4th drawer on styrofoam rack
-</p>
+<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=9" title="Edit section: 2012-07-09">edit</a>]</span> <span class="mw-headline" id="2012-07-09"><p style="background-color: rgb(240, 20, 70);">2012-07-09</p></span></h3>
+<b>Method:</b><br>
+Glycerol stock: 500 µL Glycerol 99,8 % + 500 µL overnight cultures --> put in -80 °C freezer
+<br>
+Miniprep (all 6 over night cultures (pSB1C3 with CMV+AID)
+<br>
+<br>
+<b>Results:</b><br>
+Cryostocks are stored in the igem box in the -80°C freezer and Plasmids are stored in -20°C in the 4th drawer on styrofoam rack
+===<p style="background-color: rgb(240, 20, 70);">2012-07-09</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Measuring DNA-concentration of plasmids from 2012-07-08</p>
-<p><b>Investigators:</b> Mario, Tom S. <br />
-</p><p><br />
+<b>Investigators:</b> Mario, Tom S. <br>
-</p><p><b>Time:</b> 2012-07-09<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-09<br>
-<ul><li> Plasmids: pSB1C3 with CMV+AID (samples: 1, 2, 3, 4, 5, 6)<br />
-</li></ul>
+<br>
-<ul><li> Nanodrop<br />
-</li></ul>
+<b>Materials:</b><br>
-<ul><li> NE-buffer<br />
-</li></ul>
+* Plasmids: pSB1C3 with CMV+AID (samples: 1, 2, 3, 4, 5, 6)<br>
-<p><b>Method:</b><br />
-</p><p>2 µL of each DNA-sample onto nanodrop (Ne-buffer blank) <br />
+* Nanodrop<br>
-</p><p><br />
-</p><p><b>Results:</b><br />
+* NE-buffer<br>
-</p><p>DNA-concentrations:<br />
-</p><p>1 = 290 ng/µL<br />
+<b>Method:</b><br>
-</p><p>2 = 361,2 ng/µL<br />
-</p><p>3 = 316,8 ng/µL<br />
+µL of each DNA-sample onto nanodrop (Ne-buffer blank) <br>
-</p><p>4 = 360,5 ng/µL<br />
-</p><p>5 = 392,5 ng/µL<br />
+<br>
-</p><p>6 = 390 ng/µL<br />
-</p><p><br />
+<b>Results:</b><br>
-</p><p><b>Further tasks:</b><br />
-</p>
+DNA-concentrations:<br>
-<ul><li> restriction enzyme digestion with XbaI und PstI<br />
-</li></ul>
+= 290 ng/µL<br>
+= 361,2 ng/µL<br>
+= 316,8 ng/µL<br>
+= 360,5 ng/µL<br>
+= 392,5 ng/µL<br>
+= 390 ng/µL<br>
+<br>
+<b>Further tasks:</b><br>
+* restriction enzyme digestion with XbaI und PstI<br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: preparative digestion</p>
-<p><b>Investigators:</b> Mario, Tom S. <br />
-</p><p><br />
+<b>Investigators:</b> Mario, Tom S. <br>
-</p><p><b>Time:</b> 2012-07-09<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-09<br>
-<ul><li> Plasmids: pSB1C3 with CMV+AID (samples: 1, 2, 3, 4, 5, 6)<br />
-</li></ul>
+<br>
-<ul><li> Restriction enzymes (XbaI and PstI)<br />
-</li></ul>
+<b>Materials:</b><br>
-<ul><li> NE3-buffer<br />
-</li></ul>
+* Plasmids: pSB1C3 with CMV+AID (samples: 1, 2, 3, 4, 5, 6)<br>
-<p><b>Method:</b><br />
-</p><p>heat block (37 °C) <br />
+* Restriction enzymes (XbaI and PstI)<br>
-</p><p>sample preparation: each DNA 25 µL + 3 µL NE3-buffer + 1 µL XbaI + 1 µL PstI<br />
-</p><p>incubation of samples for 4 h at 37 °C<br />
+* NE3-buffer<br>
-</p><p><br />
-</p><p><b>Results:</b><br />
+<b>Method:</b><br>
-</p><p>none
-</p><p><br />
+heat block (37 °C) <br>
-</p><p><b>Further tasks:</b><br />
-</p>
+sample preparation: each DNA 25 µL + 3 µL NE3-buffer + 1 µL XbaI + 1 µL PstI<br>
-<ul><li> gel electrophoresis<br />
-</li></ul>
+incubation of samples for 4 h at 37 °C<br>
+<br>
+<b>Results:</b><br>
+none
+<br>
+<b>Further tasks:</b><br>
+* gel electrophoresis<br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Separation of cut DNA fragments via gel electrophoresis</p>
-<p><b>Investigators:</b> Mario, Tom S. <br />
-</p><p><br />
+<b>Investigators:</b> Mario, Tom S. <br>
-</p><p><b>Time:</b> 2012-07-09<br />
-</p><p><br />
+<br>
-</p><p><b>Aim</b> Separation of cut DNA fragments via gel electrophoresis<br />
-</p><p><b>Materials:</b><br />
+<b>Time:</b> 2012-07-09<br>
-</p><p>gel electrophoresis material<br />
-</p><p>cut samples:
+<br>
-</p><p>AID: Restriction enzymes (XbaI, PstI); NEB buffer 3
-</p><p>CMV: Restriction enzymes (XbaI, PstI); NEB buffer 3
+<b>Aim</b> Separation of cut DNA fragments via gel electrophoresis<br>
-</p><p>AID+CMV: Restriction enzymes (XbaI, PstI); NEB buffer 3
-</p><p><br />
+<b>Materials:</b><br>
-</p><p><b>Method:</b><br />
-</p><p>samples:<br />
+gel electrophoresis material<br>
-</p><p>- 10 µL AID cut with XbaI and PstI + 2,5 µL loading dye<br />
-</p><p><br />
+cut samples:
-</p><p>gel electrophoresis conditions:<br />
-</p><p>10 µL of each sample into one big well<br />
+AID: Restriction enzymes (XbaI, PstI); NEB buffer 3
-</p><p>V = 120 V<br />
-</p><p>duration roughly 95 minutes<br />
+CMV: Restriction enzymes (XbaI, PstI); NEB buffer 3
-</p><p><br />
-</p><p><b>Results:</b><br />
+AID+CMV: Restriction enzymes (XbaI, PstI); NEB buffer 3
-</p><p><a href="https://static.igem.org/mediawiki/2012/8/88/UP12_digest_2012-07-09.jpg" class="image"><img alt="UP12 digest 2012-07-09.jpg" src="https://static.igem.org/mediawiki/2012/8/88/UP12_digest_2012-07-09.jpg" width="500" height="193" /></a><br />
-</p><p><br />
+<br>
-</p><p><br />
-</p><p><b>Further Tasks:</b><br />
+<b>Method:</b><br>
-</p><p>overnight culture with AID+CMV sample 1, 2 and 3
-</p>
+samples:<br>
+- 10 µL AID cut with XbaI and PstI + 2,5 µL loading dye<br>
+<br>
+gel electrophoresis conditions:<br>
+µL of each sample into one big well<br>
+V = 120 V<br>
+duration roughly 95 minutes<br>
+<br>
+<b>Results:</b><br>
+[[file:UP12_digest_2012-07-09.jpg|500px]]<br>
+<br>
+<br>
+<b>Further Tasks:</b><br>
+overnight culture with AID+CMV sample 1, 2 and 3
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Overnight culture of AID+CMV carrying cells</p>
-<p><b>Investigators:</b> Basia, Tom S. <br />
-</p><p><br />
+<b>Investigators:</b> Basia, Tom S. <br>
-</p><p><b>Time:</b> 2012-07-09, 17:30<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p><p>LB medium <br />
+<b>Time:</b> 2012-07-09, 17:30<br>
-</p><p>chloramphenicol 25 mg/ ml stock solution<br />
-</p><p>glycerol stocks <i>E. coli</i> XL1 blue with Plasmids: pSB1C3 with AID+CMV of sample 1,2 and 3,
+<br>
-</p><p><br />
-</p><p><b>Method:</b><br />
+<b>Materials:</b><br>
-</p><p>Inoculation of cell samples in 3 ml LB medium <br />
-</p><p>shaking over night at 37°C, 300 rpm <br />
+LB medium <br>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+chloramphenicol 25 mg/ ml stock solution<br>
-</p><p>Miniprep, preparative digestion, Plasmid ligation with polyA <br />
-</p>
+glycerol stocks <i>E. coli</i> XL1 blue with Plasmids: pSB1C3 with AID+CMV of sample 1,2 and 3,
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=10" title="Edit section: 2012-07-10">edit</a>]</span> <span class="mw-headline" id="2012-07-10"><p style="background-color: rgb(240, 20, 70);">2012-07-10</p></span></h3>
+<br>
+<b>Method:</b><br>
+Inoculation of cell samples in 3 ml LB medium <br>
+shaking over night at 37°C, 300 rpm <br>
+<br>
+<b>Further tasks:</b><br>
+Miniprep, preparative digestion, Plasmid ligation with polyA <br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-10</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Miniprep of CMV+AID carrying plasmids</p>
-<p><b>Investigators:</b> Tom S., Mario <br />
-</p><p><br />
+<b>Investigators:</b> Tom S., Mario <br>
-</p><p><b>Time:</b> 2012-07-10<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-10<br>
-<ul><li> samples(CMV + AID: 1, 2, 3) - for detailed info check lab day 2012-07-09<br />
-</li></ul>
+<br>
-<ul><li> Miniprep Kit<br />
-</li></ul>
+<b>Materials:</b><br>
-<ul><li> overnight culture (pSB1C3 with AID + CMV: samples 1, 2, 3,)
-</li></ul>
+* samples(CMV + AID: 1, 2, 3) - for detailed info check lab day 2012-07-09<br>
-<p><br />
-</p><p><b>Method:</b><br />
+* Miniprep Kit<br>
-</p><p>Plasmid isolation via Kit (check manual)
-</p><p>concentration measurement via nanodrop (2 µL sample)
+* overnight culture (pSB1C3 with AID + CMV: samples 1, 2, 3,)
-</p><p><br />
-</p><p><br />
+<br>
-</p><p><br />
-</p><p><b>Results:</b><br />
+<b>Method:</b><br>
-</p><p>DNA - concentrations via nanodrop:<br />
-</p><p>AID + CMV (1) = 303,2 ng/µL <br />
+Plasmid isolation via Kit (check manual)
-</p><p>AID + CMV (2) = 366,6 ng/µL <br />
-</p><p>AID + CMV (3) = 378,5 ng/µL <br />
+concentration measurement via nanodrop (2 µL sample)
-</p><p><b>Further Tasks:</b><br />
-</p><p>preparative digestion (<b>use sample #3;</b> samples 1 and 2 for back up in -20 °C freezer topmost drawer)<br />
+<br>
-</p><p>fragment cut<br />
-</p>
+<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=11" title="Edit section: 2012-07-11">edit</a>]</span> <span class="mw-headline" id="2012-07-11"><p style="background-color: rgb(240, 20, 70);">2012-07-11</p></span></h3>
+<br>
+<b>Results:</b><br>
+DNA - concentrations via nanodrop:<br>
+AID + CMV (1) = 303,2 ng/µL <br>
+AID + CMV (2) = 366,6 ng/µL <br>
+AID + CMV (3) = 378,5 ng/µL <br>
+<b>Further Tasks:</b><br>
+preparative digestion ('''use sample #3;''' samples 1 and 2 for back up in -20 °C freezer topmost drawer)<br>
+fragment cut<br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-11</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: preparative digestion</p>
-<p><b>Investigators:</b> Tom S.<br />
-</p><p><br />
+<b>Investigators:</b> Tom S.<br>
-</p><p><b>Time:</b> 2012-07-11 09:00<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-11 09:00<br>
-<ul><li> pSB1C3 Vector with CMV+AID
-</li></ul>
+<br>
-<ul><li> Restriction enzymes (SpeI, PstI); Fast Digest Green Buffer
-</li></ul>
+<b>Materials:</b><br>
-<p><br />
-</p><p><b>Method:</b><br />
+* pSB1C3 Vector with CMV+AID
-</p><p>preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)
-</p><p><br />
+* Restriction enzymes (SpeI, PstI); Fast Digest Green Buffer
-</p><p><br />
-</p><p><b>further tasks:</b><br />
+<br>
-</p><p>Gel electrophoresis<br />
-</p>
+<b>Method:</b><br>
+preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)
+<br>
+<br>
+<b>further tasks:</b><br>
+Gel electrophoresis<br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Gel electrophoresis of cut pSB1C3 (CMV + AID) fragments</p>
-<p><b>Investigators:</b> Tom S.<br />
-</p><p><br />
+<b>Investigators:</b> Tom S.<br>
-</p><p><b>Time:</b> 2012-07-11 11:00<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-11 11:00<br>
-<ul><li> cut sample (CMV + AID, PstI + SpeI)
-</li></ul>
+<br>
-<ul><li> Gel electrophoresis material
-</li></ul>
+<b>Materials:</b><br>
-<p><br />
-</p><p><b>Method:</b><br />
+* cut sample (CMV + AID, PstI + SpeI)
-</p><p>sample preparation: none
-</p><p>loading into wll: 30 µL<br />
+* Gel electrophoresis material
-</p><p>duration: 70 minutes
-</p><p><br />
+<br>
-</p><p><br />
-</p><p><b>Results:</b><br />
+<b>Method:</b><br>
-</p><p>one band
-</p><p><br />
+sample preparation: none
-</p><p><b>Further Tasks:</b><br />
-</p><p>Gel extraction
+loading into wll: 30 µL<br>
-</p>
+duration: 70 minutes
+<br>
+<br>
+<b>Results:</b><br>
+one band
+<br>
+<b>Further Tasks:</b><br>
+Gel extraction
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Gel extraction and measurement of DNA concentration</p>
-<p><b>Investigators:</b> Chris, Mario<br />
-</p><p><br />
+<b>Investigators:</b> Chris, Mario<br>
-</p><p><b>Time:</b> 2012-07-11 13:00 - 14:00<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-11 13:00 - 14:00<br>
-<ul><li> Analytic Jena gel extraction kit
-</li></ul>
+<br>
-<ul><li> measurement of DNA concentration via nanodrop
-</li></ul>
+<b>Materials:</b><br>
-<p><br />
-</p><p><b>Method:</b><br />
+* Analytic Jena gel extraction kit
-</p><p>Gel extraction via manual<br />
-</p><p><br />
+* measurement of DNA concentration via nanodrop
-</p><p><br />
-</p><p><b>Results:</b><br />
+<br>
-</p><p>DNA concentration via nanodrop: 98.7 ng/µL<br /> --&gt;2051640 Da (2051,64 kDa)--&gt; c=48.1 nM
-</p><p><br />
+<b>Method:</b><br>
-</p><p><b>Further Tasks:</b><br />
-</p><p>Ligation of fragment with Poly-A
+Gel extraction via manual<br>
-</p>
+<br>
+<br>
+<b>Results:</b><br>
+DNA concentration via nanodrop: 98.7 ng/µL<br> -->2051640 Da (2051,64 kDa)--> c=48.1 nM
+<br>
+<b>Further Tasks:</b><br>
+Ligation of fragment with Poly-A
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Ligation CMV+AID in pSB1C3 (cut:Spe1 and Pst1) with hGH-polyA (cut:Xba1 and Pst1)</p>
-<p><b>Investigators:</b> Chris, Mario<br />
-</p><p><br />
+<b>Investigators:</b> Chris, Mario<br>
-</p><p><b>Time:</b> 2012-07-11 16:45 - 17:30<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p><p>digested fragments: CMV+AID in pSB1C3 (cut:Spe1 and Pst1) c=48.1 nM , hGH-polyA (cut:Xba1 and Pst1) c= 15,1 ng/µL -&gt; 48,5 nM
+<b>Time:</b> 2012-07-11 16:45 - 17:30<br>
-</p><p><br />
-</p><p><b>Method:</b><br />
+<br>
-</p><p>mix 1µL CMV+AID in pSB1C3 (cut:Spe1 Pst1) c=48.1 nM, 3µL hGH-polyA (cut:Xba1 Pst1) c=48.5 nM, 1µl T4 Ligase, 1µ 10x Buffer,4 µL H20<br />
-</p><p>incubate 1.5 h
+<b>Materials:</b><br>
-</p><p><br />
-</p><p><br />
+digested fragments: CMV+AID in pSB1C3 (cut:Spe1 and Pst1) c=48.1 nM , hGH-polyA (cut:Xba1 and Pst1) c= 15,1 ng/µL -> 48,5 nM
-</p><p><b>Results:</b><br /> not visible
-</p><p><b>Further Tasks:</b><br />
+<br>
-</p><p>Transformation
-</p>
+<b>Method:</b><br>
+mix 1µL CMV+AID in pSB1C3 (cut:Spe1 Pst1) c=48.1 nM, 3µL hGH-polyA (cut:Xba1 Pst1) c=48.5 nM, 1µl T4 Ligase, 1µ 10x Buffer,4 µL H20<br>
+incubate 1.5 h
+<br>
+<br>
+<b>Results:</b><br> not visible
+<b>Further Tasks:</b><br>
+Transformation
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Transformation of XL1 Blue with CMV+AID+hGH-polyA in pSB1C3 </p>
-<p><b>Investigators:</b> Chris<br />
-</p><p><br />
+<b>Investigators:</b> Chris<br>
-</p><p><b>Time:</b> 2012-07-11 finished:18 Uhr<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p><p>LB medium, <i>E. coli</i> XL1 Blue, ligation product (CMV+AID+hGH-polyA), agar-LB-paltes with 1:1000 chloramphenicol
+<b>Time:</b> 2012-07-11 finished:18 Uhr<br>
-</p><p><br />
-</p><p><b>Method:</b><br />
+<br>
-</p><p>transformation - standard operating procedures<br />
-</p><p><br />
+<b>Materials:</b><br>
-</p><p><br />
-</p><p><b>Results:</b><br /> two plates with transformed <i>E. coli</i> (CMV+AID+polyA)<br />
+LB medium, <i>E. coli</i> XL1 Blue, ligation product (CMV+AID+hGH-polyA), agar-LB-paltes with 1:1000 chloramphenicol
-</p><p><b>Further Tasks:</b><br />
-</p><p>picking colonies &amp; inoculate 5 ml overnight culture
+<br>
-</p>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=12" title="Edit section: 2012-07-12">edit</a>]</span> <span class="mw-headline" id="2012-07-12"><p style="background-color: rgb(240, 20, 70);">2012-07-12</p></span></h3>
+<b>Method:</b><br>
+transformation - standard operating procedures<br>
+<br>
+<br>
+<b>Results:</b><br> two plates with transformed <i>E. coli</i> (CMV+AID+polyA)<br>
+<b>Further Tasks:</b><br>
+picking colonies & inoculate 5 ml overnight culture
+===<p style="background-color: rgb(240, 20, 70);">2012-07-12</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Overnight culture of pSB1C3 CMV+AID+hGH-polyA, CMV+AID, CMV, hGH-polyA and pSB1A3 AID carrying cells</p>
-<p><b>Investigators:</b> Tom S.<br />
-</p><p><br />
+<b>Investigators:</b> Tom S.<br>
-</p><p><b>Time:</b> 2012-07-12 6pm<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b>
-</p><p>LB medium, chloramphenicol 25 mg/ ml stock solution, plates with <i>E. coli</i> XL1 blue with plasmids: pSB1C3+CMV+AID, glycerol stocks: pSB1C3 with AID+CMV, CMV, hGH-polyA and pSB1A3 with AID<br />
+<b>Time:</b> 2012-07-12 6pm<br>
-</p><p><br />
-</p><p><b>Method:</b> picking clones(3 per plate-&gt;Nr.1-6) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours, samples from glycerolstocks in 3 ml LB + 3 µL chloramphenicol or 3µL Amp<br />
+<br>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+<b>Materials:</b>
-</p><p>glycerol stocks &amp; Miniprep
-</p><p><br />
+LB medium, chloramphenicol 25 mg/ ml stock solution, plates with <i>E. coli</i> XL1 blue with plasmids: pSB1C3+CMV+AID, glycerol stocks: pSB1C3 with AID+CMV, CMV, hGH-polyA and pSB1A3 with AID<br>
-</p>
+<br>
+<b>Method:</b> picking clones(3 per plate->Nr.1-6) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours, samples from glycerolstocks in 3 ml LB + 3 µL chloramphenicol or 3µL Amp<br>
+<br>
+<b>Further tasks:</b><br>
+glycerol stocks & Miniprep
+<Br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Planing BBa_K929001</p>
-<p><b>Investigators:</b> Tom S., Chris, Basia, Rico, Mario, Kevin <br />
-</p><p><br />
+<b>Investigators:</b> Tom S., Chris, Basia, Rico, Mario, Kevin <br>
-</p><p><b>Aim:</b> planing how to digest and ligate the vectors for BBa_K929001 <br />
-</p><p><br />
+<Br>
-</p><p><b>Material:</b> Genious <br />
-</p><p><br />
+<b>Aim:</b> planing how to digest and ligate the vectors for BBa_K929001 <Br>
-</p><p><b>Results:</b>
-</p><p>pSB1C3 with CMV -&gt; (cut with SpeI and XbaI) 2072 bp (pSB1C3 backbone) + 662 bp (rest)
+<Br>
-</p><p>PCR-amplificate -&gt; (cut with SpeI and XbaI) 597 bp (modified AID insert)
-</p><p><br />
+<b>Material:</b> Genious <Br>
-</p><p><b>Further tasks:</b>
-</p><p>design and ordering of primers, practical part
+<Br>
-</p><p><a href="https://static.igem.org/mediawiki/2012/c/c4/UP12_BBa_K929001.JPG" class="image"><img alt="UP12 BBa K929001.JPG" src="https://static.igem.org/mediawiki/2012/c/c4/UP12_BBa_K929001.JPG" width="700" height="410" /></a>
-</p>
+'''Results:'''
+pSB1C3 with CMV -> (cut with SpeI and XbaI) 2072 bp (pSB1C3 backbone) + 662 bp (rest)
+PCR-amplificate -> (cut with SpeI and XbaI) 597 bp (modified AID insert)
+<Br>
+'''Further tasks:'''
+design and ordering of primers, practical part
+[[File:UP12_BBa_K929001.JPG|700px]]
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Primer design and ordering for BBa_K929001</p>
-<p><b>Investigators:</b> Tom S., Rico<br />
-</p><p><br />
+<b>Investigators:</b> Tom S., Rico<br>
-</p><p><b>Time:</b> 2012-07-12 7pm<br />
-</p><p><br />
+<br>
-</p><p>Primer (forward) with XbaI recognition site, kozak consensus sequence, NLS:
-</p><p>ATCTAGAGCCGCCACCATGGGACCCAAGAAGAGGAAGGTGATGGACAGCCTCTTGATGAACCGGAGG
+<b>Time:</b> 2012-07-12 7pm<br>
-</p><p><br />
-</p><p><br />
+<br>
-</p><p>Primer (reverse, complement)with AgeI and SpeI recognition site:
-</p><p>CCACTAGTATTAACCGGTGGGCAAAAGGATGCGCCGAAGC
+Primer (forward) with XbaI recognition site, kozak consensus sequence, NLS:
-</p>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=13" title="Edit section: 2012-07-13">edit</a>]</span> <span class="mw-headline" id="2012-07-13"><p style="background-color: rgb(240, 20, 70);">2012-07-13</p></span></h3>
+ATCTAGAGCCGCCACCATGGGACCCAAGAAGAGGAAGGTGATGGACAGCCTCTTGATGAACCGGAGG
+<Br>
+<Br>
+Primer (reverse, complement)with AgeI and SpeI recognition site:
+CCACTAGTATTAACCGGTGGGCAAAAGGATGCGCCGAAGC
+===<p style="background-color: rgb(240, 20, 70);">2012-07-13</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Mini Prep of WT Plasmids, nanodrop</p>
-<p><b>Investigators:</b> Tom S., Mario<br />
-</p><p><br />
+<b>Investigators:</b> Tom S., Mario<br>
-</p><p><b>Time:</b> 2012-07-13 10am<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b>
-</p><p>Miniprep Kit<br />
+<b>Time:</b> 2012-07-13 10am<br>
-</p><p>Overnight culture of AID-WT tranfected <i>E. coli</i> strains<br />
-</p><p><b>Method:</b> Kit via manual<br />
+<br>
-</p><p><br />
-</p><p><b>Results:</b><br />
+<b>Materials:</b>
-</p><p>DNA-concentrations via nanodrop:<br />
-</p><p>WT-AID 1: 387,2 ng/µL<br />
+Miniprep Kit<br>
-</p><p>WT-AID 2: 453,0 ng/µL<br />
-</p><p>WT-AID 3: 415,8 ng/µL<br />
+Overnight culture of AID-WT tranfected <i>E. coli</i> strains<br>
-</p><p>WT-AID 4: 445,5 ng/µL<br />
-</p><p>WT-AID 5: 474,1 ng/µL<br />
+<b>Method:</b> Kit via manual<br>
-</p><p>WT-AID 6: 645,1 ng/µL<br />
-</p><p>AID: 393,5 ng/µL<br />
+<br>
-</p><p>CMV: 188,0 ng/µL<br />
-</p><p>CMV+AID 221,9 ng/µL<br />
+<b>Results:</b><br>
-</p><p>hGH 318,2 ng/µL<br />
-</p><p><br />
+DNA-concentrations via nanodrop:<br>
-</p><p><b>Further tasks:</b><br />
-</p><p>digestion and gelelectrophoresis
+WT-AID 1: 387,2 ng/µL<br>
-</p><p><br />
-</p>
+WT-AID 2: 453,0 ng/µL<br>
+WT-AID 3: 415,8 ng/µL<br>
+WT-AID 4: 445,5 ng/µL<br>
+WT-AID 5: 474,1 ng/µL<br>
+WT-AID 6: 645,1 ng/µL<br>
+AID: 393,5 ng/µL<br>
+CMV: 188,0 ng/µL<br>
+CMV+AID 221,9 ng/µL<br>
+hGH 318,2 ng/µL<br>
+<br>
+<b>Further tasks:</b><br>
+digestion and gelelectrophoresis
+<Br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: preparative digestion</p>
-<p><b>Investigators:</b> Tom S.<br />
-</p><p><br />
+<b>Investigators:</b> Tom S.<br>
-</p><p><b>Time:</b> 2012-07-11 09:00<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-11 09:00<br>
-<ul><li> pSB1C3 Vectors with CMV+AID+hGH-polyA, AID, CMV, hGH, CMV+AID
-</li></ul>
+<br>
-<ul><li> Restriction enzymes (SpeI, PstI); Fast Digest Green Buffer
-</li></ul>
+<b>Materials:</b><br>
-<p><br />
-</p><p><b>Method:</b><br />
+* pSB1C3 Vectors with CMV+AID+hGH-polyA, AID, CMV, hGH, CMV+AID
-</p><p>preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)
-</p><p><br />
+* Restriction enzymes (SpeI, PstI); Fast Digest Green Buffer
-</p><p><br />
-</p><p><b>further tasks:</b><br />
+<br>
-</p><p>Gel electrophoresis<br />
-</p><p><br />
+<b>Method:</b><br>
-</p>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=14" title="Edit section: 2012-07-16">edit</a>]</span> <span class="mw-headline" id="2012-07-16"><p style="background-color: rgb(240, 20, 70);">2012-07-16</p></span></h3>
+preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)
+<br>
+<br>
+<b>further tasks:</b><br>
+Gel electrophoresis<br>
+<Br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-16</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Gel electrophoresis of cut ligation samples (WT AID - CMV+AID+hGH-polyA)</p>
-<p><b>Investigators:</b> Tom S.<br />
-</p><p><br />
+<b>Investigators:</b> Tom S.<br>
-</p><p><b>Time:</b> 2012-07-16; <br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b> <br />
-</p><p>gel electrophoresis equipment<br />
+<b>Time:</b> 2012-07-16; <br>
-</p><p>samples<br />
-</p><p><br />
+<br>
-</p><p><b>Method:</b> <br />
-</p><p>loading wells with 10 µL of each cut sample (ca. 600-800 ng DNA per sample) <br />
+<b>Materials:</b> <br>
-</p><p>gel ectrophoresis standard operating procedure<br />
-</p><p><br />
+gel electrophoresis equipment<br>
-</p><p><b>Results:</b><br />
-</p><p><a href="https://static.igem.org/mediawiki/2012/4/45/UP12_digest_2012-07-16.jpg" class="image"><img alt="UP12 digest 2012-07-16.jpg" src="https://static.igem.org/mediawiki/2012/4/45/UP12_digest_2012-07-16.jpg" width="500" height="212" /></a><br />
+samples<br>
-</p><p><b>Further tasks:</b><br />
-</p><p>sequencing
+<br>
-</p><p><br />
-</p>
+<b>Method:</b> <br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=15" title="Edit section: 2012-07-23">edit</a>]</span> <span class="mw-headline" id="2012-07-23"><p style="background-color: rgb(240, 20, 70);">2012-07-23</p></span></h3>
+loading wells with 10 µL of each cut sample (ca. 600-800 ng DNA per sample) <br>
+gel ectrophoresis standard operating procedure<br>
+<br>
+<b>Results:</b><br>
+[[file:UP12_digest_2012-07-16.jpg|500px]]<br>
+<b>Further tasks:</b><br>
+sequencing
+<Br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-23</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Topic: PCR of AID+NLS+Kozak sequence</p>
-<p><b>Investigators:</b>
-</p><p>Basia, Tom S. <br />
+<b>Investigators:</b>
-</p><p><b>Aim:</b>
-</p>
+Basia, Tom S. <br>
-<ul><li> amplification of the AID with inserted Kozak sequence and NLS sequence via PCR
-</li></ul>
+<b>Aim:</b>
-<p><br />
-</p><p><b>Materials:</b>
+* amplification of the AID with inserted Kozak sequence and NLS sequence via PCR
-</p>
-<ul><li> Phusion, template (AID insert), Primers designed by Tom S. and Rico on 12.07.2012, dNTPs, Polymerase)
+<br>
-</li></ul>
-<ul><li> PCR clean-up kit
+<b>Materials:</b>
-</li></ul>
-<p><b>Method:</b>
+* Phusion, template (AID insert), Primers designed by Tom S. and Rico on 12.07.2012, dNTPs, Polymerase)
-</p>
-<ul><li> polymerase chain reaction <br />
+* PCR clean-up kit
-</li></ul>
-<p><b>Mastermix</b>
+<b>Method:</b>
-</p>
-<table border="1">
+* polymerase chain reaction <br>
+'''Mastermix'''
+<table border=1>
 <tr>
-<td><b>reagent</b> </td>
+<td>'''reagent''' </td>
-<td><b>volume [µL]</b> </td>
+<td>'''volume [µL]''' </td>
 </tr>
@@ Line 683: / Line 1,183: @@
 <td>HF Phusion buffer 5x</td>
 <td>10</td>
 </tr>
@@ Line 689: / Line 1,191: @@
 <td>dNTPs</td>
 <td>1</td>
 </tr>
@@ Line 695: / Line 1,199: @@
 <td>Primer (Forward)</td>
 <td>1,25</td>
 </tr>
@@ Line 701: / Line 1,207: @@
 <td>Primer (Reverse)</td>
 <td>1,25</td>
 </tr>
@@ Line 707: / Line 1,215: @@
 <td> DNA (Plasmid) </td>
 <td> 1,0 </td>
 </tr>
@@ Line 713: / Line 1,223: @@
 <td> Phusion Polymerase </td>
 <td> 0,5 </td>
 </tr>
@@ Line 719: / Line 1,231: @@
 <td> water </td>
 <td> 35,0 </td>
 </tr>
@@ Line 727: / Line 1,241: @@
 </table>
-<p><br />
-</p><p><b>Program</b>
+<br>
-</p>
-<table border="1">
+'''Program'''
+<table border=1>
 <tr>
-<td><b>step</b> </td>
+<td>'''step''' </td>
-<td><b>Temperature [°C]</b> </td>
-<td><b>duration [s]</b> </td>
+<td>'''Temperature [°C]''' </td>
-<td><b>cycles</b> </td>
+<td>'''duration [s]''' </td>
+<td>'''cycles''' </td>
 </tr>
@@ Line 743: / Line 1,263: @@
 <td> denaturation </td>
 <td> 98 </td>
 <td>30 </td>
 <td>1 </td>
 </tr>
@@ Line 751: / Line 1,275: @@
 <td> denaturation </td>
 <td> 98 </td>
 <td> 5 </td>
 <td> 17 </td>
 </tr>
@@ Line 759: / Line 1,287: @@
 <td> annealing + elongation </td>
 <td> 72 </td>
 <td> 45 </td>
 <td> 17 </td>
 </tr>
@@ Line 767: / Line 1,299: @@
 <td> denaturation </td>
 <td> 98 </td>
 <td> 5 </td>
 <td> 17 </td>
 </tr>
@@ Line 775: / Line 1,311: @@
 <td> elongation </td>
 <td> 72 </td>
 <td> 25 </td>
 <td> 17 </td>
 </tr>
@@ Line 783: / Line 1,323: @@
 <td> final elongation </td>
 <td> 72 </td>
 <td> 600 </td>
 <td> 1 </td>
 </tr>
 <tr><td> cooling </td>
 <td> 4 </td>
 <td> ∞ </td>
 <td> 1 </td>
 </tr>
@@ Line 799: / Line 1,347: @@
 </table>
-<p><b>Results:</b><br /> 125ng/µl - 1st sample, 135ng/µl 2nd sample
-</p><p><b>Further tasks:</b><br />
+'''Results:'''<br> 125ng/µl - 1st sample, 135ng/µl 2nd sample
-</p>
-<ul><li> digestion + agarose gel electrophoresis
+'''Further tasks:'''<br>
-</li></ul>
+* digestion + agarose gel electrophoresis
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Primer design and ordering for sequencing BBa_K929001 and BBa_K929003</p>
-<p><b>Investigators:</b> Tom S., Rico<br />
-</p><p><br />
+<b>Investigators:</b> Tom S., Rico<br>
-</p><p><b>Time:</b> 2012-07-23 <br />
-</p><p><br />
+<br>
-</p><p>Primer bind on pSB1C3-vector (left next to backbone-prefix): <br />
-</p><p>GGCGTATCACGAGGCAG<br />
+<b>Time:</b> 2012-07-23 <br>
-</p><p>Primer (reverse, complement) bind on pSB1C3-vector (right next to backbone-suffix):<br />
-</p><p>CGAGTCAGTGAGCGAGG<br />
+<br>
-</p>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=16" title="Edit section: 2012-07-25">edit</a>]</span> <span class="mw-headline" id="2012-07-25"><p style="background-color: rgb(240, 20, 70);">2012-07-25</p></span></h3>
+Primer bind on pSB1C3-vector (left next to backbone-prefix): <br>
+GGCGTATCACGAGGCAG<br>
+Primer (reverse, complement) bind on pSB1C3-vector (right next to backbone-suffix):<br>
+CGAGTCAGTGAGCGAGG<br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-25</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: preparative digestion</p>
-<p><b>Investigators:</b> Tom S.<br />
-</p><p><br />
+<b>Investigators:</b> Tom S.<br>
-</p><p><b>Time:</b> 2012-07-25 08:30<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p><p>pSB1C3 Vector with CMV
+<b>Time:</b> 2012-07-25 08:30<br>
-</p><p><br />2 PCR-products - AID without NES, with NLS+Kozak Sequence (theoretically the same) (SpeI, XbaI; Fast Digest); Fast Digest Green Buffer
-</p><p><br />
+<br>
-</p><p><b>Method:</b><br />
-</p><p>preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)-&gt; for the pSB1C3 backbone <br />
+<b>Materials:</b><br>
-</p><p>preparative digestion: 18 µL DNA + 1 µL of each enzyme + 2 µL Fast Digest Green Buffer (incubation for 2 h)-&gt; for the PCR-products
-</p><p><br />
+pSB1C3 Vector with CMV
-</p><p><br />
-</p>
+<br>2 PCR-products - AID without NES, with NLS+Kozak Sequence (theoretically the same) (SpeI, XbaI; Fast Digest); Fast Digest Green Buffer
+<br>
+<b>Method:</b><br>
+preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)-> for the pSB1C3 backbone <br>
+preparative digestion: 18 µL DNA + 1 µL of each enzyme + 2 µL Fast Digest Green Buffer (incubation for 2 h)-> for the PCR-products
+<br>
+<br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Separation of cut DNA fragments via gel electrophoresis</p>
-<p><b>Investigators:</b> Tom S. <br />
-</p><p><br />
+<b>Investigators:</b> Tom S. <br>
-</p><p><b>Time:</b> 2012-07-25<br />
-</p><p><br />
+<br>
-</p><p><b>Aim</b> Separation of cut DNA fragments via gel electrophoresis<br />
-</p><p><b>Materials:</b><br />
+<b>Time:</b> 2012-07-25<br>
-</p><p>gel electrophoresis material<br />
-</p><p><br />
+<br>
-</p><p><b>Method:</b><br />
-</p><p>cut samples:
+<b>Aim</b> Separation of cut DNA fragments via gel electrophoresis<br>
-</p>
-<ul><li> pSB1C3 backbone: Restriction enzymes (XbaI, SpeI; Fast Digest); Fast Digest buffer
+<b>Materials:</b><br>
-</li></ul>
-<ul><li> PCR-products (AID without NES, with NLS+Kozak Sequence): Restriction enzymes (XbaI, SpeI; Fast Digest); Fast Digest buffer
+gel electrophoresis material<br>
-</li></ul>
-<p><br />
+<br>
-</p><p>wells loaded with 30 or 22 µL of digested samples via gel electrophoresis - standard operating procedure<br />
-</p><p><br />
+<b>Method:</b><br>
-</p><p>gel electrophoresis conditions:<br />
-</p><p>V = 120 V<br />
+cut samples:
-</p><p>duration roughly 50 minutes<br />
-</p><p><br />
+* pSB1C3 backbone: Restriction enzymes (XbaI, SpeI; Fast Digest); Fast Digest buffer
-</p><p><b>Results:</b><br />
-</p><p><a href="/iGEM/wiki2011/index.php/File:UP12_digest_2012-07-25.jpg" class="image"><img alt="UP12 digest 2012-07-25.jpg" src="/iGEM/wiki2011/images/thumb/e/ee/UP12_digest_2012-07-25.jpg/300px-UP12_digest_2012-07-25.jpg" width="300" height="213" /></a><br />
+* PCR-products (AID without NES, with NLS+Kozak Sequence): Restriction enzymes (XbaI, SpeI; Fast Digest); Fast Digest buffer
-</p><p><br />
-</p><p>Marked fragment was cut out of the gel and transferred into 1,5 mL Eppendorf tube<br />
+<br>
-</p><p><br />
-</p><p><b>Further Tasks:</b><br />
+wells loaded with 30 or 22 µL of digested samples via gel electrophoresis - standard operating procedure<br>
-</p><p>Gel extraction
-</p>
+<br>
+gel electrophoresis conditions:<br>
+V = 120 V<br>
+duration roughly 50 minutes<br>
+<br>
+<b>Results:</b><br>
+[[file:UP12_digest_2012-07-25.jpg|300px]]<br>
+<br>
+Marked fragment was cut out of the gel and transferred into 1,5 mL Eppendorf tube<br>
+<br>
+<b>Further Tasks:</b><br>
+Gel extraction
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Gel extraction of pSB1C3 backbone and modified AID insert (AID without NES, with NLS+Kozak Sequence)</p>
-<p><b>Investigators:</b>
-</p><p>Tom S. <br />
+<b>Investigators:</b>
-</p><p><br />
-</p><p><b>Aim:</b>
+Tom S. <br>
-</p><p>Gel extraction of pSB1C3 backbone and modified AID insert
-</p><p><br /><br />
+<br>
-</p><p><b>Materials:</b>
-</p><p>centrifuge, Nucleo Spin and PCR clean up - Kit, thermo heater, nanodrop
+<b>Aim:</b>
-</p><p><br /><br />
-</p><p><b>Method:</b>
+Gel extraction of pSB1C3 backbone and modified AID insert
-</p><p>DNA extraction: according to the manual
-</p><p><br /><br />
+<br><br>
-</p><p><b>Results:</b><br />
-</p><p>DNA-concentrations via nanodrop:<br />
+<b>Materials:</b>
-</p><p>pSB1C3 backbone = 83,6 ng/µL -&gt; 65,7 nM (with mass conc. of 1273,3 kDa)<br />
-</p><p>PCR-product 1 = 74,0 ng/µL -&gt; 201,5 nM (with mass conc. of 367,18 kDa)<br />
+centrifuge, Nucleo Spin and PCR clean up - Kit, thermo heater, nanodrop
-</p><p>PCR-product 1 = 77,5 ng/µL -&gt; 211,1 nM (with mass conc. of 367,18 kDa)<br />
-</p><p>location: -20 °C freezer, topmost drawer
+<br><br>
-</p><p><br />
-</p><p>ready DNA for ligation
+<b>Method:</b>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+DNA extraction: according to the manual
-</p><p>ligation of fragments
-</p>
+<br><br>
+<b>Results:</b><br>
+DNA-concentrations via nanodrop:<br>
+pSB1C3 backbone = 83,6 ng/µL -> 65,7 nM (with mass conc. of 1273,3 kDa)<br>
+PCR-product 1 = 74,0 ng/µL -> 201,5 nM (with mass conc. of 367,18 kDa)<br>
+PCR-product 1 = 77,5 ng/µL -> 211,1 nM (with mass conc. of 367,18 kDa)<br>
+location: -20 °C freezer, topmost drawer
+<br>
+ready DNA for ligation
+<br>
+<b>Further tasks:</b><br>
+ligation of fragments
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Ligation of PCR-product (AID without NES, with NLS+Kozak Sequence) and pSB1C3 backbone</p>
-<p><b>Investigators:</b>
-</p><p>Tom S. <br />
+<b>Investigators:</b>
-</p><p><br />
-</p><p><b>Aim:</b>
+Tom S. <br>
-</p><p>Ligation of PCR-product and pSB1C3 backbone
-</p><p><br /><br />
+<br>
-</p><p><b>Materials:</b>
-</p><p>T4 DNA-Ligase, samples(PCR-product 1 and 2 + pSB1C3 backbone)-&gt; PCR products 1 and 2 are theoretically the same
+<b>Aim:</b>
-</p><p><br /><br />
-</p><p><b>Method:</b>
+Ligation of PCR-product and pSB1C3 backbone
-</p><p>DNA Fragment ligation: according to the manual<br />
-</p><p>sample preparation:
+<br><br>
-</p>
-<ul><li> 2 µL (PCR-product) c=75,8 ng/µL(206,4 nM)-&gt; 41,3 nM
+<b>Materials:</b>
-</li></ul>
-<ul><li> 2 µL (pSB1C3 backbone) c=83,6 ng/µL(65,7 nM) -&gt; 13,2 nM
+T4 DNA-Ligase, samples(PCR-product 1 and 2 + pSB1C3 backbone)-> PCR products 1 and 2 are theoretically the same
-</li></ul>
-<ul><li> 1 µL (T4 DNA-Ligase)
+<br><br>
-</li></ul>
-<ul><li> 1 µL 10x T4 DNA Ligase Buffer
+<b>Method:</b>
-</li></ul>
-<ul><li> 4 µL (DNase free water)
+DNA Fragment ligation: according to the manual<br>
-</li></ul>
-<p><br />
+sample preparation:
-</p><p>incubation of sample 1,5 h at 22°C<br /> <br />
-</p><p><b>Results:</b><br />
+* 2 µL (PCR-product) c=75,8 ng/µL(206,4 nM)-> 41,3 nM
-</p><p>samples ligated<br />
-</p><p>location: -20 °C freezer, topmost drawer
+* 2 µL (pSB1C3 backbone) c=83,6 ng/µL(65,7 nM) -> 13,2 nM
-</p><p><br />
-</p><p>ready DNA for transformation
+* 1 µL (T4 DNA-Ligase)
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+* 1 µL 10x T4 DNA Ligase Buffer
-</p><p>Transformation
-</p>
+* 4 µL (DNase free water)
+<br>
+incubation of sample 1,5 h at 22°C<br> <br>
+<b>Results:</b><br>
+samples ligated<br>
+location: -20 °C freezer, topmost drawer
+<br>
+ready DNA for transformation
+<br>
+<b>Further tasks:</b><br>
+Transformation
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Transformation of ligated sample</p>
-<p><b>Investigators:</b> Tom S. <br />
-</p><p><br />
+<b>Investigators:</b> Tom S. <br>
-</p><p><b>Time:</b> 2012-07-25<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-25<br>
-<ul><li> Bunsen Burner, Agar Plate with Chloramphenicol, 37 °C heater, centrifuge<br />
-</li></ul>
+<br>
-<ul><li> ligated sample (compare last step 25-07-2012)
-</li></ul>
+<b>Materials:</b><br>
-<ul><li> icebox
-</li></ul>
+* Bunsen Burner, Agar Plate with Chloramphenicol, 37 °C heater, centrifuge<br>
-<ul><li> competent <i>E. coli</i> cells (XL 1)
-</li></ul>
+* ligated sample (compare last step 25-07-2012)
-<p><br />
-</p><p><b>Method:</b><br />
+* icebox
-</p><p>Transformation via manual
-</p><p><br />
+* competent <i>E. coli</i> cells (XL 1)
-</p><p>Plate incubation start: 5:00 pm
-</p><p><br />
+<br>
-</p><p><b>Results:</b><br />
-</p><p>ready for growing mutants to pick clones
+<b>Method:</b><br>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+Transformation via manual
-</p><p>picking clones
-</p>
+<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=17" title="Edit section: 2012-07-26">edit</a>]</span> <span class="mw-headline" id="2012-07-26"><p style="background-color: rgb(240, 20, 70);">2012-07-26</p></span></h3>
-<p style="background-color: rgb(238, 221, 130); font-weight: bold;">picking clones &amp; inoculation</p>
+Plate incubation start: 5:00 pm
-<p><b>Investigators:</b> Sascha <br />
-</p><p><br />
+<br>
-</p><p><b>Time:</b> 2012-07-27 6 pm <br />
-</p><p><br />
+<b>Results:</b><br>
-</p><p><b>Materials:</b>
-</p><p>LB medium, chloramphenicol 25 mg/ ml stock solution, plates with <i>E. coli</i> XL1 blue with plasmids: pSB1C3+pcr-products(AID with NLS,without NES+Kozak sequence), glycerol stocks: pSB1C3 with CMV<br />
+ready for growing mutants to pick clones
-</p><p><br />
-</p><p><b>Method:</b> picking clones(3 per plate) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours, samples of glycerol stocks in 5 ml LB + 5 µL chloramphenicol<br />
+<br>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+<b>Further tasks:</b><br>
-</p><p>glycerolstocks &amp; Miniprep
-</p><p><br />
+picking clones
-</p>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=18" title="Edit section: 2012-07-27">edit</a>]</span> <span class="mw-headline" id="2012-07-27"><p style="background-color: rgb(240, 20, 70);">2012-07-27</p></span></h3>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-26</p>===
+<p style="background-color: rgb(238, 221, 130); font-weight: bold;">picking clones & inoculation</p>
+<b>Investigators:</b> Sascha <br>
+<br>
+<b>Time:</b> 2012-07-27 6 pm <br>
+<br>
+<b>Materials:</b>
+LB medium, chloramphenicol 25 mg/ ml stock solution, plates with <i>E. coli</i> XL1 blue with plasmids: pSB1C3+pcr-products(AID with NLS,without NES+Kozak sequence), glycerol stocks: pSB1C3 with CMV<br>
+<br>
+<b>Method:</b> picking clones(3 per plate) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours, samples of glycerol stocks in 5 ml LB + 5 µL chloramphenicol<br>
+<br>
+<b>Further tasks:</b><br>
+glycerolstocks & Miniprep
+<Br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-27</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Miniprep</p>
-<p><b>Investigators:</b> Tom S. <br />
-</p><p>Time:
+<b>Investigators:</b> Tom S. <br>
-</p><p>2012-07-03 8 am
-</p><p>Materials:
+Time:
-</p><p>Glycerol, Miniprep Kit, over night culture (pSB1C3 with CMV); overnight culture (pSB1C3 with modified AID)
-</p><p>Method:
+-07-03 8 am
-</p><p>Glycerol stock: 300 µL Glycerol 99,8&nbsp;% + 700 µL over night cultures --&gt; put in -80 °C freezer
-</p><p>Miniprep (both overnight culture (pSB1C3 with CMV) and overnight cultures (pSB1C3 with PCR 1 colony 1-3 and PCR 2 colony 1-3)
+Materials:
-</p><p>Results:
-</p><p>DNA - concentrations via nanodrop:
+Glycerol, Miniprep Kit, over night culture (pSB1C3 with CMV); overnight culture (pSB1C3 with modified AID)
-</p><p>PCR1 C1= 163.7 ng/µL <br />
-</p><p>PCR1 C2= 154.7 ng/µL <br />
+Method:
-</p><p>PCR1 C3= 165.5 ng/µL <br />
-</p><p>PCR2 C1= 117.1 ng/µL <br />
+Glycerol stock: 300 µL Glycerol 99,8 % + 700 µL over night cultures --> put in -80 °C freezer
-</p><p>PCR2 C2= 164.7 ng/µL <br />
-</p><p>PCR2 C3= 94,4 ng/µL <br />
+Miniprep (both overnight culture (pSB1C3 with CMV) and overnight cultures (pSB1C3 with PCR 1 colony 1-3 and PCR 2 colony 1-3)
-</p><p>CMV= 144.2 ng/µL
-</p><p><br />
+Results:
-</p><p><b>Further tasks:</b><br />
-</p><p>preparative digestion
+DNA - concentrations via nanodrop:
-</p><p><br />
-</p>
+PCR1 C1= 163.7 ng/µL <br>
+PCR1 C2= 154.7 ng/µL <br>
+PCR1 C3= 165.5 ng/µL <br>
+PCR2 C1= 117.1 ng/µL <br>
+PCR2 C2= 164.7 ng/µL <br>
+PCR2 C3= 94,4 ng/µL <br>
+CMV= 144.2 ng/µL
+<br>
+<b>Further tasks:</b><br>
+preparative digestion
+<Br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: preparative digestion</p>
-<p><b>Investigators:</b>Chris<br />
-</p><p><br />
+<b>Investigators:</b>Chris<br>
-</p><p><b>Time:</b> 2012-07-27 11:30<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p><p>pSB1C3 Vector with CMV (SpeI, PstI; Fast Digest); Fast Digest Green Buffer<br />
+<b>Time:</b> 2012-07-27 11:30<br>
-</p><p>PCR 1 C 3 and PCR 2 C 2 in pSB1C3 vector(PstI, XbaI; Fast Digest); Fast Digest Green Buffer
-</p><p><br />
+<br>
-</p><p><b>Method:</b><br />
-</p>
+<b>Materials:</b><br>
-<ul><li>preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2,5 h)
-</li></ul>
+pSB1C3 Vector with CMV (SpeI, PstI; Fast Digest); Fast Digest Green Buffer<br>
-<p><br />
-</p><p><br />
+PCR 1 C 3 and PCR 2 C 2 in pSB1C3 vector(PstI, XbaI; Fast Digest); Fast Digest Green Buffer
-</p>
+<br>
+<b>Method:</b><br>
+*preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2,5 h)
+<br>
+<br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Separation of cut DNA fragments via gel electrophoresis</p>
-<p><b>Investigators:</b> Tom S. <br />
-</p><p><br />
+<b>Investigators:</b> Tom S. <br>
-</p><p><b>Time:</b> 2012-07-27<br />
-</p><p><br />
+<br>
-</p><p><b>Aim:</b> Separation of cut DNA fragments via gel electrophoresis<br />
-</p><p><b>Materials:</b><br />
+<b>Time:</b> 2012-07-27<br>
-</p><p>gel electrophoresis material<br />
-</p><p>cut samples:
+<br>
-</p>
-<ul><li> digested CMV: Restriction enzymes (SpeI, PstI; Fast Digest); Fast Digest buffer
+<b>Aim:</b> Separation of cut DNA fragments via gel electrophoresis<br>
-</li></ul>
-<ul><li> digested PCR-products: Restriction enzymes (PstI, XbaI; Fast Digest); Fast Digest buffer
+<b>Materials:</b><br>
-</li></ul>
-<p><br />
+gel electrophoresis material<br>
-</p><p><b>Method:</b><br />
-</p><p>samples:<br />
+cut samples:
-</p><p>loading wells with 30µl of digested samples via gel electrophoresis, standard operating procedure<br />
-</p><p><br />
+* digested CMV: Restriction enzymes (SpeI, PstI; Fast Digest); Fast Digest buffer
-</p><p>gel electrophoresis conditions:<br />
-</p><p>30 µL of each samples into one big well<br />
+* digested PCR-products: Restriction enzymes (PstI, XbaI; Fast Digest); Fast Digest buffer
-</p><p>V = 120 V<br />
-</p><p>duration 72 minutes<br />
+<br>
-</p><p><br />
-</p><p><b>Results:</b><br />
+<b>Method:</b><br>
-</p><p><a href="/iGEM/wiki2011/index.php/File:UP12_digest_2012-07-27.jpg" class="image"><img alt="UP12 digest 2012-07-27.jpg" src="/iGEM/wiki2011/images/thumb/a/ae/UP12_digest_2012-07-27.jpg/300px-UP12_digest_2012-07-27.jpg" width="300" height="267" /></a><br />
-</p><p><br />
+samples:<br>
-</p><p>Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tube for gel extraction<br />
-</p><p><br />
+loading wells with 30µl of digested samples via gel electrophoresis, standard operating procedure<br>
-</p><p><b>Further Tasks:</b><br />
-</p><p>Gel extraction
+<br>
-</p>
+gel electrophoresis conditions:<br>
+µL of each samples into one big well<br>
+V = 120 V<br>
+duration 72 minutes<br>
+<br>
+<b>Results:</b><br>
+[[file:UP12_digest_2012-07-27.jpg|300px]]<br>
+<br>
+Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tube for gel extraction<br>
+<br>
+<b>Further Tasks:</b><br>
+Gel extraction
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Gel extraction of digested CMV+backbone and PCR-products (AID without NES, with NLS+Kozak sequence) insert</p>
-<p><b>Investigators:</b>
-</p><p>Tom S. <br />
+<b>Investigators:</b>
-</p><p><br />
-</p><p><b>Aim:</b>
+Tom S. <br>
-</p><p>Gel extraction of digested CMV+backbone and PCR-products insert
-</p><p><br /><br />
+<br>
-</p><p><b>Materials:</b>
-</p><p>centrifuge, Nucleo Spin and PCR clean up - Kit, heat block, nanodrop
+<b>Aim:</b>
-</p><p><br /><br />
-</p><p><b>Method:</b>
+Gel extraction of digested CMV+backbone and PCR-products insert
-</p><p>extraction of DNA: according to the manual
-</p><p><br /><br />
+<br><br>
-</p><p><b>Results:</b><br />
-</p><p>DNA-concentrations via nanodrop:<br />
+<b>Materials:</b>
-</p><p>CMV+backbone = 85,6 ng/µL -&gt; 50,9 nM (with mass conc. of 1681,3 kDa)<br />
-</p><p>PCR 1 C 3 = 33,7 ng/µL -&gt; 89,1 nM (with mass conc. of 378,3 kDa)<br />
+centrifuge, Nucleo Spin and PCR clean up - Kit, heat block, nanodrop
-</p><p>PCR 2 C 2 = 29,4 ng/µL -&gt; 77,7 nM (with mass conc. of 378,3 kDa)<br />
-</p><p>location: -20 °C freezer, topmost drawer
+<br><br>
-</p><p><br />
-</p><p>ready DNA for Ligation
+<b>Method:</b>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+extraction of DNA: according to the manual
-</p><p>ligation of fragments
-</p>
+<br><br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=19" title="Edit section: 2012-07-28">edit</a>]</span> <span class="mw-headline" id="2012-07-28"><p style="background-color: rgb(240, 20, 70);">2012-07-28</p></span></h3>
+<b>Results:</b><br>
+DNA-concentrations via nanodrop:<br>
+CMV+backbone = 85,6 ng/µL -> 50,9 nM (with mass conc. of 1681,3 kDa)<br>
+PCR 1 C 3 = 33,7 ng/µL -> 89,1 nM (with mass conc. of 378,3 kDa)<br>
+PCR 2 C 2 = 29,4 ng/µL -> 77,7 nM (with mass conc. of 378,3 kDa)<br>
+location: -20 °C freezer, topmost drawer
+<br>
+ready DNA for Ligation
+<br>
+<b>Further tasks:</b><br>
+ligation of fragments
+===<p style="background-color: rgb(240, 20, 70);">2012-07-28</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Ligation of PCR-products(AID without NES, with NLS+Kozak sequence) and CMV+backbone</p>
-<p><b>Investigators:</b>
-</p><p>Basia <br />
+<b>Investigators:</b>
-</p><p><br />
-</p><p><b>Aim:</b>
+Basia <br>
-</p><p>Ligation of PCR-products and CMV+backbone
-</p><p><br /><br />
+<br>
-</p><p><b>Materials:</b>
-</p><p>T4 DNA-Ligase, samples(PCR 1 C 3 or PCR 2 C 2 and CMV+backbone)
+<b>Aim:</b>
-</p><p><br /><br />
-</p><p><b>Method:</b>
+Ligation of PCR-products and CMV+backbone
-</p><p>DNA fragment ligation: according to the manual<br />
-</p><p>sample preparation:
+<br><br>
-</p>
-<ul><li> 4 µL PCR 1 C3 c=33,7 ng/µL(89,1 nM)-&gt; 35,6 nM; (for the other sample 4µL PCR 2 C 2 c=29,4 ng/µL(77,7 nM)-&gt; 31,1 nM
+<b>Materials:</b>
-</li></ul>
-<ul><li> 2 µL (CMV+backbone) c=85,6 ng/µL(50,9 nM) -&gt; 10,2 nM
+T4 DNA-Ligase, samples(PCR 1 C 3 or PCR 2 C 2 and CMV+backbone)
-</li></ul>
-<ul><li> 1 µL (T4 DNA-Ligase)
+<br><br>
-</li></ul>
-<ul><li> 1 µL 10x T4 DNA Ligase Buffer
+<b>Method:</b>
-</li></ul>
-<ul><li> 2 µL (DNase free water)
+DNA fragment ligation: according to the manual<br>
-</li></ul>
-<p><br />
+sample preparation:
-</p><p>incubation of sample 1,5 h at 22°C<br /> <br />
-</p><p><b>Results:</b><br />
+* 4 µL PCR 1 C3 c=33,7 ng/µL(89,1 nM)-> 35,6 nM; (for the other sample 4µL PCR 2 C 2 c=29,4 ng/µL(77,7 nM)-> 31,1 nM
-</p><p>location: -20°C freezer, topmost drawer
-</p><p><br />
+* 2 µL (CMV+backbone) c=85,6 ng/µL(50,9 nM) -> 10,2 nM
-</p><p>ready DNA Transformation
-</p><p><br />
+* 1 µL (T4 DNA-Ligase)
-</p><p><b>Further tasks:</b><br />
-</p><p>Transformation
+* 1 µL 10x T4 DNA Ligase Buffer
-</p>
+* 2 µL (DNase free water)
+<br>
+incubation of sample 1,5 h at 22°C<br> <br>
+<b>Results:</b><br>
+location: -20°C freezer, topmost drawer
+<br>
+ready DNA Transformation
+<br>
+<b>Further tasks:</b><br>
+Transformation
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Transformation of ligated sample</p>
-<p><b>Investigators:</b> Basia <br />
-</p><p><br />
+<b>Investigators:</b> Basia <br>
-</p><p><b>Time:</b> 2012-07-28 12:30<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-28 12:30<br>
-<ul><li> Bunsen Burner, Agar Plate with Chloramphenicol, 37°C heat block, centrifuge<br />
-</li></ul>
+<br>
-<ul><li> ligase sample (from last step 28.07.2012)
-</li></ul>
+<b>Materials:</b><br>
-<ul><li> icebox
-</li></ul>
+* Bunsen Burner, Agar Plate with Chloramphenicol, 37°C heat block, centrifuge<br>
-<ul><li> competent <i>E. coli</i> cells (XL 1 Blue)
-</li></ul>
+* ligase sample (from last step 28.07.2012)
-<p><br />
-</p><p><b>Method:</b><br />
+* icebox
-</p><p>Transformation according to the manual
-</p><p><br />
+* competent <i>E. coli</i> cells (XL 1 Blue)
-</p><p>Plate incubation start: 14:30 pm
-</p><p><br />
+<br>
-</p><p><b>Results:</b><br />
-</p><p>ready mutants to pick clones
+<b>Method:</b><br>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+Transformation according to the manual
-</p><p>picking clones
-</p>
+<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=20" title="Edit section: 2012-07-29">edit</a>]</span> <span class="mw-headline" id="2012-07-29"><p style="background-color: rgb(240, 20, 70);">2012-07-29</p></span></h3>
+Plate incubation start: 14:30 pm
+<br>
+<b>Results:</b><br>
+ready mutants to pick clones
+<br>
+<b>Further tasks:</b><br>
+picking clones
+===<p style="background-color: rgb(240, 20, 70);">2012-07-29</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Overnight culture of <i>E. coli</i> containing plasmids with PCR products (AID without NES, with NLS+Kozak sequence) and CMV promoter</p>
-<p><b>Investigators:</b> Basia<br />
-</p><p><br />
+<b>Investigators:</b> Basia<br>
-</p><p><b>Time:</b> 2012-07-29 7 pm<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b>
-</p><p>LB medium, chloramphenicol 25 mg/ ml stock solution, plates with <i>E. coli</i> XL1 blue with plasmids: CMV+PCR1C3 and CMV+PCR2C2<br />
+<b>Time:</b> 2012-07-29 7 pm<br>
-</p><p><br />
-</p><p><b>Method:</b> picking clones(2 per plate) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours<br />
+<br>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+<b>Materials:</b>
-</p><p>glycerol stocks &amp; Miniprep
-</p><p><br />
+LB medium, chloramphenicol 25 mg/ ml stock solution, plates with <i>E. coli</i> XL1 blue with plasmids: CMV+PCR1C3 and CMV+PCR2C2<br>
-</p>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=21" title="Edit section: 2012-07-30">edit</a>]</span> <span class="mw-headline" id="2012-07-30"><p style="background-color: rgb(240, 20, 70);">2012-07-30</p></span></h3>
+<br>
+<b>Method:</b> picking clones(2 per plate) and inoculation in 5 ml LB medium + 5µl chloramphenicol stock shaking over night at 37°C, 300 rpm, approx. 16 hours<br>
+<br>
+<b>Further tasks:</b><br>
+glycerol stocks & Miniprep
+<br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-30</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Transformation of BBa_E0040 (wild-type GFP) from Distribution Plate 1 Kit 2012</p>
-<p><b>Investigators:</b> Chris<br />
-</p><p><br />
+<b>Investigators:</b> Chris<br>
-</p><p><b>Time:</b> 2012-07-30 10:30<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p><p>Bunsen Burner, Agar Plate with ampicillin, icebox, competent <i>E. coli</i> cells (XL 1 Blue)
+<b>Time:</b> 2012-07-30 10:30<br>
-</p><p><br />
-</p><p><b>Method:</b><br />
+<br>
-</p><p>Transformation according to the manual
-</p><p><br />
+<b>Materials:</b><br>
-</p><p>Plate incubation start: 13:30 pm
-</p><p><br />
+Bunsen Burner, Agar Plate with ampicillin, icebox, competent <i>E. coli</i> cells (XL 1 Blue)
-</p><p><b>Results:</b><br />
-</p><p>ready mutants to pick clones
+<br>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+<b>Method:</b><br>
-</p><p>picking clones
-</p>
+Transformation according to the manual
-<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Glycerol stocks &amp; miniprep of CMV+AID without NES, with NLS+Kozak sequence containing plasmids</p>
-<p><b>Investigators:</b> Tom S. <br />
+<br>
-</p><p>Time:
-</p><p>2012-07-03 8:30 am
+Plate incubation start: 13:30 pm
-</p><p>Materials:
-</p><p>Glycerol, Miniprep Kit, overnight cultures (CMV+PCR1C3C1-2; CMV+PCR2C2C1-2)
+<br>
-</p><p>Method:
-</p><p>Glycerol stock: 300 µL Glycerol 99,8&nbsp;% + 700 µL overnight cultures --&gt; put in -80 °C freezer
+<b>Results:</b><br>
-</p><p>Miniprep overnight cultures (CMV+PCR1C3C1-2; CMV+PCR2C2C1-2) procedure according to the manual
-</p><p>Results:
+ready mutants to pick clones
-</p><p>DNA concentrations via nanodrop:<br />
-</p><p>PCR1C3 C1= 389,5 ng/µL <br />
+<br>
-</p><p>PCR1C3 C2= 394,3 ng/µL <br />
-</p><p>PCR2C2 C1= 409,8 ng/µL <br />
+<b>Further tasks:</b><br>
-</p><p>PCR2C2 C2= 383,4 ng/µL <br />
-</p><p><br />
+picking clones
-</p><p><b>Further tasks:</b><br />
-</p><p>preparative digestion with PCR1C3 C2 and PCR2C2 C1
+<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Glycerol stocks & miniprep of CMV+AID without NES, with NLS+Kozak sequence containing plasmids</p>
-</p><p><br />
-</p>
+<b>Investigators:</b> Tom S. <br>
+Time:
+-07-03 8:30 am
+Materials:
+Glycerol, Miniprep Kit, overnight cultures (CMV+PCR1C3C1-2; CMV+PCR2C2C1-2)
+Method:
+Glycerol stock: 300 µL Glycerol 99,8 % + 700 µL overnight cultures --> put in -80 °C freezer
+Miniprep overnight cultures (CMV+PCR1C3C1-2; CMV+PCR2C2C1-2) procedure according to the manual
+Results:
+DNA concentrations via nanodrop:<br>
+PCR1C3 C1= 389,5 ng/µL <br>
+PCR1C3 C2= 394,3 ng/µL <br>
+PCR2C2 C1= 409,8 ng/µL <br>
+PCR2C2 C2= 383,4 ng/µL <br>
+<br>
+<b>Further tasks:</b><br>
+preparative digestion with PCR1C3 C2 and PCR2C2 C1
+<Br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: preparative digestion</p>
-<p><b>Investigators:</b>Chris<br />
-</p><p><br />
+<b>Investigators:</b>Chris<br>
-</p><p><b>Time:</b> 2012-07-30 11:00<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p><p>pSB1C3 Vector with hGH-PolyA (XbaI, PstI; Fast Digest); Fast Digest Green Buffer<br />
+<b>Time:</b> 2012-07-30 11:00<br>
-</p><p>PCR1C3 C2 and PCR2C2 C1 in pSB1C3 vector - AID without NES, with NLS+Kozak sequence+CMV(PstI, SpeI; Fast Digest); Fast Digest Green Buffer
-</p><p><br />
+<br>
-</p><p><b>Method:</b><br />
-</p><p>preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)
+<b>Materials:</b><br>
-</p><p><br />
-</p><p><br />
+pSB1C3 Vector with hGH-PolyA (XbaI, PstI; Fast Digest); Fast Digest Green Buffer<br>
-</p>
-<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Separation of cut DNA fragments via gel electrophoresis &amp; Gel extraction</p>
+PCR1C3 C2 and PCR2C2 C1 in pSB1C3 vector - AID without NES, with NLS+Kozak sequence+CMV(PstI, SpeI; Fast Digest); Fast Digest Green Buffer
-<p><b>Investigators:</b> Chris <br />
-</p><p><br />
+<br>
-</p><p><b>Time:</b> 2012-07-30<br />
-</p><p><br />
+<b>Method:</b><br>
-</p><p><b>Aim:</b> Separation of cut DNA fragments via gel electrophoresis<br />
-</p><p><b>Materials:</b><br />
+preparative digestion: 25 µL DNA + 1 µL of each enzyme + 3 µL Fast Digest Green Buffer (incubation for 2 h)
-</p><p>gel electrophoresis material<br />
-</p><p>cut samples:
+<br>
-</p><p>digested hGH-PolyA: Restriction enzymes (XbaI, PstI; Fast Digest); Fast Digest buffer<br />
-</p><p>digested PCR-products: Restriction enzymes (PstI, SpeI; Fast Digest); Fast Digest buffer
+<br>
-</p><p><br />
-</p><p><b>Method:</b><br />
+<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Separation of cut DNA fragments via gel electrophoresis & Gel extraction</p>
-</p><p>gel ectrophoresis - standard operating procedure<br />
-</p><p><br />
+<b>Investigators:</b> Chris <br>
-</p><p>gel electrophoresis conditions:<br />
-</p><p>30 µL of each samples into one big slot<br />
+<br>
-</p><p>V = 120 V<br />
-</p><p>duration roughly 60 minutes<br />
+<b>Time:</b> 2012-07-30<br>
-</p><p><br />
-</p><p><b>Results:</b><br />
+<br>
-</p><p><a href="/iGEM/wiki2011/index.php/File:UP12_digest_2012-07-30.jpg" class="image"><img alt="UP12 digest 2012-07-30.jpg" src="/iGEM/wiki2011/images/thumb/4/48/UP12_digest_2012-07-30.jpg/300px-UP12_digest_2012-07-30.jpg" width="300" height="138" /></a><br />
-</p><p><br />
+<b>Aim:</b> Separation of cut DNA fragments via gel electrophoresis<br>
-</p><p>Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tubes<br />
-</p><p><br />
+<b>Materials:</b><br>
-</p><p>Gel Extraction: <br />
-</p><p>final concentrations: <br />
+gel electrophoresis material<br>
-</p><p>CMV+PCR1C3C2(3318 nt, MW=2048.48 kDa)&nbsp;: 188.1 ng/µl (91.8 nM)<br />
-</p><p>CMV+PCR2C2C1&nbsp;: 182.2 ng/µl (88.9 nM)<br />
+cut samples:
-</p><p>hGH-polyA (495 nt, MW=305.4 kDa): 26.1 ng/µl (85 nM)<br />
-</p><p><b>Further Tasks:</b><br />
+digested hGH-PolyA: Restriction enzymes (XbaI, PstI; Fast Digest); Fast Digest buffer<br>
-</p><p>Ligation, transformation
-</p>
+digested PCR-products: Restriction enzymes (PstI, SpeI; Fast Digest); Fast Digest buffer
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=22" title="Edit section: 2012-07-31">edit</a>]</span> <span class="mw-headline" id="2012-07-31"><p style="background-color: rgb(240, 20, 70);">2012-07-31</p></span></h3>
+<br>
+<b>Method:</b><br>
+gel ectrophoresis - standard operating procedure<br>
+<br>
+gel electrophoresis conditions:<br>
+µL of each samples into one big slot<br>
+V = 120 V<br>
+duration roughly 60 minutes<br>
+<br>
+<b>Results:</b><br>
+[[file:UP12_digest_2012-07-30.jpg|300px]]<br>
+<br>
+Marked fragments were cut out of the gel and transferred into 1,5 mL Eppendorf tubes<br>
+<br>
+Gel Extraction: <br>
+final concentrations: <br>
+CMV+PCR1C3C2(3318 nt, MW=2048.48 kDa) : 188.1 ng/µl (91.8 nM)<br>
+CMV+PCR2C2C1 : 182.2 ng/µl (88.9 nM)<br>
+hGH-polyA (495 nt, MW=305.4 kDa): 26.1 ng/µl (85 nM)<br>
+<b>Further Tasks:</b><br>
+Ligation, transformation
+===<p style="background-color: rgb(240, 20, 70);">2012-07-31</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Planing BBa_K929003</p>
-<p><b>Investigators:</b> Tom S., Chris, Basia, Rico, Mario, Kevin <br />
-</p><p><br />
+<b>Investigators:</b> Tom S., Chris, Basia, Rico, Mario, Kevin <br>
-</p><p><b>Aim:</b> planing how to digest and ligate the vectors for BBa_K929003 <br />
-</p><p><br />
+<Br>
-</p><p><b>Material:</b> Genious <br />
-</p><p><br />
+'''Aim:''' planing how to digest and ligate the vectors for BBa_K929003 <Br>
-</p><p><b>Results:</b>
-</p>
+<Br>
-<ul><li> pSB1C3 with CMV+ mod. AID (without NES, with NLS) -&gt; cut with AgeI and SpeI, 3322 bp - pSB1C3 backbone with CMV + mod. AID, 14 bp - rest
-</li></ul>
+'''Material:''' Genious <Br>
-<ul><li> eGFP -&gt; cut with SpeI and NgoMIV, 731 bp - eGFP insert, 2074 bp - pSB1C3 backbone
-</li></ul>
+<Br>
-<ul><li> pSB1C3 with CMV+ mod. AID + eGFP -&gt; cut with Spe1 and Pst1, 4035 bp - pSB1C3 backbone with CMV + mod. AID+eGFP, 18 bp - rest
-</li></ul>
+'''Results:'''
-<ul><li> hGH-polyA -&gt; cut with Xba1 and Pst1, 505 bp - hGH-polyA insert, 2053 - pSB1C3 backbone
-</li></ul>
+* pSB1C3 with CMV+ mod. AID (without NES, with NLS) -> cut with AgeI and SpeI, 3322 bp - pSB1C3 backbone with CMV + mod. AID, 14 bp - rest
-<p><br />
-</p><p><b>Further tasks:</b>
+* eGFP -> cut with SpeI and NgoMIV, 731 bp - eGFP insert, 2074 bp - pSB1C3 backbone
-</p>
-<ul><li> practical part
+* pSB1C3 with CMV+ mod. AID + eGFP -> cut with Spe1 and Pst1, 4035 bp - pSB1C3 backbone with CMV + mod. AID+eGFP, 18 bp - rest
-</li></ul>
-<p><a href="/iGEM/wiki2011/index.php/File:UP12_BBa_K929003.JPG" class="image"><img alt="UP12 BBa K929003.JPG" src="/iGEM/wiki2011/images/thumb/4/4e/UP12_BBa_K929003.JPG/500px-UP12_BBa_K929003.JPG" width="500" height="483" /></a>
+* hGH-polyA -> cut with Xba1 and Pst1, 505 bp - hGH-polyA insert, 2053 - pSB1C3 backbone
-</p>
-<p style="background-color: rgb(238, 221, 130); font-weight: bold;">inoculation of GFP in pSB1A2 (BBa_E0040) &amp; eGFP (from Sven eGFP in pSB1C3 in <a href="http://tools.ietf.org/html/rfc25" class="external mw-magiclink-rfc">RFC 25</a>-like <a href="http://partsregistry.org/Part:BBa_K404316" class="external text" rel="nofollow">BBa_K404316</a></p>
+<Br>
-<p><b>Investigators:</b> Tom S., Chris <br />
-</p><p><br />
+'''Further tasks:'''
-</p><p><b>Time:</b> 2012-07-31 3pm<br />
-</p><p><br />
+* practical part
-</p><p><b>Materials:</b>
-</p><p>LB medium, chloramphenicol 25 mg/ ml stock solution, ampicillin stock solution, plates with <i>E. coli</i> XL1 blue with plasmid: GFP in pSB1A2 (BBa_E0040), glycerol stock from Sven: eGFP in pSB1C3 in <a href="http://tools.ietf.org/html/rfc25" class="external mw-magiclink-rfc">RFC 25</a> <br />
+[[File:UP12_BBa_K929003.JPG|500px]]
-</p><p><br />
-</p><p><b>Method:</b> picking clones (1 per plate from 2 plates) GFP in pSB1A2 (BBa_E0040) and inoculation in 5 ml LB medium + 5µl ampicillin stock, 2 times inoculation of glycerol stock (eGFP in pSB1C3 in <a href="http://tools.ietf.org/html/rfc25" class="external mw-magiclink-rfc">RFC 25</a>) in 5mL LB medium + 5µL chloramphenicol stock, shaking over night at 37°C, 300 rpm, approx. 16 hours<br />
+<p style="background-color: rgb(238, 221, 130); font-weight: bold;">inoculation of GFP in pSB1A2 (BBa_E0040) & eGFP (from Sven eGFP in pSB1C3 in RFC 25-like [http://partsregistry.org/Part:BBa_K404316 BBa_K404316]</p>
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+<b>Investigators:</b> Tom S., Chris <br>
-</p><p>glycerol stocks &amp; Miniprep
-</p><p><br />
+<br>
-</p>
-<p style="background-color: rgb(238, 221, 130); font-weight: bold;">preparation of WT-AID &amp; modified AID (without NES, with NLS) in pSB1C3 for sequencing &amp; send to GATC</p>
+<b>Time:</b> 2012-07-31 3pm<br>
-<p><b>Investigators:</b> Tom S., Chris <br />
-</p><p><br />
+<br>
-</p><p><b>Time:</b> 2012-07-31 7pm<br />
-</p><p><br />
+<b>Materials:</b>
-</p><p><b>Materials:</b>
-</p><p>20 µl primer c=10µM for each sequencing, 20 µl sample with concentration around 70 ng/µl <br />
+LB medium, chloramphenicol 25 mg/ ml stock solution, ampicillin stock solution, plates with <i>E. coli</i> XL1 blue with plasmid: GFP in pSB1A2 (BBa_E0040), glycerol stock from Sven: eGFP in pSB1C3 in RFC 25 <br>
-</p><p><br />
-</p><p><b>Method:</b> mark the samples with bar code stickers &amp; order the sequencing from GATC, put the cups into the orange boxes<br />
+<br>
-</p><p><br />samples: <br />
-</p>
+<b>Method:</b> picking clones (1 per plate from 2 plates) GFP in pSB1A2 (BBa_E0040) and inoculation in 5 ml LB medium + 5µl ampicillin stock, 2 times inoculation of glycerol stock (eGFP in pSB1C3 in RFC 25) in 5mL LB medium + 5µL chloramphenicol stock, shaking over night at 37°C, 300 rpm, approx. 16 hours<br>
-<table border="1">
+<br>
+<b>Further tasks:</b><br>
+glycerol stocks & Miniprep
+<br>
+<p style="background-color: rgb(238, 221, 130); font-weight: bold;">preparation of WT-AID & modified AID (without NES, with NLS) in pSB1C3 for sequencing & send to GATC</p>
+<b>Investigators:</b> Tom S., Chris <br>
+<br>
+<b>Time:</b> 2012-07-31 7pm<br>
+<br>
+<b>Materials:</b>
+µl primer c=10µM for each sequencing, 20 µl sample with concentration around 70 ng/µl <br>
+<br>
+<b>Method:</b> mark the samples with bar code stickers & order the sequencing from GATC, put the cups into the orange boxes<br>
+<br>samples: <br>
+<table border=1>
 <tr>
-<td><b>sample</b></td>
+<td>'''sample'''</td>
-<td><b>barcode</b></td>
-<td><b>primer</b></td>
+<td>'''barcode'''</td>
-<td><b>sample</b></td>
-<td><b>barcode</b></td>
+<td>'''primer'''</td>
-<td><b>primer</b></td>
+<td>'''sample'''</td>
+<td>'''barcode'''</td>
+<td>'''primer'''</td>
 </tr>
@@ Line 1,289: / Line 2,199: @@
 <td>WT AID clone 1 (Cmv+WtAID+PolyA in pSB1C3)</td>
 <td>CC0697</td>
 <td>forward pSB1C3</td>
 <td>WT AID clone 1 </td>
 <td>CC0709</td>
 <td>reverse pSB1C3</td>
 </tr>
@@ Line 1,299: / Line 2,215: @@
 <td>WT AID clone 2</td>
 <td>CC0698</td>
 <td>forward pSB1C3</td>
 <td>WT AID clone 2</td>
 <td>CC0710</td>
 <td>reverse pSB1C3</td>
 </tr>
@@ Line 1,309: / Line 2,231: @@
 <td>WT AID clone 3 </td>
 <td>CC0699</td>
 <td>forward pSB1C3</td>
 <td>WT AID clone 3 </td>
 <td>CC0711</td>
 <td>reverse pSB1C3</td>
 </tr>
@@ Line 1,319: / Line 2,247: @@
 <td>WT AID clone 4 </td>
 <td>CC0700</td>
 <td>forward pSB1C3</td>
 <td>WT AID clone 4 </td>
 <td>CC0712</td>
 <td>reverse pSB1C3</td>
 </tr>
@@ Line 1,329: / Line 2,263: @@
 <td>WT AID clone 5 </td>
 <td>CC0701</td>
 <td>forward pSB1C3</td>
 <td>WT AID clone 5 </td>
 <td>CC0713</td>
 <td>reverse pSB1C3</td>
 </tr>
@@ Line 1,339: / Line 2,279: @@
 <td>WT AID clone 6 </td>
 <td>CC0702</td>
 <td>forward pSB1C3</td>
 <td>WT AID clone 6 </td>
 <td>CC0714</td>
 <td>reverse pSB1C3</td>
 </tr>
@@ Line 1,349: / Line 2,295: @@
 <td>PCR1 C1 (modified AID- Kozak sequence+NLS+AID without NES+Age1-restriction site in pSB1C3) </td>
 <td>CC0703</td>
 <td>forward pSB1C3</td>
 <td>PCR1 C1 </td>
 <td>CC0715</td>
 <td>reverse pSB1C3</td>
 </tr>
@@ Line 1,359: / Line 2,311: @@
 <td>PCR1 C2 </td>
 <td>CC0704</td>
 <td>forward pSB1C3</td>
 <td>PCR1 C2 </td>
 <td>CC0716</td>
 <td>reverse pSB1C3</td>
 </tr>
@@ Line 1,369: / Line 2,327: @@
 <td>PCR1 C3 </td>
 <td>CC0705</td>
 <td>forward pSB1C3</td>
 <td>PCR1 C3 </td>
 <td>CC0717</td>
 <td>reverse pSB1C3</td>
 </tr>
@@ Line 1,379: / Line 2,343: @@
 <td>PCR2 C1 </td>
 <td>CC0706</td>
 <td>forward pSB1C3</td>
 <td>PCR2 C1 </td>
 <td>CC0718</td>
 <td>reverse pSB1C3</td>
 </tr>
@@ Line 1,389: / Line 2,359: @@
 <td>PCR2 C2 </td>
 <td>CC0707</td>
 <td>forward pSB1C3</td>
 <td>PCR2 C2 </td>
 <td>CC0719</td>
 <td>reverse pSB1C3</td>
 </tr>
@@ Line 1,399: / Line 2,375: @@
 <td>PCR2 C3 </td>
 <td>CC0708</td>
 <td>forward pSB1C3</td>
 <td>PCR2 C3 </td>
 <td>CC0720</td>
 <td>reverse pSB1C3</td>
 </tr>
 </table>
-<p><b>Further tasks:</b><br />
-</p><p>alignment
+<b>Further tasks:</b><br>
-</p>
-<h2><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=23" title="Edit section: Antibody">edit</a>]</span> <span class="mw-headline" id="Antik.C3.B6rper">Antibody</span></h2>
+alignment
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=24" title="Edit section: 2012-07-06">edit</a>]</span> <span class="mw-headline" id="2012-07-06_2"><p style="background-color: rgb(240, 20, 70);">2012-07-06</p></span></h3>
+==Antikörper==
+===<p style="background-color: rgb(240, 20, 70);">2012-07-06</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Sequencing of pcDNA5-FRT and pOG44 by GATC</p>
-<p><b>Investigators:</b> Sascha <br />
-</p><p><br />
+<b>Investigators:</b> Sascha <br>
-</p><p><b>Aim:</b> Sequencing of invitrogen vectors pcDNA5-FRT and pOG44<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b>
-</p>
+<b>Aim:</b> Sequencing of invitrogen vectors pcDNA5-FRT and pOG44<br>
-<ul><li> Geneious
-</li></ul>
+<br>
-<ul><li> Lablife Sequences of pcDNA5-FRT and pOG44
-</li></ul>
+<b>Materials:</b>
-<ul><li> GATC<br />
-</li></ul>
+* Geneious
-<p><br />
-</p><p><b>Method:</b> forward sequencing using GATC-CMV-forward-primer <br />
+* Lablife Sequences of pcDNA5-FRT and pOG44
-</p>
-<ul><li> pcdna5frt_cmv_forward-CMV-F<br />
+* GATC<br>
-</li></ul>
-<ul><li> pog44_cmv_forward-CMV-F <br />
+<br>
-</li></ul>
-<p><br />
+<b>Method:</b> forward sequencing using GATC-CMV-forward-primer <br>
-</p><p><b>Further tasks:</b> checking sequences <br />
-</p>
+* pcdna5frt_cmv_forward-CMV-F<br>
+* pog44_cmv_forward-CMV-F <br>
+<br>
+<b>Further tasks:</b> checking sequences <br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Primer-design for assembly-PCR, generating geneconstruct: scFv-TEV-TMD-EYFP </p>
-<p><b>Investigators:</b> Sascha <br />
-</p><p><br />
+<b>Investigators:</b> Sascha <br>
-</p><p><b>Aim:</b> Design of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP <br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b>
-</p>
+<b>Aim:</b> Design of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP <br>
-<ul><li> Lablife Sequences of pcDNA5-FRT and pOG44
-</li></ul>
+<br>
-<ul><li> Databases
-</li></ul>
+<b>Materials:</b>
-<ul><li> Oligocalc
-</li></ul>
+* Lablife Sequences of pcDNA5-FRT and pOG44
-<ul><li> Wordpad
-</li></ul>
+* Databases
-<p><b>Method:</b> <br />
-</p>
+* Oligocalc
-<ul><li> P1_Signalp_N-term<br />
-</li></ul>
+* Wordpad
-<ul><li> P2_Signalp_C-term<br />
-</li></ul>
+<b>Method:</b> <br>
-<ul><li> P3_TMD-N-term<br />
-</li></ul>
+* P1_Signalp_N-term<br>
-<ul><li> P4_TMD-C-term/N-YFP<br />
-</li></ul>
+* P2_Signalp_C-term<br>
-<ul><li> P5_YFP-N-term/TMD-C-term<br />
-</li></ul>
+* P3_TMD-N-term<br>
-<ul><li> P6_YFP-C-term<br />
-</li></ul>
+* P4_TMD-C-term/N-YFP<br>
-<ul><li> P7_Gesamtanfang<br />
-</li></ul>
+* P5_YFP-N-term/TMD-C-term<br>
-<ul><li> P8_Gesamtende<br />
-</li></ul>
+* P6_YFP-C-term<br>
-<p><br />
-</p><p><b>Further tasks:</b><br />
+* P7_Gesamtanfang<br>
-</p>
-<ul><li> checking primer with Geneious
+* P8_Gesamtende<br>
-</li></ul>
-<ul><li> adapt primer to NEB-Phusion-polymerase conditions <br />
+<br>
-</li></ul>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=25" title="Edit section: 2012-07-07">edit</a>]</span> <span class="mw-headline" id="2012-07-07_2"><p style="background-color: rgb(240, 20, 70);">2012-07-07</p></span></h3>
+<b>Further tasks:</b><br>
+* checking primer with Geneious
+* adapt primer to NEB-Phusion-polymerase conditions <br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-07</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Primer-design for assembly-PCR, generating geneconstruct: scFv-TEV-TMD-EYFP </p>
-<p><b>Investigators:</b> Sascha <br />
-</p><p><br />
+<b>Investigators:</b> Sascha <br>
-</p><p><b>Aim:</b> Design of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP <br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b>
-</p>
+<b>Aim:</b> Design of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP <br>
-<ul><li> Lablife Sequences of pcDNA5-FRT and pOG44
-</li></ul>
+<br>
-<ul><li> Databases
-</li></ul>
+<b>Materials:</b>
-<ul><li> Oligocalc
-</li></ul>
+* Lablife Sequences of pcDNA5-FRT and pOG44
-<ul><li> Wordpad
-</li></ul>
+* Databases
-<p><br />
-</p><p><b>Method:</b> forward sequencing using GATC-CMV-forward-primer <br />
+* Oligocalc
-</p>
-<ul><li> P1_Signalp_N-term<br />
+* Wordpad
-</li></ul>
-<ul><li> P2_Signalp_C-term<br />
+<br>
-</li></ul>
-<ul><li> P3_TMD-N-term<br />
+<b>Method:</b> forward sequencing using GATC-CMV-forward-primer <br>
-</li></ul>
-<ul><li> P4_TMD-C-term/N-YFP<br />
+* P1_Signalp_N-term<br>
-</li></ul>
-<ul><li> P5_YFP-N-term/TMD-C-term<br />
+* P2_Signalp_C-term<br>
-</li></ul>
-<ul><li> P6_YFP-C-term<br />
+* P3_TMD-N-term<br>
-</li></ul>
-<ul><li> P7_Gesamtanfang<br />
+* P4_TMD-C-term/N-YFP<br>
-</li></ul>
-<ul><li> P8_Gesamtende<br />
+* P5_YFP-N-term/TMD-C-term<br>
-</li></ul>
-<p><br />
+* P6_YFP-C-term<br>
-</p><p><b>Further tasks:</b><br />
-</p>
+* P7_Gesamtanfang<br>
-<ul><li> checking primer with Geneious
-</li></ul>
+* P8_Gesamtende<br>
-<ul><li> adapt primer to NEB-Phusion-polymerase conditions <br />
-</li></ul>
+<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=26" title="Edit section: 2012-07-10">edit</a>]</span> <span class="mw-headline" id="2012-07-10_2"><p style="background-color: rgb(240, 20, 70);">2012-07-10</p></span></h3>
+<b>Further tasks:</b><br>
+* checking primer with Geneious
+* adapt primer to NEB-Phusion-polymerase conditions <br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-10</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Checking of Sequencing of GATC-results of pcDNA5-FRT and pOG44 </p>
-<p><b>Investigators:</b> Sascha <br />
-</p><p><br />
+<b>Investigators:</b> Sascha <br>
-</p><p><b>Aim:</b> Control of pcDNA5-FRT- and pOG44-sequences<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b>
-</p>
+<b>Aim:</b> Control of pcDNA5-FRT- and pOG44-sequences<br>
-<ul><li> Geneious
-</li></ul>
+<br>
-<ul><li> Lablife Sequences of pcDNA5-FRT and pOG44
-</li></ul>
+<b>Materials:</b>
-<ul><li> GATC-viewer
-</li></ul>
+* Geneious
-<ul><li> NCBI BLASTn<br />
-</li></ul>
+* Lablife Sequences of pcDNA5-FRT and pOG44
-<p><br />
-</p><p><b>Results:</b>
+* GATC-viewer
-</p>
-<ul><li> sequences are correct
+* NCBI BLASTn<br>
-</li></ul>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=27" title="Edit section: 2012-07-12">edit</a>]</span> <span class="mw-headline" id="2012-07-12_2"><p style="background-color: rgb(240, 20, 70);">2012-07-12</p></span></h3>
+<br>
+<b>Results:</b>
+* sequences are correct
+===<p style="background-color: rgb(240, 20, 70);">2012-07-12</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> ordering of primer for assembly-PCR, generating geneconstruct: scFv-TEV-TMD-EYFP </p>
-<p><b>Investigators:</b> Sascha, Maria <br />
-</p><p><br />
+<b>Investigators:</b> Sascha, Maria <br>
-</p><p><b>Aim:</b> ordering of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP <br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b>
-</p>
+<b>Aim:</b> ordering of primer for assembly-pcr of geneconstruct scFv-TEV-TMD-EYFP <br>
-<ul><li> Lablife Sequences of pcDNA5-FRT and pOG44
-</li></ul>
+<br>
-<ul><li> Databases
-</li></ul>
+<b>Materials:</b>
-<ul><li> Oligocalc
-</li></ul>
+* Lablife Sequences of pcDNA5-FRT and pOG44
-<ul><li> Wordpad
-</li></ul>
+* Databases
-<ul><li> Geneious
-</li></ul>
+* Oligocalc
-<ul><li> NEB-Calculator for high-fidelity Phusion-polymerase
-</li></ul>
+* Wordpad
-<p><br />
-</p><p><b>Method:</b> forward sequencing using GATC-CMV-forward-primer <br />
+* Geneious
-</p>
-<ul><li> P1_Signalp_N-term<br />
+* NEB-Calculator for high-fidelity Phusion-polymerase
-</li></ul>
-<ul><li> P2_Signalp_C-term<br />
+<br>
-</li></ul>
-<ul><li> P3_TMD-N-term<br />
+<b>Method:</b> forward sequencing using GATC-CMV-forward-primer <br>
-</li></ul>
-<ul><li> P4_TMD-C-term/N-YFP<br />
+* P1_Signalp_N-term<br>
-</li></ul>
-<ul><li> P5_YFP-N-term/TMD-C-term<br />
+* P2_Signalp_C-term<br>
-</li></ul>
-<ul><li> P6_YFP-C-term<br />
+* P3_TMD-N-term<br>
-</li></ul>
-<ul><li> P7_Gesamtanfang<br />
+* P4_TMD-C-term/N-YFP<br>
-</li></ul>
-<ul><li> P8_Gesamtende<br />
+* P5_YFP-N-term/TMD-C-term<br>
-</li></ul>
-<p><br />
+* P6_YFP-C-term<br>
-</p><p><b>Further tasks:</b><br />
-</p>
+* P7_Gesamtanfang<br>
-<ul><li> extension-assembly-pcr
-</li></ul>
+* P8_Gesamtende<br>
-<p><br />
-</p>
+<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=28" title="Edit section: 2012-07-15">edit</a>]</span> <span class="mw-headline" id="2012-07-15"><p style="background-color: rgb(240, 20, 70);">2012-07-15</p></span></h3>
+<b>Further tasks:</b><br>
+* extension-assembly-pcr
+<br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-15</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Retransformation with scFv, transmembrane domain and YFP</p>
-<p><b>Investigators:</b> Maria <br />
-</p><p><br />
+<b>Investigators:</b> Maria <br>
-</p><p><b>Aim:</b> Retransformation with scFv anti-EGFR, transmembrane domain BBa_KI157010, YFP BBa_E0030 <br />
-</p><p><br />
+<br>
-</p><p><b>Date/Time:</b> 15th July 2012, 2:30 – 4:30 pm <br />
-</p><p><br />
+<b>Aim:</b> Retransformation with scFv anti-EGFR, transmembrane domain BBa_KI157010, YFP BBa_E0030 <br>
-</p><p><b>Materials:</b> competent <i>E. coli</i> cells XL1 Blue, Biobricks BBa_K157010 and BBa_E0030, scFv anti-EGFR, 42°/37° C shaker, centrifuge<br />
-</p><p><br />
+<br>
-</p><p><b>Method:</b> see transformation protocol <br />
-</p><p><br />
+<b>Date/Time:</b> 15th July 2012, 2:30 – 4:30 pm <br>
-</p><p><b>Results:</b> colonies on Amp plates with scFv-, transmembrane domain- and YFP- plasmid <br />
-</p><p><br />
+<br>
-</p><p><b>Further tasks:</b> picking clones and overnight culture (16th July)<br />
-</p><p><br />
+<b>Materials:</b> competent <i>E. coli</i> cells XL1 Blue, Biobricks BBa_K157010 and BBa_E0030, scFv anti-EGFR, 42°/37° C shaker, centrifuge<br>
-</p>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=29" title="Edit section: 2012-07-16">edit</a>]</span> <span class="mw-headline" id="2012-07-16_2"><p style="background-color: rgb(240, 20, 70);">2012-07-16</p></span></h3>
+<br>
+<b>Method:</b> see transformation protocol <br>
+<br>
+<b>Results:</b> colonies on Amp plates with scFv-, transmembrane domain- and YFP- plasmid <br>
+<br>
+<b>Further tasks:</b> picking clones and overnight culture (16th July)<br>
+<BR>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-16</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Overnight culture of scFv, YFP and transmembrane domain carrying cells</p>
-<p><b>Investigators:</b> Maria<br />
-</p><p><br />
+<b>Investigators:</b> Maria<br>
-</p><p><b>Time:</b> 2012-07-16; 6:30 - 7 pm<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-16; 6:30 - 7 pm<br>
-<ul><li> LB medium <br />
-</li></ul>
+<br>
-<ul><li> Amp. 25 mg/ ml stock solution<br />
-</li></ul>
+<b>Materials:</b><br>
-<ul><li> Plasmids: scFv; BBa-KI57000 with transmembrane domain; pSB1AK3 with YFP
-</li></ul>
+* LB medium <br>
-<p><br />
-</p><p><b>Method:</b><br />
+* Amp. 25 mg/ ml stock solution<br>
-</p><p>Inoculation of cell sample each in 5 ml LB medium with Amp<br />
-</p><p>shaking over night at 37°C, 300 rpm, approx. 17 hours <br />
+* Plasmids: scFv; BBa-KI57000 with transmembrane domain; pSB1AK3 with YFP
-</p><p><br />
-</p><p><b>Further tasks:</b><br />
+<br>
-</p>
-<ul><li> Miniprep <br />
+<b>Method:</b><br>
-</li></ul>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=30" title="Edit section: 2012-07-17">edit</a>]</span> <span class="mw-headline" id="2012-07-17"><p style="background-color: rgb(240, 20, 70);">2012-07-17</p></span></h3>
+Inoculation of cell sample each in 5 ml LB medium with Amp<br>
+shaking over night at 37°C, 300 rpm, approx. 17 hours <br>
+<br>
+<b>Further tasks:</b><br>
+* Miniprep <br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-17</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Mini Prep of YFP and transmembrane domain
 </p>
-<p><b>Investigators:</b> Stefan, Tarek, Kerstin<br />
-</p><p><br />
+<b>Investigators:</b> Stefan, Tarek, Kerstin<br>
-</p><p><b>Time:</b> 2012-07-17; 2 - 3.30 pm<br />
-</p><p><br />
+<br>
-</p><p><b>Materials:</b><br />
-</p>
+<b>Time:</b> 2012-07-17; 2 - 3.30 pm<br>
-<ul><li> overnight cultures from 2012-07-16 <br />
-</li></ul>
+<br>
-<ul><li> GeneJET Plasmid Miniprep Kit (Thermo Scientific)<br />
-</li></ul>
+<b>Materials:</b><br>
-<ul><li> Plasmids: BBa-KI57000 with transmembrane domain; pSB1AK3 with YFP
-</li></ul>
+* overnight cultures from 2012-07-16 <br>
-<p><br />
-</p><p><b>Method:</b><br />
+* GeneJET Plasmid Miniprep Kit (Thermo Scientific)<br>
-</p><p>Miniprep according to Kit<br />
-</p><p><br />
+* Plasmids: BBa-KI57000 with transmembrane domain; pSB1AK3 with YFP
-</p><p><b>Note:</b><br />
-</p><p>overnight culture of retransformation of scFv did not grow --&gt; Resistance was not known in scFv vector, screening was done with ampicillin
+<br>
-</p><p><br />
-</p><p><b>Further Tasks:</b><br />
+<b>Method:</b><br>
-</p><p>PCR to produce sp-scFv-tmd-yfp construct
-</p><p><br />
+Miniprep according to Kit<br>
-</p>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=31" title="Edit section: 2012-07-20">edit</a>]</span> <span class="mw-headline" id="2012-07-20"><p style="background-color: rgb(240, 20, 70);">2012-07-20</p></span></h3>
+<br>
+<b>Note:</b><br>
+overnight culture of retransformation of scFv did not grow --> Resistance was not known in scFv vector, screening was done with ampicillin
+<br>
+<b>Further Tasks:</b><br>
+PCR to produce sp-scFv-tmd-yfp construct
+<br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-20</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: extension-assembly-pcr of scFv-TEV-TMD-EYFP geneconstruct
 </p>
-<p><b>Investigators:</b> Stefan, Sascha<br />
-</p><p><br />
+<b>Investigators:</b> Stefan, Sascha<br>
-</p><p><b>Materials:</b><br />
-</p><p><b>Materials:</b><br />scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP<br />
+<br>
-</p>
-<ul><li> P1_Signalp_N-term<br />
+<b>Materials:</b><br>
-</li></ul>
-<ul><li> P2_Signalp_C-term<br />
+<b>Materials:</b><br>scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP<br>
-</li></ul>
-<ul><li> P3_TMD-N-term<br />
+* P1_Signalp_N-term<br>
-</li></ul>
-<ul><li> P4_TMD-C-term/N-YFP<br />
+* P2_Signalp_C-term<br>
-</li></ul>
-<ul><li> P5_YFP-N-term/TMD-C-term<br />
+* P3_TMD-N-term<br>
-</li></ul>
-<ul><li> P6_YFP-C-term<br />
+* P4_TMD-C-term/N-YFP<br>
-</li></ul>
-<ul><li> P7_Gesamtanfang<br />
+* P5_YFP-N-term/TMD-C-term<br>
-</li></ul>
-<ul><li> P8_Gesamtende<br />
+* P6_YFP-C-term<br>
-</li></ul>
-<ul><li> Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer
+* P7_Gesamtanfang<br>
-</li></ul>
-<p><b>Method:</b><br />
+* P8_Gesamtende<br>
-</p>
-<ul><li> 50µl PCR mix of each plasmid= 10µl HF-Buffer; 1µl dNTPs(10mM); forward and reverse primer each 2,5µl (10µM); template DNA: 1µl of 200ng/µl scFv --&gt; 200ng, 5µl of BBa_E0030 with EYFP (46,3ng/µl--&gt; ca. 230ng),5µl of BBa-KI57000 with transmembrane domain (43,9ng/µl --&gt; ca. 230ng); Phusion DNA polymerase 0,5µl; nclease-free water ad to 50µl <br />
+* Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer
-</li></ul>
-<ul><li> PCR-program: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 11´´ at 72°C; final-Elongation 10´at 72°C; 30 cycles
+<b>Method:</b><br>
-</li></ul>
-<p><br />
+* 50µl PCR mix of each plasmid= 10µl HF-Buffer; 1µl dNTPs(10mM); forward and reverse primer each 2,5µl (10µM); template DNA: 1µl of 200ng/µl scFv --> 200ng, 5µl of BBa_E0030 with EYFP (46,3ng/µl--> ca. 230ng),5µl of BBa-KI57000 with transmembrane domain (43,9ng/µl --> ca. 230ng); Phusion DNA polymerase 0,5µl; nclease-free water ad to 50µl <br>
-</p><p><b>Further Tasks:</b><br />
-</p>
+* PCR-program: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 11´´ at 72°C; final-Elongation 10´at 72°C; 30 cycles
-<ul><li> gelextraction
-</li></ul>
+<br>
-<ul><li> assembly-pcr
-</li></ul>
+<b>Further Tasks:</b><br>
-<p><br />
-</p>
+* gelextraction
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=32" title="Edit section: 2012-07-26">edit</a>]</span> <span class="mw-headline" id="2012-07-26_2"><p style="background-color: rgb(240, 20, 70);">2012-07-26</p></span></h3>
+* assembly-pcr
+<br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-26</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Planning the antibody construct for genesynthesis</p>
-<p><b>Investigators:</b> Maria <br />
-</p><p><br />
+<b>Investigators:</b> Maria <br>
-</p><p><b>Aim:</b> construct with scFv 425bla, LoxP and TEV recognition site, E-YFP<br />
-</p><p><br />
+<br>
-</p><p><b>Date/Time:</b> 26th July 2012, 2 - 5 pm <br />
-</p><p><br />
+<b>Aim:</b> construct with scFv 425bla, LoxP and TEV recognition site, E-YFP<br>
-</p><p><b>Materials:</b> Geneious <br />
-</p><p><br />
+<br>
-</p><p><b>Results:</b> antibody construct RCF25 <br />
-</p><p><br />
+<b>Date/Time:</b> 26th July 2012, 2 - 5 pm <br>
-</p>
+<br>
+<b>Materials:</b> Geneious <br>
+<br>
+<b>Results:</b> antibody construct RCF25 <br>
+<br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: extension-pcr of scFv-TEV-TMD-EYFP geneconstruct
 </p>
-<p><b>Investigators:</b> Sascha<br />
-</p><p><br />
+<b>Investigators:</b> Sascha<br>
-</p><p><b>Materials:</b><br />scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP<br />
-</p>
+<br>
-<ul><li> P1_Signalp_N-term<br />
-</li></ul>
+<b>Materials:</b><br>scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP<br>
-<ul><li> P2_Signalp_C-term<br />
-</li></ul>
+* P1_Signalp_N-term<br>
-<ul><li> P3_TMD-N-term<br />
-</li></ul>
+* P2_Signalp_C-term<br>
-<ul><li> P4_TMD-C-term/N-YFP<br />
-</li></ul>
+* P3_TMD-N-term<br>
-<ul><li> P5_YFP-N-term/TMD-C-term<br />
-</li></ul>
+* P4_TMD-C-term/N-YFP<br>
-<ul><li> P6_YFP-C-term<br />
-</li></ul>
+* P5_YFP-N-term/TMD-C-term<br>
-<ul><li> Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer
-</li></ul>
+* P6_YFP-C-term<br>
-<p><b>Method:</b><br />
-</p>
+* Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer
-<ul><li> 50µl PCR mix of each plasmid= 10µl HF-Buffer; 1µl dNTPs(10mM); forward and reverse primer each 2,5µl (10µM); template DNA: 1µl of 200ng/µl scFv--&gt; 200ng, 5µl of BBa_E0030 with EYFP (46,3ng/µl--&gt; ca. 230ng),5µl of BBa-KI57000 with transmembrane domain (43,9ng/µl --&gt; ca. 230ng); Phusion DNA polymerase 0,5µl; nclease-free water ad to 50µl <br />
-</li></ul>
+<b>Method:</b><br>
-<ul><li> PCR-program: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 11´´ at 72°C; final-Elongation 10´at 72°C; 30 cycles
-</li></ul>
+* 50µl PCR mix of each plasmid= 10µl HF-Buffer; 1µl dNTPs(10mM); forward and reverse primer each 2,5µl (10µM); template DNA: 1µl of 200ng/µl scFv--> 200ng, 5µl of BBa_E0030 with EYFP (46,3ng/µl--> ca. 230ng),5µl of BBa-KI57000 with transmembrane domain (43,9ng/µl --> ca. 230ng); Phusion DNA polymerase 0,5µl; nclease-free water ad to 50µl <br>
-<p><br />
-</p><p><b>Further Tasks:</b><br />
+* PCR-program: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 11´´ at 72°C; final-Elongation 10´at 72°C; 30 cycles
-</p>
-<ul><li> gelelectrophoresis
+<br>
-</li></ul>
-<p><br />
+<b>Further Tasks:</b><br>
-</p>
+* gelelectrophoresis
+<br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: gelelectrophoresis of extended genes after extension-pcr</p>
-<p><b>Investigators:</b> Sascha<br />
-</p><p><br />
+<b>Investigators:</b> Sascha<br>
-</p><p><b>Aim:</b> separation of extended genes scFv-TEV, TEV-TMD, EYFP in 1% agarosegel<br />
-</p><p><b>Materials:</b><br />
+<br>
-</p>
-<ul><li> agarose
+<b>Aim:</b> separation of extended genes scFv-TEV, TEV-TMD, EYFP in 1% agarosegel<br>
-</li></ul>
-<ul><li> 1xTAE-buffer
+<b>Materials:</b><br>
-</li></ul>
-<ul><li> 10xFD Green Buffer
+* agarose
-</li></ul>
-<ul><li> extended genes
+* 1xTAE-buffer
-</li></ul>
-<p><br />
+* 10xFD Green Buffer
-</p><p><b>Method:</b><br />
-</p>
+* extended genes
-<ul><li> 1% agarosegel
-</li></ul>
+<br>
-<ul><li> 70 min at 105V
-</li></ul>
+<b>Method:</b><br>
-<p><b>Results:</b><br />
-</p><p><b>Further Tasks:</b><br />
+* 1% agarosegel
-</p>
-<ul><li> gelextraction
+* 70 min at 105V
-</li></ul>
-<p><br />
+<b>Results:</b><br>
-</p>
+<b>Further Tasks:</b><br>
+* gelextraction
+<br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: gelextraction of extended genes after extension-pcr
 </p>
-<p><b>Investigators:</b> Sascha<br />
-</p><p><br />
+<b>Investigators:</b> Sascha<br>
-</p><p><b>Aim:</b> gelextraction of extended genes(scFv-TEV, TEV-TMD, EYFP) out of 1% agarosegel <br />
-</p><p><b>Method:</b><br />
+<br>
-</p>
-<ul><li> DNA extracted according to the manual
+<b>Aim:</b> gelextraction of extended genes(scFv-TEV, TEV-TMD, EYFP) out of 1% agarosegel <br>
-</li></ul>
-<p><b>Results: concentration measuremnt using nanodrop</b> <br />
+<b>Method:</b><br>
-</p>
-<ul><li> concentrations of extended scFv:
+* DNA extracted according to the manual
-</li></ul>
-<ul><li> concentrations of extended TMD:
+<b>Results: concentration measuremnt using nanodrop</b> <br>
-</li></ul>
-<ul><li> concentrations of extended EYFP:
+* concentrations of extended scFv:
-</li></ul>
-<p><b>Further Tasks:</b><br />
+* concentrations of extended TMD:
-</p>
-<ul><li> assembly-pcr
+* concentrations of extended EYFP:
-</li></ul>
-<p><br />
+<b>Further Tasks:</b><br>
-</p>
+* assembly-pcr
+<br>
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct
 </p>
-<p><b>Investigators:</b> Sascha<br />
-</p><p><br />
+<b>Investigators:</b> Sascha<br>
-</p><p><b>Aim:</b> assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct <br />
-</p><p><b>Materials:</b><br />scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP<br />
+<br>
-</p>
-<ul><li> P7_Gesamtanfang (forward-primer)<br />
+<b>Aim:</b> assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct <br>
-</li></ul>
-<ul><li> P8_Gesamtende (reverse-primer)<br />
+<b>Materials:</b><br>scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP<br>
-</li></ul>
-<ul><li> Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer
+* P7_Gesamtanfang (forward-primer)<br>
-</li></ul>
-<p><b>Method:</b><br />
+* P8_Gesamtende (reverse-primer)<br>
-</p>
-<ul><li> first assembly-pcr-mix--&gt; 150:50: 10µl HF-Buffer; 1µl dNTPs(10mM); 5µl of extended TMD (30ng/µl --&gt; 150ng), 5µl of extended EYFP (10ng/µl --&gt; 50ng), 2µl of extended scFv (25ng/µl --&gt; 50ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase<br />
+* Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer
-</li></ul>
-<ul><li> second assembly-pcr-mix--&gt; 90:30: 10µl HF-Buffer; 1µl dNTPs(10mM); 2,5µl of extended TMD (30ng/µl --&gt; 90ng), 3µl of extended EYFP (10ng/µl --&gt; 30ng), 1µl of extended scFv (25ng/µl --&gt; 25ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase<br />
+<b>Method:</b><br>
-</li></ul>
-<ul><li> PCR-program to let the extended genes prime each other: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 15 cycles
+* first assembly-pcr-mix--> 150:50: 10µl HF-Buffer; 1µl dNTPs(10mM); 5µl of extended TMD (30ng/µl --> 150ng), 5µl of extended EYFP (10ng/µl --> 50ng), 2µl of extended scFv (25ng/µl --> 50ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase<br>
-</li></ul>
-<p><br />
+* second assembly-pcr-mix--> 90:30: 10µl HF-Buffer; 1µl dNTPs(10mM); 2,5µl of extended TMD (30ng/µl --> 90ng), 3µl of extended EYFP (10ng/µl --> 30ng), 1µl of extended scFv (25ng/µl --> 25ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase<br>
-</p>
-<ul><li> after annealing of extended genes to each other 2,5µl of primer forw_P7_Gesamtanfang and primer rev_P8_Gesamtende were added
+* PCR-program to let the extended genes prime each other: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 15 cycles
-</li></ul>
-<ul><li> PCR-prgram with end-primers: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 57°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 27 cycles
+<br>
-</li></ul>
-<p><br />
+* after annealing of extended genes to each other 2,5µl of primer forw_P7_Gesamtanfang and primer rev_P8_Gesamtende were added
-</p><p><br />
-</p>
+* PCR-prgram with end-primers: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 57°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 27 cycles
-<ul><li> Gelelectrophoresis at 105V for 75`
-</li></ul>
+<br>
-<p><b>Results:</b> <br />
-</p>
+<br>
-<ul><li> extraction of wrong 1100bp DNA-bond
-</li></ul>
+* Gelelectrophoresis at 105V for 75`
-<p><b>Further Tasks:</b><br />
-</p>
+<b>Results:</b> <br>
-<ul><li> assembly-pcr
-</li></ul>
+* extraction of wrong 1100bp DNA-bond
-<ul><li> extraction of correct DNA (1701bp)
-</li></ul>
+<b>Further Tasks:</b><br>
-<p><br />
-</p>
+* assembly-pcr
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=33" title="Edit section: 2012-07-28">edit</a>]</span> <span class="mw-headline" id="2012-07-28_2"><p style="background-color: rgb(240, 20, 70);">2012-07-28</p></span></h3>
+* extraction of correct DNA (1701bp)
+<br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-28</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct
 </p>
-<p><b>Investigators:</b> Sascha, Tarek<br />
-</p><p><br />
+<b>Investigators:</b> Sascha, Tarek<br>
-</p><p><b>Aim:</b> assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct <br />
-</p><p><b>Materials:</b><br />scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP<br />
+<br>
-</p>
-<ul><li> P7_Gesamtanfang (forward-primer)<br />
+<b>Aim:</b> assembly-pcr with extended genes to scFv-TEV-TMD-EYFP geneconstruct <br>
-</li></ul>
-<ul><li> P8_Gesamtende (reverse-primer)<br />
+<b>Materials:</b><br>scFv anti-EGFR, BBa-KI57000 with transmembrane domain; BBa_E0030 with EYFP<br>
-</li></ul>
-<ul><li> Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer
+* P7_Gesamtanfang (forward-primer)<br>
-</li></ul>
-<p><b>Method:</b><br />
+* P8_Gesamtende (reverse-primer)<br>
-</p>
-<ul><li> first assembly-pcr-mix--&gt; 90:30: 10µl HF-Buffer; 1µl dNTPs(10mM); 2,5µl of extended TMD (30ng/µl --&gt; 90ng), 3µl of extended EYFP (10ng/µl --&gt; 30ng), 1µl of extended scFv (25ng/µl --&gt; 25ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase<br />
+* Phusion -polymerase, dNTPs (10mM), Phusion HF-Buffer
-</li></ul>
-<ul><li> second assembly-pcr-mix--&gt; 140:20: 10µl HF-Buffer; 1µl dNTPs(10mM); 1µl of extended TMD (140ng/µl --&gt; 140ng), 12,5µl of extended EYFP (1,6ng/µl --&gt; 20ng), 4,8µl of extended scFv (4,2ng/µl --&gt; ca. 20ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase<br />
+<b>Method:</b><br>
-</li></ul>
-<ul><li> PCR-program to let the extended genes prime each other: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 15 cycles
+* first assembly-pcr-mix--> 90:30: 10µl HF-Buffer; 1µl dNTPs(10mM); 2,5µl of extended TMD (30ng/µl --> 90ng), 3µl of extended EYFP (10ng/µl --> 30ng), 1µl of extended scFv (25ng/µl --> 25ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase<br>
-</li></ul>
-<p><br />
+* second assembly-pcr-mix--> 140:20: 10µl HF-Buffer; 1µl dNTPs(10mM); 1µl of extended TMD (140ng/µl --> 140ng), 12,5µl of extended EYFP (1,6ng/µl --> 20ng), 4,8µl of extended scFv (4,2ng/µl --> ca. 20ng); nuclease-free water ad to 45µl; 0,5µl Phusion-polymerase<br>
-</p>
-<ul><li> after annealing of extended genes to each other 2,5µl of primer forw_P7_Gesamtanfang and primer rev_P8_Gesamtende were added
+* PCR-program to let the extended genes prime each other: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 55°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 15 cycles
-</li></ul>
-<ul><li> PCR-prgram with end-primers: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 57°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 27 cycles
+<br>
-</li></ul>
-<p><br />
+* after annealing of extended genes to each other 2,5µl of primer forw_P7_Gesamtanfang and primer rev_P8_Gesamtende were added
-</p><p><br />
-</p>
+* PCR-prgram with end-primers: initial Denat. 40´´ at 98°C; Denat 12´´ at 98°C; Annealing 15´´ at 57°C; Elongation 27´´ at 72°C; final-Elongation 10´at 72°C; 27 cycles
-<ul><li> Gelelectrophoresis at 105V for 85`
-</li></ul>
+<br>
-<p><b>Results:</b> <br />
-</p>
+<br>
-<ul><li> extraction of correct DNA (1701bp)
-</li></ul>
+* Gelelectrophoresis at 105V for 85`
-<p><b>Further Tasks:</b><br />
-</p>
+<b>Results:</b> <br>
-<ul><li> digestion of pcDNA5-FRT and geneconstruct scFv-TEV-TMD-EYFP
-</li></ul>
+* extraction of correct DNA (1701bp)
-<ul><li> ligation of plasmid and insert
-</li></ul>
+<b>Further Tasks:</b><br>
-<p><br />
-</p>
+* digestion of pcDNA5-FRT and geneconstruct scFv-TEV-TMD-EYFP
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=34" title="Edit section: 2012-07-31">edit</a>]</span> <span class="mw-headline" id="2012-07-31_2"><p style="background-color: rgb(240, 20, 70);">2012-07-31</p></span></h3>
+* ligation of plasmid and insert
+<br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-31</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Planning and reviewing the antibody construct for genesynthesis</p>
-<p><b>Investigators:</b> Maria <br />
-</p><p><br />
+<b>Investigators:</b> Maria <br>
-</p><p><b>Aim:</b> construct with scFv 425bla, LoxP and TEV recognition site, mVenus<br />
-</p><p><br />
+<br>
-</p><p><b>Date/Time:</b> 27th July 2012, 3 - 5 pm <br />
-</p><p><br />
+<b>Aim:</b> construct with scFv 425bla, LoxP and TEV recognition site, mVenus<br>
-</p><p><b>Materials:</b> Geneious <br />
-</p><p><br />
+<br>
-</p><p><b>Results:</b> antibody construct RCF25 <br />
-</p><p><br />
+<b>Date/Time:</b> 27th July 2012, 3 - 5 pm <br>
-</p><p><br />
-</p>
+<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=35" title="Edit section: 2012-07-31">edit</a>]</span> <span class="mw-headline" id="2012-07-31_3"><p style="background-color: rgb(240, 20, 70);">2012-07-31</p></span></h3>
+<b>Materials:</b> Geneious <br>
+<br>
+<b>Results:</b> antibody construct RCF25 <br>
+<br>
+<br>
+===<p style="background-color: rgb(240, 20, 70);">2012-07-31</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Construct for genesynthesis with human scFv 425-72000</p>
-<p><b>Investigators:</b> Maria <br />
-</p><p><br />
+<b>Investigators:</b> Maria <br>
-</p><p><b>Aim:</b> construct with human scFv 425-72000, LoxP and TEV recognition site, mVenus<br />
-</p><p><br />
+<br>
-</p><p><b>Date/Time:</b> 27th July 2012, 3 - 5 pm <br />
-</p><p><br />
+<b>Aim:</b> construct with human scFv 425-72000, LoxP and TEV recognition site, mVenus<br>
-</p><p><b>Materials:</b> Geneious <br />
-</p><p><br />
+<br>
-</p><p><b>Results:</b> antibody construct RCF25 <br />
-</p><p><br />
+<b>Date/Time:</b> 27th July 2012, 3 - 5 pm <br>
-</p>
-<h2><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=36" title="Edit section: Virus">edit</a>]</span> <span class="mw-headline" id="Virus">Virus</span></h2>
+<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=37" title="Edit section: 02.07.2012">edit</a>]</span> <span class="mw-headline" id="02.07.2012"><p style="background-color: rgb(240, 20, 70);"> 02.07.2012</p></span></h3>
+<b>Materials:</b> Geneious <br>
+<br>
+<b>Results:</b> antibody construct RCF25 <br>
+<br>
+==Virus==
+===<p style="background-color: rgb(240, 20, 70);"> 02.07.2012</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Topic: PCR</p>
-<p><b>Investigators:</b> Xenia and Kathi <br />
-</p><p><b>Aim:</b>
+<b>Investigators:</b> Xenia and Kathi <br>
-</p>
-<ul><li> to test the primer
+<b>Aim:</b>
-</li></ul>
-<ul><li> amplification of the cap and VP-region, insertion of kozak-, Sortasemotive-, mycTag- and restiction sites Sequence <br />
+* to test the primer
-</li></ul>
-<p><b>Materials:</b>
+* amplification of the cap and VP-region, insertion of kozak-, Sortasemotive-, mycTag- and restiction sites Sequence <br>
-</p>
-<ul><li> new primer combination (prr_VP2_pstI_Temp68 and prf_XbaI_kozak_So rtlN_myc_VP2 [c= 10 µM])<br />
+<b>Materials:</b>
-</li></ul>
-<p><b>Method:</b>
+* new primer combination (prr_VP2_pstI_Temp68 and prf_XbaI_kozak_So rtlN_myc_VP2 [c= 10 µM])<br>
-</p>
-<ul><li> polymerase chain reaction <br />
+<b>Method:</b>
-</li></ul>
-<p><b>Mastermix</b>
+* polymerase chain reaction <br>
-</p>
-<table border="1">
+'''Mastermix'''
+<table border=1>
 <tr>
-<td><b>reagenz</b> </td>
+<td>'''reagenz''' </td>
-<td><b>volumen [µL]</b> </td>
+<td>'''volumen [µL]''' </td>
 </tr>
@@ Line 1,941: / Line 3,075: @@
 <td>HE buffer</td>
 <td>5</td>
 </tr>
@@ Line 1,947: / Line 3,083: @@
 <td>dNTPs (NEB)</td>
 <td>1.25</td>
 </tr>
@@ Line 1,953: / Line 3,091: @@
 <td>Primer (prr_VP2_pstI_Temp68)</td>
 <td>1.0</td>
 </tr>
@@ Line 1,959: / Line 3,099: @@
 <td>Primer (prf_XbaI_kozak_So rtlN_myc_VP2)</td>
 <td>1.0</td>
 </tr>
@@ Line 1,965: / Line 3,107: @@
 <td> DNA (Plasmid) </td>
 <td> 1.0 </td>
 </tr>
@@ Line 1,971: / Line 3,115: @@
 <td> Phusion polymerase </td>
 <td> 1.0 </td>
 </tr>
@@ Line 1,977: / Line 3,123: @@
 <td> water </td>
 <td> 33.75 </td>
 </tr>
@@ Line 1,985: / Line 3,133: @@
 </table>
-<p><br />
-</p><p><b>program</b>
+<br>
-</p>
-<table border="1">
+<b>program</b>
+<table border=1>
 <tr>
-<td><b>step</b> </td>
+<td>'''step''' </td>
-<td><b>temperature [°C]</b> </td>
-<td><b>duration [s]</b> </td>
+<td>'''temperature [°C]''' </td>
-<td><b>cycles</b> </td>
+<td>'''duration [s]''' </td>
+<td>'''cycles''' </td>
 </tr>
@@ Line 2,001: / Line 3,155: @@
 <td> denaturation </td>
 <td> 95 </td>
 <td>120 </td>
 <td>1 </td>
 </tr>
@@ Line 2,009: / Line 3,167: @@
 <td> denaturation </td>
 <td> 95 </td>
 <td> 30 </td>
 <td> 30 </td>
 </tr>
@@ Line 2,017: / Line 3,179: @@
 <td> annealing </td>
 <td> 68 </td>
 <td> 60 </td>
 <td> 30 </td>
 </tr>
@@ Line 2,025: / Line 3,191: @@
 <td> elongation </td>
 <td> 72 </td>
 <td> 60 </td>
 <td> 30 </td>
 </tr>
@@ Line 2,033: / Line 3,203: @@
 <td> final elongation </td>
 <td> 72 </td>
 <td> 60 </td>
 <td> 1 </td>
 </tr>
 <tr><td> cooling </td>
 <td> 4 </td>
 <td> ∞ </td>
 <td> 1 </td>
 </tr>
@@ Line 2,049: / Line 3,227: @@
 </table>
-<p><b>Results:</b><br />
-</p><p><b>Further tasks:</b><br />
+<b>Results:</b><br>
-</p>
-<ul><li> agarose gel electrophoresis
+<b>Further tasks:</b><br>
-</li></ul>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=38" title="Edit section: 04.07.2012">edit</a>]</span> <span class="mw-headline" id="04.07.2012"><p style="background-color: rgb(240, 20, 70);"> 04.07.2012</p></span></h3>
+* agarose gel electrophoresis
+===<p style="background-color: rgb(240, 20, 70);"> 04.07.2012</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Topic: gel electrophoresis </p>
-<p><b>Investigator:</b> Laura <br />
+<b>Investigator:</b> Laura <br>
 <b>Aim:</b>
-</p>
-<ul><li> measurement of DNA-concentration of pcr product and DARPin+cmv plasmid
+* measurement of DNA-concentration of pcr product and DARPin+cmv plasmid
-</li><li> test pcr product and DRAPin+cmv plasmid<br />
-</li></ul>
+* test pcr product and DRAPin+cmv plasmid<br>
-<p><b>Materials:</b>
-</p>
+<b>Materials:</b>
-<ul><li> pcr product (02.07.) and DARPin+cmv Plasmid (Sven)
-</li></ul>
+* pcr product (02.07.) and DARPin+cmv Plasmid (Sven)
-<p><b>Method:</b>
-</p>
+<b>Method:</b>
-<ul><li> agarose gel electrophoresis<br />
-</li><li> nanodrop
+* agarose gel electrophoresis<br>
-</li></ul>
-<p><b>Results:</b>
+* nanodrop
-</p>
-<ul><li> DNA-concentrations:
+<b>Results:</b>
-<ul><li> pcr-prduct: 266.1 ng/µL
-</li><li> plasmid: 441.4 ng/µL
+* DNA-concentrations:
-</li></ul>
-</li><li> gel electrophoresis
+** pcr-prduct: 266.1 ng/µL
-<ul><li> pcr product present but concentration too high --&gt; next time better: serial dilution of pcr product!<br />
-</li></ul>
+** plasmid: 441.4 ng/µL
-</li></ul>
-<p>IMPORTANT!: Our primer is wrong! we have put the C-terminal sortase-motiv into our primer, but we just need the N-terminal sortase-tag (glycin-rests)
+* gel electrophoresis
-<b>further tasks:</b><br />
+** pcr product present but concentration too high --> next time better: serial dilution of pcr product!<br>
+IMPORTANT!: Our primer is wrong! we have put the C-terminal sortase-motiv into our primer, but we just need the N-terminal sortase-tag (glycin-rests)
+<b>further tasks:</b><br>
 design new primer
-</p>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=39" title="Edit section: 04.07.2012">edit</a>]</span> <span class="mw-headline" id="04.07.2012_2"><p style="background-color: rgb(240, 20, 70);"> 04.07.2012</p></span></h3>
+===<p style="background-color: rgb(240, 20, 70);"> 04.07.2012</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Topic: Primer design - Cloning: Change the C-terminal Sortase-Tag against the N-terminal </p>
-<p><b>Investigators:</b>Tobias and Xenia <br />
-</p><p><b>Aim:</b>
+<b>Investigators:</b>Tobias and Xenia <br>
-</p>
-<ul><li> Change the C-terminal sortase-tag against the N-terminal <br />
+<b>Aim:</b>
-</li></ul>
-<p><b>Materials:</b> <br />
+* Change the C-terminal sortase-tag against the N-terminal <br>
-</p>
-<ul><li> prf_XbaI_kozak_SortaseMotivN_myc_VP2
+<b>Materials:</b> <br>
-</li></ul>
-<p><b>Method:</b> Geneious<br />
+* prf_XbaI_kozak_SortaseMotivN_myc_VP2
-</p><p><b>Results:</b>
-</p>
+<b>Method:</b> Geneious<br>
-<ul><li> prf_Xba1 koz_GGGGG_VP2 (forward primer)
-</li></ul>
+<b>Results:</b>
-<ul><li> prf_XbaI_koz_GGGGG_myc_VP2 (forward primer)
-</li></ul>
+* prf_Xba1 koz_GGGGG_VP2 (forward primer)
-<p>the sortase-tag was changed in both primers and prf_Xba1 koz_GGGGG_VP2 contain no myc-tag<br />
-</p><p><b>Further tasks:</b><br />
+* prf_XbaI_koz_GGGGG_myc_VP2 (forward primer)
-</p><p>PCR
-</p>
+the sortase-tag was changed in both primers and prf_Xba1 koz_GGGGG_VP2 contain no myc-tag<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=40" title="Edit section: 11.07.2012">edit</a>]</span> <span class="mw-headline" id="11.07.2012"><p style="background-color: rgb(240, 20, 70);"> 11.07.2012</p></span></h3>
+<b>Further tasks:</b><br>
+PCR
+===<p style="background-color: rgb(240, 20, 70);"> 11.07.2012</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Topic: PCR - Cloning: PCR using the new forward primers</p>
-<p><b>Investigators:</b> Kathi and Laura <br />
-</p><p><b>Aim:</b>
+<b>Investigators:</b> Kathi and Laura <br>
-</p>
-<ul><li> PCR using the both new forward primer (prf_Xba1 koz_GGGGG_VP2 and prf_XbaI_koz_GGGGG_myc_VP2)
+<b>Aim:</b>
-</li></ul>
-<ul><li> gel electrophoresis <br />
+* PCR using the both new forward primer (prf_Xba1 koz_GGGGG_VP2 and prf_XbaI_koz_GGGGG_myc_VP2)
-</li></ul>
-<p><b>Materials:</b> <br />
+* gel electrophoresis <br>
-</p>
-<ul><li> prf_Xba1 koz_GGGGG_VP2 (FP 1)--&gt; myc-
+<b>Materials:</b> <br>
-</li></ul>
-<ul><li> prf_XbaI_koz_GGGGG_myc_VP2(FP2)--&gt; myc+
+* prf_Xba1 koz_GGGGG_VP2 (FP 1)--> myc-
-</li></ul>
-<ul><li> prr_VP2_pstI_Temp68 (RP) <br />
+* prf_XbaI_koz_GGGGG_myc_VP2(FP2)--> myc+
-</li></ul>
-<p><b>Method:</b>
+* prr_VP2_pstI_Temp68 (RP) <br>
-</p>
-<ul><li> PCR (PCR protocol: 02.07.2012)
+<b>Method:</b>
-</li></ul>
-<ul><li> gel electropohoresis:&nbsp;: 2.1 and 0.5 µL pcr product of primer pair myc+ and myc- loaded on gel<br />
+* PCR (PCR protocol: 02.07.2012)
-</li></ul>
-<p><b>Results:</b><br />
+* gel electropohoresis: : 2.1 and 0.5 µL pcr product of primer pair myc+ and myc- loaded on gel<br>
-</p>
-<ul><li> gel electrophoresis: pcr product at 2000 bp present, primer dimer obvious<br />
+<b>Results:</b><br>
-</li></ul>
-<p><b>Further tasks:</b><br />
+* gel electrophoresis: pcr product at 2000 bp present, primer dimer obvious<br>
-</p>
-<ul><li> ligation
+<b>Further tasks:</b><br>
-</li></ul>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=41" title="Edit section: 12.07.2012">edit</a>]</span> <span class="mw-headline" id="12.07.2012"><p style="background-color: rgb(240, 20, 70);"> 12.07.2012</p></span></h3>
+* ligation
+===<p style="background-color: rgb(240, 20, 70);"> 12.07.2012</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;"> Topic: PCR </p>
-<p><b>Investigators:</b> Xenia and Laura <br />
-</p><p><b>Aim:</b>
+<b>Investigators:</b> Xenia and Laura <br>
-</p>
-<ul><li> test the primer using different annealing temperatures to get the right sequence of 2000 bp<br />
+<b>Aim:</b>
-</li></ul>
-<p><b>Materials:</b>
+* test the primer using different annealing temperatures to get the right sequence of 2000 bp<br>
-</p><p>primer combination:
-</p>
+<b>Materials:</b>
-<ul><li> prr_VP2_pstI_Temp68 and prf_XbaI_koz_GGGGG_VP2 (FP1)-&gt; myc-
-</li></ul>
+primer combination:
-<ul><li> prr_VP2_pstI_Temp68 (RP) and prf_XbaI_koz_GGGGG_myc_VP2(FP2)--&gt; myc+
-</li></ul>
+* prr_VP2_pstI_Temp68 and prf_XbaI_koz_GGGGG_VP2 (FP1)-> myc-
-<p><b>Method:</b>
-</p>
+* prr_VP2_pstI_Temp68 (RP) and prf_XbaI_koz_GGGGG_myc_VP2(FP2)--> myc+
-<ul><li> polymerase chain reaction <br />
-</li></ul>
+<b>Method:</b>
-<p><b>Mastermix</b>
-</p>
+* polymerase chain reaction <br>
-<table border="1">
+'''Mastermix'''
+<table border=1>
 <tr>
-<td><b>reagenz</b> </td>
+<td>'''reagenz''' </td>
-<td><b>volumen [µL]</b> </td>
+<td>'''volumen [µL]''' </td>
 </tr>
@@ Line 2,169: / Line 3,373: @@
 <td>HF buffer</td>
 <td>5</td>
 </tr>
@@ Line 2,175: / Line 3,381: @@
 <td>dNTPs (NEB)</td>
 <td>1.25</td>
 </tr>
@@ Line 2,181: / Line 3,389: @@
 <td>Primer (prr_VP2_pstI_Temp68)</td>
 <td>1.0</td>
 </tr>
@@ Line 2,187: / Line 3,397: @@
 <td>Primer (prf_XbaI_kozak_So rtlN_myc_VP2)</td>
 <td>1.0</td>
 </tr>
@@ Line 2,193: / Line 3,405: @@
 <td> DNA (Plasmid) </td>
 <td> 1.0 </td>
 </tr>
@@ Line 2,199: / Line 3,413: @@
 <td> Phusion Polymerase </td>
 <td> 1.0 </td>
 </tr>
@@ Line 2,205: / Line 3,421: @@
 <td> water </td>
 <td> 33.75 </td>
 </tr>
@@ Line 2,213: / Line 3,431: @@
 </table>
-<p><br />
-</p><p><b>Program</b>
+<br>
-</p>
-<table border="2">
+'''Program'''
+<table border=2>
 <tr>
-<td><b>step</b> </td>
+<td>'''step''' </td>
-<td><b>Temperature [°C]</b> </td>
-<td><b>duration [s]</b> </td>
+<td>'''Temperature [°C]''' </td>
-<td><b>cycles</b> </td>
+<td>'''duration [s]''' </td>
+<td>'''cycles''' </td>
 </tr>
@@ Line 2,229: / Line 3,453: @@
 <td> denaturation </td>
 <td> 98 </td>
 <td> 30 </td>
 <td>1 </td>
 </tr>
@@ Line 2,237: / Line 3,465: @@
 <td> denaturation </td>
 <td> 98 </td>
 <td> 10 </td>
 <td> 30 </td>
 </tr>
@@ Line 2,245: / Line 3,477: @@
 <td> annealing </td>
 <td> 64; 68; 70; 72 </td>
 <td> 40 </td>
 <td> 30 </td>
 </tr>
@@ Line 2,253: / Line 3,489: @@
 <td> elongation </td>
 <td> 72 </td>
 <td> 40 </td>
 <td> 30 </td>
 </tr>
@@ Line 2,261: / Line 3,501: @@
 <td> final elongation </td>
 <td> 72 </td>
 <td> 300 </td>
 <td> 1 </td>
 </tr>
 <tr><td> cooling </td>
 <td> 4 </td>
 <td> ∞ </td>
 <td> 1 </td>
 </tr>
@@ Line 2,277: / Line 3,525: @@
 </table>
-<p><b>Results:</b><br />
-</p><p><b>Further tasks:</b>
+<b>Results:</b><br>
-</p>
-<ul><li> agarose gel electrophoresis
+<b>Further tasks:</b>
-</li></ul>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=42" title="Edit section: 13.07.2012">edit</a>]</span> <span class="mw-headline" id="13.07.2012"><p style="background-color: rgb(240, 20, 70);">13.07.2012</p></span></h3>
+* agarose gel electrophoresis
+===<p style="background-color: rgb(240, 20, 70);">13.07.2012</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: gel electrophoresis of the pcr product </p>
-<p><b>Investigators:</b>Xenia and Mario <br />
-<b>Aim:</b>gel electrophoresis of the pcr product (12.07.2012)<br />
+<b>Investigators:</b>Xenia and Mario <br>
-<b>material and method:</b><br />
-</p>
+<b>Aim:</b>gel electrophoresis of the pcr product (12.07.2012)<br>
-<ul><li> gel electrophoresis
-</li><li>samples:
+<b>material and method:</b><br>
-<ul><li> 4 µL dest. Wasser + 1 µL pcr sample + 1 µL loading dye<br />
-</li></ul>
+* gel electrophoresis
-</li></ul>
-<p><b>Results:</b><br />
+*samples:
-<a href="/iGEM/wiki2011/index.php/File:UP12_13.07.2012_PCR_Produkt.jpg" class="image"><img alt="UP12 13.07.2012 PCR Produkt.jpg" src="/iGEM/wiki2011/images/thumb/9/93/UP12_13.07.2012_PCR_Produkt.jpg/350px-UP12_13.07.2012_PCR_Produkt.jpg" width="350" height="263" /></a><a href="/iGEM/wiki2011/index.php/File:UP12_ladder.jpg" class="image"><img alt="UP12 ladder.jpg" src="/iGEM/wiki2011/images/thumb/9/96/UP12_ladder.jpg/150px-UP12_ladder.jpg" width="150" height="294" /></a><br />
-The fragment should have the size of 2000 bp, but the band is by 3000 bp<br />
+** 4 µL dest. Wasser + 1 µL pcr sample + 1 µL loading dye<br>
+<b>Results:</b><br>
+[[file:UP12_13.07.2012_PCR_Produkt.jpg‎|350 px]][[file:UP12_ladder.jpg|150px]]<br>
+The fragment should have the size of 2000 bp, but the band is by 3000 bp<br>
 <b>Further Tasks:</b>
-</p>
-<ul><li> test digestion
+* test digestion
-</li></ul>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=43" title="Edit section: 2012-17-07">edit</a>]</span> <span class="mw-headline" id="2012-17-07"><p style="background-color: rgb(240, 20, 70);">2012-17-07</p></span></h3>
+===<p style="background-color: rgb(240, 20, 70);">2012-17-07</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: test digestion</p>
-<p><b>Investigators:</b> Tobias <br />
-</p><p><b>Materials:</b><br />
+<b>Investigators:</b> Tobias <br>
-</p>
-<ul><li> pcr products of 02-07 and 12-07-2012 (Ta= 70°C)
+<b>Materials:</b><br>
-</li></ul>
-<ul><li> restriction enzymes (FastDigest XbaI, PstI)<br />
+* pcr products of 02-07 and 12-07-2012 (Ta= 70°C)
-</li></ul>
-<p><b>Method:</b>
+* restriction enzymes (FastDigest XbaI, PstI)<br>
-</p><p>digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL green-buffer + 17 µL water <br />
-</p><p><b>Results:</b><br />
+<b>Method:</b>
-</p><p><a href="/iGEM/wiki2011/index.php/File:UP12_17072012_digestion.png" class="image"><img alt="UP12 17072012 digestion.png" src="/iGEM/wiki2011/images/thumb/3/35/UP12_17072012_digestion.png/350px-UP12_17072012_digestion.png" width="350" height="342" /></a><a href="/iGEM/wiki2011/index.php/File:UP12_ladder.jpg" class="image"><img alt="UP12 ladder.jpg" src="/iGEM/wiki2011/images/thumb/9/96/UP12_ladder.jpg/150px-UP12_ladder.jpg" width="150" height="294" /></a>
-</p>
+digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL green-buffer + 17 µL water <br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=44" title="Edit section: 2012-18-07">edit</a>]</span> <span class="mw-headline" id="2012-18-07"><p style="background-color: rgb(240, 20, 70);">2012-18-07</p></span></h3>
+<b>Results:</b><br>
+[[file:UP12_17072012_digestion.png|350 px]][[file:UP12_ladder.jpg|150px]]<br>
+* caused on the gel qualtity: repetition of the digestion
+<b> Further Tasks: </b>
+* Digestion
+===<p style="background-color: rgb(240, 20, 70);">2012-18-07</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: preperative digestion an gel extraction of pcr fragments</p>
-<p><b>Investigators:</b> Tobias and Laura <br />
-</p><p><b>Materials:</b><br />
+<b>Investigators:</b> Tobias and Laura <br>
-</p>
-<ul><li> pcr-products of 02-07-2012 and 12-07-2012 (Ta= 64 °C and 68 °C)
+<b>Materials:</b><br>
-</li></ul>
-<ul><li> restriction enzymes (FastDigest XbaI, PstI)<br />
+* pcr-products of 02-07-2012 and 12-07-2012 (Ta= 64 °C and 68 °C)
-</li></ul>
-<p><b>Method:</b><br />
+* restriction enzymes (FastDigest (FD) XbaI, PstI)<br>
-</p><p>digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL Green-buffer + 17 µL water<br />
-</p><p><b>Results:</b><br />
+<b>Method:</b><br>
-</p><p><a href="/iGEM/wiki2011/index.php/File:UP12_17072012_preperative_digestion.jpg" class="image"><img alt="UP12 17072012 preperative digestion.jpg" src="/iGEM/wiki2011/images/thumb/8/85/UP12_17072012_preperative_digestion.jpg/350px-UP12_17072012_preperative_digestion.jpg" width="350" height="263" /></a><a href="/iGEM/wiki2011/index.php/File:UP12_ladder.jpg" class="image"><img alt="UP12 ladder.jpg" src="/iGEM/wiki2011/images/thumb/9/96/UP12_ladder.jpg/150px-UP12_ladder.jpg" width="150" height="294" /></a>
-</p>
+digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL FD green-buffer + 17 µL water<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=45" title="Edit section: 2012-27-07">edit</a>]</span> <span class="mw-headline" id="2012-27-07"><p style="background-color: rgb(240, 20, 70);">2012-27-07</p></span></h3>
+<b>Results:</b><br>
+[[file:UP12_17072012_preperative digestion.jpg|350 px]][[file:UP12_ladder.jpg|150px]]
+===<p style="background-color: rgb(240, 20, 70);">2012-27-07</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: digestion of pcr fragments and plasmid</p>
-<p><b>Investigators:</b> Tobias <br />
-</p><p><b>Materials:</b><br />
+<b>Investigators:</b> Tobias <br>
-</p>
-<ul><li> pcr-products of 12-07-2012
+<b>Materials:</b><br>
-</li></ul>
-<ul><li> plasmid (P10_pSB1C3_001_CMV_DARPin_ML_VP2/3_587KO_6xHis)
+* pcr-products of 12-07-2012
-</li></ul>
-<ul><li> restriction enzymes (FastDigest XbaI, PstI, SpeI)<br />
+* plasmid (P10_pSB1C3_001_CMV_DARPin_ML_VP2/3_587KO_6xHis)
-</li></ul>
-<p><b>Method:</b><br />
+* restriction enzymes (FastDigest (FD) XbaI, PstI, SpeI)<br>
-</p><p>digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL Green-buffer + 17 µL water<br />
-</p><p><b>Results:</b><br />
+<b>Method:</b><br>
-</p><p><a href="/iGEM/wiki2011/index.php/File:UP12_27072012_digestion.jpg" class="image"><img alt="UP12 27072012 digestion.jpg" src="/iGEM/wiki2011/images/thumb/b/bc/UP12_27072012_digestion.jpg/350px-UP12_27072012_digestion.jpg" width="350" height="263" /></a><a href="/iGEM/wiki2011/index.php/File:UP12_ladder.jpg" class="image"><img alt="UP12 ladder.jpg" src="/iGEM/wiki2011/images/thumb/9/96/UP12_ladder.jpg/150px-UP12_ladder.jpg" width="150" height="294" /></a>
-</p>
+digestion: 10 µL DNA + 1 µL of each enzyme + 2 µL FD green-buffer + 17 µL water<br>
-<h3><span class="editsection">[<a href="/iGEM/wiki2011/index.php?title=UP12_labjournal_july&amp;action=edit&amp;section=46" title="Edit section: 2012-01-08">edit</a>]</span> <span class="mw-headline" id="2012-01-08"><p style="background-color: rgb(240, 20, 70);">2012-01-08</p></span></h3>
+<b>Results:</b><br>
+[[file:UP12_27072012_digestion.jpg|350 px]][[file:UP12_ladder.jpg|150px]]
+===<p style="background-color: rgb(240, 20, 70);">2012-01-08</p>===
 <p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: Sequencing of pcr-pruducts</p>
-<p><b>Investigator:</b> Tobias <br />
-</p><p><b>Materials:</b><br />
+<b>Investigator:</b> Tobias <br>
-</p>
-<ul><li> PCR-products of 12-07-2012 (+myc and-myc)
+<b>Materials:</b><br>
-</li></ul>
-<ul><li> Primer: prr_VP2_pstI_Temp68 <br />
+* PCR-products of 12-07-2012 (+myc and-myc)
-</li></ul>
-<p><b>Method:</b>
+* Primer: prr_VP2_pstI_Temp68 <br>
-</p><p>GATC<br />
-</p><p><b>Results:</b><br />
+<b>Method:</b>
-</p>
+GATC<br>

Team:Potsdam Bioware/Lab/Labjournal/July

From 2012.igem.org

Latest revision as of 19:27, 25 September 2012

Contents

AID

2012-07-02

2012-07-03

2012-07-04

2012-07-05

2012-07-06

2012-07-07

2012-07-08

2012-07-09

2012-07-10

2012-07-11

2012-07-12

2012-07-13

2012-07-16

2012-07-23

2012-07-25

2012-07-26

2012-07-27

2012-07-28

2012-07-29

2012-07-30

2012-07-31

Antikörper

2012-07-06

2012-07-07

2012-07-10

2012-07-12

2012-07-15

2012-07-16

2012-07-17

2012-07-20

2012-07-26

2012-07-28

2012-07-31

2012-07-31

Virus

02.07.2012

04.07.2012

04.07.2012

11.07.2012

12.07.2012

13.07.2012

2012-17-07

2012-18-07

2012-27-07

2012-01-08