From 2012.igem.org

Revision as of 19:06, 25 September 2012

• Home
• Team
• Project
  • Why Beadzillus?
  • Bacillus Introduction
  • Bacillus BioBrickBox
  • GerminationSTOP
  • Sporobeads
  • Data
  • Applications
• Extras
  • Attributions
  • Collaborations
  • Registry
  • Bacillus Strains
  • Special: Inverter
  • Achievements
• Safety
  • Project Safety
  • Release for application
• Lab Notebook
  • Weekly Journal
  • Protocols
• Human Practice
  • SynBio Day
  • Students Practical Course
  • CAS SynBio Conference
  • Berlin Conference
• Sponsors

Inverter

The LMU-Munich 2011 Team started a project to convert a positive input signal into a negative output or a negative input signal into a positive output.

Last year LMU-Munich designed a metal-sensing device. However, it turned out that some of the promoters that respond to metal ions are negativly regulated. So there was a need of an inverter, a genetic part that converts the repression of the metal sensing promoter in a positive output.

Since such a genetic part would be a very beneficial tool, Julia, who also participated in iGEM 2011, continued the work from last year and got some great results.

• To get an explanation how it works and see the results: Data and Results
• How to compose your individual Inverter, over Fusions PCRs and 3a assemblies is explained here: Construct your own Inverter

Theory and Results

The [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823040 Inverter] is composed of the promoter one wants to invert, in this proof of principle case P_BAD (PCR of [http://partsregistry.org/Part:BBa_I0500 BBa_I0500]), which is induced by arabinose, which regulates the small RNA RyhB ([http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1852835/ Vecerek B., Bläsi U., 2007]). RyhB itself translationally inhibits uof_CGU (upstream of fur)([http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1852835/ Vecerek B., Bläsi U., 2007]) by binding and masking the Shine Dalgarno sequence. If this is translationally fused to a reporter, in this case lacZalpha (PCR from pRuof_CGU-lacZ from [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1852835/ Vecerek B., Bläsi U., 2007]), this too is translationally repressed. The repression of the reporter is dependent on the concentration of RyhB, and therefore the Induction of the pBAD promoter. The Induction of the pBAD promoter is inverted to a negative output of the reporter.

The ONPG assay below shows the function of this Inverter. The Signal of the lacZalpha is so low, as the pBAD promoter lacks the repressor binding sites, and is therefore quite leaky, which makes it less titratable. But as this peticuliar Inverter is just a proof of principle, it is not essential. The Inverter for the wanted Promoter and Output has to be constructed by FusionsPCR.

Construct your own Inverter

1. Primer design:

• To be inversed Promoter: BB-suffix + to be inversed Promoter primer forward (a), GTCTTCCTGATCGCGAGACA + to be inversed Promoter reverse primer (b)
• RyhB: TGTCTCGCGATCAGGAAGAC (RyhB fwd) (c), BB-suffix + AAAGCCAGCACCCGGCTGGCTAAG (RyhB rev) (d)
• uof: BB-prefix + GTGGTTTTCATTTAGGCGTG (Uof fwd) (e), Output/Reporter forward primer + GTTATCAGTCATGCGGAATC (uof rev) (f)
• Output/Reporter: Forward primer without BB-prefix (g), Reverse primer with BB-suffix (h)

2. PCRs and Fusion PCRs:

• basic PCRs: To be inversed Promoter (a+b), RyhB (c+d), uof (e+f), Output/Reporter (g+h)
• Fusion PCRs: ~ 200 ng equimolar with forward primer of the front and reverse primer of the back fusion part: to be inversed promoter to RyhB (a+d) and uof to Output/Reporter (e+h)

3. 3a assemblies

• 3a assembly of Output/Reporter with a constitutive/inducible promoter like BBa_R0011
• 3a assembly of to be inverted promoter + RyhB with product of step above