Team:LMU-Munich/Bacillus BioBricks

From 2012.igem.org

(Difference between revisions)
Line 260: Line 260:
==''Bacillus'' Reporters  [[File:LMU Reporter.png|50px]]==
==''Bacillus'' Reporters  [[File:LMU Reporter.png|50px]]==
-
<p align="justify">We designed some reporters that are commonly used in ''B. subtilis'' or are codon optimized versions of popular reporter genes. All reporters have a modified iGEM Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RCF 25]) pre- and suffix for assembly of in-frame fusion proteins. Our prefix also includes the ''B. subitlis'' optimized RBS.</p>
+
We designed some reporters that are commonly used in ''B. subtilis'' or are codon optimized versions of popular reporter genes. All reporters have a modified iGEM Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RCF 25]) pre- and suffix for assembly of in-frame fusion proteins. Our prefix also includes the ''B. subitlis'' optimized RBS.
prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
Line 273: Line 273:
*'''mKate2'''      ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029])
*'''mKate2'''      ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029])
-
[[File:MKate Pellet.JPG|<p align="justify">'''''mKate2'' fused to the terminator B0014 under the control of P<sub>''liaI''</sub> (up), P<sub>''lepA''</sub> (middle) and the Anderson promoter J23101 (down) in pSB<sub>''Bs''</sub>1C.''' Pellets are ''Escherichia coli'' cells which contain the plasmid with the right insert.</p>|thumb|300px|left]]
+
[[File:MKate Pellet.JPG|<p align="justify">'''''mKate2'' fused to the terminator B0014 under the control of the Anderson promoter J23101 (up), P<sub>''liaI''</sub> (middle) and P<sub>''lepA''</sub> (down) in pSB<sub>''Bs''</sub>1C.''' Pellets are ''Escherichia coli'' cells which contain the plasmid with the right insert.</p>|thumb|300px|left]]
<p align="justify">We synthesized this monomeric far-red fluorescence protein with a codon-optimized version for the use in ''B. subtilis'' with pre- and suffix of the Freiburg standard. We cloned this reporter in front of the terminator B0014. For the evaluation this reporter was successfully combined with the promoters P<sub>''liaI''</sub>, P<sub>''lepA''</sub> and the Anderson promoter J23101 in the empty ''Bacillus'' vector pSB<sub>''Bs''</sub>1C from our '''''Bacillus''B'''io'''B'''rick'''B'''ox. At the moment we have the right clones of ''B. subtilis'' with the integrated construct. Unfortunately we have no equipment to measure this reporter. Neither our plate reader nor the fluorescent microscope has the required filters.</p>
<p align="justify">We synthesized this monomeric far-red fluorescence protein with a codon-optimized version for the use in ''B. subtilis'' with pre- and suffix of the Freiburg standard. We cloned this reporter in front of the terminator B0014. For the evaluation this reporter was successfully combined with the promoters P<sub>''liaI''</sub>, P<sub>''lepA''</sub> and the Anderson promoter J23101 in the empty ''Bacillus'' vector pSB<sub>''Bs''</sub>1C from our '''''Bacillus''B'''io'''B'''rick'''B'''ox. At the moment we have the right clones of ''B. subtilis'' with the integrated construct. Unfortunately we have no equipment to measure this reporter. Neither our plate reader nor the fluorescent microscope has the required filters.</p>

Revision as of 12:52, 24 September 2012

iGEM Ludwig-Maximilians-Universität München Beadzillus

Team-LMU culture tubes.resized.jpg

The LMU-Munich team is exuberantly happy about the great success at the World Championship Jamboree in Boston. Our project Beadzillus finished 4th and won the prize for the "Best Wiki" (with Slovenia) and "Best New Application Project".

IGEM HQ LMU prize.jpg

[ more news ]

Sporenfreunde