Team:Leicester/September2012

(11:00) Nathan and Chris went to the lab and started to work out the concentrations of the 16s extracted DNA to run on the gel, ready for sequencing. We don't want to use up to much of our DNA so needed to work out the optimum amount to run on the gel.

(14:00) Calculations done, took some time as Chris had a meeting at 12 for a hour and a half. Had it checked and now are going to get ready to run 2μl of each of our sample, and 4μl of sample number 2 which has a lower ng/μl reading. As we have only a small amount of DNA we are to vary the amount of the markers for different concentrations of DNA to work out the concentration of our samples to make sure the nano-drop was accurate. After this we can get ready to sequence the DNA to find out what the bacteria is.

(15:45) Nathan loaded the gel and then put the gel lane organisation
x
x
marker 4μl
2 (4μl)
3 (2μl)
4 (2μl)
marker 2μl
5 (2μl)
6 (2μl)
marker 1μl
x
x
x
x
Gel is now running, and will be complete in 1 & 1/2 hours time.

(16:30) Group meeting to bring our supervisors up to speed with the project progress, and discuss terms and action plan for the following day, as well as a look into future plans.

(17:30) Meeting finished early so that Chris could stop the gel and then transilluminate to get a gel photo, allowing us to work out the concentration of the DNA more accurately and thus allowing us to work out how much to use for the sequencing to be done tomorrow.

(09:00 am) Some colonies from the growth curve experiment could be counted, but in general there was too much growth.

(09:15 am) The group worked on the wiki for the rest of the day writing the past weeks work in, making sure all the details were correct and in the right order, and then attributing the members as required.

(9:00) Chris and Luke discussed the pathways for the project, before a meeting at 11 with Dr Dagleish and Dr Badge to discuss what to do next. We are hoping at this stage, although late in the competition, to try and engineer a BioBrick. We are looking at the TodX, TodC1&2, TobA&B and other genes in the operon for toluene degradation which we think is also the pathway for the polystyrene degradation.

(12:00) After the meeting Chris and Luke started looking though the genomic sequences and BLAST searching for bacteria that had proteins similar to the ones above to PCR out; though Pseudomonas aeruginosa seems to have nothing, Pseudomonas putida F1 has all of the genes.

(15:00)Dr Badge and Chris set up the PCR reaction of the 16S to increase the amount of DNA in the forward and reverse directions (in separate tubes) ready for sequencing tomorrow. Chris then plated out the Yellow colonies, Orange colonies, and re streaked the 01#502 so we have fresh colonies ready to prepare them for storage as we are coming close to the end of the project.

(16:00) Chris is now writing up the wiki while Luke is looking through BLAST searches again to find proteins. Phil is currently getting spec readings for the mmp broth with the 01#502 which came out at mixed culture 0.334, orange culture 0.6 at OD600 blank being the mm, which looks good as there is no other carbon other than the polystyrene.

(09:00 am) An early start with no set experiment today. Two of the colonies were plated out to see if they are two forms of the same bacteria or simply two separate species. This required plates being made, then individual colonies picked out to streak them. Once finished it is a day working on modelling, writing protocol and other computer work before checking the results of the plates in the late afternoon.

(16:00 pm) Some spec readings were taken of the MMP broth, with the blank just being MM broth. At 600nm wavelength the results came back for the mixed culture as 0.334, and the orange culture as 0.6.

Nathan editing the wiki once more.

(14:00) Meeting to discuss important matters before going to Amsterdam. Everyone was brought up to speed with what each individual section of our project (modelling, lab work and chemistry) has done, found out and achieved. Job roles were assigned to each person to complete in labs and on the computer modelling.

(16:30) Luke has prepared more polystyrene minimal media plates ready for plating out some colonies from CSE kits, to see whether more positive results can be found from other samples.

(17:00) Will is making more minimal media from minimal broth, to make more polystyrene minimal media plates ready for the CSE kits and potentially the P. putida strains we may be getting shortly.

(17:05) Chris setting up ready for the boilate with a sample of our unknown bacteria to extract the DNA, ready to set an overnight PCR reaction so that we can sequence the 16S ribosome later on this week.

(17:20) Will has now taken over doing the boilate so that Chris can set up the master mix for the PCR reactions. As we are doing 14 PCR reactions we need to make up 270μl of the master mix which is enough for aliquoting 18μl into 15 reactions. reaction mixture list:
171μl PCR H₂0
60μl HF buffer
6μl dNTP's
15μl Primer A 28f AAGAGTTTGATCCTGGCTCAGA
15μl Primer B 519R GWATTACCGCGGCKGCTG
Template DNA to be added later as it is not PCR clean
3μl DNA Pol
These reagents were added then as the DNApol was in glycerol the tube was mixed and spun for a second to remove bubbles. dNTPs cannot be freeze thawed so whatever was left was thrown. After this, in the hood Chris took 18μl aliquots of the master mix into 9 separate PCR eppendorfs and prepared the -ve control while in the PCR hood with the PCR clean H2O. The tubes were then taken to the bench where the DNA and diluted bacteria were added, and the +ve and -ve controls (see gel lane organization) all samples were added at 2μl to make a final volume of 20μl.
PCR Cycle program used was iGEM16S which is as follows:
98 degrees C - 5 min
98 degrees C - 30 seconds
50 degrees C - 30 seconds
72 degrees C - 2 minutes
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction)

Also our organic chemists, Reema and Mohammed, have been designing a number of mechanisms.

(9:00) Chris, Will, Emily and Luke in lab, Anthony and Phil in computer lab. Luke is writing the protocol page on the wiki, while Chris is making a 2% gel ready to run the PCR reaction mixture. Will is currently trying to track down some of the P. putida F1 strain which we may have located. Luke is writing up some of the protocol in the project section of the wiki.

(9:40) Chris has poured the gel which is setting and is now going to prep the PCR reaction mixtures adding 5μl of loading dye to each of the mixtures, ready for them to be run once the gel has set.

( 11:16) Chris has now loaded the gel and is running it at 120 volts. Lane organisation:
1) +ve control 10ng P. aeruginosa DNA from the Maxwell prep
2) +ve control 10ng P. aeruginosa DNA from the Maxwell prep
3) Neat orange culture DNA
4) x10^-1 dilution Orange culture DNA
5) x10^-2 dilution Orange culture DNA
6) x10^-3 dilution Orange culture DNA
7) x10^-4 dilution Orange culture DNA
8) Neat Yellow culture DNA
9) x10^-1 dilution Yellow culture DNA
10) x10^-2 dilution Yellow culture DNA
11) x10^-3 dilution Yellow culture DNA
12) 5μl Marker 100bp thermo scientific
13) -ve Bench H20
14) -ve Hood PCR H20
Luke has prepared the Sau3AI partial digest. This time the experiment will only run for 30 minutes as from the last test the only lanes which were digested enough were the times 5-15 minutes. A "no enzyme" control will also be run.

(12:30) The sequencing results of the 16S ribosomal DNA came back, so Chris and Luke did a BLAST Search to find the genus of the bacteria cultured from the 01#502 CSE kit, which turns out to be a Pseudomonas of unknown species.

(13:20) Chris stopped the gel and went down to the transilluminator with Emily to get a gel photo:

The x10^-2 and lower dilutions showed no bands, but the 0 dilution and x10^-1 dilutions worked well

The PCR was re-run over night with the x10^-1 orange dilution and the 0 yellow dilution with 5 of each to make sure that we have enough DNA to Sequence, as the amount recovered from this gel may not be enough for the sequencing. This is being done as there are two different colour bacteria growing, to see if these are two different species of bacteria, or the same one with a different morphology of colony. Chris and Emily are now going to do the QIAGEN gel extraction of yesterday's PCR to see how much can be recovered; more will be amplified over night. Will is making a gel for Luke's Sau3AI digest, which has now finished and is ready to be run.

(15:10) Chris and Emily have now cut the gel and have removed and weighed the samples of DNA, Chris is now adding the QG buffer at x6 the amount in μl of the amount of agarose there is. Emily is now going to put the samples in the 50 degree incubator and vortex every 2 minutes to dissolve the agarose.

(15:30) Chris and Luke just realised that the Sau3AI digest was carried out at 37^o again rather than at the room temp we were going to try to see if this produced better bands. So we will have to re run this experiment, however we are still going to run the gel to see how it went and confirm the need to reduce the activity of the enzyme.

Will is speccing the experiment that Nathan set up on the 31st, after 2 day's extra growth; mmb with 5% poly, OD600 mixed = 0.053 at a 10x dilution so 0.53 Orange is 0.072 at a x10 dilution so 0.72 which is higher than before, so it looks to be that the bacteria is growing in the broth with no other carbon other than the sugar beads at 5% concentration. To confirm this will is re doing the experiment with more controls totalling at 8 tubes (Will to put protocol in here).

(16:00) Will is taping the shaker to the bench to prevent it from moving. Tony is loading up a gel using Luke's Sau3AI digest from earlier. Chris and Emily are extracting DNA from the earlier electrophoresis using a QIAGEN QIAquick Gel Extraction Kit. Luke is writing up protocol for some of the experiments we've done so far in the projects.

(16:30) Chris is now doing the boilate for tonight's PCR of the 16S yellow and orange colonies; only the 5 neat yellow cultures and 5 x10^-1 orange cultures will be PCRed as these seem to be the best, though it looks like we don't have enough DNA to sequence.

(17:15) Emily is finishing off the boilate, doing the centrifuge step, removal of the supernatant and doing the dilutions while Chris is in the PCR hood setting up the master mix.

(17:30) Luke transilluminates the Sau3A1 digest from earlier:

(17:45) Chris is just adding the DNA to the samples ready to put them in the PCR machine, Program to be used is the iGEM16S which is as follows:
98 degrees C - 5 min
98 degrees C - 30 seconds
50 degrees C - 30 seconds
72 degrees C - 2 minutes
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction)

(9:00) Chris, Will and Luke in lab, Phil in computer lab. Will started to make a new 2% gel ready for the PCR samples which Chris is preparing, Luke is getting ready for the Sau3A1 digest at room temp

(10:30) Luke has almost finished the Sau3A1 prep and Chris is re-making one of the gels. Will is making another 2% gel ready for the "Gelception" gel and is waiting on someone to help with the Nanodrop of the gel extraction from yesterday.

(12:10) After having a lot of problems with gel making today, Chris is finally loading the PCR gel from last nights PCR reaction this time loading as much of the sample as possible being 22ul. This will be ran for 2.5 hours at 120volts to make sure the bands are well separated for the gel extraction. Sau3A1 prep is finished and the samples have been put into the freezer ready to be run on Monday.

(13:00) Working lunch break for Chris and Luke, looking at the primer designs for BioBrick.

(15:35) Luke is now designing the primers ready to order for Monday morning. The gel is now finished so Chris, Luke and Emily take that down to be transilluminated. We also take down some plates, as some Pseudomonas species' fluoresce under UV, and benzene rings under UV can also fluoresce. The gel looks like this:

(16:00) None of the plates fluoresced under UV, though this may be due to the wavelength different wavelengths will be tried. Will is now wrapping the PCR gel ready for gel extraction on Monday. As the Nanodrop results were low for yesterday's gel extraction from the PCR at 4.8 for 0range 5.1 for mixed and 3.2 for yellow when the two extracts were combined, Chris is going to do a PCR of these samples to increase the amount of DNA. The "Gelception" gel is to be run on Monday as there isn't enough time to run it today.

(16:30) Luke has finished the primer sequences and has sent them to Dr Badge to be checked and ordered. Chris is now setting up the master mix for the PCR in the PCR hood as we are doing 13 PCR reactions, we need to make up 270µl of the master mix which is enough for aliquots of 18µl in 15 reactions. Reaction mixture list:
171µl PCR H₂0
60µl HF buffer
6µl dNTPs
15µl Primer A 28f AAGAGTTTGATCCTGGCTCAGA
15µl Primer B 519R GWATTACCGCGGCKGCTG
2µl Template DNA to be added later to each PCR tube as it is not PCR clean
3µl DNA Polymerase
These reagents were added then as the DNApol was in glycerol the tube was mixed and spun for a second to remove bubbles. dNTPs cannot be freeze thawed so whatever was left was thrown. After this, Chris put 18µl aliquots of the master mix into 9 separate PCR eppendorfs and prepared the negative control while in the PCR hood with the PCR clean H2O. The tubes were then taken to the bench where the DNA was added, and the positive P.aeruginosa DNA and negative bench H₂O controls all samples were added at 2µl to make a final volume of 20µl.
PCR cycle program used was iGEM16S which is as follows:
98 degrees C - 5 min
98 degrees C - 30 seconds
50 degrees C - 30 seconds
72 degrees C - 2 minutes
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction) This time instead of loading bacteria from a boilate reaction Chris added in a 1/100 dilution of the three different gel extractions at 2µl to each tube to amplify the amount of DNA in these samples. Luke prepared the 1/100 samples by taking 1µl of the DNA and adding in 99µl of TE buffer. Reaction organisation ( CHECK ON CHRIS' SHEET TO SEE IF THIS IS CORRECT)
1 = positive P. aeruginosa control
2 = orange 100x dilution
3 = orange 100x dilution
4 = orange 100x dilution
5 = yellow 100x dilution
6 = yellow 100x dilution
7 = yellow 100x dilution
8 = yellow 100x dilution
9 = mixed 100x dilution
10 = mixed 100x dilution
11 = mixed 100x dilution
12 = negative control bench
13 = negative control hood

The reason why there are four reactions for the yellow is that it had the lowest ng/µl reading so thought this would be useful. As there was a problem with the dilutions in the boilate from Wednesday, we are running multiple reactions for each of the extractions in case one doesn't work.

Chris is meant to be having the week off, however is working from home today on the primers using in silico PCR and BLAST searching

(9:00) Nathan, Will, Luke and Anthony in lab. Nathan started preparation of yet another 0.7% gel, Will and Luke found DNA markers - "HyperLadder 1"

(10:30) Luke started loading a 2% agarose gel with DNA recovered from a previous gel from last week. The lane order is:
5µl DNA HyperLadder 1
x
4µl 100bp DNA ladder
x
20µl of DNA recovered from PCRed mixed colonies
x
2µl DNA HyperLadder 1
x
20µl of DNA recovered from PCRed Orange colonies
x
20µl of DNA recovered from PCRed Yellow colonies
x
1µl DNA HyperLadder 1
x This gel will be run at 120 volts

(11:00) Luke pours the 0.7% gel ready for running the Sau3A1 digests.

(11:50) Luke, Nathan and Tony go to transilluminate the gel run with recovered DNA from a previous gel, however, the bands have moved little, so we decide to run it for another hour.

(12:15) Tony loads Sau3A1 digests into wells on the set 0.7% gel. The lane organisation is:
x
DNA HyperLadder 1
x
DNA digest without enzyme
DNA digest after 0 minutes
DNA digest after 5 minutes
DNA digest after 10 minutes
DNA digest after 15 minutes
DNA digest after 20 minutes
DNA digest after 25 minutes
DNA digest after 30 minutes
x
DNA HyperLadder 1
x This will be run at 100 volts

(13:00) Luke and Nathan transilluminate the recovered DNA gel again, where the bands are a lot more spread:

(13:20) Luke and Will check Sau3A1 digest- we decide to leave it in for longer, though the loading dye appears to be running slightly quicker at one end of the gel

(13:30) Luke looks through the primers he helped to design on Friday, that Dr Badge has given a few tweeks, to add degeneracy to make them more likely to PCR out the genes we want to extract. Using BLAST searches of the FASTA data, it is apparent that the sequence in P. putida, regardless of strain, is remarkable conserved, with only one or two bases needing any degeneracy at primer binding sites. These modified primers are sent off to Dr Badge well before the deadline, so will hopefully be made up and sent to us before the end of the week, so Chris can start the PCRing out of genes we’ll hopefully be making into Biobricks.

(14:45) The Sau3A1 digest gel’s loading dye is a couple of inches off the end, so Luke and Will go to transilluminate it:

(9:00) Chris, Nathan, Luke and Will came into labs, while Phil was editing the Wiki at home. Day started with Will getting the P. putida streaked out onto LA so we can get single colonies and also getting the P. putida strains into LB so we can do the Maxwell prep tomorrow to extract DNA from these strains. Chris then started to prepare to run the 1/100 dilution PCR on a gel which has been kept in the fridge. Luke is currently writing up the Wiki for yesterday and Nathan is making a 2% gel ready to run the PCR reaction.

(11:00) Luke is preparing polystyrene 'sugar' for a polystyrene-propane experiment, to see whether propane, which is an expanding agent in the expansion of polystyrene could have caused the mystery Pseudomonas species to grow, rather than the polystyrene. Propane is already in the sugar before expansion, so when we got sent a box of 'sugar', we had to vent it for several days to remove the worst of the propane- even now though, if the lid is left on for a time, propane still builds up. By soaking the 'sugar' in varying concentrations of propane, mixed with minimal media broth upto 0.4 ml, to completely cover the 0.5g 'sugar' that will be put in each agar dish tomorrow. 0.4, 0.2, 0.1, 0.05 and 0.00ml of propane are used to soak 0.5g of polystyrene 'sugar' overnight on a shaker at 275RPM.
Meanwhile Nathan edits the Rockethub site in order to make it easier to read.

(14:30) After many problems again with the gel's Chris has finally been able to load the gel with 1/100 dilution the PCR reaction. Unfortunately with one of the gels the comb was to long and so the sample went straight through... meaning that we lost the majority of the first two samples.

Lane organisation
1 = P. aeruginosa +ve control
2 = orange 100x dilution
3 = orange 100x dilution
4 = orange 100x dilution
5 = yellow 100x dilution
6 = yellow 100x dilution
7 = yellow 100x dilution
8 = yellow 100x dilution
9 = mixed 100x dilution
10 = mixed 100x dilution
11 = mixed 100x dilution
DNA Hyperladder 5ul
12 = negative control bench
13 = negative control hood this is to be ran for 2.5 hours at 120V . each sample was 20μL apart from 1 and 2 which there were only 2μL and 5μL left respectively.

(15:00) Luke has made some corning broth solutions using the pentane, 'sugar' and bacteria. They are made with either 0.00, 0.05, 0.10, 0.20 or 0.40ml of pentane, and for each different amount of pentane used, we had 4 reaction conditions: with our yellow Pseudomonas culture, 0.5g of polystyrene 'sugar', with our yellow bacteria only, with 0.5g polystyrene 'sugar' only, and with neither polystyrene or bacteria. Each different condition's volume was made up to 10ml with the addition of our minimal salts medium broth. Along with the 'sugar' soaking in pentane, this was put on our shaker at 240rpm overnight at room temperature to allow time to grow. We will spec them tomorrow, and if the set with polystyrene and bacteria have the same growth as those without polystyrene, but with bacteria, then pentane has little if any effect on the growth of the yellow colony.

(15:40) gel has been running for 1.1 hours now and the loading dye is almost at half way. Luke is now about to load the bacteria into the Pentane Poly experiment. Nathan is starting to do the gel extraction of the PCR reaction of the orange and yellow single 16S. primers have yet to arrive. Will had just spec'ed the experiment with the Yellow, Mixed and Orange colonies, which looks promising, however we are going to re spec, and do this experiment again in triplicate to make sure that it is not just chance, as well as the pentane with poly experiment to hopefully rule out this.

(16:00) Will has just added the yellow bacteria to the 10 corning tubes that need to be inoculated for the pentane test.

(17:00) Nathan and Will are doing the gel extraction, while Chris and Luke are righting on the wiki and now making a gel ready for tomorrow. There were a total of 22 extractions going on, Nathan's were the +ve aeruginosa then 1-5 were the orange, 6-10 were the yellow which have now been combined so we only have 3 tubes to nano tomorrow for Nathan which is equal to three lanes on the gel. Will was also extracting 10, however this was 3 orange PCR product gel extraction x100 dilution PCR product's 4 Yellow PCR product gel extraction 100x dilution PCR product and 3 of the mixed PCR product gel extraction x100 dilution PCR product's . the +ve control was unable to be exacted as not enough was loaded.

(17:50) Will has almost finished the gel extract, with one step left to before combining the tubes. Luke is just pouring the gel ready for running the gel-ception gel tomorrow. This will be the three samples of Nathan, as well as the 3 combined samples of Will's extract, which need Nano dropping before we run the gel to work out the amount of the marker to load.

(9:00) Luke, Chris, Nathan, Will and Phil are in the lab. Phil is counting up the contents of our swear/latejar to pay into our account later when the bank opens. He will also be decontaminating some things from our area in the class 2 lab. We're just sending/receiving emails at the moment.

(10:00) Luke is about to spec the pentane experiment from last night, as there has been some obvious growth. However after thought it may not be a very conclusive experiment. Will has now combined the tubes and is now doing a nano drop on the gel extraction's from yesterday so we can work out how much to run on the gel. Chris has just came back from getting the shoes Ellen from the environment team gave us as a Citizen Science experiment for phil to analyse and is now working out the amounts of extract to use on the gel-ception gel Lane organisation and volumes
x
x
4μL of DNA Hyperladder ( 600bp band = 48ng 400bp band = 32ng)
2μL of DNA from extract labelled 4 ( according to the Nano 32.8ng)
2μL of DNA from extract labelled A ( according to the Nano 24.6ng)
2μL of DNA Hyperladder ( 600bp band = 24ng 400bp band = 16ng )
2μL of DNA from extract labelled 8 ( according to the Nano 22.4ng)
2μL of DNA from extract labelled 10 ( according to the Nano 22.8ng)
2μL of DNA Hyperladder ( 600bp band = 24ng 400bp band = 16ng )
2μL of DNA from extract labelled 5 ( according to the Nano 21.0ng)
2μL of DNA from extract labelled 1 ( according to the Nano 17.4ng)
1ul of DNA Hyperladder ( 600bp band = 12ng 400bp band = 8ng )
x
x

(11:00) Luke has just finished specing the overnight broth cultures, though the results are inconclusive. We realised that we should have inoculated with a set amount of bacteria in solution, rather than just a swab (like we used). We will set up a rerun this afternoon so that we can analyse whether the bacteria use polystyrene or pentane in preference.

(11:20) Chris has just loaded the gel and it is running at 120V.

(11:45) Chris and Nathan head to the coffee room to discuss future ideas for the project as well as analysis on what we're currently doing.

(13:30) Luke is just starting the pentane experiment again (see yesterday). The protocol is virtually the same, though this time, he's using 0.1 ml less minimal media in the tubes needing the yellow bacteria, and replacing it with 0.1 ml of a 1ml yellow colony bacteria suspension in phosphate buffer solution (PBS)(so as to make the amounts of bacteria in the broths more constant to reduce error significantly). This could take a while. Chris stopped the gel and went down to the transilluminator:

As poor amounts of DNA have been successfully extracted so far, Chris is now troubleshooting the gel extraction kit. unfortunately it also means we have to gather and PCR more DNA again.

(15:00) Luke has just finished preparing the pentane experiment. We're hoping by reducing the errors in bacterial concentration, a pattern will be made clearer. The tubes used have just been put on a shaker, and started off at 240rpm. It will be sampled tomorrow morning, and then Friday morning to determine the growth. Chris has now found the 1/100 dilutions of the last gel extraction which we amplified the DNA of, however Tony and Phil are going to do the Boilate to obtain DNA and run this in the PCR as well.
Nathan and Will start off the triplicate experiment, first by making up a 1L minimal media mixture.

(15:30) to test the Gel extraction kit, Dr Badge supplied 1kb DNA ladder of known DNA concentration to pass through the coulomb to see what % recovery there is, or if there is no DNA recovery in the final aliquot as with the other gel extractions. This time using the new reagents from the box rather than the ones we have currently been using to see if this is the problem fingers crossed the new reagents will be better. if not, we will have to use the second gel extraction kit that we have.
With the minimal media prepared it is set up with 10 ml amounts in 20 corning tubes and 0.5g of polystyrene "sugar" is set up in the necessary tubes, and for the rest of the working day Will and Nathan work on inoculating each of the samples into their respective tubes, in preparation for further testing after staying in the shaker for enough time.

(16:00) Luke has gone to the coffee room to work on degenerate primers for the rest of the afternoon- its surprisingly difficult building in the degeneracy, as he's trying to build in as many alternative codons as possible (the reverse primers are the hardest).

(16:30) Chris has now finished the gel extraction and has put the tubes in the fridge ready to run in the morning . Chris is now setting up the master mix for the PCR in the PCR hood as we are doing 13 PCR reactions, we need to make up 270ul of the master mix which is enough for aliquots of 18µl in 15 reactions. Reaction mixture list:
171µl PCR H₂0
60µl HF buffer
6µl dNTPs
15µl Primer A 28f AAGAGTTTGATCCTGGCTCAGA
15µl Primer B 519R GWATTACCGCGGCKGCTG
2µl Template DNA to be added later to each PCR tube as it is not PCR clean
3µl DNA Polymerase
These reagents were added then as the DNApol was in glycerol the tube was mixed and spun for a second to remove bubbles. dNTPs cannot be freeze thawed so whatever was left was thrown. After this, Chris put 18µl aliquots of the master mix into 9 separate PCR eppendorfs and prepared the negative control while in the PCR hood with the PCR clean H2O. The tubes were then taken to the bench where the DNA was added, and the positive P. aeruginosa DNA and negative bench H₂O controls all samples were added at 2µl to make a final volume of 20µl.
PCR cycle program used was iGEM16S which is as follows:
98 degrees C - 5 min
98 degrees C - 30 seconds
50 degrees C - 30 seconds
72 degrees C - 2 minutes
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction)

DNA Samples: ( use this for loading of the gel)
1 = +ve control Aeruginosa
2 = 100x dilution of orange gel extract ( from previous)
3 = 100x dilution of mixed gel extract ( from previous)
4 = 100x dilution of yellow gel extract ( from previous)
5 = Yellow boilate
6 = Yellow boilate
7 = Yellow boilate
8 = Yellow boilate
9 = orange boilate
10 = orange boilate
11 = orange boilate
12 -ve control hood PCR water
13 -ve control bench H2O

(9:00) Will is making a gel ready to load the PCR reactions and the gel extraction test while Chris and Luke are writing up the wiki for yesterday.

(10:00) Luke has just made up and poured 2 gels ready for electrophoresis. Nathan removes the tubes from the PCR machine and loads them with dye, ready for gel electrophoresis.

(10:30) Phil loads the samples into a gel. This is the PCR which Chris did the previous night. Gel lane organisation:
1 = +ve control aeruginosa
2 = 100x dilution of orange gel extract (from previous)
3 = 100x dilution of mixed gel extract (from previous)
4 = 100x dilution of yellow gel extract (from previous)
5 = Yellow boilate
6 = Yellow boilate
7 = Yellow boilate
8 = Yellow boilate
9 = Orange boilate
10 = Orange boilate
11 = Orange boilate
12 = Marker Hyperladder 5μl
13 = -ve control hood PCR water
14 = -ve control bench H₂O
Each lane was loaded with 20μl of sample as this was the most you could accurately load.

(11:00) Chris is preparing the primers and showing Luke how to prepare the primers made up earlier today, ready for PCRing tonight. (need detail / protocol)

(13:00) Chris loaded and ran the gel extraction test at 120v on a 2% gel. For this you need to make dilutions of the marker DNA to 100ng/50ng total amount of DNA. Load only 100ng of the samples, taking off 10% of the total volume of the elution from the column.

(14:30) Delivery arrived from NewEngland Biolabs, a new sponsor of some competent cells as well as more DNA ladders etc (need detail). Luke and Phil transilluminate Phil's gel from earlier:

(14:40) Will is preparing the boilate reaction to extract DNA for the PCR later.

(15:00) Nathan is re doing the gel extraction test, while Phil is transilluminating the gel extraction test from earlier (no gel photo). The test recovered too little DNA which is why we are re doing the experiment with new reagents from a new kit. As the PE was a new set it must be the QG at fault. (need detail). Luke is taking 1ml aliquots out of the pentane experiment corning tubes that he set up yesterday. Another 1ml aliquot will be taken tomorrow to compare the differences in growth of the bacteria in different concentrations of pentane, with or without polystyrene.

(15:40) Nathan has almost finished doing the gel extraction test, and Phil is making a new gel ready for it to be run, Will is doing the boilate for the PCR which is to be loaded later, while Dr Badge is setting up the Maxwell prep of the DNA for the PCR as well. Chris is now to work out the reaction mixture for the PCR of the different bacteria with the different primers.

(15:45) Luke and Tony have just finished measuring the absorbances of the aliquots at 600nm of the pentane experiment:
Key:
0.XX pent – volume of pentane added to the minimal broth
Bac - 100µl of bacteria suspended in PBS added to the minimal broth
PS - 0.5g polystyrene ‘sugar’ added to the minimal broth
Abs - absorption at 600nm

Absorbance readings:
0.00 pent, Bac, PS Abs=0.292
0.00 pent, PS Abs=0.014
0.00 pent, Bac Abs=0.255
0.00 pent Abs=-0.009
0.05 pent, Bac, PS Abs=0.317
0.05 pent, PS Abs=0.003
0.05 pent, Bac Abs=0.259
0.05 pent Abs=0.001
0.10 pent, Bac, PS Abs=0.300
0.10 pent, Ps Abs=-0.025
0.10 pent, Bac Abs=0.250
0.10 pent Abs=-0.005
0.20 pent, Bac, PS Abs=0.182
0.20 pent, Bac Abs=0.007
0.20 pent, PS Abs=0.250
0.20 pent Abs=0.001
0.40 pent, Bac, PS Abs=0.203
0.40 pent, Bac Abs=-0.018
0.40 pent, PS Abs=0.260
0.40 pent Abs=0.026

The corning tubes will have another aliquot taken out tomorrow at 15:00, and absorbance will be measured again to determine growth. Hopefully the absorbance will change most in the tubes with polystyrene and bacteria in. Seeing as this is just for the yellow colonies, we will be repeating this experiment twice next week with our orange and mixed colonies.

(11:00) Luke and Will in labs. Luke's just tranilluminated the gel set up last night:

(11:20) Luke's just made up a gel ready for running the PCR from overnight.

(12:00) Luke and Will load up the gel with the PCR from last night, and start it running at 120 volts with the following lane organisation:
1 x
2 5µl DNA HyperLadder
3 P. aeruginosa
4 P. aeruginosa
5 P. putida strain A maxwell prep
6 P. putida strain B maxwell prep
7 Orange colony maxwell prep
8 Yellow colony maxwell prep
9 P. putida strain A boilate
10 P. putida strain B boilate
11 Orange colony boilate
12 Yellow colony boilate
13 -ve control bench
14 -ve control hood

(14:30) Will and Phil stop the gel and transilluminate it. The extractions don't appear to have worked unfortunately.

(15:00) Will and Phil spec the pentane experiment, and get these results: (notation is same as thursday:)
Absorbance readings:
0.00 pent, Bac, PS Abs=0.292
0.00 pent, PS Abs=0.014
0.00 pent, Bac Abs=0.255
0.00 pent Abs=-0.009
0.05 pent, Bac, PS Abs=0.317
0.05 pent, PS Abs=0.003
0.05 pent, Bac Abs=0.259
0.05 pent Abs=0.001
0.10 pent, Bac, PS Abs=0.300
0.10 pent, Ps Abs=-0.025
0.10 pent, Bac Abs=0.250
0.10 pent Abs=-0.005
0.20 pent, Bac, PS Abs=0.182
0.20 pent, Bac Abs=0.007
0.20 pent, PS Abs=0.250
0.20 pent Abs=0.001
0.40 pent, Bac, PS Abs=0.203
0.40 pent, Bac Abs=-0.018
0.40 pent, PS Abs=0.260
0.40 pent Abs=0.026

no labs at a weekend. Chris is planning Monday's lab work as there is a lot to get into the next few day's before wiki freeze. As well as that, while at work Chris thought up a new way to test if the bacteria are using residual pentane / removing residual pentane from the raw poly sugar to try on Monday. If this works we can confirm that the bacteria are growing with the polystyrene alone.

(8:30) Chris arrives at the lab and prepares the master mix for the PCR. Luke then takes over removing the aliquots when he gets in at 9:00, and the PCR tubes are put in a PCR machine at 10:00.

(9:30) Chris, Will and Nathan are setting up gel extractions using a new kit with a view to extracting the TodX gene later today. Will and Nathan have also made 2 gels.

(10:50) Chris set up aerating polystyrene experiment by putting 20g polystyrene in 500ml duran, putting it in the hybridiser at 60 degrees, to try and vaporise residue pentane in the sugar. Pentane boils at 37 degrees C so this is way above the boiling point so all of the pentane can be said to be removed without expanding, leaving just polystyrene. The hybridiser has no exposed elements so should be safe for the small amount of pentane left to be vaporised. two 10g amounts of poly have also been put into tubes and sealed to act as a time zero. These can then be used in a minimal broth poly orange and yellow growth experiment as we can be sure that there is no pentane left over.

(11:00) Luke has just analysed the pentane experiment results: there is clearly an increase in absorbance by bacteria as pentane concentration also increases. The presence of polystyrene sugar also appears to increase the bacteria's absorbance, indicating an increase in bacteria concentration. However, the bacteria could be growing using residue pentane within the sugar.

(13:00) gel extractions are now ready to be ran after nano dropping, and the PCR has finished, Chris changed the program for this run as there was a lot of other interference bands of other amplified areas of DNA with some very large... to combat this the extension time has been reduced to one minute to only give enough time to amplify the shorter bands
PCR cycle program used was iGEMTOL2 which is as follows:
98 degrees C - 5 min
98 degrees C - 30 seconds
65 degrees C - 30 seconds
72 degrees C - 1 minutes
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction)

(12:00) Luke is designing new primers for the genes we've managed to extract, that incorporate the biobrick prefix/suffixes.

(1:15) will did nano drop of gel extraction using a different kit- zymo.

(14:10) Chris has prepared and loaded the TobB and the TodF gels and has set them running at 120V for 2.5 hours, the gel extraction nano drop results had a lot of salt contamination, so we are now looking into trouble shooting this, however there was a ok amount of DNA recovery.

(16:20) Chris has finished the gel extraction of the remaining samples from the TodX gel putting through 2x 200μL 1x600μL and 1x400μL as although the protocol said 200μL twice, the bottle of the wash buffer said between 200μL and 600μL. as there was a lot of salt the extra washes should remove this.

(17:30) The gel extractions don't appear to have worked:

(9:00) started the day by setting up pcr.

(11:00) Chris prepared and loaded the PCR gel of the 16S samples from last night, running at 120V on a 2% gel for 2.5 hours lane organisation:
+ve Aeruginosa
orange boilate
orange boilate
orange boilate
yellow boilate
yellow boilate
yellow boilate
marker 5μL ( new England biolabs 100bp )
-ve bench
-ve hood

(12:00) Chris prepared and loaded the gel extractions, earlier on he ran though another 10μL of distilled water through the coulomb to see if there was any DNA left, so there are two lots of gel extractions being run. gel was ran at 120V on a 2% gel lane organisation:
4μL marker (New england Biolabs 100bp)
orange boilate (9) extraction
putida maxwell A(6B) extraction
putida Maxwell A(6A) extraction
4μL marker (New england Biolabs 100bp)
putida Maxwell B(5B) extraction
putida Maxwell B(5A) extraction
orange boilate (9) extraction number 2
putida maxwell A(6B) extraction number 2
putida Maxwell A(6A) extraction number 2
2μL marker (New england Biolabs 100bp)
putida Maxwell B(5A) extraction number 2
putida Maxwell B(5B) extraction number 2
1μL marker (New england Biolabs 100bp)

(13:40) Chris Stopped the PCR gel and the gel extraction gel:

(14:00) From this Chris is now setting up the samples for a sequencing reaction Dr Badge is going to run over night, only using the reverse primer. primer is diluted three fold from the 10μM concentration, and 2μL of each of the 5A and 5B are to b sequenced as these were the best extracts.

(14:30) after analysis of the 16S PCR from last night, there is contamination in the -ve controls, both bench and hood... this was using new polymerase, DNTP's and buffers so the only suspects for the contamination are the primers and PCR water. As we have ran out of PCR water this is going to be fresh for the next set of reactions, however the todC1 used the same water so we can compare when this is run on the gel.

(15:00) Chris is now preparing the todX PCR samples from this morning with the old polymerase (had a slight problem so the todC1 and todG PCR reactions used fresh Polymerase) this can test the polymerase for contamination from the 16s experiment. loading 5μL of loading dye into each sample. Luke and Chris are making two new gel's ready for these to be run, with the 3rd gel in the gel tank.

(16:20) Tony has now loaded the gel for the TodX PCR from this morning running it at 120V Lane organisation:
1 P. aeruginosa
2 P. aeruginosa
3 P. putida strain A maxwell prep
4 P. putida strain B maxwell prep
5 Orange colony maxwell prep
6 Yellow colony maxwell prep
7 P. putida strain A boilate
8 P. putida strain B boilate
9 Orange colony boilate
10 Yellow colony boilate
5μL marker (New england Biolabs 100bp)
11 -ve control bench
12 -ve control hood
Chris and Luke are editing the Wiki while the gel's are cooling.

(17:00) Chris is now setting up the Re amplification on the TodX Gel extraction, as there are only 5 samples the PCR has only been set up for 10 to save on reagents, only doing each one once and the controls. Chris is now setting up the master mix for the PCR in the PCR hood as we are doing 9 PCR reactions, we need to make up 180ul of the master mix which is enough for aliquots of 18ul in 10 reactions. Reaction mixture list:
112ul PCR H20
40ul HF buffer
4ul dNTPs
10ul Primer A TODXF 5'-atgcccgccagtctgacgcttg-3'
10ul Primer B TODXR 5'-accagccagcaccatgcggc-3'
Template DNA to be added later as it is not PCR clean
2ul DNA Polymerase
These reagents were added then as the DNApol was in glycerol the tube was mixed and spun for a second to remove bubbles. dNTPs cannot be freeze thawed so whatever was left was thrown. After this, Chris put 18ul aliquots of the master mix into 9 separate PCR eppendorfs and prepared the negative control while in the PCR hood with the PCR clean H2O. The tubes were then taken to the bench where the DNA was added, and the positive P. aeruginosa DNA and negative bench H2O controls all samples were added at 2ul to make a final volume of 20ul.
PCR cycle program used was iGEMTOL which is as follows:
98 degrees C - 5 min
98 degrees C - 30 seconds
50 degrees C - 30 seconds
72 degrees C - 1 minutes
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction)
the part in italics is the cycle which is repeated 30 times.

(17:40) Chris just loaded the PCR and is now preparing the samples to be ran over night on the gel at 20V. As there will be a lot of gels to do in the morning, we're thinking this is the best use of time. Luke is editing some of the modelling page and italicising bacteria names on the Wiki while Tony is re streaking the orange and yellow colonies. Lane organisation was the same for both todC1 and todG :
x
1 P. aeruginosa
2 P. aeruginosa
3 P. putida strain A maxwell prep
4 P. putida strain B maxwell prep
5 Orange colony maxwell prep
6 Yellow colony maxwell prep
7 P. putida strain A boilate
8 P. putida strain B boilate
9 Orange colony boilate
10 Yellow colony boilate
5µl DNA HyperLadder
11 -ve control bench
12 -ve control hood

(17:55) Luke has just stopped and transilluminated the gel ready for us to go home:

Chris has just finished loading the gel and has set it running at 20 volts.

(9:00) Chris came in and stopped the gel's with Luke and Nathan close behind. After transilluminating, Chris realised that the power pack was set too high (120v instead of 20v), so all of the DNA had run off the end of the gel:

This means that once the PCR has been stopped we will need to re-run these primers to re extract the DNA from yesterday. As all of the DNA had been run off the gel, Nathan is now remelting the gel so we can reuse it to save on costs, ready to run some of the TodX Gel extraction PCR amplification from last night's PCR. as this time the reaction should have only been able to amplify single bands, we are going to do a PCR purification rather than run it all and gel extract due to the low yields.

(10:15) Nathan has just finished making the first gel after a few problems with the melting. Luke is updating the modelling page and Chris is about to set up the PCR for the TodC1 and TodG samples. hopefully by the time these are ready we can then run 2µl of last nights PCR to see what bands are present.

(10:30) Chris is now setting up the master mix for the PCR of the TodG and TodC1 in the PCR hood as we are doing 12 PCR reactions, we need to make up 270ul of the master mix which is enough for aliquots of 18ul in 15 reactions. Reaction mixture list:
171ul PCR H20
60ul HF buffer
6ul dNTPs
15ul Primer A
15ul Primer B
Template DNA to be added later as it is not PCR clean
3ul DNA Polymerase
These reagents were added then as the DNApol was in glycerol the tube was mixed and spun for a second to remove bubbles. dNTPs cannot be freeze thawed so whatever was left was thrown. After this, Chris put 18ul aliquots of the master mix into 9 separate PCR eppendorfs and prepared the negative control while in the PCR hood with the PCR clean H2O. The tubes were then taken to the bench where the DNA was added, and the positive P. aeruginosa DNA and negative bench H2O controls all samples were added at 2ul to make a final volume of 20ul.
PCR cycle program used was iGEM16S which is as follows:
98 degrees C - 5 min
98 degrees C - 30 seconds
50 degrees C - 30 seconds
72 degrees C - 1 minutes
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction)
the text in italics is the cycle, which is repeated 30 times.

(11:30) Chris is now putting the DNA into the PCR reactions ready to run the PCR. Nathan is re making one of the gel's and Luke is editing the modelling page. Had a slight problem with the gel with a spillage so Chris and Sue are clearing that up making sure there is no ETBR on the surfaces. Luke is now making some more gel to replace the spilt stuff.

(12:00) PCR is now running and Chris is preparing the samples for running some of the TodX gel extraction re amplification gel as we are going to do PCR purification rather than gel extraction, only 2μL of the 5 reactions are to be loaded so we have 18 micro litres DNA to purify . Samples were made by adding 4μL of loading dye to 14μL of TE buffer and 2μL of each of the sample. the aeruginosa and -ve control's had 5μL of loading dye added and were loaded completly as they were more to test the PCR rather than for extraction of the DNA.

(12:40) Chris has now loaded the gel and is running it at 120V, Lane organisation:
x
-ve aeruginosa
-ve aeruginosa
5μL marker (New england Biolabs 100bp)
number 6A
number 6B
number 5A
number 5b
number 9
5μL marker (New england Biolabs 100bp)
-ve hood
-ve bench
x
x

(14:00) Gel has been transilluminated:

Chris is now going to do a PCR purification of the 18micro litres of the PCR left. fingers crossed this works well!

(15:00) Nathan is now preparing the samples of the PCR Chris set up this morning ready for loading while Luke is looking over the enzymes we need for the insertion of the DNA into the biobrick. PCR purification is done and Chris is getting it Nano dropped with Colin downstairs, Data to be added here soon, Looks good though! max of 47ng/ul min of 32ng/ul for the 5 samples so great results for the TodX PCR purification (QIAGEN).

(15:50) Chris and Luke have now loaded the samples on to the gel's and set them running at 120V until the end of the day and is now discussing the ligation with Dr Badge as well as trying to get some more 16S primers so we can do some more PCR on the orange and yellow bacteria. Lane organisation: (same for both gel's)
1 P. aeruginosa
2 P. aeruginosa
3 P. putida strain A maxwell prep
4 P. putida strain B maxwell prep
5 Orange colony maxwell prep
6 Yellow colony maxwell prep
7 P. putida strain A boilate
8 P. putida strain B boilate
9 Orange colony boilate
10 Yellow colony boilate
5µl marker (New england Biolabs 100bp)
11 -ve control bench
12 -ve control hood

(17:16) Nathan and Luke are now doing the spec 600nm on the airated Poly experiment while chris is writing the wiki.

(17:30) Chris is now setting up the master mix for the PCR 16S orange and yellow as we have been donated more universal 16S primers from Dr Richard Haigh. This is done in the PCR hood as we are doing 9 PCR reactions, we need to make up 270ul of the master mix which is enough for aliquots of 18ul in 15 reactions. Reaction mixture list:
112ul PCR H20
40ul HF buffer
4ul dNTPs
10ul Primer A
10ul Primer B
Template DNA to be added later as it is not PCR clean
2ul DNA Polymerase
These reagents were added then as the DNApol was in glycerol the tube was mixed and spun for a second to remove bubbles. dNTPs cannot be freeze thawed so whatever was left was thrown. After this, Chris put 18ul aliquots of the master mix into 9 separate PCR eppendorfs and prepared the negative control while in the PCR hood with the PCR clean H2O. The tubes were then taken to the bench where the DNA was added, and the positive P. aeruginosa DNA and negative bench H2O controls all samples were added at 2ul to make a final volume of 20ul.
PCR cycle program used was iGEM16S which is as follows:
98 degrees C - 5 min
98 degrees C - 30 seconds
50 degrees C - 30 seconds
72 degrees C - 2 minutes
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction)
the text in italics is the cycle, which is repeated 30 times

(17:50) After the PCR was set up, Chris and Nathan swiftly stopped the gel's and got them on the transilluminator. the results from the PCR of the todC1 and TodG look promising for the C1, however again there is two bands at about the correct position.

(9:00) in and straight away making gel's , Chris is sterilising the bottles while Nathan and Will are getting ready to make the gel. Luke is creating a task list.

(10:00) Luke is re formatting photos ready to go on the Wiki and Will is doing the Boilate as from looking at last nights gel's the boilate DNA hasn't amplified any bands... Tony and Nathan are pouring the gel's ready to be loaded while Chris is analysing the gel photos of the tod genes.

(10:30) After the pc crashed... losing lots of wiki work, Chris and Nathan are now re-writing the entrance for today.
TodC1 - 1353bp
> Aeruginosa - band at 800bp and 1kb
> Maxwell reaction
> Putida A and b - Band at 800bp, 1.2kb and one in-between 1.2 and 1.5kb
> Orange bacteria - one band high up above the 1.5kb marker
> yellow bacteria - no bands
> Boilate reaction
> boilates failed to amplify

TodG - 807bp
> Aeruginosa - band at 1kb and one high up
> Maxwell reaction
> putida A and b - band at 700bp and a fainter one at 800 and 600 ... bands also present above the 1.5kb marker
> Orange good sized band at 800bp and a lower one at 700bp ... also has bands at 1.2 and 1.5 kb
> yellow faint band at 800bp and one at 1kb
> Boilate reaction
> boilate failed

TodX - 544bp
> Aeruginosa - None
> Maxwell reaction
> Putida A and B - Bands at <500bp, 600bp, 1200bp and >1500bp
> Orange bacteria - 1 band at >1500bp
> Yellow bacteria - Faint bands at 1200bp and >1500bp
> Boilate reaction
> Putida A and B - Faint bands at <500bp, 600bp, 1200bp and >1500bp
> Orange and yellow boilates failed.

TodB - 324bp
> Aeruginosa - None
> Maxwell reaction
> Putida A and B - None
> Orange bacteria - several non distinct bands ranging from >300bp to 800bp, 2 are between 300bp-400bp
> Yellow bacteria - several non distinct bands ranging from >200bp to 1500bp, 1 faint band is between 300bp-400bp
> Boilate reaction
> Putida A and B - No distinct bands
> Orange - one faint band between 300bp-400bp and more faint bands between 400bp-1000bp
> Yellow - None

> TodF - 460bp
> Aeruginosa - None
> Maxwell reaction
> Putida A and B - 1 band between 700bp-800bp
> Orange bacteria - 1 band at 1500bp and 1 band between 1200-1500bp
> Yellow bacteria - Faint band between 500bp-600bp, other bands are above
> Boilate reaction
> Putida A and B - Faint band between 500bp-600bp, other bands are above, 1 strong band between 700bp-800bp
> Orange - Strong bands between 1000bp-1500bp
> Yellow - Faint band between 500bp-600bp, and strong bands >1200bp

(11:00) As the gel is set, Chris is now loading the test of the pcr purification, loading (10%) 3µL of each of the samples with 4µL of loading dye and 13µL of TE buffer to make each sample for loading. gel is running at 120V for 2 hours. lane organisation:
5µL 100bp Marker, ( New England Biolabs)
6a
6b
5a
5b
9
1µL 100bp marker ( New England Biolabs)
10µL 100bp marker ( New England Biolabs)
the different amounts of DNA ladder are to see if the concentrations from the Nano Drop are correct.

(11:40) Chris stopped and transilluminated the 16S gel after it only being ran for a hour, surprisingly there are bands for all of the reactions, however, there are also bands in the -ve bench and a lighter band in the -ve hood lane, as these were fresh primers, DNTp's, there was no contamination last time we used the pol and reaction buffer... the only thing it can be is the PCR H2O or technique.. so we will need to obtain a fresh stock of PCR H2O for the next set of reactions. unfortunately this sets us back again, and as the primers have also yet to arrive the day has yet to kick start.

(13:30) Chris Stopped the Gel Purification gel which Luke then transilluminated. There is DNA in the purification and it is of high ng/ul which is good. Unfortunately however we have just got the sequence data back from the DNA and it looks like we haven't extracted the TodX gene itself, which is disappointing. As before we only sequenced from the reverse primer, we are to re do this with the forward primer to get the full set of data. this calls however for a meeting

(14:30) Chris is preparing for PCR for the 16s , todX and TodF as the TodF PCR gel has some bands which look promising. At the same time Chris is running the original PCR at 150V transilluminating every 15 min.

(15:00) will has now taken over the running of the PCR gel, the bands are still very hard to see, however don't seem to be improving.. Chris is now setting up the master mix for the PCR 16S orange and yellow This is done in the PCR hood as we are doing 9 PCR reactions, we need to make up 180ul of the master mix which is enough for aliquots of 18ul in 10 reactions. Reaction mixture list:
112ul PCR H20
40ul HF buffer
4ul dNTPs
10ul Primer A
10ul Primer B
Template DNA to be added later as it is not PCR clean
2ul DNA Polymerase
These reagents were added then as the DNApol was in glycerol the tube was mixed and spun for a second to remove bubbles. dNTPs cannot be freeze thawed so whatever was left was thrown. After this, Chris put 18ul aliquots of the master mix into 9 separate PCR eppendorfs and prepared the negative control while in the PCR hood with the PCR clean H2O. The tubes were then taken to the bench where the DNA was added, and the positive P. aeruginosa DNA and negative bench H2O controls all samples were added at 2ul to make a final volume of 20ul.
PCR cycle program used was iGEM16S which is as follows:
98 degrees C - 5 min
98 degrees C - 30 seconds
50 degrees C - 30 seconds
72 degrees C - 2 minutes
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction)
the text in italics is the cycle, which is repeated 30 times
as well as that Chris is setting up the TodX and todF which PCR under different conditions and as there are 12 reactions, the mixture is for 15. Program used was iGEMTOL2 - used previously.

(15:50) Nathan and Tony are doing spectrophotometry on the aerated Poly experiment - results to follow while Luke has almost finished putting the photos into the wiki.

(16:30) Chris is now analysing the gel photos from the todF re run gel in a hope to find the bands again, after looking at the gel under the cutting UV light, no bands can been seen to actually cut them out of the gel... Luckily the PCR from today will give us more DNA. so to not waste more time, we will Freeze thaw the bands, to extract some DNA to amplify from the band directly to save on time, as well as doing the Zymogen gel extraction.

(17:30) preparing for tomorrow by making gel's and Wiki'ing. After labs today, Chris and Luke are going to go to Asda to get preparations for the cake sale on saturday at the open day.

(8:50) Chris is preparing the samples for the 16S PCR to be ran on a gel, while will is making two new gels ready to run the tod PCR's. Bad news from the Asda trip, so will have to pop to Morrison's after labs.

(9:30) Gel running with the following organisation: Chris, insert lanes here

Luke and Nathan just got in and are getting ready for the day ahead.

(10:00) Will is making and pouring a couple of gels for the TodX and TodF PCR gel electrophoresis.

(10:20) Luke is now preparing the samples of the todX and todF PCR reactions from last night for running on the gel, while Chris is writing the Wiki for yesterday/this morning so far.

(11:00) Luke has just set up the next gels, using the TodF and TodX PCRed out last night. The lane organisation is:
1 x
2 P. aeruginosa
3 P. aeruginosa
4 P. putida strain A Maxwell prep
5 P. putida strain B Maxwell prep
6 Orange bacteria Maxwell prep
7 Yellow bacteria Maxwell prep
8 P. putida strain A boilate
9 P. putida strain B boilate
10 Orange boilate
11 Yellow boilate
12 5µl 100bp DNA ladder
13 bench H₂O
14 hood H₂O

(11:30) Luke has just transilluminated the 16S gel from 9:30:

(13:30) Luke has just transilluminated the TodX gel:

University of Leicester open day today, Chris arranged for the team to have a stall outside our building to try and raise some money as well as helping out on the department tours.