|
|
(25 intermediate revisions not shown) |
Line 1: |
Line 1: |
- | {{:Team:St_Andrews/Template:Header}}
| |
| | | |
- | <html>
| |
- | <head>
| |
- |
| |
- | <style type="text/css">
| |
- | body {
| |
- | padding-top: 60px; /* 60px to make the container go all the way to the bottom of the topbar */
| |
- | }
| |
- | h1 {
| |
- | padding-bottom: 10px;
| |
- | }
| |
- | #footer{
| |
- | padding-top: 60px;
| |
- | }
| |
- | </style>
| |
- |
| |
- | <title></title>
| |
- | </head>
| |
- |
| |
- | <body id="body-pattern">
| |
- | <div class="container" id="content-container">
| |
- | <header class="jumbotron subhead" id="overview">
| |
- | <h1>Lab Book</p>
| |
- | <p></p>
| |
- | <h2>Procedure</h2>
| |
- |
| |
- | </header>
| |
- |
| |
- | <div class="tabbable">
| |
- | <ul class="nav nav-tabs">
| |
- | <li class="active"><a href="#tab1" data-toggle="tab">General Methods</a></li>
| |
- | <li><a href="#tab2" data-toggle="tab">ω-3 Synthesis</a></li>
| |
- | <li><a href="#tab3" data-toggle="tab">Metal-binding peptides</a></li>
| |
- | </ul>
| |
- |
| |
- | <div class="tab-content">
| |
- |
| |
- | <div class="tab-pane active" id="tab1">
| |
- |
| |
- | <dl class="dl-horizontal">
| |
- | <dt>date</dt>
| |
- | <dd>what we did</dd>
| |
- | <dt>date</dt>
| |
- | <dd>what we did</dd>
| |
- | <dt>date</dt>
| |
- | <dd>what we did</dd>
| |
- | </dl>
| |
- |
| |
- | <p>anyone really keen to write this up, up to protein visualization? Don't forget to mention the differing restriction enzymes and vectors of each team. I can add in links to the protocols page.</p>
| |
- | <p>Please also refer to our <a href="https://2012.igem.org/Team:St_Andrews/Lab-book"><font color="gray">Protocols</font></a> page.</p>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- |
| |
- | </div>
| |
- |
| |
- | <div class="tab-pane" id="tab2">
| |
- | <BR> </BR>
| |
- |
| |
- | <span class="label"><a href="#Sequences"><font color="white">Sequences</font></a></span> <span class="label"><a href="#Primers"><font color="white">Primers</font></a></span> <span class="label"><a href="#Sequencing"><font color="white">Sequencing results</font></a></span> <span class="label"><a href="#Lipid"><font color="white">Lipid analysis</font></a></span>
| |
- |
| |
- | <BR> </BR>
| |
- |
| |
- | <p>Start from lipid extraction</p>
| |
- | <p>primers, sequence results</p>
| |
- |
| |
- | <BR> </BR>
| |
- |
| |
- |
| |
- | <a name="Sequences"><span class="label">Sequences</span></a>
| |
- | <BR> </BR>
| |
- | <p>
| |
- | <div class="btn-toolbar">
| |
- | <a data-toggle="modal" href="#modal1" class="btn btn-primary btn-small">Δ12 T. Cruzi</a>
| |
- | <div class="modal hide" id="modal1">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>Δ12 T. Cruzi</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>atgtcgcgggttgacaatttaactgtcgcgccgggtccaccggatgtcatgaaggcggtgcttaagtctgggcgcaacaaggagcacaat
| |
- | gtcattgtgccttcctccgcactgaccattggagaaattcaggagaaaatcccggtaaagtactttgaacgcaacactacccggagcgtc
| |
- | atgtttcttttacgcgacctcgcacaggtggcgttgacgtacgccattatgtacgccgtcgccttgccacttgccacttccatggaagtttctg
| |
- | cagcaagaacgttggccgacggtggggtgttatcattgatggcaggtacagccatgacgacagcggcgtggcttttaaaggcagtgttgtg
| |
- | ggcggtgttttggtttgtacagggacttaacggcactgcgctttgggtcctggctcacgaatgcggccatcaggcgttcagccccatgaaag
| |
- | gtttgaatgacgccgttggcatgattttgcactctgcgctgctcgtgccgtaccacagctggcgcatcacccacggcggccaccacaaac
| |
- | acacgaatcacctcacgaaggatcttgtgtttgttccagacaaacgaaacgcggttgtggagctcgtggaggaggcgccgctggtgttatt
| |
- | aattcaattattgctgatttttctctttggttggccggcacatcttctttttaatgcctctggacaggaatttggccgactcgcgagccactttgac
| |
- | cccggcgctccatttttccgcagcgaagaccgtcacgatattgtcctgtcgaatgttgggattgtcagcgcgttatttgtcattttctccagcgt
| |
- | ttaccgctttggttttacaaatgttttctgctggtacattgtaccgtacctctgggtgaacttttggcttgtgtacattacatacctgcagcacacg
| |
- | gatatacgcattcctcactacacacatgagcactggacgtttgttcgcggtgcattggcggctgtggacagggactacggctttgtccttaac
| |
- | acatggctccatcacatcaatgattcccacgtggtacatcacctctttagcaaaatgccacactacaacgcaatccaggtgacaagaaag
| |
- | tacattcgtgagatactgggtgccacatacattacggatgagaggtcactgtggaagatgctctgggaacagcgtagagagtgccgctatg
| |
- | ttgttcccgcagagggcgtctgtgtctttcatgggtaa</p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <a data-toggle="modal" href="#modal2" class="btn btn-primary btn-small">Δ12 Synechocystis</a>
| |
- | <div class="modal hide" id="modal2">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>Δ12 Synechocystis</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>atgactgccacgattcccccgttgacaccaacggtaacgcccagcaatcccgatcgcccg
| |
- | attgcggatctcaaactacaagacatcattaaaaccctgcccaaggaatgcttcgagaaa
| |
- | aaagcgagcaaagcctgggcttctgttttgattaccctaggggcgatcgccgtgggctat
| |
- | ttgggcattatttatctgccctggtactgcttgcccattacctggatctggacagggaca
| |
- | gccttaacgggggccttcgttgtcggccatgactgtggccatcgctcctttgctaaaaaa
| |
- | cgctgggtcaatgatttagtgggacatatcgcttttgctcccctcatctaccctttccat
| |
- | agctggcgcctactccacgaccaccatcacctccacaccaacaaaattgaggttgataac
| |
- | gcctgggatccctggagtgtggaagctttccaagccagcccggcgatcgtccggcttttt
| |
- | tatcgggccatccggggtcccttctggtggactggttccattttccattggagcttaatg
| |
- | cacttcaaactttccaactttgcccaaagggaccgcaataaagtcaaattatccattgcc
| |
- | gttgtcttcctgtttgcggcgatcgcctttcctgccctaattatcaccacaggggtgtgg
| |
- | ggtttcgtcaaattttggctaatgccctggttggtgtatcacttttggatgagcactttt
| |
- | accattgtgcaccacaccattcccgaaattcgtttccgtcccgccgccgattggagtgcc
| |
- | gccgaagcccagttaaatggtactgttcactgcgattatccccgttgggtggaagtgctc
| |
- | tgccatgacatcaacgtccatattccccaccacctctccgttgccatcccttcctataac
| |
- | ctacgactagcccacggaagtttaaaagaaaactggggaccttttctttacgagcgcacc
| |
- | tttaactggcaattaatgcaacaaattagtgggcaatgtcatttatatgaccccgaacat
| |
- | ggctaccgcaccttcggctccctgaaaaaagtttaa
| |
- | </p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <a data-toggle="modal" href="#modal3" class="btn btn-primary btn-small">Δ15 Synechocystis</a>
| |
- | <div class="modal hide" id="modal3">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>Δ15 Synechocystis</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>gtgcgtctagaaatttcatcgcctcaaacaaagcttccttaccccaaaactgaagaatta
| |
- | ccatttaccctccaagagctcagaaacgctattccagcggattgttttgagccatcggta
| |
- | gtccggtccttgggctacttttttttggatgttggtttaattgccgggttttatgctcta
| |
- | gcggcctaccttgattcctggttcttctatccgattttttggttaattcagggaacccta
| |
- | ttctggtccctgtttgtggtgggccatgattgtggccatggctccttttccaaatccaaa
| |
- | acccttaataattggattggtcatctcagccacacgccaattttggtgccttaccatggc
| |
- | tggcgtattagtcatcgtactcaccatgccaacacgggcaatatcgacaccgacgaaagt
| |
- | tggtatccagtgtcggagcaaaaatataaccaaatggcctggtatgaaaaacttctacgt
| |
- | ttttacttgcctctgatcgcctaccccatttatctatttcggcgatcgccaaaccggcaa
| |
- | ggctcccatttcatgcccggcagtcccctattccgtcccggagaaaaagcagctgttctc
| |
- | accagcacctttgcccttgcagcctttgtcggcttccttggctttttaacttggcaattt
| |
- | ggctggctatttttgctgaaattttatgttgccccctacctcgtgtttgtggtgtggtta
| |
- | gatttggtcacatttttacatcacactgaagacaatatcccttggtatcgtggtgatgac
| |
- | tggtattttctcaaaggtgccctctccaccattgatcgggattacggcttcattaacccc
| |
- | attcaccatgacattggcacccacgtcgcccaccatattttctcgaatatgccccactac
| |
- | aagttacgccgggcgactgaagccatcaagcccattttaggggaatattatcgatattct
| |
- | gacgagccaatttggcaagctttttttaagtcctactgggcttgccattttgttcctaat
| |
- | caaggttcaggggtctattaccaatccccatccaatggtggatatcaaaagaaaccttaa
| |
- | </p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <a data-toggle="modal" href="#modal4" class="btn btn-primary btn-small">Δ6 Synechocystis</a>
| |
- | <div class="modal hide" id="modal4">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>Δ6 Synechocystis</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>atgctaacagcggaaagaattaaatttacccagaaacgggggtttcgtcgggtactaaac
| |
- | caacgggtggatgcctactttgccgagcatggcctgacccaaagggataatccctccatg
| |
- | tatctgaaaaccctgattattgtgctctggttgttttccgcttgggcctttgtgcttttt
| |
- | gctccagttatttttccggtgcgcctactgggttgtatggttttggcgatcgccttggcg
| |
- | gccttttccttcaatgtcggccacgatgccaaccacaatgcctattcctccaatccccac
| |
- | atcaaccgggttctgggcatgacctacgattttgtcgggttatctagttttctttggcgc
| |
- | tatcgccacaactatttgcaccacacctacaccaatattcttggccatgacgtggaaatc
| |
- | catggagatggcgcagtacgtatgagtcctgaacaagaacatgttggtatttatcgtttc
| |
- | cagcaattttatatttggggtttatatcttttcattcccttttattggtttctctacgat
| |
- | gtctacctagtgcttaataaaggcaaatatcacgaccataaaattcctcctttccagccc
| |
- | ctagaattagctagtttgctagggattaagctattatggctcggctacgttttcggctta
| |
- | cctctggctctgggcttttccattcctgaagtattaattggtgcttcggtaacctatatg
| |
- | acctatggcatcgtggtttgcaccatctttatgctggcccatgtgttggaatcaactgaa
| |
- | tttctcacccccgatggtgaatccggtgccattgatgacgagtgggctatttgccaaatt
| |
- | cgtaccacggccaattttgccaccaataatcccttttggaactggttttgtggcggttta
| |
- | aatcaccaagttacccaccatcttttccccaatatttgtcatattcactatccccaattg
| |
- | gaaaatattattaaggatgtttgccaagagtttggtgtggaatataaagtttatcccacc
| |
- | ttcaaagcggcgatcgcctctaactatcgctggctagaggccatgggcaaagcatcgtga
| |
- | </p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <a data-toggle="modal" href="#modal5" class="btn btn-primary btn-small">ELO 6 L. major</a>
| |
- | <div class="modal hide" id="modal5">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>ELO 6 L. major</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>atgaaggtcatcgtcgcttctggcccggacggtgcccgcaagcacgaggtggagctggca
| |
- | gccaacgccacgctcgcagatctgaagaaggcctaccaacggggtgtggacgtgcaccgc
| |
- | aagtcgttcaaggttcccagcgcggagtcgccgctgccaggtgcggatagtggcaagctg
| |
- | cgcccgaacctcattactctgtcagataaggtgcccctgtcgcagcagggggtgaaggat
| |
- | ggctcggtgatcacttacaaggacctcggcccgcagatcggctaccgcacggtgttctac
| |
- | gtcgagtatgccggccccatcgccttcatgctgctgtacgccatgcgcccttcgctcatc
| |
- | tacggctctgccccgatgccggcttacggctacacgcagaagctatacattggcctcttc
| |
- | ctcgcccacttcttaaagcgcgagctcgagtccatgtttgtgcacaagttctcgcaccca
| |
- | acgatgccgatgcgcaacatcttcaagaactgcatctactactggtccttcgccgccttc
| |
- | atcggctacgtgctgtgcagtccttcattcacgccgaccagcaccatgcagtcaaacttc
| |
- | ggcgccgtggtcatggtcatcaacgagctgctgaacttcgcggtgcactaccagcttagc
| |
- | acgatgcgcaagtccgatggtgacaccacccgcaacgtgccgcaaggccctctgttcgcc
| |
- | ttcgtctcgtgcccgaactacttctttgagattatgtcgtgggtgtccttttccatcggc
| |
- | acaaatatgttatcctcctggttcttcacactcgccggtttcgtgcagatggcggactgg
| |
- | gcgaagaagaagcaccggggctacgtcaaggcggacccggccaataaaaagaaggccgcc
| |
- | attctgcccttcatcatgtag</p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <BR> </BR><BR> </BR>
| |
- |
| |
- | <a name="Primers"><span class="label">Primers</span></a>
| |
- |
| |
- | <BR> </BR>
| |
- | <p>All primers are notated 5' to 3'.
| |
- | <BR> </BR>
| |
- | <div class="btn-toolbar">
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 T. Cruzi forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCATATGTGGCGGGTTGACAATTTA
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 T. Cruzi reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <p><div class="span3">ATATCTCGAGTTACCCATGAAAGACAC</div></p>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 Synechocystis forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCATATGACTGCCACGATTCCC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 Synechocystis reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCTCGAGTTAAACTTTTTTCAGGGAGC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ15 Synechocystis forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCATATCGCTCTAGAAATTTCATC</div>
| |
- | </ul>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <p>
| |
- | <div class="btn-toolbar">
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ15 Synechocystis reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCACGACTTAAGGTTTCTTTTGATATC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ6 Synechocystis forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCATATGCAAACAGCGGAAAGAATT</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ6 Synechocystis reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4">ATATCTCGAGTAACGATGCTTTGACCATGGCCTCTAG</div>
| |
- | </ul>
| |
- | </div></p>
| |
- | </div>
| |
- |
| |
- | <BR> <?BR>
| |
- | <p>When using the pET-duet vector, we needed additionally primers for the alternative restriction sites and His-tags.</p>
| |
- |
| |
- | <div class="btn-toolbar">
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | ELO6 L. major forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span6">TATCATATGGGAAGCAGCCATCATCATCATCATCACAGCATGGTCTCTCTGGAGCAGGCC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ15 T. Cruzi forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span6">TATCATATGGGCAGCCATCATCATCATCATCACAGCATGCGTCTAGAAATTTCATCG</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ6 T. Cruzi forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4">GGATCCGAATTCATCTAACAGCGGAAAGAATT</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ6 T. Cruzi reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4">GACAAGCTTTCACGATGCTTTGCCCATGGCCTCTAC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 T. Cruzi forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4"> GGATCCGAATTCATGACTGCCACGATTCCC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 T. Cruzi reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">GACAAGCTTTTAAACTTTTTTCAGGGAGC</div>
| |
- | </ul>
| |
- | </div>
| |
- | </div>
| |
- | <BR> </BR>
| |
- |
| |
- |
| |
- | <a name="Sequencing"><span class="label">Sequencing results</span></a>
| |
- | <BR> </BR>
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- | <dl class="dl-horizontal">
| |
- | <dt>16/7/12 Δ15</dt>
| |
- | <dd><p><ul>Δ15 and Δ6 desaturases from <i>Synechocystis</i> in pET-15b were sent off for sequencing. Once again, the results were discouraging even though protein and lipid analysis showed the opposite. BLAST showed that the gene found in both samples corresponded to a <i>T. brucei</i> HMG-CoA reductase which we thought we had cut out from the plasmid. We thus performed a PCR, using the vectors sent off for sequencing as a template.</ul></p>
| |
- |
| |
- | <p><ul><a data-toggle="modal" href="#modal7" class="btn btn-primary btn-mini">Sequence</a>
| |
- | <div class="modal hide" id="modal7">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>Δ15 Syn. in pET-15b</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>atATACCAtggGcAgCAGccaTcnnCATcaTCAtnncAGCagCGGCCTggtgCCGCGCGGCAGCCATATGCTTCgtagga
| |
- | cTCTCTCatgtgCTtgtGGGACAGGCAAAACGGGttgGGGCGCAAtgaGCAATGCCgagCTTGTTaAAGCcgtAAGCAgt
| |
- | cGTCAAttAACCTTTTATGGGTTAGAGCacgCTCTGgagCCCGACTACCAGCGCGCTATCGcTgtGCGTCGtgAGGTGgt
| |
- | gtCCGACTAtgtgGCATCCTCCCAAAgTGCggaGGTGAAGAGGAAAAGCTTGGAGCGTATACCATTTGAAAACTACGAAT
| |
- | GGGATCGAGTGGTTGGTCAGAACTGTGAAAATATTGTGGGTTACGTTCCTATTCCTCTTGGTATGGCTGGGCCAATAATA
| |
- | ATGGATGGCTGTGAATACCCCATTCCCATGGCCACGACAGAAGGTGCCCTggtTGCCAGCACACATCGAGGCGCACGAGC
| |
- | TATATCCCAAAGTGGGGGCTGTAAGACACTGATCTTGGGCGAGGGCATGTCACGTGCTCCAGTAGTGGAGGTTGAGTCTT
| |
- | TGGAAGAGGCGGGAAggcttCATAATTTTTGTGTagaAAAtttcaCTGAAATCAAAGCAGCTTTCGAGagaCGACGCGAT
| |
- | TTGGGAattGCAGTCGCTCAAGTGCGTCATCATCGGTCnnnannCCTATATTCggTTCCGCGCGAccaCCGGagatGCga
| |
- | tg
| |
- | </p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div></ul>
| |
- | </ul></p></dd>
| |
- | <BR> </BR>
| |
- |
| |
- | <dt>16/7/12 Δ6</dt>
| |
- | <dd><p><ul><a data-toggle="modal" href="#modal8" class="btn btn-primary btn-mini">Sequence</a>
| |
- | <div class="modal hide" id="modal8">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>Δ6 Syn. in pET-15b</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>AnTTCCCCcTctaGaaTaTTTTTGTTtACTTtAAGaAGGAGATATACCATGGGCAGCAGCCATcncTcAtcaTCATCACA
| |
- | GCAGCGGCCTGGTGCCGCGCGGCAGCCATATGCTTCGTAGGACTCTCTCATgtGCTTGTGGGACAGGCAAAACGGGTTGG
| |
- | GGCGCAATGAGCAATGCCGaGCTtgTTAAAGCCGTAAGCAGTCGTCAATTAACCTTTTATGGGTTAGAGCAGGCTCTGGA
| |
- | GCCCGACTACCAGCGCGCTATCGCTGTGCGTCGTGAGGTGGTGTCCGACTATGTGGCATCCTCCCAAAGTGCGGAGGTGA
| |
- | AGAGGAAAAGCTTGGAGCGTATACCATTTGAAAACTACGAATGGGATCGAGTGGTTGGTCAGAACTGTGAAAATATTGTG
| |
- | GGTTACGTTCCTATTCCTCTTGGTATGGCTGGGCCAATAATAATGGATGGCTGTGAATACCCCATTCCCATGGCCACGAC
| |
- | AGAAGGTGCCCTGGTTGCCAGCACACATCGAGGCGCACGAGCTATATCCCAAAGTGGGGGCTGTAAGACACTGATCTTGG
| |
- | GCGAGGGCATGTCACGTGCTCCAGTAGTGGAGGTTGAGTCTTTGGAAGAGGCGGGAAGGCTTCATAATTTTTGTGTAGAA
| |
- | AATTTCACTGAAATCAAAGCAGCTTTCGAGAGCACGACGCGATTTGGGAAGTTGCAGTCGCTCAAGTGCGTCATCATCGG
| |
- | TCGCAnAGCCTATATTCGGTTCCGCGCGACCACCGGAGATGCGATGGGGATGAACATGATAACCAAAGGTGTCGACAAGG
| |
- | CATTGGAGTTAAtanAGCAnAACTTTCCGTCGATGAAGGTTATTGCGTTGTCGGGGAACTACTGCACTGanaagAAACcC
| |
- | TCCGCAGTGAACTGGATTGaggggaaGAGGAAnAAaCTGTcnnttgCCgaagGCGCTcgtaaaggggCgaAGt
| |
- | </p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div></ul>
| |
- | </ul></p></dd>
| |
- | <BR> </BR>
| |
- |
| |
- | <dt>29/6/12 ELO6</dt>
| |
- | <dd><p><ul>After showing successful insertion of <i>L. major</i> Δ6 elongase in pET-15b, the sample was sent off for sequencing. Unfortunately, the gene sequenced was not the Δ6 elongase we were hoping to find, but a <i>T. brucei</i> mevalonate kinase, which was previously inserted in the pET-15b vectors we had been using. Thus, we digested some fresh pET-15b to be used in the future.</ul></p>
| |
- |
| |
- | <p><ul><a data-toggle="modal" href="#modal6" class="btn btn-primary btn-mini">Sequence</a>
| |
- | <div class="modal hide" id="modal6">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>ELO6 in pET-15b</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>GnanTTTGTTtAcTttaagaaggagaTATACCATGGGcAGCAGCCATcatCATcatcaTCACAGCAGCGGCCTggtGCCG
| |
- | CGCGGCagCCATATGGTCGTGGCATCGtgTCCGGGAAAAGTGCTGATTCTTGGTGGTTAcCTAATAGttGAGGAGCCAAA
| |
- | TGTTGGTATTTCCGTAGGAACAACCGCGCGCTTCGTGACACGTGTGGCGTCgtgGAAAAAATGCTCTGATGGAAAGTGTC
| |
- | GAGTGCACATCGTCTCGTCACAGTTCAACAAggaGTTTACGTTTGAATGCGCGGCTGAAGAGGACAGTGATTCCACTATC
| |
- | AAGATTGTGCAATTAGAGGGTGCACCATCGCCGTTTCTCTTCTACGGTATTTTGTACTCGGTTGCCGGCGCTCTATTATT
| |
- | TGGTGGTGATATTTTTCGTGATGTTACCCTAGAGTTGTTGGCGGATAACGATTTCTACAGCCAAAGGAATTATTTGGAGT
| |
- | CCCAAGGCAAGCCGGTGACCGCAGCCAACCTGCGGCTCATCCCCCGTTATACGCCCCTCTTGGGGGAGGTTTCCAAAACT
| |
- | GGTCTAGGATCTTCAGCGGCAATGACCACTAGTGTCGTAGCGTGCCTGCTCCAACTTTTTGTTTTTGATTCGAAGAAAAA
| |
- | CAATGCCACTGAGTCCGTGGAGAGGGCACCGGAGCTACCTCTACGTTTGGAGGATGTAACAGAGTTCATTCATCGTATTA
| |
- | GTCAGGTTGCCCACTGCGTAGCACAGGGAAAAGTGgGGAGCGGGTTTGATGTCTACACGGCCACGTTCGGGACGTGTGTG
| |
- | TACCGACGGTTCTCCGCACGCGTGCTGGAnAAGCTCGTAAAGGgtAATGAACCTCCGAAGCGCGTCGCTATTCCTCTTTT
| |
- | ACGTGAGTGTGTCGAGACGGATGAAGTGTGgGTTCAGAGGATACcCTtccGGCTTCCTACCGGGTTGCAGCTTCTTTTAG
| |
- | GGGATGTACACAAGGGAGgAacaGAAAcACCTGGCATGGTGTcgaAGGTCATGTCatgnnagnggTCGGTGACCacGGAC
| |
- | CCcAACAGnttgnggnnnngantTcCCATgnntAAT
| |
- | </p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div></ul>
| |
- | </ul></p></dd>
| |
- |
| |
- | <BR> </BR>
| |
- | <dt>23/7/12 Δ12</dt>
| |
- | <dd><p><ul>15b forward gave 0 nucleotides</ul></p>
| |
- | <p><ul>15b reverse gave 0 nucleotides</ul></p>
| |
- | <p><ul>20b forward gave a 41 nucleotide result.</ul></p>
| |
- |
| |
- | <ul><div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">Sequence<span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4"><font size="1">gCGnCctGntGCCgCGCGGCnnnnnnnnnnnnnnnnnngac</font></div>
| |
- | </ul>
| |
- | </div></ul>
| |
- |
| |
- | <p><ul>A BLAST search showed this to be compatible with <i>Crocosphaera watsonii</i> (genome shotgun sequence, 21%), a diazotrophic cyanobacteria. Add in relations to synechocystis.</ul></p>
| |
- |
| |
- | <p><ul>20b reverse gave 0 nucleotides</ul></p>
| |
- |
| |
- |
| |
- |
| |
- | </dd>
| |
- | </dl>
| |
- | </div>
| |
- |
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- |
| |
- | <a name="Lipid"><span class="label">Lipid analysis</span></a>
| |
- |
| |
- | <BR> </BR><BR> </BR><BR> </BR><BR> </BR>
| |
- | <BR> </BR><BR> </BR><BR> </BR><BR> </BR><BR> </BR>
| |
- | </div>
| |
- |
| |
- | <div class="tab-pane" id="tab3">
| |
- | <p>who knows what those Metal Mickies are up to. Eating nachos in the Whey Pat most likely. MEGA LOLS (all caps, with a Z).</p>
| |
- |
| |
- | <BR> </BR>
| |
- |
| |
- | <p><span class="label"><a href="#Primers2"><font color="white">Primers</font></a></span><span class="label"><a href="#Digestion2"><font color="white">Digestion</font></a></span><span class="label"><a href="#Transformation2"><font color="white">Transformation</font></a></span></p>
| |
- |
| |
- | <BR> </BR>
| |
- | <a name="Primers2"><span class="label">Primers</span></a>
| |
- |
| |
- | <BR> </BR>
| |
- | <p>All primers are notated 5' to 3'.
| |
- | <BR> </BR>
| |
- | <div class="btn-toolbar">
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Ni forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">AATTCCATCATCACCATCACCACC</ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Ni reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <p><div class="span3">TCGAGGTGGTGATCGTGATGATGG</div></p>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Ni<sub>2</sub> forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4">AATTCATGTGTACAACATGCGGTTGCGGTGAAGGCC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Ni<sub>2</sub> reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4">TCGAGGCCTTCACCGCAACCGCATGTTGTACACATG</div>
| |
- | </ul>
| |
- | </div>.
| |
- | </div>
| |
- |
| |
- | <p>
| |
- | <div class="btn-toolbar">
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Pd forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">AGCGTGACCCAGAACAAATAT</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Pd reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATTTGTTCTGGGTCACGCT</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Pt forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">GATCGCACCAGCACCTGGCGC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Pt reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">GCGCCAGGTGCTGGTGCGATC</div>
| |
- | </ul>
| |
- | </div></p>
| |
- | </div>
| |
- |
| |
- | <BR> </BR>
| |
- |
| |
- | <p>For primer annealing in the PCR, the primer sequences were combined in the following way:</p>
| |
- |
| |
- | <li><strong>GST Forward</strong> and <strong>Ni Reverse</strong></li>
| |
- | <li><strong>GST Forward</strong> and <strong>Ni<sub>2</sub> Reverse</strong></li>
| |
- | <li><strong>GST Forward</strong> and <strong>Pd Reverse</strong></li>
| |
- | <li><strong>GST Forward</strong> and <strong>Pt Reverse</strong></li>
| |
- |
| |
- | <BR> </BR>
| |
- | <a name="Digestion2"><span class="label">Digestion</span></a>
| |
- |
| |
- | <BR> </BR>
| |
- | <p>pGEX-6P-1 was cut using EcoR1(954) and Xho1 (975)</p>
| |
- |
| |
- | <BR> </BR>
| |
- |
| |
- | <a name="Transformation2"><span class="label">Transformation</span></a>
| |
- | <BR> </BR>
| |
- | <p>pGEX vector with insert transformed into DH5α E. coli cells to replicate.</p>
| |
- | <p>pGEX vector with G-Block insert transformed into DH5α E. coli cells to replicate.</p>
| |
- | <BR> </BR>
| |
- | <p>pGEX vector with insert transformed into BL21 E. coli cells for protein expression.</p>
| |
- | <p>pGEX vector with G-Block insert transformed into BL21 E. coli cells for protein expression.</p>
| |
- |
| |
- |
| |
- |
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- |
| |
- |
| |
- | </div>
| |
- |
| |
- |
| |
- |
| |
- |
| |
- | </body>
| |
- | </html>
| |
- | {{:Team:St_Andrews/Template:Footer}}
| |