|
|
(29 intermediate revisions not shown) |
Line 1: |
Line 1: |
- | {{:Team:St_Andrews/Template:Header}}
| |
| | | |
- | <html>
| |
- | <head>
| |
- |
| |
- | <style type="text/css">
| |
- | body {
| |
- | padding-top: 60px; /* 60px to make the container go all the way to the bottom of the topbar */
| |
- | }
| |
- | h1 {
| |
- | padding-bottom: 10px;
| |
- | }
| |
- | #footer{
| |
- | padding-top: 60px;
| |
- | }
| |
- | </style>
| |
- |
| |
- | <title></title>
| |
- | </head>
| |
- |
| |
- | <body id="body-pattern">
| |
- | <div class="container" id="content-container">
| |
- | <header class="jumbotron subhead" id="overview">
| |
- | <h1>Lab Book</p>
| |
- | <p></p>
| |
- | <h2>Procedure</h2>
| |
- |
| |
- | </header>
| |
- |
| |
- | <div class="tabbable">
| |
- | <ul class="nav nav-tabs">
| |
- | <li class="active"><a href="#tab1" data-toggle="tab">General Methods</a></li>
| |
- | <li><a href="#tab2" data-toggle="tab">ω-3 Synthesis</a></li>
| |
- | <li><a href="#tab3" data-toggle="tab">Metal-binding peptides</a></li>
| |
- | </ul>
| |
- |
| |
- | <div class="tab-content">
| |
- |
| |
- | <div class="tab-pane active" id="tab1">
| |
- |
| |
- | <dl class="dl-horizontal">
| |
- | <dt>date</dt>
| |
- | <dd>what we did</dd>
| |
- | <dt>date</dt>
| |
- | <dd>what we did</dd>
| |
- | <dt>date</dt>
| |
- | <dd>what we did</dd>
| |
- | </dl>
| |
- |
| |
- | <p>anyone really keen to write this up, up to protein visualization? Don't forget to mention the differing restriction enzymes and vectors of each team. I can add in links to the protocols page.</p>
| |
- | <p>Please also refer to our <a href="https://2012.igem.org/Team:St_Andrews/Lab-book"><font color="gray">Protocols</font></a> page.</p>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- |
| |
- | </div>
| |
- |
| |
- | <div class="tab-pane" id="tab2">
| |
- | <BR> </BR>
| |
- |
| |
- | <span class="label"><a href="#Sequences"><font color="white">Sequences</font></a></span> <span class="label"><a href="#Primers"><font color="white">Primers</font></a></span> <span class="label"><a href="#Sequencing"><font color="white">Sequencing results</font></a></span> <span class="label"><a href="#Lipid"><font color="white">Lipid analysis</font></a></span>
| |
- |
| |
- | <BR> </BR>
| |
- |
| |
- | <p>Start from lipid extraction</p>
| |
- | <p>primers, sequence results</p>
| |
- |
| |
- | <BR> </BR>
| |
- |
| |
- |
| |
- | <a name="Sequences"><span class="label">Sequences</span></a>
| |
- | <BR> </BR>
| |
- | <p>
| |
- | <div class="btn-toolbar">
| |
- | <a data-toggle="modal" href="#modal1" class="btn btn-primary btn-small">Δ12 T. Cruzi</a>
| |
- | <div class="modal hide" id="modal1">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>Δ12 T. Cruzi</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>atgtcgcgggttgacaatttaactgtcgcgccgggtccaccggatgtcatgaaggcggtgcttaagtctgggcgcaacaaggagcacaat
| |
- | gtcattgtgccttcctccgcactgaccattggagaaattcaggagaaaatcccggtaaagtactttgaacgcaacactacccggagcgtc
| |
- | atgtttcttttacgcgacctcgcacaggtggcgttgacgtacgccattatgtacgccgtcgccttgccacttgccacttccatggaagtttctg
| |
- | cagcaagaacgttggccgacggtggggtgttatcattgatggcaggtacagccatgacgacagcggcgtggcttttaaaggcagtgttgtg
| |
- | ggcggtgttttggtttgtacagggacttaacggcactgcgctttgggtcctggctcacgaatgcggccatcaggcgttcagccccatgaaag
| |
- | gtttgaatgacgccgttggcatgattttgcactctgcgctgctcgtgccgtaccacagctggcgcatcacccacggcggccaccacaaac
| |
- | acacgaatcacctcacgaaggatcttgtgtttgttccagacaaacgaaacgcggttgtggagctcgtggaggaggcgccgctggtgttatt
| |
- | aattcaattattgctgatttttctctttggttggccggcacatcttctttttaatgcctctggacaggaatttggccgactcgcgagccactttgac
| |
- | cccggcgctccatttttccgcagcgaagaccgtcacgatattgtcctgtcgaatgttgggattgtcagcgcgttatttgtcattttctccagcgt
| |
- | ttaccgctttggttttacaaatgttttctgctggtacattgtaccgtacctctgggtgaacttttggcttgtgtacattacatacctgcagcacacg
| |
- | gatatacgcattcctcactacacacatgagcactggacgtttgttcgcggtgcattggcggctgtggacagggactacggctttgtccttaac
| |
- | acatggctccatcacatcaatgattcccacgtggtacatcacctctttagcaaaatgccacactacaacgcaatccaggtgacaagaaag
| |
- | tacattcgtgagatactgggtgccacatacattacggatgagaggtcactgtggaagatgctctgggaacagcgtagagagtgccgctatg
| |
- | ttgttcccgcagagggcgtctgtgtctttcatgggtaa</p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <a data-toggle="modal" href="#modal2" class="btn btn-primary btn-small">Δ12 Synechocystis</a>
| |
- | <div class="modal hide" id="modal2">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>Δ12 Synechocystis</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>atgactgccacgattcccccgttgacaccaacggtaacgcccagcaatcccgatcgcccg
| |
- | attgcggatctcaaactacaagacatcattaaaaccctgcccaaggaatgcttcgagaaa
| |
- | aaagcgagcaaagcctgggcttctgttttgattaccctaggggcgatcgccgtgggctat
| |
- | ttgggcattatttatctgccctggtactgcttgcccattacctggatctggacagggaca
| |
- | gccttaacgggggccttcgttgtcggccatgactgtggccatcgctcctttgctaaaaaa
| |
- | cgctgggtcaatgatttagtgggacatatcgcttttgctcccctcatctaccctttccat
| |
- | agctggcgcctactccacgaccaccatcacctccacaccaacaaaattgaggttgataac
| |
- | gcctgggatccctggagtgtggaagctttccaagccagcccggcgatcgtccggcttttt
| |
- | tatcgggccatccggggtcccttctggtggactggttccattttccattggagcttaatg
| |
- | cacttcaaactttccaactttgcccaaagggaccgcaataaagtcaaattatccattgcc
| |
- | gttgtcttcctgtttgcggcgatcgcctttcctgccctaattatcaccacaggggtgtgg
| |
- | ggtttcgtcaaattttggctaatgccctggttggtgtatcacttttggatgagcactttt
| |
- | accattgtgcaccacaccattcccgaaattcgtttccgtcccgccgccgattggagtgcc
| |
- | gccgaagcccagttaaatggtactgttcactgcgattatccccgttgggtggaagtgctc
| |
- | tgccatgacatcaacgtccatattccccaccacctctccgttgccatcccttcctataac
| |
- | ctacgactagcccacggaagtttaaaagaaaactggggaccttttctttacgagcgcacc
| |
- | tttaactggcaattaatgcaacaaattagtgggcaatgtcatttatatgaccccgaacat
| |
- | ggctaccgcaccttcggctccctgaaaaaagtttaa
| |
- | </p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <a data-toggle="modal" href="#modal3" class="btn btn-primary btn-small">Δ15 Synechocystis</a>
| |
- | <div class="modal hide" id="modal3">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>Δ15 Synechocystis</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>gtgcgtctagaaatttcatcgcctcaaacaaagcttccttaccccaaaactgaagaatta
| |
- | ccatttaccctccaagagctcagaaacgctattccagcggattgttttgagccatcggta
| |
- | gtccggtccttgggctacttttttttggatgttggtttaattgccgggttttatgctcta
| |
- | gcggcctaccttgattcctggttcttctatccgattttttggttaattcagggaacccta
| |
- | ttctggtccctgtttgtggtgggccatgattgtggccatggctccttttccaaatccaaa
| |
- | acccttaataattggattggtcatctcagccacacgccaattttggtgccttaccatggc
| |
- | tggcgtattagtcatcgtactcaccatgccaacacgggcaatatcgacaccgacgaaagt
| |
- | tggtatccagtgtcggagcaaaaatataaccaaatggcctggtatgaaaaacttctacgt
| |
- | ttttacttgcctctgatcgcctaccccatttatctatttcggcgatcgccaaaccggcaa
| |
- | ggctcccatttcatgcccggcagtcccctattccgtcccggagaaaaagcagctgttctc
| |
- | accagcacctttgcccttgcagcctttgtcggcttccttggctttttaacttggcaattt
| |
- | ggctggctatttttgctgaaattttatgttgccccctacctcgtgtttgtggtgtggtta
| |
- | gatttggtcacatttttacatcacactgaagacaatatcccttggtatcgtggtgatgac
| |
- | tggtattttctcaaaggtgccctctccaccattgatcgggattacggcttcattaacccc
| |
- | attcaccatgacattggcacccacgtcgcccaccatattttctcgaatatgccccactac
| |
- | aagttacgccgggcgactgaagccatcaagcccattttaggggaatattatcgatattct
| |
- | gacgagccaatttggcaagctttttttaagtcctactgggcttgccattttgttcctaat
| |
- | caaggttcaggggtctattaccaatccccatccaatggtggatatcaaaagaaaccttaa
| |
- | </p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <a data-toggle="modal" href="#modal4" class="btn btn-primary btn-small">Δ6 Synechocystis</a>
| |
- | <div class="modal hide" id="modal4">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>Δ6 Synechocystis</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>atgctaacagcggaaagaattaaatttacccagaaacgggggtttcgtcgggtactaaac
| |
- | caacgggtggatgcctactttgccgagcatggcctgacccaaagggataatccctccatg
| |
- | tatctgaaaaccctgattattgtgctctggttgttttccgcttgggcctttgtgcttttt
| |
- | gctccagttatttttccggtgcgcctactgggttgtatggttttggcgatcgccttggcg
| |
- | gccttttccttcaatgtcggccacgatgccaaccacaatgcctattcctccaatccccac
| |
- | atcaaccgggttctgggcatgacctacgattttgtcgggttatctagttttctttggcgc
| |
- | tatcgccacaactatttgcaccacacctacaccaatattcttggccatgacgtggaaatc
| |
- | catggagatggcgcagtacgtatgagtcctgaacaagaacatgttggtatttatcgtttc
| |
- | cagcaattttatatttggggtttatatcttttcattcccttttattggtttctctacgat
| |
- | gtctacctagtgcttaataaaggcaaatatcacgaccataaaattcctcctttccagccc
| |
- | ctagaattagctagtttgctagggattaagctattatggctcggctacgttttcggctta
| |
- | cctctggctctgggcttttccattcctgaagtattaattggtgcttcggtaacctatatg
| |
- | acctatggcatcgtggtttgcaccatctttatgctggcccatgtgttggaatcaactgaa
| |
- | tttctcacccccgatggtgaatccggtgccattgatgacgagtgggctatttgccaaatt
| |
- | cgtaccacggccaattttgccaccaataatcccttttggaactggttttgtggcggttta
| |
- | aatcaccaagttacccaccatcttttccccaatatttgtcatattcactatccccaattg
| |
- | gaaaatattattaaggatgtttgccaagagtttggtgtggaatataaagtttatcccacc
| |
- | ttcaaagcggcgatcgcctctaactatcgctggctagaggccatgggcaaagcatcgtga
| |
- | </p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <a data-toggle="modal" href="#modal5" class="btn btn-primary btn-small">ELO 6 L. major</a>
| |
- | <div class="modal hide" id="modal5">
| |
- | <div class="modal-header">
| |
- | <button type="button" class="close" data-dismiss="modal">×</button>
| |
- | <h3>ELO 6 L. major</h3>
| |
- | </div>
| |
- | <div class="modal-body">
| |
- | <p>atgaaggtcatcgtcgcttctggcccggacggtgcccgcaagcacgaggtggagctggca
| |
- | gccaacgccacgctcgcagatctgaagaaggcctaccaacggggtgtggacgtgcaccgc
| |
- | aagtcgttcaaggttcccagcgcggagtcgccgctgccaggtgcggatagtggcaagctg
| |
- | cgcccgaacctcattactctgtcagataaggtgcccctgtcgcagcagggggtgaaggat
| |
- | ggctcggtgatcacttacaaggacctcggcccgcagatcggctaccgcacggtgttctac
| |
- | gtcgagtatgccggccccatcgccttcatgctgctgtacgccatgcgcccttcgctcatc
| |
- | tacggctctgccccgatgccggcttacggctacacgcagaagctatacattggcctcttc
| |
- | ctcgcccacttcttaaagcgcgagctcgagtccatgtttgtgcacaagttctcgcaccca
| |
- | acgatgccgatgcgcaacatcttcaagaactgcatctactactggtccttcgccgccttc
| |
- | atcggctacgtgctgtgcagtccttcattcacgccgaccagcaccatgcagtcaaacttc
| |
- | ggcgccgtggtcatggtcatcaacgagctgctgaacttcgcggtgcactaccagcttagc
| |
- | acgatgcgcaagtccgatggtgacaccacccgcaacgtgccgcaaggccctctgttcgcc
| |
- | ttcgtctcgtgcccgaactacttctttgagattatgtcgtgggtgtccttttccatcggc
| |
- | acaaatatgttatcctcctggttcttcacactcgccggtttcgtgcagatggcggactgg
| |
- | gcgaagaagaagcaccggggctacgtcaaggcggacccggccaataaaaagaaggccgcc
| |
- | attctgcccttcatcatgtag</p>
| |
- | </div>
| |
- | <div class="modal-footer">
| |
- | <a href="#" class="btn" data-dismiss="modal">Close</a>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <BR> </BR><BR> </BR>
| |
- |
| |
- | <a name="Primers"><span class="label">Primers</span></a>
| |
- |
| |
- | <BR> </BR>
| |
- | <p>All primers are notated 5' to 3'.
| |
- | <BR> </BR>
| |
- | <div class="btn-toolbar">
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 T. Cruzi forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCATATGTGGCGGGTTGACAATTTA
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 T. Cruzi reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <p><div class="span3">ATATCTCGAGTTACCCATGAAAGACAC</div></p>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 Synechocystis forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCATATGACTGCCACGATTCCC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 Synechocystis reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCTCGAGTTAAACTTTTTTCAGGGAGC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ15 Synechocystis forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCATATCGCTCTAGAAATTTCATC</div>
| |
- | </ul>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- | <p>
| |
- | <div class="btn-toolbar">
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ15 Synechocystis reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCACGACTTAAGGTTTCTTTTGATATC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ6 Synechocystis forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATCATATGCAAACAGCGGAAAGAATT</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ6 Synechocystis reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4">ATATCTCGAGTAACGATGCTTTGACCATGGCCTCTAG</div>
| |
- | </ul>
| |
- | </div></p>
| |
- | </div>
| |
- |
| |
- | <BR> <?BR>
| |
- | <p>When using the pET-duet vector, we needed additionally primers for the alternative restriction sites and His-tags.</p>
| |
- |
| |
- | <div class="btn-toolbar">
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | ELO6 L. major forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span6">TATCATATGGGAAGCAGCCATCATCATCATCATCACAGCATGGTCTCTCTGGAGCAGGCC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ15 T. Cruzi forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span6">TATCATATGGGCAGCCATCATCATCATCATCACAGCATGCGTCTAGAAATTTCATCG</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ6 T. Cruzi forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4">GGATCCGAATTCATCTAACAGCGGAAAGAATT</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ6 T. Cruzi reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4">GACAAGCTTTCACGATGCTTTGCCCATGGCCTCTAC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 T. Cruzi forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4"> GGATCCGAATTCATGACTGCCACGATTCCC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Δ12 T. Cruzi reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">GACAAGCTTTTAAACTTTTTTCAGGGAGC</div>
| |
- | </ul>
| |
- | </div>
| |
- | </div>
| |
- | <BR> </BR>
| |
- |
| |
- |
| |
- | <a name="Sequencing"><span class="label">Sequencing results</span></a>
| |
- | <BR> </BR>
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- | <dl class="dl-horizontal">
| |
- | <dt>date and gene</dt>
| |
- | <dd>result</dd>
| |
- | <dt>date and gene</dt>
| |
- | <dd>result</dd>
| |
- | <dt>date and gene</dt>
| |
- | <dd>result</dd>
| |
- | <dt>23/7/12 Δ12 Syn.</dt>
| |
- | <dd><p>15b forward gave 0 nucleotides</p>
| |
- | <p>15b reverse gave 0 nucleotides</p>
| |
- | <p>20b forward gave a 41 nucleotide result.</p>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">Sequence<span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span5"><font size="1">gCGnCctGntGCCgCGCGGCnnnnnnnnnnnnnnnnnngac</font></div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <p>A BLAST search showed this to be compatible with <i>Crocosphaera watsonii</i> (genome shotgun sequence, 21%), a diazotrophic cyanobacteria. Add in relations to synechocystis.</p>
| |
- |
| |
- | <p>20b reverse gave 0 nucleotides</p>
| |
- |
| |
- |
| |
- |
| |
- | </dd>
| |
- | </dl>
| |
- | </div>
| |
- |
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- |
| |
- | <a name="Lipid"><span class="label">Lipid analysis</span></a>
| |
- |
| |
- | <BR> </BR><BR> </BR><BR> </BR><BR> </BR>
| |
- | <BR> </BR><BR> </BR><BR> </BR><BR> </BR><BR> </BR>
| |
- | </div>
| |
- |
| |
- | <div class="tab-pane" id="tab3">
| |
- | <p>who knows what those Metal Mickies are up to. Eating nachos in the Whey Pat most likely. MEGA LOLS (all caps, with a Z).</p>
| |
- |
| |
- | <BR> </BR>
| |
- |
| |
- | <p><span class="label"><a href="#Primers2"><font color="white">Primers</font></a></span><span class="label"><a href="#Digestion2"><font color="white">Digestion</font></a></span><span class="label"><a href="#Transformation2"><font color="white">Transformation</font></a></span></p>
| |
- |
| |
- | <BR> </BR>
| |
- | <a name="Primers2"><span class="label">Primers</span></a>
| |
- |
| |
- | <BR> </BR>
| |
- | <p>All primers are notated 5' to 3'.
| |
- | <BR> </BR>
| |
- | <div class="btn-toolbar">
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Ni forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">AATTCCATCATCACCATCACCACC</ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Ni reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <p><div class="span3">TCGAGGTGGTGATCGTGATGATGG</div></p>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Ni<sub>2</sub> forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4">AATTCATGTGTACAACATGCGGTTGCGGTGAAGGCC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Ni<sub>2</sub> reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span4">TCGAGGCCTTCACCGCAACCGCATGTTGTACACATG</div>
| |
- | </ul>
| |
- | </div>.
| |
- | </div>
| |
- |
| |
- | <p>
| |
- | <div class="btn-toolbar">
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Pd forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">AGCGTGACCCAGAACAAATAT</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Pd reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">ATATTTGTTCTGGGTCACGCT</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Pt forward
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">GATCGCACCAGCACCTGGCGC</div>
| |
- | </ul>
| |
- | </div>
| |
- |
| |
- | <div class="btn-group">
| |
- | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
- | Pt reverse
| |
- | <span class="caret"></span>
| |
- | </a>
| |
- | <ul class="dropdown-menu">
| |
- | <div class="span3">GCGCCAGGTGCTGGTGCGATC</div>
| |
- | </ul>
| |
- | </div></p>
| |
- | </div>
| |
- |
| |
- | <BR> </BR>
| |
- |
| |
- | <p>For primer annealing in the PCR, the primer sequences were combined in the following way:</p>
| |
- |
| |
- | <li><strong>GST Forward</strong> and <strong>Ni Reverse</strong></li>
| |
- | <li><strong>GST Forward</strong> and <strong>Ni<sub>2</sub> Reverse</strong></li>
| |
- | <li><strong>GST Forward</strong> and <strong>Pd Reverse</strong></li>
| |
- | <li><strong>GST Forward</strong> and <strong>Pt Reverse</strong></li>
| |
- |
| |
- | <BR> </BR>
| |
- | <a name="Digestion2"><span class="label">Digestion</span></a>
| |
- |
| |
- | <BR> </BR>
| |
- | <p>pGEX-6P-1 was cut using EcoR1(954) and Xho1 (975)</p>
| |
- |
| |
- | <BR> </BR>
| |
- |
| |
- | <a name="Transformation2"><span class="label">Transformation</span></a>
| |
- | <BR> </BR>
| |
- | <p>pGEX vector with insert transformed into DH5α E. coli cells to replicate.</p>
| |
- | <p>pGEX vector with G-Block insert transformed into DH5α E. coli cells to replicate.</p>
| |
- | <BR> </BR>
| |
- | <p>pGEX vector with insert transformed into BL21 E. coli cells for protein expression.</p>
| |
- | <p>pGEX vector with G-Block insert transformed into BL21 E. coli cells for protein expression.</p>
| |
- |
| |
- |
| |
- |
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | <BR> </BR>
| |
- | </div>
| |
- | </div>
| |
- |
| |
- |
| |
- |
| |
- | </div>
| |
- |
| |
- |
| |
- |
| |
- |
| |
- | </body>
| |
- | </html>
| |
- | {{:Team:St_Andrews/Template:Footer}}
| |