|
|
| Line 1: |
Line 1: |
| - | {{:Team:St_Andrews/Template:Header}}
| |
| | | | |
| - | <html>
| |
| - | <head>
| |
| - |
| |
| - | <style type="text/css">
| |
| - | body {
| |
| - | padding-top: 60px; /* 60px to make the container go all the way to the bottom of the topbar */
| |
| - | }
| |
| - | h1 {
| |
| - | padding-bottom: 10px;
| |
| - | }
| |
| - | #footer{
| |
| - | padding-top: 60px;
| |
| - | }
| |
| - | </style>
| |
| - |
| |
| - | <title></title>
| |
| - | </head>
| |
| - |
| |
| - | <body id="body-pattern">
| |
| - | <div class="container" id="content-container">
| |
| - | <header class="jumbotron subhead" id="overview">
| |
| - | <h1>Lab Book</p>
| |
| - | <p></p>
| |
| - | <h2>Procedure</h2>
| |
| - |
| |
| - | </header>
| |
| - |
| |
| - | <div class="tabbable">
| |
| - | <ul class="nav nav-tabs">
| |
| - | <li><a href="#tab1" data-toggle="tab">ω-3 Synthesis</a></li>
| |
| - | <li><a href="#tab2" data-toggle="tab">Metal-binding peptides</a></li>
| |
| - | </ul>
| |
| - | </div>
| |
| - | <div class="tab-content">
| |
| - |
| |
| - | <div class="tab-pane" id="tab1">
| |
| - | </div>
| |
| - |
| |
| - | <div class="tab-pane" id="tab2">
| |
| - |
| |
| - | <BR> </BR>
| |
| - |
| |
| - | <p><span class="label label-info"><a href="#Primers2"><font color="white">Primers</font></a></span> <span class="label label-info"><a href="#Digestion2"><font color="white">Digestion</font></a></span> <span class="label label-info"><a href="#Transformation2"><font color="white">Transformation</font></a></span></p>
| |
| - |
| |
| - | <BR> </BR>
| |
| - | <a name="Primers2"><span class="label label-info">Primers</span></a>
| |
| - |
| |
| - | <BR> </BR>
| |
| - | <p>All primers are notated 5' to 3'.</p>
| |
| - |
| |
| - | <p>Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book#Primer annealing"><strong>Primer annealing lab book entry</strong></a> for further detail.</p>
| |
| - | <p> </p>
| |
| - | <div class="btn-toolbar">
| |
| - | <div class="btn-group">
| |
| - | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
| - | Ni forward
| |
| - | <span class="caret"></span>
| |
| - | </a>
| |
| - | <ul class="dropdown-menu">
| |
| - | <div class="span3">AATTCCATCATCACCATCACCACC</ul>
| |
| - | </div>
| |
| - |
| |
| - | <div class="btn-group">
| |
| - | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
| - | Ni reverse
| |
| - | <span class="caret"></span>
| |
| - | </a>
| |
| - | <ul class="dropdown-menu">
| |
| - | <p><div class="span3">TCGAGGTGGTGATCGTGATGATGG</div></p>
| |
| - | </ul>
| |
| - | </div>
| |
| - |
| |
| - | <div class="btn-group">
| |
| - | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
| - | Ni<sub>2</sub> forward
| |
| - | <span class="caret"></span>
| |
| - | </a>
| |
| - | <ul class="dropdown-menu">
| |
| - | <div class="span4">AATTCATGTGTACAACATGCGGTTGCGGTGAAGGCC</div>
| |
| - | </ul>
| |
| - | </div>
| |
| - |
| |
| - | <div class="btn-group">
| |
| - | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
| - | Ni<sub>2</sub> reverse
| |
| - | <span class="caret"></span>
| |
| - | </a>
| |
| - | <ul class="dropdown-menu">
| |
| - | <div class="span4">TCGAGGCCTTCACCGCAACCGCATGTTGTACACATG</div>
| |
| - | </ul>
| |
| - | </div>.
| |
| - | </div>
| |
| - |
| |
| - | <p>
| |
| - | <div class="btn-toolbar">
| |
| - | <div class="btn-group">
| |
| - | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
| - | Pd forward
| |
| - | <span class="caret"></span>
| |
| - | </a>
| |
| - | <ul class="dropdown-menu">
| |
| - | <div class="span3">AGCGTGACCCAGAACAAATAT</div>
| |
| - | </ul>
| |
| - | </div>
| |
| - |
| |
| - | <div class="btn-group">
| |
| - | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
| - | Pd reverse
| |
| - | <span class="caret"></span>
| |
| - | </a>
| |
| - | <ul class="dropdown-menu">
| |
| - | <div class="span3">ATATTTGTTCTGGGTCACGCT</div>
| |
| - | </ul>
| |
| - | </div>
| |
| - |
| |
| - | <div class="btn-group">
| |
| - | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
| - | Pt forward
| |
| - | <span class="caret"></span>
| |
| - | </a>
| |
| - | <ul class="dropdown-menu">
| |
| - | <div class="span3">GATCGCACCAGCACCTGGCGC</div>
| |
| - | </ul>
| |
| - | </div>
| |
| - |
| |
| - | <div class="btn-group">
| |
| - | <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
| |
| - | Pt reverse
| |
| - | <span class="caret"></span>
| |
| - | </a>
| |
| - | <ul class="dropdown-menu">
| |
| - | <div class="span3">GCGCCAGGTGCTGGTGCGATC</div>
| |
| - | </ul>
| |
| - | </div></p>
| |
| - | </div>
| |
| - |
| |
| - | <BR> </BR>
| |
| - |
| |
| - | <p>For primer annealing in the PCR, the primer sequences were combined in the following way:</p>
| |
| - |
| |
| - | <p>Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book"><strong>Primer annealing lab book entry</strong></a> for further detail.</p>
| |
| - |
| |
| - | <li><strong>GST Forward</strong> and <strong>Ni Reverse</strong></li>
| |
| - | <li><strong>GST Forward</strong> and <strong>Ni<sub>2</sub> Reverse</strong></li>
| |
| - | <li><strong>GST Forward</strong> and <strong>Pd Reverse</strong></li>
| |
| - | <li><strong>GST Forward</strong> and <strong>Pt Reverse</strong></li>
| |
| - |
| |
| - | <BR> </BR>
| |
| - | <a name="Digestion2"><span class="label label-info">Digestion</span></a>
| |
| - |
| |
| - | <BR> </BR>
| |
| - | <p>pGEX-6P-1 was cut using EcoR1(954) and Xho1 (975)</p>
| |
| - |
| |
| - | <BR> </BR>
| |
| - |
| |
| - | <a name="Transformation2"><span class="label label-info">Transformation</span></a>
| |
| - | <BR> </BR>
| |
| - | <p>pGEX vector with insert transformed into DH5α E. coli cells to replicate.</p>
| |
| - | <p>pGEX vector with G-Block insert transformed into DH5α E. coli cells to replicate.</p>
| |
| - | <BR> </BR>
| |
| - | <p>pGEX vector with insert transformed into BL21 E. coli cells for protein expression.</p>
| |
| - | <p>pGEX vector with G-Block insert transformed into BL21 E. coli cells for protein expression.</p>
| |
| - |
| |
| - |
| |
| - |
| |
| - | <BR> </BR>
| |
| - | <BR> </BR>
| |
| - | <BR> </BR>
| |
| - | <BR> </BR>
| |
| - | <BR> </BR>
| |
| - | <BR> </BR>
| |
| - | <BR> </BR>
| |
| - | </div>
| |
| - | </div>
| |
| - |
| |
| - |
| |
| - |
| |
| - | </div>
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - | </body>
| |
| - | </html>
| |
| - | {{:Team:St_Andrews/Template:Footer}}
| |
"
