Team:TU Darmstadt/Project/Metabolism/Materials

From 2012.igem.org

(Difference between revisions)
(Kits)
(Blanked the page)
 
(3 intermediate revisions not shown)
Line 1: Line 1:
-
<html>
 
-
<link rel="stylesheet" href="https://2012.igem.org/wiki/index.php?title=Team:TU_Darmstadt/css&amp;action=raw&amp;ctype=text/css" type="text/css" />
 
-
<div id="TUD">
 
-
<div id="top">
 
-
<ul>
 
-
<li><a href="http://www.igem.tu-darmstadt.de/igem/projekt/index.en.jsp" title="iGEM">iGEM@TUD</a></li>
 
-
<li><a href="/Team:TU_Darmstadt" title="Home">Home</a></li>
 
-
<li><a href="/Team:TU_Darmstadt/Project" title="Project">Project</a><ul>
 
-
        <li><a href="/Team:TU_Darmstadt/Project" title="Team:Overview">Overview</a></li>
 
-
        <li><a href="/Team:TU_Darmstadt/Project/Degradation" title="Degradation">1. Degradation</a></li>
 
-
        <li><a href="/Team:TU_Darmstadt/Project/Transport" title="Transport">2. Transport</a></li>
 
-
        <li><a href="/Team:TU_Darmstadt/Project/Metabolism" title="Metabolism">3. Metabolism</a></li>
 
-
        <li><a href="/Team:TU_Darmstadt/Project/Material_Science" title="Material Science">4. Material Science</a></li>
 
-
        <li><a href="/Team:TU_Darmstadt/Project/Simulation" title="Simulation">5. Simulation</a></li>
 
-
        <li><a href="/Team:TU_Darmstadt/Project/Ecology" title="Ecology">Ecology</a></li>
 
-
        <li><a href="/Team:TU_Darmstadt/Project/Philosophy" title="Philosophy">Philosophy</a></li></ul></li>
 
-
<li><a href="/Team:TU_Darmstadt/Team" title="Team:TU_Darmstadt/Team">Team</a><ul>
 
-
        <li><a href="/Team:TU_Darmstadt/Team" title="Team:TU_Darmstadt/Team">Members</a></li>
 
-
        <li><a href="/Team:TU_Darmstadt/Supporters" title="Team:TU_Darmstadt/Supporters">Supporters</a></li></ul></li>
 
-
<li><a href="/Team:TU_Darmstadt/Parts" title="BioBricks">BioBricks</a></li>
 
-
<li><a href="/Team:TU_Darmstadt/Documentation" title="Documentation">Documentation</a><ul>
 
-
<li><a href="/Team:TU_Darmstadt/Documentation" title="Documentation">Overview</a></li>
 
-
    <li><a href="/Team:TU_Darmstadt/Labjournal" title="Labjournal">Labjournal</a></li>
 
-
    <li><a href="/Team:TU_Darmstadt/Protocols" title="Protocols">Protocols</a></li>
 
-
<li><a href="/Team:TU_Darmstadt/Materials" title="Materials">Materials</a></li>
 
-
<li><a href="/Team:TU_Darmstadt/Modeling" title="Modeling">Modeling</a></li>
 
-
    <li><a href="/Team:TU_Darmstadt/Safety" title="Safety">Safety</a></li>
 
-
    <li><a href="/Team:TU_Darmstadt/Downloads" title="Downloads">Downloads</a></li></ul></li>
 
-
<li><a href="/Team:TU_Darmstadt/Human_Practice" title="Human Practice">Human Practice</a><ul>
 
-
    <li><a href="/Team:TU_Darmstadt/Human_Practice/Panel_Discussion " title="Panel Discussion">Panel Discussion</a></li>
 
-
    <li><a href="/Team:TU_Darmstadt/Human_Practice/Symposia" title="Symposia">Symposia</a></li>
 
-
    <li><a href="/Team:TU_Darmstadt/Human_Practice/Classes" title="Classes">Classes</a></li></ul></li> 
 
-
<li><a href="/Team:TU_Darmstadt/Sponsors" title="Sponsors">Sponsors</a><ul>
 
-
    <li><a href="/Team:TU_Darmstadt/Sponsors" title="Sponsors">Overview</a></li>
 
-
    <li><a href="/Team:TU_Darmstadt/Contact" title="Contact">Benefits</a></li></ul></li> 
 
-
</ul>
 
-
<div id="igem"><a href="https://2012.igem.org/Main_Page"></a></div>
 
-
</div>
 
-
<!-- end #menu -->
 
-
</html>
 
-
<span style="font-size:200%;"><span style="color:#00689D;">Materials</span></span>
 
-
 
-
 
-
==Primer==
 
-
 
-
{| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
 
-
|- style="font-size:11pt;font-weight:bold" align="center" valign="bottom"
 
-
| width="22" height="15" | No.
 
-
| width="89" | Name
 
-
| width="422" | 5´-->3´
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 1
 
-
| tphA2-l-F
 
-
| TCATGCTTGCATCTCCTGTC
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 2
 
-
| tphA2-l-Prefix
 
-
| GAATTCGCGGCCGCTTCTAGATGCAAGAATCCATCATCCAGTGGC
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 3
 
-
| tphA1-Suffix_R
 
-
| CTGCAGCGGCCGCTACTAGTACTAATGGTTGCCAGTCGGGTCTG
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 4
 
-
| tphA3-Suffix_R
 
-
| CTGCAGCGGCCGCTACTAGTATCATAGCGGCAATGACATCAGCGTG
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 5
 
-
| tphA3-Prefix_F
 
-
| GAATTCGCGGCCGCTTCTAGATGATCCATGAAATTCAAATCGCGG
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 6
 
-
| tphA1-l-R
 
-
| CTAATGGTTGCCAGTCGGGT
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 7
 
-
| tphA1-l-PstI(99)-F
 
-
| CATGGTCTCCTCCAGGCCGGCATCGAGCT
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 8
 
-
| tphA1-l-Prefix
 
-
| GAATTCGCGGCCGCTTCTAGATGAACCACCAGATCCATATCCACG
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 9
 
-
| tphA3-l-F
 
-
| TCATAGCGGCAATGACATCA
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 10
 
-
| tphA3-l-Prefix
 
-
| GAATTCGCGGCCGCTTCTAGAGATGATCCATGAAATTCAAATCGC
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 11
 
-
| Prefix
 
-
| GAATTCGCGGCCGCTTCTAGAG
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 12
 
-
| tphB-l-F
 
-
| TCAGACCGGTTGGGCTCCGA
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 13
 
-
| tphB-l-Prefix
 
-
| GAATTCGCGGCCGCTTCTAGAGATGACAATAGTGCACCGTAGATT
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 14
 
-
| tphA2-l-R
 
-
| ATGCAAGAATCCATCATCCAG
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 15
 
-
| tphA1-l-R
 
-
| ATGAACCACCAGATCCATATC
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 16
 
-
| tphA1-l-PstI(99)-R
 
-
| CATGGTCTCCTGGAGGGCTGCATCCAGTAC
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 17
 
-
| tphA3-l-R
 
-
| ATGATCCATGAAATTCAAAT
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 18
 
-
| Suffix
 
-
| CTGCAGCGGCCGCTACTAGTA
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 19
 
-
| tphB-l-Suffix-R
 
-
| CTGCAGCGGCCGCTACTAGTATCAGACCGGTTGGGCTCCGAGTA
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 20
 
-
| EcoRIGFxa-tphA1
 
-
| TTCTGGAATTCGGGTATTGAAGGAAGAATGAACCACCAGATCCATAT
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 21
 
-
| EcoRIGFxa-tphA2
 
-
| TTCTGGAATTCGGGTATTGAAGGAAGAATGCAAGAATCCATCATCCA
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 22
 
-
| EcoRIGFxa-tphA3
 
-
| TTCTGGAATTCGGGTATTGAAGGAAGAATGATCCATGAAATTCAAAT
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 23
 
-
| EcoRIGFxa-tphB
 
-
| TTCTGGAATTCGGGTATTGAAGGAAGAATGACAATAGTGCACCGTAG
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 24
 
-
| EcoRIGFxa-aroY
 
-
| TTCTGGAATTCGGGTATTGAAGGAAGAATGACAGCGCCTATCCAG
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 25
 
-
| RBS-tphA1
 
-
| TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGAACCACCAGATCCATAT
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 26
 
-
| RBS-tphA2
 
-
| TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGCAAGAATCCATCATCCA
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 27
 
-
| RBS-tphA3
 
-
| TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGATCCATGAAATTCAAAT
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 28
 
-
| RBS-tphB
 
-
| TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGACAATAGTGCACCGTAG
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 29
 
-
| RBS-aroY
 
-
| TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGACAGCGCCTATCCAG
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 30
 
-
| VF2
 
-
| TGCCACCTGACGTCTAAGAA
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 31
 
-
| VR
 
-
| ATTACCGCCTTTGAGTGAGC
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 32
 
-
| pPR-IBA2 rev
 
-
| TAGTTATTGCTCAGCGGTGG
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 33
 
-
| pPR-IBA2 for
 
-
| TAATACGACTCACTATAGGG
 
-
 
-
|}
 
-
 
-
==Plasmids==
 
-
 
-
{| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
 
-
|- style="font-size:11pt;font-weight:bold" align="center"
 
-
| width="60" height="15" | No.
 
-
| width="60" | Name
 
-
| width="60" | Sequence
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="center" height="15" | 1
 
-
| pSB1C3
 
-
|style="text-decoration:underline;color:#0000FF" |  [http://partsregistry.org/Part:pSB1C3 Get]
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold;text-decoration:none" align="center" height="15" | 2
 
-
| pSB1AK3
 
-
|style="text-decoration:underline;color:#0000FF" |  [http://partsregistry.org/Part:pSB1AK3 Get]
 
-
 
-
|-  align="center"
 
-
|style="font-size:11pt;font-weight:bold;text-decoration:none" align="center" height="15" | 3
 
-
| BBa_J61002
 
-
|style="font-size:11pt;text-decoration:underline;color:#0000FF" |  [http://partsregistry.org/Part:BBa_J61002 Get]
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold;text-decoration:none" align="center" height="15" | 4
 
-
| pSB1A2
 
-
|style="text-decoration:underline;color:#0000FF" |  [http://partsregistry.org/Part:pSB1A2 Get]
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold;text-decoration:none" align="center" height="15" | 5
 
-
| pPR-IBA2
 
-
|style="text-decoration:underline;color:#0000FF" |  [http://www.iba-lifesciences.com/isotope/2/2-1391-000-Sequence-pPR-IBA2.txt Get]
 
-
 
-
|}
 
-
 
-
==Biobricks from the registry==
 
-
 
-
{| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
 
-
|- style="font-size:11pt;font-weight:bold" align="center"
 
-
| width="60" height="15" | No.
 
-
| width="65" | Name
 
-
| width="60" | Platte
 
-
| width="60" | Well
 
-
| width="60" | Resistence
 
-
| width="90" | Plasmid backbone
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="center" height="15" | 1
 
-
| BBa_K316003
 
-
| align="center" | 4
 
-
| 15C
 
-
| C
 
-
| pSB1C3
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="center" height="15" | 2
 
-
| BBa_J23100
 
-
| align="center" | 1
 
-
| 18C
 
-
| A
 
-
| BBa_J61002
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="center" height="15" | 3
 
-
| BBa_B0015
 
-
| align="center" | 1
 
-
| 23L
 
-
| A und K
 
-
| pSB1AK3
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="center" height="15" | 4
 
-
| BBa_J61101
 
-
| align="center" | 1
 
-
| 5L
 
-
| A
 
-
| pSB1A2
 
-
 
-
|}
 
-
 
-
 
-
==Bacteria==
 
-
 
-
{| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
 
-
|- style="font-size:11pt;font-weight:bold" align="center"
 
-
| width="180" height="30" | Species
 
-
| width="76" | Strain
 
-
| width="501" | Genotype
 
-
| width="46" | DSM-No.
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="22" | Escherichia coli
 
-
| DH5α
 
-
| F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK- mK+), λ–
 
-
| 6897
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="17" | Escherichia coli
 
-
| MG1655
 
-
| F- λ- ilvG- rfb-50 rph-1
 
-
| 18039
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="19" | Escherichia coli
 
-
| BL21(DE3)pLysS
 
-
| F- ompT gal dcm lon hsdSB(rB- mB-) λ(DE3) pLysS(cmR)
 
-
| none
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Comamonas testosteroni
 
-
| Kf-1
 
-
| -
 
-
| 14576
 
-
 
-
|}
 
-
 
-
==Enzymes==
 
-
 
-
{| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
 
-
|- style="font-size:11pt;font-weight:bold" align="center"
 
-
| width="60" height="15" | No.
 
-
| width="250" | Enzyme
 
-
| width="154" | Supplier
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 1
 
-
| Antarctic Phosphatase
 
-
| NEB
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 2
 
-
| BsaI
 
-
| NEB
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 3
 
-
| EcoRI-HF
 
-
| NEB
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 4
 
-
| Phusion® High-Fidelity DNA Polymerase
 
-
| NEB
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 5
 
-
| PstI-HF
 
-
| NEB
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 6
 
-
| SpeI-HF
 
-
| NEB
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 7
 
-
| T4 DNA Ligase
 
-
| NEB
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 8
 
-
| Taq DNA Polymerase with ThermoPol Buffer
 
-
| NEB
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 9
 
-
| XbaI
 
-
| NEB
 
-
 
-
|}
 
-
 
-
==Chemicals==
 
-
 
-
{| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
 
-
|- style="font-size:11pt;font-weight:bold" align="center" valign="bottom"
 
-
| width="60" height="15" | No.
 
-
| width="332" | Name
 
-
| width="104" | Firma
 
-
| width="77" | Order-ID
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 1
 
-
| Terephthalat
 
-
| Sigma-Aldrich
 
-
| 185361-500G
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 2
 
-
| Acetic acid
 
-
| Roth
 
-
| 6755.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 3
 
-
| Methanol
 
-
| Roth
 
-
| CP43.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 4
 
-
| Coomassie Brilliant Blue R-250
 
-
| Roth
 
-
| 9598.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 5
 
-
| Trypton
 
-
| Roth
 
-
| 8952.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 6
 
-
| Ethylene glycol
 
-
| Roth
 
-
| 9516.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 7
 
-
| 3,4-Dihydroxybenzoic acid
 
-
| Sigma-Aldrich
 
-
| 37580-25G-F
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 8
 
-
| Catechol
 
-
| Sigma-Aldrich
 
-
| C9510-100G
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 9
 
-
| Isopropyl β-D-1-thiogalactopyranoside
 
-
| Roth
 
-
| CN08.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 10
 
-
| Tetramethylethylenediamine
 
-
| Roth
 
-
| 2367.3
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 11
 
-
| Ammonium persulfate
 
-
| Roth
 
-
| 9592.3
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 12
 
-
| Bromophenol blue
 
-
| Roth
 
-
| A512.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 13
 
-
| Glucose
 
-
| Roth
 
-
| X997.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 14
 
-
| Calcium chloride
 
-
| Roth
 
-
| CN92.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 15
 
-
| Dithiothreitol
 
-
| Roth
 
-
| 6908.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 16
 
-
| Sodium carbonate
 
-
| Roth
 
-
| 8563.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 17
 
-
| Phenylmethanesulfonylfluoride
 
-
| Roth
 
-
| 6367.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 18
 
-
| NADH-Disodium
 
-
| Roth
 
-
| AE12.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 19
 
-
| Nicotinamide adenine dinucleotide
 
-
| Roth
 
-
| AE11.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 20
 
-
| orthophosphoric acid 85%
 
-
| Roth
 
-
| 9079.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 21
 
-
| Trichloroacetic acid
 
-
| Roth
 
-
| 8789.2
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 22
 
-
| Quick-Load® 100 bp DNA Ladder
 
-
| NEB Biolabs
 
-
| N0467S
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 23
 
-
| Phenol
 
-
| AppliChem
 
-
| A4458.0250
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 24
 
-
| Dimethyl sulfoxide
 
-
| AppliChem
 
-
| A1584.0100
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 25
 
-
| Methylene blue
 
-
| AppliChem
 
-
| A4084.0025
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 26
 
-
| Magnesium sulfate
 
-
| AppliChem
 
-
| A6287.0250
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 27
 
-
| Cetrimonium bromide
 
-
| AppliChem
 
-
| A0805.0100
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 28
 
-
| Tetramethylethylenediamine
 
-
| AppliChem
 
-
| A1148.0025
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 29
 
-
| Urea
 
-
| AppliChem
 
-
| A5470.0500
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 30
 
-
| Tween20
 
-
| AppliChem
 
-
| A1389.0500
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 31
 
-
| Protein Marker III (6,5-200)
 
-
| AppliChem
 
-
| A4402.0001
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 32
 
-
| Thiamine hydrochloride
 
-
| AppliChem
 
-
| A09955.0050
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 33
 
-
| Triton  X-100
 
-
| AppliChem
 
-
| A1388.0500
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 34
 
-
| DNA-Dye NonTox
 
-
| AppliChem
 
-
| A9555.1000
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 35
 
-
| Agarose
 
-
| Roth
 
-
| 3810.2
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 36
 
-
| Ethanol 96 %
 
-
| Roth
 
-
| T171.4
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 37
 
-
| Ethylenediaminetetraacetic acid
 
-
| Roth
 
-
| X986.2
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 38
 
-
| Ethanol
 
-
| Roth
 
-
| P076.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 39
 
-
| Tetracycline hydrochloride
 
-
| Roth
 
-
| 237.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 40
 
-
| D-Desthiobiotin 10x Buffer E
 
-
| iba
 
-
| 2-1000-025
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 41
 
-
| 2-(4-Hydroxyphenylazo)benzoic acid
 
-
| Sigma-Aldrich
 
-
| H5126-5G
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 42
 
-
| 10 mM dNTP-Mix
 
-
| Roth
 
-
| L785.2
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 43
 
-
| Hydrochloric acid
 
-
| Roth
 
-
| 9277.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 44
 
-
| Acrylamid - Bis (37,5:1)
 
-
| Roth
 
-
| 3029.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 45
 
-
| Ammonium acetate
 
-
| Roth
 
-
| 7869.2
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 46
 
-
| Agar-Agar
 
-
| Roth
 
-
| 5210.3
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 47
 
-
| Chloroform
 
-
| Roth
 
-
| 4423.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 48
 
-
| Glycine
 
-
| Roth
 
-
| 3790.2
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 49
 
-
| Dipotassium phosphate
 
-
| Roth
 
-
| T875.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 50
 
-
| Sodium chloride
 
-
| Roth
 
-
| 9265.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 51
 
-
| Yeast extract
 
-
| Roth
 
-
| 2363.2
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 52
 
-
| Monopotassium phosphate
 
-
| Roth
 
-
| P018.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 53
 
-
| Glycerine
 
-
| Roth
 
-
| 3783.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 54
 
-
| Sodium hydroxide
 
-
| Roth
 
-
| P031.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 55
 
-
| Tris-Base
 
-
| Roth
 
-
| AE15.2
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 56
 
-
| Isopropyl alcohol
 
-
| Roth
 
-
| CP41.3
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 57
 
-
| Isoamyl alcohol
 
-
| Roth
 
-
| T870.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 58
 
-
| Acetonitrile
 
-
| Roth
 
-
| 7330.2
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 59
 
-
| Acetone
 
-
| Roth
 
-
| 5025.5
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 60
 
-
| Chloramphenicol
 
-
| Roth
 
-
| 3886.2
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 61
 
-
| Ampicillin
 
-
| Roth
 
-
| K029.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 62
 
-
| Kanamycin
 
-
| Roth
 
-
| T832.1
 
-
 
-
|- style="font-size:11pt" align="center" valign="bottom"
 
-
|style="font-weight:bold" align="center" height="15" | 63
 
-
| Sodium dodecyl sulfate
 
-
| Roth
 
-
| 5136.1
 
-
 
-
|}
 
-
 
-
 
-
==Kits==
 
-
 
-
{| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
 
-
|- style="font-size:11pt;font-weight:bold" align="center"
 
-
| width="60" height="15" | No.
 
-
| width="250" | Kit
 
-
| width="154" | Supplier
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 1
 
-
| PureYield™ Plasmid Miniprep System
 
-
| Promega
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 2
 
-
| PureYield™ Plasmid Midiprep System
 
-
| Promega
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
|style="font-weight:bold" align="right" height="15" | 3
 
-
| Wizard® SV Gel and PCR Clean-Up System
 
-
| Promega
 
-
 
-
|}
 
-
 
-
==Consumabels==
 
-
 
-
{| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
 
-
|- style="font-size:11pt;font-weight:bold" align="center"
 
-
| width="250" height="15" | Article
 
-
| width="142" | Supplier
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | epT.I.P.S.® Box pipette tips 0.1–20 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | epT.I.P.S.® Box pipette tips 10–200 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | epT.I.P.S.® Box pipette tips 100–1000 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | epT.I.P.S.® Bulk pipette tips 0.1–20 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | epT.I.P.S.® Bulk pipette tips 10–200 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | epT.I.P.S.® Bulk pipette tips 100–1000 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | PCR Tubes 0.2 mL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | PCR Tube Strips 0.2 mL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Safe-Lock Tubes (1.5 mL)
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Safe-Lock Tubes (2 mL)
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Rotilabo®-syringe filters
 
-
| Carl Roth GmbH
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | NORM-Ject Syringes
 
-
| Henke/Sass/Wolf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Multiply®-PCR-tubes 0.2 mL
 
-
| Sarstedt
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | VWR® Pipet Tips (Standard Tips, 0.1–20 µL)
 
-
| VWR
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | VWR® Pipet Tips (Standard Tips, 10–200 µL)
 
-
| VWR
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | VWR® Pipet Tips (Standard Tips, 100-1000 µL)
 
-
| VWR
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | VWR® Powder-Free Nitrile Examination Gloves
 
-
| VWR
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Eco-friendly centrifuge tubes (15 mL, unsterile)
 
-
| Carl Roth GmbH
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | 50 mL Centrifuge tubes, sterile
 
-
| Greiner bio-one
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Sekuroka®-disposal bags
 
-
| Carl Roth GmbH
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Rotiprotect®-nitrile gloves, unpowdered
 
-
| Carl Roth GmbH
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | UV-cuvettes PLASTIBRAND® (Micro z = 8,5 mm)
 
-
| Brand GmbH & Co. KG
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Parafilm® M
 
-
| Pechiney Plastic Packaging
 
-
 
-
|}
 
-
 
-
==Equipment==
 
-
 
-
{| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
 
-
|- style="font-size:11pt;font-weight:bold" align="center"
 
-
| width="250" height="15" | Equipment
 
-
| width="154" | Supplier
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Mastercycler personal (Thermocycler)
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Heraeus Pico Microcentrifuge
 
-
| Thermo Scientific
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Multifuge® 1S-R
 
-
| Thermo Scientific
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | VX-150 Autoclave
 
-
| Systec
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Uni-Drybath Thermoshaker
 
-
| Universal Labortechnik
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Vortex Genie 2
 
-
| Scientific Industries
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Universal Centrifuge
 
-
| Sigma Laborzentrifugen
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Dark Hood DH-40 with control panel and display
 
-
| Biostep
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="30" | BioMate 3S Spectrophotometer
 
-
| Thermo Scientific
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | GENESYS 10S UV-Vis
 
-
| Thermo Scientific 
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Heraeus LaminAir HA 2448 GS
 
-
| Heraeus 
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="30" | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 10 µL
 
-
| VWR
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="30" | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 100 µL
 
-
| VWR
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="30" | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 1000 µL
 
-
| VWR
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Research® plus, adjustable pipette 0.5 - 10 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Research® plus, adjustable pipette 10 - 100 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Research® plus, adjustable pipette 100 – 1000 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Research® plus, adjustable pipette 10 - 200 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Research® plus, adjustable pipette 0.5 - 20 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Reference, adjustable pipette 0.5 – 10 µL
 
-
| Eppendorf
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | M-Prove Balances
 
-
| Sartorius
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | M-Power Balances
 
-
| Sartorius
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Owl Series EasyCast™ Horizontal Mini-Gel Systems
 
-
| VWR
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Owl Series Horizontal Gel Systems
 
-
| VWR
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Owl Series Dual Gel Vertical Electrophoresis System
 
-
| VWR
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Power Supplies 250V
 
-
| VWR
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Incubation/Inactivation Water Bath  1008
 
-
| Gesellschaft für Labortechnik
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | Lab-Shaker LSR-V
 
-
| Adolf Kühner AG
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | MR Hei-Mix S
 
-
| Heidolph
 
-
 
-
|- style="font-size:11pt" align="center"
 
-
| height="15" | FE20 – FiveEasy™ pH
 
-
| Mettler Toledo
 
-
 
-
|}
 

Latest revision as of 11:17, 23 September 2012