Overview

Three problems came up while we start calculating: what sequences to input, which method to use and how cogent the result will be. As for sequence, we input the both the SD and the protein coding sequence.

Our goal is to calculate the total ΔG of each reaction and then predict the amount of protein expressed. There are several softwares dealing with DNA or RNA base-pairing progress, such as NUPACK, RBS-Calculator, and Vienna RNA etc. After comparison, we decide to use RBS-Calculator.

Due to the complication of translation progress and our lack of insight in this issue, the results of our modeling can’t be very precise. But at least it should have the precision of order of magnitude.

Input of Our Calculation

RBS sequence

• RFP, normal RBS

ATTTCACACATACTAGAGAAAGAGGAGAAATACTAGATGGCTTCCTCCGAAGACGTTATCAAAGAGTT

CATGCGTT

• RFP, orthogonal RBS

ATTTCACACATGTTCCGTACTAGATGGCTTCCTCCGAAGACGTTATCAAAGAGTTCATGCGTT

• GFP, normal RBS

TACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAAT

TCTTGTT

16S rRNA sequence

• normal 16S: ACCTCCTTA
• orthogonal 16S: ACGGAACTA

Formula Derivation

Basic Idea

For model design, please refer to Design part. Data of the curve Er-time is obtained from E_c=K∙E_r experiments. The function of our model is to work out the proportion factor ‘K’

Basic Assumption

1. The expression of RFP and GFP are independent.
2. The expression of the two proteins are determined by the percentage of normal and orthogonal ribosomes rather than the number of the two ribosomes.
3. The growth curve ofbacteria do not change significantly after the transferredinto orthogonal protein expression system.