Team:LMU-Munich/Bacillus BioBricks
From 2012.igem.org
Line 191: | Line 191: | ||
*'''J23118''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823014 BioBrick:BBa_K823014] | *'''J23118''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823014 BioBrick:BBa_K823014] | ||
<p align="justify"></p> | <p align="justify"></p> | ||
- | |||
====Constitutive promoters from ''B. subtilis''==== | ====Constitutive promoters from ''B. subtilis''==== | ||
- | <p align="justify">The second group of promoters charaterized are constitutive promoters from ''B. subtilis''. We evaluated the promoters P<sub>''liaG''</sub>, P<sub>''veg''</sub> and P<sub>''lepA''</sub>. Therefore we used the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' as well as the | + | <p align="justify">The second group of promoters charaterized are constitutive promoters from ''B. subtilis''. We evaluated the promoters P<sub>''liaG''</sub>, P<sub>''veg''</sub> and P<sub>''lepA''</sub>. Therefore we used the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' as well as the BioBrick reporters ''lacZ'', ''luc'' and ''mKate2''.</p> |
+ | |||
*'''P<sub>''liaG''</sub>''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823000 BioBrick:BBa_K823000] | *'''P<sub>''liaG''</sub>''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823000 BioBrick:BBa_K823000] | ||
<p align="justify">P<sub>''liaG''</sub> is a weak, constitutive promoter from B. subtilis. It is responsible for the transcription of the last four genes of the liaIHGFSR locus and therefore for the production of the components of the LiaRS system, which is important for the detection of cell wall antibiotics [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan ''et al.'', 2006)]. P<sub>''liaG''</sub> was evaluated with the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' as well as the reporter BioBrick ''lacZ''. This promoter showed a much higher activity than the Anderson promoters which was still weak in comparison to the other evaluated ''Bacillus'' promoters (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). </p> | <p align="justify">P<sub>''liaG''</sub> is a weak, constitutive promoter from B. subtilis. It is responsible for the transcription of the last four genes of the liaIHGFSR locus and therefore for the production of the components of the LiaRS system, which is important for the detection of cell wall antibiotics [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan ''et al.'', 2006)]. P<sub>''liaG''</sub> was evaluated with the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' as well as the reporter BioBrick ''lacZ''. This promoter showed a much higher activity than the Anderson promoters which was still weak in comparison to the other evaluated ''Bacillus'' promoters (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). </p> | ||
+ | |||
*'''P<sub>''veg''</sub>''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823003 BioBrick:BBa_K823003] | *'''P<sub>''veg''</sub>''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823003 BioBrick:BBa_K823003] | ||
<p align="justify">P<sub>''veg''</sub> is known to show a strong constitutive activity during the vegetative growth phase and sporulation phase. This promoter is important for the transcription of the veg gene, which plays an important role during sporulation [http://www.ncbi.nlm.nih.gov/pubmed?term=J.%20Biochem.%2C%20133%20%284%29%3A%20475%E2%80%93483: (Fukushima ''et al.'', 2003)]. P<sub>''veg''</sub> was measured by using the reporter vector pSB<sub>Bs</sub>1C-''lacZ'' as well as the reporter BioBrick ''lacZ''. This promoter was the strongest of our evaluated promoters (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). </p> | <p align="justify">P<sub>''veg''</sub> is known to show a strong constitutive activity during the vegetative growth phase and sporulation phase. This promoter is important for the transcription of the veg gene, which plays an important role during sporulation [http://www.ncbi.nlm.nih.gov/pubmed?term=J.%20Biochem.%2C%20133%20%284%29%3A%20475%E2%80%93483: (Fukushima ''et al.'', 2003)]. P<sub>''veg''</sub> was measured by using the reporter vector pSB<sub>Bs</sub>1C-''lacZ'' as well as the reporter BioBrick ''lacZ''. This promoter was the strongest of our evaluated promoters (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). </p> | ||
+ | |||
*'''P<sub>''lepA''</sub>''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823002 BioBrick:BBa_K823002] | *'''P<sub>''lepA''</sub>''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823002 BioBrick:BBa_K823002] | ||
<p align="justify"> P<sub>''lepA''</sub> is constitutive promoter which is important for the transcription of a bicistronic operon. One of the expressed proteins is the protein PlepA [http://www.ncbi.nlm.nih.gov/pubmed?term=Microbiology%2C%20142%3A%201641%E2%80%931649: (Homuth ''et al.'', 1996)]. This protein plays an important role during the translation as it can move the mRNA-tRNA complex one step back in the ribosome which is expected to improve the fidelity of translation [http://www.ncbi.nlm.nih.gov/pubmed?term=Cell%2C%20127%20%284%29%3A%20721%E2%80%93733: (Qin ''et al.'', 2006)]. This promoter was evaluated with the reporter vector pSB<sub>Bs</sub>3C-<i>luxABCDE</i> as well as the reporter BioBricks ''luc'' and ''mKate2''. The activity of this promoter is between the activity of the strongest promoter P<sub>''veg''</sub> and the weak ''Bacillus'' promoter P<sub>''liaG''</sub> (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). </p> | <p align="justify"> P<sub>''lepA''</sub> is constitutive promoter which is important for the transcription of a bicistronic operon. One of the expressed proteins is the protein PlepA [http://www.ncbi.nlm.nih.gov/pubmed?term=Microbiology%2C%20142%3A%201641%E2%80%931649: (Homuth ''et al.'', 1996)]. This protein plays an important role during the translation as it can move the mRNA-tRNA complex one step back in the ribosome which is expected to improve the fidelity of translation [http://www.ncbi.nlm.nih.gov/pubmed?term=Cell%2C%20127%20%284%29%3A%20721%E2%80%93733: (Qin ''et al.'', 2006)]. This promoter was evaluated with the reporter vector pSB<sub>Bs</sub>3C-<i>luxABCDE</i> as well as the reporter BioBricks ''luc'' and ''mKate2''. The activity of this promoter is between the activity of the strongest promoter P<sub>''veg''</sub> and the weak ''Bacillus'' promoter P<sub>''liaG''</sub> (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). </p> | ||
Line 211: | Line 213: | ||
<p align="justify">The last group of promoters consists of two inducible promoters of ''B. subtilis'' , P''<sub>liaI</sub>'' and P''<sub>xyl</sub>''-''XylR''. They are useful to decide when to turn on gene expression because these promoters need an inducer to start transcription. They are evaluated with the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' and the BioBrick reporters ''lacZ'', ''luc'' and ''mKate2''. | <p align="justify">The last group of promoters consists of two inducible promoters of ''B. subtilis'' , P''<sub>liaI</sub>'' and P''<sub>xyl</sub>''-''XylR''. They are useful to decide when to turn on gene expression because these promoters need an inducer to start transcription. They are evaluated with the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' and the BioBrick reporters ''lacZ'', ''luc'' and ''mKate2''. | ||
+ | |||
*'''P<sub>''liaI''</sub>''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823001 BioBrick:BBa_K823001] | *'''P<sub>''liaI''</sub>''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823001 BioBrick:BBa_K823001] | ||
P''<sub>liaI</sub>'' is an inducible promoter from ''B. subtilis'' which is induced by antibiotics that interact with the lipidII cycle, e.g. bacitracin. If the cell senses stress there is a phosphorylation of the two proteins LiaS and LiaR. LiaR binds to the operator of the promoter and induces the transcription. When the promoter is turned on the two proteins LiaI and LiaH are expressed which play an important role in the stress response [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan ''et al.'', 2006)]. This promoter is evaluated with the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' as well as the reporter genes ''lacZ'', ''luc'' and ''mKate2''. The induction was measured with different concentrations of bacitracin (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). | P''<sub>liaI</sub>'' is an inducible promoter from ''B. subtilis'' which is induced by antibiotics that interact with the lipidII cycle, e.g. bacitracin. If the cell senses stress there is a phosphorylation of the two proteins LiaS and LiaR. LiaR binds to the operator of the promoter and induces the transcription. When the promoter is turned on the two proteins LiaI and LiaH are expressed which play an important role in the stress response [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan ''et al.'', 2006)]. This promoter is evaluated with the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' as well as the reporter genes ''lacZ'', ''luc'' and ''mKate2''. The induction was measured with different concentrations of bacitracin (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). | ||
- | *'''P<sub>''Xyl''</sub>-''XylR'''''[http://partsregistry.org/wiki/index.php?title=Part:BBa_K8230015 BioBrick:BBa_K823015] | + | |
+ | *'''P<sub>''Xyl''</sub>-''XylR''''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K8230015 BioBrick:BBa_K823015] | ||
P<sub>''Xyl''</sub>-''XylR'' is a inducible promoter from ''B. subtilis'' which is induced by xylose. This promoter was evaluated with the BioBrick reporter lacZ (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). | P<sub>''Xyl''</sub>-''XylR'' is a inducible promoter from ''B. subtilis'' which is induced by xylose. This promoter was evaluated with the BioBrick reporter lacZ (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). | ||
Line 236: | Line 240: | ||
<p align="justify">We synthesized this ''rfp'' derivate with a codon-optimized version for the use in ''B. subtilis'' with pre- and suffix of the Freiburg standard</p> | <p align="justify">We synthesized this ''rfp'' derivate with a codon-optimized version for the use in ''B. subtilis'' with pre- and suffix of the Freiburg standard</p> | ||
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029] | [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029] | ||
+ | |||
*'''LacZ''' | *'''LacZ''' |
Revision as of 17:13, 12 September 2012
The LMU-Munich team is exuberantly happy about the great success at the World Championship Jamboree in Boston. Our project Beadzillus finished 4th and won the prize for the "Best Wiki" (with Slovenia) and "Best New Application Project".
[ more news ]
Bacillus BioBricks
We will create a toolbox of Bacillus BioBricks to contribute to the registry.
This BacillusBioBrickBox contains Bacillus specific:
Bacillus Vectors
Here is a list of all the vectors we cloned and used. Please note that pMAD is not in a BioBrick standard, but it is a useful tool to knock out genes in Bacillus subtilis.
For the use of our vectors, please see our Protocols page. A general introduction to Bacillus subtilis and its integrative vectors can be found here. All vectors have ampicillin as E. coli resistance and RFP as selection marker.
Name BioBrick | E. coli res. | B. subt. res. | Insertion locus | Description | Derived from | Reference |
---|---|---|---|---|---|---|
pSBBs1C-lacZ [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823021 (BBa_K823021) ] | Amp | Cam | amyE | with lacZ reporter gene | pAC6 | [http://www.ncbi.nlm.nih.gov/pubmed/11902727 Stülke et al.] |
pSBBs4S [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823022 (BBa_K823022)] | Amp | Spec | thrC | empty | pDG1731 | [http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury et al.] |
pSBBs1C [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823023 (BBa_K823023)] | Amp | Cam | amyE | empty | pDG1662 | [http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury et al.] |
pSBBs4S-PXyl [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823024 (BBa_K823024)] | Amp | Spec | thrC | with Xylose-inducible promoter | pXT | [http://www.ncbi.nlm.nih.gov/pubmed/11069659 Derré et al.] |
pSBBs3C-luxABCDE [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823025 (BBa_K823025)] | Amp | Cam | sacA | with luxABCDE reporter cassette | pAH328 | [http://www.ncbi.nlm.nih.gov/pubmed/20709900 Schmalisch et al.] |
pSBBs0K-Pspac [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823026 (BBa_K823026)] | Amp | Kan | replicative | with IPTG inducible promoter | pDG148 | [http://www.ncbi.nlm.nih.gov/pubmed/11728721 Joseph et al.] |
pSBBs2E [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823027 (BBa_K823027)] | Amp | MLS | lacA | empty | pAX01 | [http://www.ncbi.nlm.nih.gov/pubmed/11274134 Härtl et al.] |
The number in the vector's name codes for the insertion locus and the following letter for the Bacillus subtilis resistance gene according to the following table:
Number | Insertion locus | Letter | Resistance |
---|---|---|---|
0 | replicative | C | Chloramphenicol |
1 | amyE (amylase) | E | MLS (Erythromycin + Lincomycin) |
2 | lacA (laccase) | K | Kanamycin |
3 | sacA (sucrase) | S | Spectinomycin |
4 | thrC (threonine C) |
The concentrations of the antibiotics and the insertion tests can be found in our Protocol section.
The promoters we submit are:
Pveg, PliaI, PliaG, plepA, Pxyl, Pxyl+XylR
We also tested the [http://partsregistry.org/Promoters/Catalog/Anderson Anderson promoter collection] in Bacillus subtilis with pSBBs3C-luxABCDE. The data will be online in our Data section soon.
Furthermore we plan to submit reporter genes optimized for Bacillus subtilis, namely GFP, lacZ, luc and mKate2.
Useful for the registry are also 5 tags in Freiburg Standard (cMyc, 10His, Flag, Strep, HA).
More details to come soon.
Bacillus Promoters
To get a set of promoters with different strength we characterized several promoters in B. subtilis. They can be divided in three different groups: the constitutive promoters from the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] from the Partsregistry, the constitutive promoters PliaG, Pveg and PlepA from B. subtilis, and the inducible promoters PliaI and Pxyl-XylR from B. subtilis. For the characterization of the different promoters we used the two reporter vectors pSBBs3C-luxABCDE and pSBBs1C-lacZ as well as the reporters lacZ, luc and mKate2 in BioBrick standard.
Anderson promoters
The first group of promoters evaluated are the promoters of the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] which we call Anderson promoters. They have already been measured in Escherichia coli where they all showed a constitutive behavior with a different strength. In this project, eleven Anderson promoters were characterized in B. subtilis. Therefore we used the reporter vector pSBBs3C-luxABCDE from the BioBrickBox were they showed quiet a low activity in B. subtilis (see Data). To confirm this result some Anderson promoters were also evaluated in the reporter vector pSBBs1C-lacZ(see Data).
- J23100 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823004 BioBrick:BBa_K823004]
- J23101 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823005 BioBrick:BBa_K823005]
- J23102 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823006 BioBrick:BBa_K823006]
- J23103 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823007 BioBrick:BBa_K823007]
- J23106 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823008 BioBrick:BBa_K823008]
- J23107 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823009 BioBrick:BBa_K823009]
- J23113 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823010 BioBrick:BBa_K823010]
- J23114 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823011 BioBrick:BBa_K823011]
- J23115 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823012 BioBrick:BBa_K823012]
- J23117 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823013 BioBrick:BBa_K823013]
- J23118 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823014 BioBrick:BBa_K823014]
Constitutive promoters from B. subtilis
The second group of promoters charaterized are constitutive promoters from B. subtilis. We evaluated the promoters PliaG, Pveg and PlepA. Therefore we used the reporter vectors pSBBs3C-luxABCDE and pSBBs1C-lacZ as well as the BioBrick reporters lacZ, luc and mKate2.
- PliaG [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823000 BioBrick:BBa_K823000]
PliaG is a weak, constitutive promoter from B. subtilis. It is responsible for the transcription of the last four genes of the liaIHGFSR locus and therefore for the production of the components of the LiaRS system, which is important for the detection of cell wall antibiotics [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan et al., 2006)]. PliaG was evaluated with the reporter vectors pSBBs3C-luxABCDE and pSBBs1C-lacZ as well as the reporter BioBrick lacZ. This promoter showed a much higher activity than the Anderson promoters which was still weak in comparison to the other evaluated Bacillus promoters (see Data).
- Pveg [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823003 BioBrick:BBa_K823003]
Pveg is known to show a strong constitutive activity during the vegetative growth phase and sporulation phase. This promoter is important for the transcription of the veg gene, which plays an important role during sporulation [http://www.ncbi.nlm.nih.gov/pubmed?term=J.%20Biochem.%2C%20133%20%284%29%3A%20475%E2%80%93483: (Fukushima et al., 2003)]. Pveg was measured by using the reporter vector pSBBs1C-lacZ as well as the reporter BioBrick lacZ. This promoter was the strongest of our evaluated promoters (see Data).
- PlepA [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823002 BioBrick:BBa_K823002]
PlepA is constitutive promoter which is important for the transcription of a bicistronic operon. One of the expressed proteins is the protein PlepA [http://www.ncbi.nlm.nih.gov/pubmed?term=Microbiology%2C%20142%3A%201641%E2%80%931649: (Homuth et al., 1996)]. This protein plays an important role during the translation as it can move the mRNA-tRNA complex one step back in the ribosome which is expected to improve the fidelity of translation [http://www.ncbi.nlm.nih.gov/pubmed?term=Cell%2C%20127%20%284%29%3A%20721%E2%80%93733: (Qin et al., 2006)]. This promoter was evaluated with the reporter vector pSBBs3C-luxABCDE as well as the reporter BioBricks luc and mKate2. The activity of this promoter is between the activity of the strongest promoter Pveg and the weak Bacillus promoter PliaG (see Data).
Inducible promoters from B. subtilis
The last group of promoters consists of two inducible promoters of B. subtilis , PliaI and Pxyl-XylR. They are useful to decide when to turn on gene expression because these promoters need an inducer to start transcription. They are evaluated with the reporter vectors pSBBs3C-luxABCDE and pSBBs1C-lacZ and the BioBrick reporters lacZ, luc and mKate2.
- PliaI [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823001 BioBrick:BBa_K823001]
- PXyl-XylR [http://partsregistry.org/wiki/index.php?title=Part:BBa_K8230015 BioBrick:BBa_K823015]
Bacillus Reporters
<p align="justify">We designed some reporters that are commonly used in B. subtilis or are codon optimized versions of popular reporter genes. All reporters have a modified iGEM Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RCF 25]) pre- and suffix for assembly of in-frame fusion proteins. Our prefix also includes the B. subitlis optimized RBS.prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
- GFP
We took a gfp derivate of the Bacillus subtilis plasmids pGFPamy and added the BioBrick compatiple pre- and suffix of the Freiburg standard (Assembly 25).
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K823039 BioBrick:BBa_K823039]
- mKate
We synthesized this rfp derivate with a codon-optimized version for the use in B. subtilis with pre- and suffix of the Freiburg standard
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029]
- LacZ
This lacZ gene is derived from the Bacillus reporter vector pAC6. It is constructed in the Freiburg Standard (Assembly 25) for in-frame fusion proteins. It also includes a Shine-Dalgarno Sequence optimized for Bacillus subtilis translation.
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K823019 BioBrick:BBa_K823019]
- luc
We synthesized this luciferase for luminescence assays with luciferin as substrate.
[http://partsregistry.org/wiki/index.php?title=Part:BBa_K823028 BioBrick:BBa_K823028]
Affinity Tags
Project Navigation
+--+--+--+--+--+--+-- | +--+--+--+--+-- | +--+--+--+--+--+-- | +--+--+--+--+--+-- |
Bacillus BioBrickBOX |
SporeCoat FusionProteins |
Germination STOP |