Team:Leicester/September2012

(09:00 am) The group returned to labs in the hope that the growth curve had gone right this time. However as per usual there was too much growth over the whole weekend. Some colonies could be counted but the group decided to wait for the rest of the team to return from their homes after going home for the weekend.

(09:15 am) The group worked on the wiki writing the past weeks work in, making sure all the details were correct and in the right order.

(11:00) Nathan and Chris went to the lab and started to work out the concentrations of the 16s extracted DNA to run on the gel, ready for sequencing. We don't want to use up to much of our DNA so needed to work out the optimum amount to run on the gel. As well as that we are going to have to remake the gel as the one will made has a fair few imperfections just to be on the safe side

(14:00) Calculations done, took some time as Chris had a meeting at 12 for a hour and a half. Had it checked and now are going to get ready to run 2ul of each of our sample, and 4ul of sample number 2 which has a lower ng/ul reading. As we have only a finite amount of DNA we are to vary the amount of the markers for different conc of DNA to work out the concentration of our samples to make sure the nano-drop was accurate. After this we can get ready to sequence the DNA to find out what the bacteria is.

(15:45) Nathan loaded the gel and then put the gel lane organisation
x
x
marker 4ul
2 (4ul)
3 (2ul)
4 (2ul)
marker 2ul
5 (2ul)
6 (2ul)
marker 1ul
x
x
x
x
Gel is now running, and will be complete in 1 & 1/2 hours time.

(16:30) Group meeting to bring our supervisors up to speed with the project progress, and discuss terms and action plan for the following day, as well as a minor look into future plans.

(17:30) Meeting finished early so that Chris could stop the gel and then transilluminate to get a gel photo allowing us to work out the concentration of the DNA more accurately allowing us to work out how much to use for the sequencing to be done tomorrow.

(09:00) The group running the growth curve experiment had a single important task to do this morning. That being to plate out 2 colonies on a plate each to see if they are 2 forms of the same bacteria or simply 2 separate species of bacteria. This required plates being made, then individual colonies picked out to streak them. Once finished it is a day working on modelling, writing protocol and other computer based stuff before checking the results of the plates in the late afternoon.

(9:00) Chris and Luke arrived at the lab and started to discuss the pathways for the project, we have a meeting at 11 with Dr Dalgelish and Dr Badge to discuss what to do next. We are hoping at this stage, although late in the competition, to try and get a biobrick sorted. We are looking at the TodX TodC1&2 TobA&B genes and the other ones in the operon for toluene degredation which we think is also the pathway for the polystyrene degradation.

(12:00) After the meeting Chris and Luke started looking though the Genomic sequences and BLAST searching for bacteria that had proteins similar to the ones above to PCR out and so far have yet to find proteins that are in p.Aeruginosa.... fingers crossed we can get hold of some of the Pseudomonas putida F1 which has all of the genes.

(15:00)Dr Badge and Chris set up the PCR reaction of the 16S to increase the amount of DNA in the forward direction, and the reverse direction (in separate tubes) ready for Sequencing tomorrow. Chris then plated out the Yellow colonies, Orange colonies, and re streaked the 01#502 so we have fresh colonies ready to prepare them for storage as we are coming close to the end of the project.

(16:00) Chris is now writing up the wiki while luke is looking through BLAST searches again to find proteins. Phil is currently getting spec readings for the mmp broth with the 01#502 which came out at mixed culture 0.334 orange culture 0.6 at OD600 blank being the mm , which looks good as there is no other carbon other than the polystyrene which is good news!

Nathan editing the wiki once more.

(14:00) had meeting to discuss important matters before going to amsterdam. Everyone was brought up to speed with what each individual section of our project (modelling, lab work and chemistry) has done, found out and achieved. Job roles were assigned to each person to complete in labs and on the computer modelling.

(16:30) Luke has prepared more polystyrene minimal media plates have been prepared ready for plating out some colonies from CSE kits onto, to see whether we can find more positive results from other samples.

(17:00) Will is making more minimal media from minimal broth, to make more polystyrene minimal media plates ready for the CSE kits and potentially the Pseudomonas putida starins we may be getting shortly.

(17:05) Chris setting up ready for the boilate with a sample of our unknown bacteria to extract the DNA, ready for hopefully setting an overnight PCR reaction so that we can sequence the 16S ribosome later on this week.

(17:20) Will has now taken over doing the boilate so that Chris can set up the master mix for the PCR Reactions. as we are doing 14 PCR reactions we need to make up 270ul of the master mix which is enough for aliquoting 18ul into 15 reactions. reaction mixture list:
171ul PCR H20
60ul HF buffer
6ul dNTP's
15ul Primer A 28f AAGAGTTTGATCCTGGCTCAGA
15ul Primer B 519R GWATTACCGCGGCKGCTG
Template DNA to e added later as it is not PCR clean
3ul DNA Pol
These reagents were added then as the DNA Pol was in glycerol the tube was mixed and span for a second to remove bubbles. dNTPs cannot be freeze thawed so whatever was left was thrown. After this, in the hood Chris took 18ul aliquots of the master mix into 9 separate PCR eppendorfs and prepared the -ve control while in the PCR hood with the PCR clean H2O. The tubes were then taken to the bench where the DNA and diluted bacteria were added, and the +ve and -ve controls ( see gel lane organization) all samples were added at 2ul to make a final volume of 20ul.
PCR Cycle program used was iGEM16S which is as follows:
98 degrees C - 5 min
''98 degrees C - 30 seconds''
''50 degrees C - 30 seconds''
''72 degrees C - 2 minutes''
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction)

(9:00) Chris, Will, Emily and Luke in lab, Anthony and Phil in computer lab. Luke is writing the Protocol page on the wiki, while Chris is making a 2% gel ready to run the PCR reaction mixture. Will is currently trying to track down some of the P. putida F1 strain which we may have located. Luke is writing up some of the protocol in the project section of the Wiki, and will be on and off for the whole day

(9:40) Chris has now poured the gel which is setting and is now going to prep the PCR reaction mixtures adding 5ul of loading dye to each of the mixtures,ready for them to be ran once the gel has set.

( 11:16) Chris has now loaded the and is it running at 120 volts. Lane organisation:
1 +ve control 10ng p.aeruginosa DNA from the maxwell prep
2 +ve control 10ng p.aeruginosa DNA from the maxwell prep
3 Neat orange culture DNA
4 x10^-1 dilution Orange culture DNA
5 x10^-2 dilution Orange culture DNA
6 x10^-3 dilution Orange culture DNA
7 x10^-4 dilution Orange culture DNA
8 Neat Yellow culture DNA
9 x10^-1 dilution Yellow culture DNA
10 x10^-2 dilution Yellow culture DNA
11 x10^-3 dilution Yellow culture DNA
5ul Marker 100bp thermo scientific
13 -ve Bench H20
14 -ve Hood PCR H20
after realising when loading the gel Chris hadn't left room for a marker with the dilutions, the smallest dilution of the yellow colony was removed as the yellow was a lot less dense to begin with, with the . Luke has prepared the Sau3A1 partial digest to do after lunch. This time we are only running the experiment for 30 minutes as from the last test the only lanes which were partially digested enough were the time 5-15 this time with a no enzyme control

(12:30) News came in during our lunch that the sequencing came back, so Chris and Luke did a BLAST Search to try and find what the genus of the original 01#502 bacteria was we had cultured, which turns out to be a pseudomonas however from the 16s we are unable to work out the Species as there were a lot of 100% hits on the search.

(13:20) Chris stopped the gel and went down to the Transilluminator with Em to get a gel photo, ( image to follow) There seems to have been a problem with the x10^-2 and lower dilutions as there were no bands, however the 0 dilution and x10^-1 dilutions have worked well. After talking to Dr Dalgelish we have decided to re-run the PCR over night with the x10^-1 orange dilution and the 0 yellow dilution with around 5 of each to make sure that we have enough DNA to Sequence, as the amount recovered from this gel may not be enough for the sequencing. This is being done as there are two different colour bacteria growing, to see if these are two different species of bacteria, or the same one with a different morphology of colony. Chris and Em are now going to do the QIAGEN gel extraction of yesterday's PCR to see how much we can recover, if this not enough, at least we will have not wasted time and will have more amplifying up over night tonight. Will is making a gel for Luke's Sau3A1 digest, which has now finished and is ready to be ran.

(15:10) Chris and Em have now cut the gel and have removed and weighed the samples of DNA, Chris is now adding the QG buffer at x6 the amount in ul of the amount of agarose there is. Em is now going to put the samples in the 50 degree incubator and vortex every 2 minutes to dissolve the agarose.

(15:30) Chris and Luke just realised that the Sau3A1 digest was carried out at 37 degrees again rather than at the room temp we were going to try to see if this produced better bands. So we will have to re run this experiment, however we are still going to run the gel to see how it went and confirm the need to reduce the activity of the enzyme. Will is Spec'ing the experiment that nathan set up on the 31st, after 2 day's extra growth ( mmb with 5% poly) OD600 Mixed = 0.053 at a 10x dilution so 0.53 Orange is 0.072 at a x10 dilution so 0.72 which is higher than before! :D so it looks to be that the bacteria is growing in the broth with no other carbon other than the sugar beads at 5% concentration. To confirm this will is re doing the experiment with more controls totaling at 8 tubes, ( Will to put protocol in here)

(16:00) Will is taping the shaker to the bench to prevent it from moving. Phil has left the building to go home early. Tony is loading up a gel using Luke's Sau3A1 digest from earlier. Chris and Emily are extracting DNA from the earlier electrophoresis using a QUIGEN QIAquick Gel extraction Kit. Luke is writing up protocol for some of the experiments we've done so far in the projects.

(16:30) Chris is now doing the Boilate for tonight's PCR of the 16S yellow and orange colonies for tonight's PCR we are only going to do 5 neat yellow cultures and 5 x10^-1 orange cultues as these seemed to be the best yesterday however it looks like we don't have enough DNA to sequence.

(17:15) Emily is finishing off the boilate, doing the centrifuge step, removal of the supernatant and doing the dilutions while Chris is in the PCR hood setting up the master mix.

(17:45) getting close to need to be out of la time, and Chris is just adding the DNA to the samples ready to put them in the PCR machine, Program to be used is the iGEM16S which is as follows:
98 degrees C - 5 min
''98 degrees C - 30 seconds''
''50 degrees C - 30 seconds''
''72 degrees C - 2 minutes''
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction)

(9:00) Chris, Will and Luke in lab, Phil in computer lab. Will started to make a new 2% gel ready for the PCR samples which Chris is preparing, Luke is getting ready for the Sau3A1 digest at room temp

(10:30) Luke has almost finished the Sau3A1 prep and Chris is re-making one of the gels. Will is making another 2% gel ready for the "Gelception" gel and is waiting on someone to help with the Nanodrop of the gel extraction from yesterday.

(12:10) After having a lot of problems with gel making today, Chris is finally loading the PCR gel from last nights PCR reaction this time loading as much of the sample as possible being 22ul. This will be ran for 2.5 hours at 120volts to make sure the bands are well separated for the gel extraction. Sau3A1 prep is finished and the samples have been put into the freezer ready to be run on Monday.

(13:00) Working lunch break for Chris and Luke, looking at the primer designs for BioBrick.

(15:36) Luke is now designing the primers ready to order for Monday morning. The gel is now finished so Chris, Luke and Emily take that down to be transilluminated, as ''Pseudomonas'' species' fluoresce under UV.

(16:00) None of the plates fluoresced under UV, though this may be due to the wavelength different wavelengths will be tried. Will is now wrapping the PCR gel ready for gel extraction on Monday. As the Nanodrop results were low for yesterday's gel extraction from the PCR at 4.8 for 0range 5.1 for mixed and 3.2 for yellow when the two extracts were combined, Chris is going to do a PCR of these samples to increase the amount of DNA. The "Gelception" gel is to be run on Monday as there isn't enough time to run it today.

(16:30) Luke has finished the primer sequences and has sent them to Dr Badge to be checked and ordered. Chris is now setting up the master mix for the PCR in the PCR hood as we are doing 13 PCR reactions, we need to make up 270ul of the master mix which is enough for aliquots of 18ul in 15 reactions. Reaction mixture list:
171ul PCR H20
60ul HF buffer
6ul dNTPs
15ul Primer A 28f AAGAGTTTGATCCTGGCTCAGA
15ul Primer B 519R GWATTACCGCGGCKGCTG
Template DNA to be added later as it is not PCR clean
3ul DNA Polymerase
These reagents were added then as the DNA Pol was in glycerol the tube was mixed and spun for a second to remove bubbles. dNTPs cannot be freeze thawed so whatever was left was thrown. After this, Chris put 18ul aliquots of the master mix into 9 separate PCR eppendorfs and prepared the negative control while in the PCR hood with the PCR clean H2O. The tubes were then taken to the bench where the DNA was added, and the positive ''aeruginosa'' DNA and negative bench H2O controls all samples were added at 2ul to make a final volume of 20ul.
PCR cycle program used was iGEM16S which is as follows:
98 degrees C - 5 min
''98 degrees C - 30 seconds''
''50 degrees C - 30 seconds''
''72 degrees C - 2 minutes''
72 degrees C - 5 minutes
15 degrees C - Forever ( this is for the end of the reaction) This time instead of loading bacteria from a boilate reaction Chris added in a 1/100 dilution of the three different gel extractions at 2ul to each tube to amplify the amount of DNA in these samples. Luke prepared the 1/100 samples by taking 1ul of the DNA and adding in 99ul of TE buffer. Reaction organisation ( CHECK ON CHRIS' SHEET TO SEE IF THIS IS CORRECT)
1 = positive ''aeruginosa'' control
2 = orange 100x dilution
3 = orange 100x dilution
4 = orange 100x dilution
5 = yellow 100x dilution
6 = yellow 100x dilution
7 = yellow 100x dilution
8 = yellow 100x dilution
9 = mixed 100x dilution
10 = mixed 100x dilution
11 = mixed 100x dilution
12 = negative control bench
13 = negative control hood The reason why there are four reactions for the yellow is that it had the lowest ng/ul reading so thought this would be useful. As there was a problem with the dilutions in the boilate from Wednesday, we are running multiple reactions for each of the extractions in case one doesn't work.

Chris is meant to be having the week off, however is working from home today on the primers using in silico PCR and BLAST searching

(9:00) Nathan, Will, Luke and Anthony in lab. Nathan started preparation of yet another 0.7% gel, Will and Luke found DNA markers - "HyperLadder 1"

(10:30) Luke started loading a 2% agarose gel with DNA recovered from a previous gel from last week. The lane order is:
5µl DNA HyperLadder 1
x
4µl 100bp DNA ladder
x
20µl of DNA recovered from PCRed mixed colonies
x
2µl DNA HyperLadder 1
x
20µl of DNA recovered from PCRed Orange colonies
x
20µl of DNA recovered from PCRed Yellow colonies
x
1µl DNA HyperLadder 1
x This gel will be run at 120 volts

(11:00) Luke pours the 0.7% gel ready for running the Sau3A1 digests.

(11:50) Luke, Nathan and Tony go to transilluminate the gel run with recovered DNA from a previous gel, however, the bands have moved little, so we decide to run it for another hour.

(12:15) Tony loads Sau3A1 digests into wells on the set 0.7% gel. The lane organisation is:
x
DNA HyperLadder 1
x
DNA digest without enzyme
DNA digest after 0 minutes
DNA digest after 5 minutes
DNA digest after 10 minutes
DNA digest after 15 minutes
DNA digest after 20 minutes
DNA digest after 25 minutes
DNA digest after 30 minutes
x
DNA HyperLadder 1
x This will be run at 100 volts

(13:00) Luke and [insert name here] transilluminate the recovered DNA gel again, where the bands are a lot more spread

(13:20) Luke and Will check Sau3A1 digest- we decide to leave it in for longer, though the loading dye appears to be running slightly quicker at one end of the gel

(13:30) Luke looks through the primers he helped to design on Friday, that Dr Badge has given a few tweeks, to add degeneracy to make them more likely to PCR out the genes we want to extract. Using BLAST searches of the FASTA data, it is apparent that the sequence in P. putida, regardless of strain, is remarkable conserved, with only one or two bases needing any degeneracy at primer binding sites. These modified primers are sent off to Dr Badge well before the deadline, so will hopefully be made up and sent to us before the end of the week, so Chris can start the PCRing out of genes we’ll hopefully be making into Biobricks.

(14:45) The Sau3A1 digest gel’s loading dye is a couple of inches off the end, so Luke and Will go to transilluminate it. We find that, despite part of the gel appearing to run more quickly, we have a decent digestion curve, showing a downward trend in fragment length as the time of the digest increases.

Luke and Tony attempt to write this notebook entry several times later that day, but each time, the website logs us out, and deletes the entry