Team:LMU-Munich/Bacillus BioBricks

From 2012.igem.org

Revision as of 09:17, 10 September 2012

• Home
• Team
• Project
  • Why Beadzillus?
  • Bacillus Introduction
  • Bacillus BioBrickBox
  • GerminationSTOP
  • Sporobeads
  • Data
  • Applications
• Extras
  • Attributions
  • Collaborations
  • Registry
  • Bacillus Strains
  • Special: Inverter
  • Achievements
• Safety
  • Project Safety
  • Release for application
• Lab Notebook
  • Weekly Journal
  • Protocols
• Human Practice
  • SynBio Day
  • Students Practical Course
  • CAS SynBio Conference
  • Berlin Conference
• Sponsors

Bacillus BioBricks

We will create a toolbox of Bacillus BioBricks to contribute to the registry.

We would like to introduce Bacillus to the world of iGEM!!!

This Bacillus BioBrick Box contains Bacillus specific:

• Vectors
• Promoter
• Reporter

Bacillus Vectors

Here is a list of all the vectors we cloned and used. Please note that pMAD is not in a BioBrick standard, but it is a useful tool to knock out genes inBacillus subtilis.

For the use of our vectors, please see our Protocols page. A general introduction to Bacillus subtilis and its integrative vectors can be found here. All vectors have ampicillin as E. coli resistance and RFP as selection marker.

The number in the vector's name codes for the insertion locus and the following letter for the Bacillus subtilis resistance gene according to the following table:

The concentrations of the antibiotics and the insertion tests can be found in our protocol section.

The promoters we submit:

Pveg, PliaI, PliaG, plepA, Pxyl, Pxyl+XylR

We also tested the Anderson promoter collection in Bacillus subtilis with pSB_Bs3C-luxABCDE. The data will be online in our data section soon.

Furthermore we plan to submit reporter genes optimized for Bacillus subtilis , namely GFP, lacZ, luc and mKate.

Useful for the registry are also 5 tages in Freiburg Standard (cMyc, 10His, Flag, Strep, HA).

More details to come soon.

Bacillus Promoters

Another goal is to produce promoters of Bacillus subtilis in BioBrick mode and to evaluate them. These well-defined promoters will then be part of the Bacillus BioBrickBox which we will send to the registry but they can also be useful in our project Beadzillus to express our fusion crust proteins on the outside of our spores. Therefore we will use different promoters which are the constitutive promoters from the Anderson collection from the partsregistry, the constitutive promoters P_liaG, P_veg and P_lepA from B. subtilis as well as the inducible promoter P_liaI from B. subtilis. For the characterization of the different promoters we will clone them upstream of reporter genes (lux operon, lacZ) to measure their activity in B. subtilis. Therefore we use e.g. the two reporter vectors from B. subtilis which are also part of the Bacillus BioBrickBox. One of the reporter vectors pSB_Bs3C-luxABCDE contains the lux operon as a reporter. This is why the activity of the promoter can be measured as luminescence with the plate reader (BioTek) which is a result of the expression of the luciferase. The second reporter vector used for the evaluation of the promoters is pSB_Bs1C-lacZ which contains the reporter gene lacZ. The promoter activity leads to the production of the enzyme beta-galactosidase which cleaves the substrate ONPG. The product is detectable with the photometer and refers to the promoter activity.

Promoter Evaluation

To get a set of promoters with different strength we chose several promoters. They can be divided in three different groups: the constitutive promoters from the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] from the partsregistry, the constitutive promoters PliaG, Pveg and PlepA from B. subtilis as well as the inducible promoter PliaI from B. subtilis. For the characterization of the different promoters they were all cloned upstream of reporter genes (lux operon, lacZ) to measure their activity in B. subtilis by regarding the gene expression of the reporter gene.

Anderson promoters

The first group of promoters evaluated are the promoters of the Anderson collection which we call Anderson promoters. They have already been measured in Escherichia coli and they all showed a constitutive behaviour but with a different strength. In this project, these Anderson promoters were measured in B. subtilis. As they have already been evaluated in E. coli, they were already in the partsregistry in the vector where they are fused to the Red fluorescent protein (RFP). For evaluation they were cut out of the vector and then first cloned in BioBrick standard in the empty vector pSB1C3 to send them to the registry. In addition, eleven (J23100,J23101, J23102, J23103, J23106, J23107, J23113, J23114, J23115, J23117, J23118) of the nineteen promoters of the Anderson collection were successfully cloned in the reporter vector pSB_Bs3C-luxABCDE from the BioBrickBox containing the lux operon as a reporter for promoter activity. The gene expression which correlates to the promoter activity leads to the expression of the lux operon with the luciferase. The luminescence which is produced by the luciferase can be measured with the plate reader (BioTek). To measure the activity not only with the lux reporter operon, four promoters were cloned into the reporter vector pSB_Bs1C-lacZ to do beta-galactosidase assays and then to compare the results of the strength of these promoters in B. subtilis.

Constitutive promoters from B. subtilis

The second group of promoters are constitutive promoters from B. subtilis. We will evaluate the promoters P_liaG, P_veg and P_lepA. Therefore we will use the reporter vectors pSB_Bs3C-luxABCDE and pSB_Bs1C-lacZ to evaluate the promoters with different reporters, the lux operon and the lacZ gene. Therefore the promoters will be amplified from the genom of B. subtilis with primers that conatin the restriction sites of the BioBrick standard. Then these constitutive promoters will be cloned into the empty vector pSB1C3 to send them to the registry as well as the two reporter vectors to evaluate their strength in B. subtilis.

Inducible promoters from B. subtilis

The last group of promoters consists of inducible promoters of B. subtilis e.g. P_liaI. They are useful to decide when to turn on gene expression because these promoters need an inducer to start transcription. P_liaI can be induced by antibiotics which interact with the lipidII cycle, e.g. bacitracin. In this project this promoter is evaluated like the constitutive promoters with the reporter vector pSB_Bs3C-luxABCDE which contains the lux operon as a reporter and with the vector pSB_Bs1C-lacZ which conatins the lacZ reporter gene. Therefore the promoters will be amplified from the genom of B. subtilis with primers that conatain the restriction sites of the BioBrick standard. Then these inducible promoters will be cloned into the empty vector pSB1C3 to send them to the registry as well as the two reporter vectors to evaluate their strength in B. subtilis. To turn the promoter on we have to add an inducer.

Bacillus Reporters

We designed some reporters that are commonly used in B. subtilis or are codon optimized versions of popular reporter genes. Alle reporters have a modified iGEM Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RCF 25]) pre- and suffix for assembly of in-frame fusion proteins. Our prefix also includes the B. subitlis optimized RBS.

prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

• GFP

We took a gfp derivate of the Bacillus subtilis plasmids pGFPamy and added the BioBrick compatiple pre- and suffix of the Freiburg standard (Assembly 25).

• mKate

We synthesized this rfp derivate with a codon-optimized version for the use in B. subtilis with pre- and suffix of the Freiburg standard

• LacZ

lacZ under the control of Pspac in pSBC3. Plate induced with Xylose (ng/µl)

This lacZ gene is derived from the Bacillus reporter vector pAC6. It is constructed in the Freiburg Standard (Assembly 25) for in-frame fusion proteins. It also includes a Shine-Dalgarno Sequence optimized for Bacillus subtilis translation.

BioBrick Name: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823019 BBa_K823019]

• luc

We synthesized this luciferase for luminescence assays with luciferin as substrate.

Project Navigation

+--+--+--+--+--+--+--	+--+--+--+--+--	+--+--+--+--+--+--	+--+--+--+--+--+--
Bacillus Intro	Bacillus BioBrickBOX	SporeCoat FusionProteins	Germination STOP