Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase

{{:Team:Edinburgh/header}}
{{Team:Edinburgh/css/navigation-structure.css}}
{{Team:Edinburgh/css/navigation-style.css}}

<html>
<style type="text/css">
/* wiki edit */
#content{
	background-image:none;
}
/* header edit */
#project-page a{
	display:block;
	background-color: #f2f2f2;
	border-top-right-radius: 10px;
	border-top-left-radius: 10px;
}
#project-page a,
#project-page a:visited{
	color: #000;
}
#project-page a:hover{
	color: #002BB8;
}
/* actual page */
#page-content{
	background-color:#fff;
	border:1px solid #ccc;
}
#CscA-primers,
#CscA-method,
#figure1,
#figure2,
#figure3{
	height:0px;
	position: relative;
	top:-9000px;
}
#fig12{
	height:0px;
	margin:5px;
}
</style>

<script language="JavaScript">
	function expand(x){
		document.getElementById(x).style.height="auto";
		document.getElementById(x).style.top="0px";
		document.getElementById('fig12').style.height="auto";
		if(x == 'figure1'){
			document.getElementById('fig1').style.height="auto";
		}
		if(x == 'figure2'){
			document.getElementById('fig2').style.height="auto";
		}
		if(x == 'figure3'){
			document.getElementById('fig3').style.height="auto";
		}
	}
	function collapse(x){
		document.getElementById(x).style.height="0px";
		document.getElementById(x).style.top="-9000px";
		document.getElementById('fig12').style.height="0px";
		if(x == 'figure1'){
			document.getElementById('fig1').style.height="0px";
		}
		if(x == 'figure2'){
			document.getElementById('fig2').style.height="0px";
		}
		if(x == 'figure3'){
			document.getElementById('fig3').style.height="0px";
		}
	}
</script>
</html>

{{:Team:Edinburgh/Project/navigation}}

<html>
	<div id="page-content">
		<div class="text">
			<p class="h1">
Alternative selectable and counter-selectable markers:
<br /><br />
Sucrose Hydrolase <i> (cscA)</i>
			</p>
			<p class="h2">
Background
			</p>
			<p class="normal-text">
Sucrose hydrolase is an enzyme from <i>Escherichia coli</i> O157:H7 strain Sakai which is involved in sucrose utilisation <a href="#bibliography" onclick="expand('works-cited');">(Jahreis, et al., 2002)</a>.  Transforming <i>Escherichia coli</i> K12 strains with sucrose hydrolase allows the cells to grow with sucrose as a sole carbon source, something the untransformed K12 strain cannot do. This allows this gene to be used as a selectable marker.
			</p>
			<p class="h2">
Cloning
			</p>
			<p class="h3">
<i>cscA</i> cloning 
			</p>
			<p class="normal-text">
The <i>cscA</i> gene was cloned PCR with <i>cscA</i> specific primers. <a onclick="expand('figure1');">Figure 1.</a>
			</p>
			<p class="normal-text" id="figure1">
<br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/0/06/G1.png"><br />
<b>Figure 1:</b> DNA gel of PCR amplification with primers specific for <i> cscA </i>. The product is around 1.4-1.5 kb which corresponds to the size of <i> cscA </i> gene, around 1.5 kb.<br /><br />
<a onclick="collapse('figure1');">Close figure 1.</a>
			</p>
			<p class="normal-text">
<br />This fragment was inserted into the standard BioBrick vector pSB1C3. <a onclick="expand('figure2');">Figure 2.</a>
			</p>
			<p class="normal-text" id="figure2">
<br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/8/85/G2.png"><br />
<b>Figure 2:</b> DNA gel of pSBIC3-<i>cscA</i> ligation digested with EcoRI in order to linearise the plasmid. The band is around 3.5 kb which corresponds to the vector pSBIC3 (around 2 kb) together with the <i>cscA</i> gene (arounf 1.5 kb)<br /><br />
<a onclick="collapse('figure2');">Close figure 2.</a>
			</p>
			<p class="normal-text">
<br />A promoter and a reporter gene were added in front of the <i>cscA</i> gene (Plac-lacZ'). <a onclick="expand('figure3');">Figure 3.</a>
			</p>
			<p class="normal-text" id="figure3">
<br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/e/e2/G9.png"><br />
<b>Figure 3:</b> DNA gel of pSB1C3-Plac-lacZ'-cscA digested with XbaI and PstI. The clear band just above 2kb corresponds both to the size of the vector and the Plac-lacZ'-cscA fragment. The band around 4 kb is likely to correspond to the undigested plasmid. <br /><br />
<a onclick="collapse('figure3');">Close figure 3.</a>
			</p>

			<p class="h3">
cscA selection plasmid
			</p>
			<p class="normal-text">
In order to create a <i>cscA</i> selection plasmid, we wanted to replace the chloramphenicol resistance in pSB1C3 with <i>cscA</i>. The <i>cscA</i> and pSB1C3 gene were cloned using these <a class="cursor-pointer" onclick="expand('CscA-primers');">primers</a>. <a class="cursor-pointer" onclick="expand('CscA-method')">Method</a>. However, this resulted in no successful pSB1C3-cscA ligation transformants.
			</p>
			<p class="normal-text" id="CscA-primers">
<br /><i>Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat<br />
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT<br /></i>
<img id="fig12" src="https://static.igem.org/mediawiki/2012/7/75/Markers-fig12.JPG"><br />
<i><b>Figure 4:</b> DNA gel of PCR products of pSB1C3 without chloramphenicol and <i>cscA</i>. One product is around 1.4 kb which corresponds to the size of <i>cscA</i> gene, the other is around 2.2 kb which corresponds to the pSB1C3 vector without cml resistance.</i><br />
<a class="cursor-pointer" onclick="collapse('CscA-primers');">Close the primers.</a><br />
			</p>
			<p class="normal-text" id="CscA-method">
<br /><i>Method: The purified <i>cscA</i> and psB1C3 PCR products were digested with NdeI and ClaI. Both products were ligated and E.coli cells transformed with the ligation.</i><br />
<a class="cursor-pointer" onclick="collapse('CscA-method');">Close the method.</a><br />
			</p>
			<p class="h2">
Characterisation
			</p>
			<p class="h3">
Plates
			</p>
			<p class="normal-text">
Plate characterisation showed that <i>cscA</i> is a suitable selectable marker- only cells which had the gene grew on sucrose as a sole carbon sourse (Figure 5). The drawback of this antibiotic-free selectable marker is that more time is required for the growth of the <i>cscA</i> cells on sucrose plates (we incubated them overnight at 37°C+4 days at room temperature, but they might have grown faster had we left them in the incubator).
<br /><br />
<img id="fig13" src="https://static.igem.org/mediawiki/2012/2/26/Markers-fig13.JPG"><br />
<b>Figure 5:</b> Cells transformed with <i>cscA</i> (<a href="http://partsregistry.org/Part:BBa_K917000">BBa_K917000</a>) (bottom row) as well as control cells (top row) were spread on LB plate, minimal plate with sucrose, minimal plate with glucose and minimal plate with no sugars, straight after transformation (without preselection on chloramphenicol).  Neither the <i>cscA</i> nor the control cells grow on minimal media with no sugars and grew well on LB and minimal plate with glucose. However, <i>cscA</i> cells are growing on minimal media with sucrose while the control cells are not.
			</p>
			<p class="h3">
Liquid Cultures
			</p>
			<p class="normal-text">
In order to better quantify our results, we have decided to grow our transformants in liquid media and measure OD after overnight incubation. We set up bottles with the same media as we have used for the plates (LB, M9 minimal medium with no sugars, M9 with 1% glucose and M9 with 1% sucrose), inoculated them with <i>cscA</i> or control transformants grown overnight and incubated them overnight before measuring OD. The results can be seen in Figure 6 below.
<br /><br />
<img src="https://static.igem.org/mediawiki/2012/2/2e/EdiGEM-Fig5.png">
<br />
<b>Figure 6:</b> Comparison of growth between cells containing the sucrose hydrolase (<i>cscA</i>) selectable marker and control. LB and M9 glucose were used as positive controls, M9 with no sugars was used as a negative control.
			</p>
			<p class="h2">
<a name="xylitol">Citrobacter xylitol selection marker strategy</a>
			</p>
			<p class="normal-text">
In addition to <i> E. coli</i>, we were also working with the organism <i>Citrobacter freundii</i> over summer. <br /><br />
Unfortunately, we could not test our sucrose hydrolase selection system in this organism, as it can already degrade sucrose naturally. We have therefore devised the concept for an alternative sugar selection system that could be used in <i>Citrobacter freundii</i>. This sugar selection system is based on the sugar alcohol xylitol – our <a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use#liquid-media"><i>Citrobacter freundii</i> sugar use experiments</a> show that it cannot grow on this sugar as a sole carbon source, so it seems to be an ideal candidate for selectable marker design.
<br /><br />
As some organisms <i>can</i> use and degrade xylitol, we have found an enzyme, called <vb>xylitol dehydrogenase </b>, which oxidizes xylitol to xylulose. This gene can be found in (for example) the gram negative rod <i> Gluconobacter oxydans </i> which is also friendly to humans, as it is not known to be pathogenic and in addition it is also used in various fields of biotechnology for example in the construction of bionsensors or for vinegar, vitamin C or sorbitol production.
<br /><br />
The cloning strategy could be the same as was used to make the sucrose hydrolase BioBrick and assessing its effectivity could also be done following the same protocols, but of course, replacing sucrose with xylitol where needed. 
<br /><br />
This non-antibiotic selectable marker could be coupled up with our levansucrase (<i>sacB</i> counterselectable marker to form a selection-counterselection cassette that depends entirely on the presence of sugars, rather than antibiotics.
			</p>
			<p class="h2">
Conclusions:
			</p>
			<p class="normal-text">
<ul style="padding-left:10px; list-style-type:circle;">
<li>We successfully cloned the sucrose hydrolase gene and inserted it into the BioBrick vector. (<a href="http://partsregistry.org/Part:BBa_K917000">BBa_K917000</a>)<br /><br /></li>
<li>We extensively characterised the sucrose hydrolase gene on plates and in liquid cultures.<br /><br /></li>
<li>We determined its suitability as a selectable marker.</li><br/<br/>
<li>We have developed a conceptual sugar-based selection system for <i>Citrobacter freundii </i></li>
</ul>
			</p>
			<p class="normal-text" style="text-align:center">
<br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Nitroreductase"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">__</span>3/6</span><span style="color:white;">__</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/DhlA"><span class="intense-emphasis">Next&gt;&gt;</span></a>
<br /><br />
			</p>
</html>
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}

<html>
<style type="text/css">
/* navigation edit*/
#page-navigation ul li#nav-markers p,
#page-navigation ul li#nav-markers ul li#nav-markers-sucrose-hydrolase a{
	color:#ccc;
	cursor:default;
}
#page-navigation ul li#nav-markers ul{
	height:auto;
}
#page-navigation ul li#nav-markers ul li{
	top:0px;left:0px;
}
</style>
</html>