Team:Westminster/Experiments

From 2012.igem.org

(Difference between revisions)
Line 197: Line 197:
<p> R: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTCTGATTCGGCTCCTGGAA </p>
<p> R: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTCTGATTCGGCTCCTGGAA </p>
<img src="http://2012.igem.org/wiki/images/7/75/Aldh1a1_promoter.png" alt="ALDH1A1 directions" title="1A1" width="545" height="141" />
<img src="http://2012.igem.org/wiki/images/7/75/Aldh1a1_promoter.png" alt="ALDH1A1 directions" title="1A1" width="545" height="141" />
 +
<p> The promoter sequences identified are represented below:</p>
 +
 +
<p> ALDH1A1 (552BP)</p>
 +
<img src="http://2012.igem.org/wiki/images/e/e4/Box_2.png" alt="ALDH1A1 directions" title="1A1" width="452" height="132" />
 +
 +
<p> ALDH2 (903BP)</p>
 +
<img src="http://2012.igem.org/wiki/images/6/60/Box3.png" alt="ALDH1A1 directions" title="1A1" width="452" height="162" />
 +
 +
<p> ALDH1A3 (932BP)</p>
 +
<img src="http://2012.igem.org/wiki/images/f/f3/Box4.png" alt="ALDH1A1 directions" title="1A1" width="452" height="194" />
 +
 +
<p> ALDH3A1 (600BP)</p>
 +
<img src="http://2012.igem.org/wiki/images/3/31/Box5.png" alt="ALDH1A1 directions" title="1A1" width="452" height="137" />
 +
 +

Revision as of 21:09, 26 September 2012

Welcome

BIOINFORMATICS

Promoter Seqeunce Identification

The team isolated regions of approximately 1kbp where the gene promoter was likely to be found. These were compared with commercial promoters (if available) and European Promoter database (EPD). The promoter sequences that appeared on the EPD site have been experimentally analysed, and also did not contain any illegal sites. Thus they were selected, in case of ADH1A1 and ALDH3A1. ALDH1A3 identified by the team had no illegal site, so it was maintained. However, ALDH2 promoter sequence on the EPD site was too small to be included. Therefore a commercial promoter of ALDH2 was selected.

The following gives an example of how a promoter sequences were identified by the iSTEM team:

ALDH1A1

ALDH1A1 directions

Directionality:5-3

ALDH1A1 directions

TAATAA= TATA box

GCTGCATACetc = the 5’UTR region.

The promoter includes elements of the 5’UTR plus the grey sequence upstream of it, up to and including the yellow region coding for the forward primer (about 1,000bp in total).

ATGTCATCCetc = start of gene at -75567940 approx

F: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCATCATATGACTTTTTTCAAC

R: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTCTGATTCGGCTCCTGGAA

ALDH1A1 directions

The promoter sequences identified are represented below:

ALDH1A1 (552BP)

ALDH1A1 directions

ALDH2 (903BP)

ALDH1A1 directions

ALDH1A3 (932BP)

ALDH1A1 directions

ALDH3A1 (600BP)

ALDH1A1 directions