Team:WHU-China/Project/cellulose synthesis

From 2012.igem.org

(Difference between revisions)
 
(5 intermediate revisions not shown)
Line 35: Line 35:
<P>
<P>
-
  <img src="http://2012.igem.org/wiki/images/3/38/Cellulose_1.png" width="500" height="500" hspace="2" vspace="1" border="2" align="top" />
+
  <img src="http://2012.igem.org/wiki/images/3/38/Cellulose_1.png" width="500" height="400" hspace="100" vspace="1" border="2" align="top" />
</P>//
</P>//
Line 50: Line 50:
<P>
<P>
-
  <img src="http://2012.igem.org/File:Cellulose_2.png" width="500" height="500" hspace="2" vspace="1" border="2" align="top" />
+
  <img src="http://2012.igem.org/wiki/images/9/9b/Cellulose_2.png" width="500" height="500" hspace="100" vspace="1" border="2" align="top" />
</P>
</P>
Line 100: Line 100:
</p>
</p>
<P>
<P>
-
  <img src="http://2012.igem.org/wiki/images/a/a1/PII_sequence.png" width="500" height="100" hspace="2" vspace="1" border="2" align="top" />
+
  <img src="http://2012.igem.org/wiki/images/a/a1/PII_sequence.png" width="500" height="100" hspace="100" vspace="1" border="2" align="top" />
</P>
</P>
Line 180: Line 180:
</p>
</p>
<P>
<P>
-
  <img src="http://2012.igem.org/File:BcsA_B_Z_C_U_F.tif" width="350" height="100" hspace="2" vspace="1" border="2" align="top" />
+
  <img src="http://2012.igem.org/wiki/images/3/30/BcsA_B_Z_C_U_F.tif" width="500" height="500" hspace="100" vspace="1" border="2" align="top" />
</P>
</P>
<h3>
<h3>
Line 192: Line 192:
The size of the Promoter PII and 18A were less than 100 bp ,the agarose gel electrophoresis indicate that the size was correct.Restriction Digestion of the plasmid BBa_I13507 only have one lad one the agarose gel,it told us that the plasmid was digested well. After transformation, competent cells were cultured on agar plate with 50 μg/L of ampicillin. Both red and white bacterial clonies appeared one the plate.The red ones were the correct clones with promoter embedded successfully, while the white ones were negative clones. The red clones were picked and cultured in LB medium for plasmid extraction. Purified plasmids were digested with XbaI and PstI for confirmation. The bands of 2000bp and 1000bp showed that the promoter had been embedded successfully. At last, the plasmids we acquired were sent for sequencing, results show no mutation exists.  
The size of the Promoter PII and 18A were less than 100 bp ,the agarose gel electrophoresis indicate that the size was correct.Restriction Digestion of the plasmid BBa_I13507 only have one lad one the agarose gel,it told us that the plasmid was digested well. After transformation, competent cells were cultured on agar plate with 50 μg/L of ampicillin. Both red and white bacterial clonies appeared one the plate.The red ones were the correct clones with promoter embedded successfully, while the white ones were negative clones. The red clones were picked and cultured in LB medium for plasmid extraction. Purified plasmids were digested with XbaI and PstI for confirmation. The bands of 2000bp and 1000bp showed that the promoter had been embedded successfully. At last, the plasmids we acquired were sent for sequencing, results show no mutation exists.  
</p>
</p>
 +
<P>
<P>
-
  <img src="http://2012.igem.org/File:18A_PII_22O.tif" width="200" height="400" hspace="2" vspace="1" border="2" align="top" />
+
  <img src="http://2012.igem.org/wiki/images/d/d5/18A_PII_22O.tif" width="200" height="500" hspace="100" vspace="1" border="200" align="FLOAT: LEFT" />
 +
<img src="http://2012.igem.org/wiki/images/f/f3/18A_PII-22O.png" width="200" height="500" hspace="20" vspace="10" border="20" align="FLOAT: RIGHT" />
</P>
</P>
 +
 +
<h4>
 +
B) Promoter 6K
 +
</h4>
 +
<p>
 +
The construction of the plasmid with promoter 6K was finished in the same method with that of PII. The results of identification with restriction enzymes indicated that the plasmids was successfully constructed.
 +
</p>
 +
<h3>
 +
Cell culture and fluorescence measurement to that the promoters are glucose activated
 +
Result for Promoter PII
 +
</h3>
 +
<p>
 +
The correct clones were cultured in 96-well plate at 37℃ for 24 hours,then the fluorescence and absorbance at 600 nm were recorded on a SpectraMax M2 plate reader.All fluorescence was normalized with absorbance at 600 nm.The fluorescence of 18A-22O was about 10000 Relative Light Units,it did not vary with concentrations of glucose.However we found a positive correlation between the fluorescence of PII-22O and concentration of glucose.At a glucose concentration low than 4mM,the fluorescence was very low, but at high concentration of glucose like 100mM,the fluorescence much less than that of 18A-22O. Fluorescent images indicated that all the cells were growing normally,because the size and morphology were both the same with cells in LB medium.the fluorescence of the cells in the images show the same discipline with results from the fluorescence measurement experiments.Fluorescence of 18A-22O was very strong but it didn't change with the glucose concentration.On the contrary,fluorescence of PII was relatively weak but increased with concentration of glucose.
 +
</p>
</html>
</html>

Latest revision as of 11:58, 14 September 2012

Outline

Cellulose is an essential material for keeping intestine peristalsis without producing energy, as prebiotics, feeding vegetarian bacteria flora (including Bacteroides, whose appropriate amount has proved important to prevent obesity[1]) of intestine as well. Thus, cellulose help people keep slim and healthy.

The developing device aims at transforming glucose into cellulose, thus producing cellulose as well as reducing energy ingestion. To achieve this goal, we cloned genes of enzymes responding for cellulose synthesis from the Escherichia coli str. DH5ɑ, constructing functional expressional elements with these genes respectively downstream of promoter activated by glucose. In this way, cellulose synthetase complex is built artificially under regulation of glucose, repressed under low concentration of glucose and activated under high concentration of glucose.

In the future, this device can be integrated to the whole planning artificial bacterium “E. coslim”, activated when excess glucose is sensed in intestine, converting it to cellulose.

As well as device I (fatty acid metabolism), we divide our work into two parallel sections. The “functional” section includes a series of molecular biological manipulation on four genes of the cellulose synthetase complex and other two genes responding for producing substrates for cellulose synthesis. On the other hand, the design, construction and function test of the glucose-activated promoter belong to the “regulatory” section.

Description

Indirect Regulation Pathway Design

In a cell, the sum of ATP, ADP and AMP molecules keeps at equilibrium. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds to and converts the cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produce, resulting in low DNA-binding activity of CRP.

We embedded gene cI of lambda phage downstream promoter PcstA (BBa_K118011) activated by the binding of CRP, and genes of cellulose synthesis respectively downstream the promoter BBa_R0051 repressed by protein cI. In this way we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as design, cellulose production will be increase following the increase of glucose concentration, and vice versa.

//

Direct Regulation Pathway Design

Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design, hence we modified a constitutive promoter (BBa_J23119) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on Standard), but we shall focus on the design itself now.

We designed two promoters PI and PII based on promoter BBa_J23119, inserting CRP-binding site overlapping on six base pairs with promoter -10 region. Because steric hindrance of CRP dimer will block the function of -10 region, gene downstream the promoter will be repressed when glucose concentration is low. That is, most CRP presenting in DNA-binding configuration. The repression is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and higher efficiency. As experimental results show, promoter PII works as we expect.

Progress

Cloning of the gene

As for the genes we clone, there is no difference between E. coli str. K12 MG1655 and more available DH5&alpha, we purified and amplified these genes from genome of Escherichia coli str. DH5&alpha using PCR. The primers contain the standard restriction enzyme cutting sites. The sequences of the primers used are as below.

  • bcsA Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG
    Sense CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG
  • bcsB Antisense CCTGCAGTACTAGTATTACTCGTTATCCGGGTTAAGAC
    Sense CGAATTCTTCTAGAGATGAAAAGAAAACTATTCTGGATTTG
  • bcsZ Antisense CCTGCAGTACTAGTATTAGTGTGAATTTGCGCATTCCTGG
    Sense CGAATTCTTCTAGAGATGAATGTGTTGCGTAGTGGAATCG
  • bcsC Antisense CCTGCAGTACTAGTATTACCAGTCGGCGTAAGGTATCA
    Sense CGAATTCTTCTAGAGATGCGCAAATTCACACTAAACATATTC
  • galF Antisense CCTGCAGTACTAGTATTATTCGCTTAACAGCTTCTCG
    Sense CGAATTCTTCTAGAGATGACGAATTTAAAAGCAGTTATACC
  • galU Antisense CCTGCAGTACTAGTATTACTTCTTAATGCCCATCTCTTCT
    Sense CGAATTCTTCTAGAGATGGCTGCCATTAATACGAAAG
Then the genes were digested with restriction enzymes and assembled with RBS (BBa_B0030) and terminator (BBa_B0024).

Design of the promoter PII which is activated by glucose

Promoter PII changes base pairs upstream and downstream of -10 region of natural promoter BBa_J23119 to construct a CRP binding site overlapping a modified -10 region (TTAAAT). The sequence was synthesized with restriction enzyme cutting sites of EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. With its cohesive terminus at both ends, it is very convenient to construct the plasmid for functional detection. The sequence of PII is as followed (CRP binding site is shown on red, and -10 conservative region is underlined):

Construction of the plasmid for direct regulation pathway

In this experiment, RFP reported the function of PII. PII was embedded into biobrick BBa_I13507 between EcoRI and XbaI. Hence, the expression of RFP in the biobrick was controlled by PII. Promoter BBa_J23119 was embedded in the same way as positive control. The constructed plasmids were transformed into competent cells of Escherichia coli str. DH5&alpha for detection.

All the enzymes and buffers above were purchased from FermentasTM. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.

Construction of plasmid for indirect regulation pathway

In this experiment, In this experiment, RFP reported the function of the indirect regulation pathway.

  • BBa_I13507, an mRFP generator with RBS and terminator was embedded downstream the cI regulated promoter BBa_R0051.

  • BBa_P0451, a cI generator with RBS and terminator was embedded downstream the promoter BBa_K118011 activated by CRP.

  • BBa_R0051 + BBa_I13507 and BBa_K118011 + BBa_P0451 were assembled together.

  • BBa_K137115, constitutively expressing cI generator with promoter, RBS and terminator was assembled with BBa_R0051 + BBa_I13507.

  • All new composite parts mentioned above were transformed to competent cells of Escherichia coli str. DH5. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.

    Cell culture and fluorescence measurements

    Preparations: Each well of a 96-well plate was filled with 200 μL minimal medium M9 with glucose in concentration of 1mM/L, 4mM/L, 10mM/L, 20mM/L, 50mM/L, 100mM/L respectively.

    Culture: 2 μL seed liquor activated overnight in minimal medium M9 with 50mM glucose at 37℃was inoculated to each well, except for blank controls. Three parallel samples were set for each level. The plate was incubated at 37℃, 150rpm for 24 hours.

    Measurements: Cell culture fluorescence was recorded on a SpectraMaxTM M2 plate reader (Molecular Devices), at 584 nm Excitation and 607 nm emission. Data of fluorescence was normalized by cell density (absorbance at 600 nm measured by a spectrophotometer).

    Cell morphology was observed through fluorescence microscope, and the image of bacterium in each glucose concentration were captured. To know more about these images, please click on Here.

    Construction of the plasmid expressing cellulose synthetase controlled by promoter we designed

    Detection of cellulose synthesis

    Results

    Cloning of the gene

    The gene bcsA was 2619bp, bcsB was 2340bp, bcsZ was 1107 bp, bcsC was 3474bp, galU was 909bp and galF was 894 bp. After amplifying by PCR, the DNA fragmentation was examined by agarose gel electrophoresis, the lads show that the sizes of all the genes were correct. Then the genes were digested with restriction enzymes and embedded into plasmid backbone pSB1A2.To confirm the accuracy of sequence, positive clones were sent for sequencing after transformation. And the results showed that no mutation existed in the genes.

    Construction of the plasmid for functional detection

    A)promoter PII

    The size of the Promoter PII and 18A were less than 100 bp ,the agarose gel electrophoresis indicate that the size was correct.Restriction Digestion of the plasmid BBa_I13507 only have one lad one the agarose gel,it told us that the plasmid was digested well. After transformation, competent cells were cultured on agar plate with 50 μg/L of ampicillin. Both red and white bacterial clonies appeared one the plate.The red ones were the correct clones with promoter embedded successfully, while the white ones were negative clones. The red clones were picked and cultured in LB medium for plasmid extraction. Purified plasmids were digested with XbaI and PstI for confirmation. The bands of 2000bp and 1000bp showed that the promoter had been embedded successfully. At last, the plasmids we acquired were sent for sequencing, results show no mutation exists.

    B) Promoter 6K

    The construction of the plasmid with promoter 6K was finished in the same method with that of PII. The results of identification with restriction enzymes indicated that the plasmids was successfully constructed.

    Cell culture and fluorescence measurement to that the promoters are glucose activated Result for Promoter PII

    The correct clones were cultured in 96-well plate at 37℃ for 24 hours,then the fluorescence and absorbance at 600 nm were recorded on a SpectraMax M2 plate reader.All fluorescence was normalized with absorbance at 600 nm.The fluorescence of 18A-22O was about 10000 Relative Light Units,it did not vary with concentrations of glucose.However we found a positive correlation between the fluorescence of PII-22O and concentration of glucose.At a glucose concentration low than 4mM,the fluorescence was very low, but at high concentration of glucose like 100mM,the fluorescence much less than that of 18A-22O. Fluorescent images indicated that all the cells were growing normally,because the size and morphology were both the same with cells in LB medium.the fluorescence of the cells in the images show the same discipline with results from the fluorescence measurement experiments.Fluorescence of 18A-22O was very strong but it didn't change with the glucose concentration.On the contrary,fluorescence of PII was relatively weak but increased with concentration of glucose.