Team:WHU-China/Project

From 2012.igem.org

(Difference between revisions)
Line 582: Line 582:
</p>
</p>
-
<a name="Indirect Pathway Design">
+
  <a name="Indirect Pathway Design">
<h3>
<h3>
Indirect Pathway Design
Indirect Pathway Design
</h3>
</h3>
</a>
</a>
-
<p align="justify">
+
<p>In a cell, the total amount of ATP, ADP and AMP molecules remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.</p>
-
In a cell, total amount of ATP, ADP and AMP remains constant. Low glucose
+
<p>We embed gene cI of lambda phage(BBa_P0451) downstream promoter PcstA (BBa_K118011) activated by the binding of CRP, and genes of red fluorescence protein(RFP, BBa_I13507)  respectively downstream the promoter BBa_R0051 repressed by protein cI. In this way we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as design, output of RFP will be increased following the elevation of glucose concentration, and vice versa.</p>
-
concentration results in high activity of adenylate cyclase converting
+
<p>   <img src="https://static.igem.org/mediawiki/2012/3/38/Cellulose_1.png" width="500"
-
ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated
+
height="421" hspace="2" vspace="1" border="2" align="center" /> </p>
-
as CRP) to DNA-binding configuration. Conversely, when glucose concentration
+
<p><strong>Method</strong></p>
-
gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding
+
<p><strong>Construction of plasmid for indirect  regulation pathway</strong></p>
-
activity of CRP.
+
<p>In this experiment, RFP reported the  function of the indirect regulation pathway.</p>
-
</p>
+
<p>K861173: BBa_I13507, an mRFP generator with RBS and terminator, was  embedded after CRP activated promoter K118011.</p>
-
<p align="justify">
+
<p>K861172: BBa_P0451, a cI generator with RBS and terminator,  was embedded after promoter BBa_K118011 activated by CRP.</p>
-
We embed gene
+
    <p>K861169:   K861172 and I763007, a cI repressed RFP generator, were assembled .</p>
-
<i>
+
    <p>K861174: BBa_K137115, constitutively  expressing cI generator with promoter, RBS and terminator, was assembled  to  I763007.</p>
-
cI
+
    <p>All new composite parts mentioned above  were transformed  to competent cells  of Escherichia coli str. DH5a. All positive clones are validated using PCR, restriction enzyme  digestion and DNA sequencing.</p>
-
</i>
+
    <p><strong>Cell culture fluorescence measurement</strong></p>
-
of lambda phage downstream promoter PcstA (
+
    <p>Minimal medium with different concentration  of glucose(1mM, 4mM, 10 mM , 20 mM , 50 mM ,100 mM) were transferred into a  96-well plate, 200 μL for each well. Then each well was inoculated with 2 μL of  seed liquor which was activated overnight in M9 minimal medium with 50mM  glucose at 37℃. The wells  without inoculation were regarded as blank controls to revise the results.  Under  each condition, three parallel samples were setted. The plate was incubated  at  37℃, 150rpm. Cell  culture fluorescence was recorded on a SpectraMax M2 plate reader (Molecular  Devices). Excitation at 584 nm and emission at 607 nm were used. All  fluorescence was normalized with cell density by measuring the absorbance at 600  nm.</p>
-
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">
+
    <p><strong>Capturing  fluorescent  image </strong></p>
-
BBa_K118011
+
    <p>Cell morphology was observed  through fluorescence microscope, and the image of bacteria  with of each  glucose concentration were captured. To know more about these images, please  click on Here.</p>
-
</a>
+
    <p><strong>Fluorescent analysis of cyto-imaging</strong></p>
-
) activated by the binding of CRP, and genes of cellulose synthesis respectively
+
    <p>A program named FANCY was  designed to recognize single cell  and calculate the fluorescence strength  according to  the images.  For more  information, please click  Here.</p>
-
downstream the promoter
+
    <p><strong>Results</strong></p>
-
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_R0051">
+
    <p>Purified  plasmids  constructed before were digested  with XbaI and PstI for confirmation. The agarose gel electrophoresis showed  that the  lengths  were  correct. At last, the plasmids  were sent for sequencing. Results  showed  no mutation.</p>
-
BBa_R0051
+
    <p>In the cell culture fluorescence  measurement experiment, fluorescence of BBa_K861173 decreased  coordinating  with glucose  concentration, while BBa_K861169 was  reverse.The fluorescence of  BBa_K861174 was too low to record, so we do not  show it here. All of the results coincided with expected results indicating  that we have successfully constructed the promoter which was activated by high  concentration of glucose.</p>
-
</a>
+
    <p align="left">Fluorescent  images indicated that all cells were growing normally, because the size and  morphology were both the same  as cells in LB  medium. The fluorescence of the cells in the images show the same discipline with  results from the fluorescence measurement experiments. <br>
-
repressed by protein cI. In this way ,we construct an indirect regulation
+
      The results of FANCY  are  showed as bellow, which conforms well  the results that showed above.</p>
-
pathway with sensus glucose, transcription activator CRP and transcription
+
    <p align="left">&nbsp;</p>
-
repressor cI. If the device works as supposed, cellulose production will
+
    <p><strong>Discussion </strong><br>
-
be increased following the elevation of glucose concentration, and vice
+
      All results of the three experiments  indicate the device works as expected. Next, RFP will be replaced with genes of  cellulose synthesis. So the exceeded glucose can  be transformed into cellulose. <br>
-
versa. For more information, click
+
      Although the indirect regulation pathway was tested effective,it  works through a intermediate product, protein cI. This determines that the  device will be less sensitive to glucose than a direct regulation pathway  without intermediate.</p>
-
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">
+
    <p align="left">&nbsp;</p>
-
Here
+
    <a name="Direct Regulatory Promoter Design">
-
</a>
+
-
.
+
-
</p>
+
-
<p align="justify">
+
-
<img src="https://static.igem.org/mediawiki/2012/3/38/Cellulose_1.png" width="500"
+
-
height="421" hspace="2" vspace="1" border="2" align="center" />
+
-
</p>
+
-
<a name="Direct Regulatory Promoter Design">
+
<h3>
<h3>
Direct Regulatory Promoter Design
Direct Regulatory Promoter Design
</h3>
</h3>
-
</a>
+
  </a>Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we altered a constitutive promoter (BBa_J23119) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on Standard), but we shall focus on the design itself now.
-
<p align="justify">
+
  <p>We designed promoter Pcar based on promoter  BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region.  Since steric hindrance of CRP dimer blocks the function of -10 region, gene  downstream will be repressed when glucose concentration is low. That is, most  CRP appears in DNA-binding configuration. The repressive  effect is undermined when glucose concentration increases. Accordingly,  we changed CRP from an activator to a repressor, simplifying the device with  potential advantages of higher sensibility and efficiency. As experimental  results show, promoter Pcar works as we expect.   </p>
-
Although the indirect regulation pathway was tested effective, we went
+
<p align="justify">&nbsp;</p>
-
on attempting a more compact and widely useful direct regulation design.
+
-
Hence we modified a constitutive promoter (
+
-
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">
+
-
BBa_J23119
+
-
</a>
+
-
) to CRP repressible ones. We have established a new technical standard
+
-
for our strategy of repressible promoter design (for more information,
+
-
click on
+
-
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">
+
-
Standard
+
-
</a>
+
-
), but we shall focus on the design itself now.
+
-
</p>
+
<center>
<center>
<p>
<p>
Line 649: Line 628:
</p>
</p>
</center>
</center>
-
<p align="justify">
+
  <p><strong>Methods</strong></p>
-
We designed promoter Pcar(
+
<p><strong>Design of the promoter Pcar which is  activated by glucose </strong></p>
-
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861171">
+
<p>Promoter Pcar , glucose biosensor plasmid, is derived from constitutive  promoter (BBa_J23119) by adding a CRP binding site upstream  the promoter which has several base pairs overlapping  with polymerase binding site. The sequence was synthesized with restriction  enzyme cutting site for EcoRI and XbaI at the 5' terminal and SpeI at 3'  terminal. The sequence of promoter Pcar has cohesive terminus at both ends, so  it is very convenient for us to construct the plasmid for functional  detection.The sequence of Pcar is as followed:</p>
-
BBa_K861171
+
<p><strong>Construction of plasmid for direct  regulation pathway</strong></p>
-
</a>
+
<p>In this experiment, RFP reported the  function of the indirect regulation pathway.</p>
-
) based on promoter BBa_J23119, inserting CRP-binding site to overlap
+
<p>K861179: BBa_I13507, an mRFP generator with RBS and  terminator was embedded downstream the constitutive promoter BBa_J23119.</p>
-
on six base pairs with promoter -10 region. Since steric hindrance of CRP
+
<p>K861176: BBa_I13507 was embedded  downstream the artificial promoter Pcar.</p>
-
dimer blocks the function of -10 region, genes downstream will be repressed
+
<p>K861178: a constitutive expressed CRP(J23116+K861161) was assembled with  K861176.</p>
-
when glucose concentration is low. That is, most CRP appears in DNA-binding
+
<p>All new composite parts mentioned above  were transformed to competent cells of Escherichia coli str. DH5a. All positive  clones are validated using PCR, restriction enzyme digestion and DNA  sequencing.</p>
-
configuration. The repressive effect is undermined when glucose concentration
+
<p><strong>Functional detection</strong></p>
-
increases. Accordingly, we changed CRP from an activator to a repressor,
+
<p>The same methods with that of the indirect regulation pathway were used  to confirm that the promoter worked as expected. For details, please click Here.</p>
-
simplifying the device with potential advantages of higher sensibility
+
  <p><strong>Results</strong></p>
-
and efficiency. As experimental results show, promoter Pcar works as we
+
<p><strong>Construction  of the plasmid for functional detection</strong></p>
-
expect. For more information, please click
+
<p>The sizes of the Promoter Pcar and J23119  were less than 100 bp and  proved to be  correct by the agarose gel electrophoresis . Restriction Digestion of the  plasmid BBa_I13507 only have one lad on the agarose gel, it told that the  plasmid was digested well. After transformation, competent cells were cultured on agar plate with 50 μg/L  of ampicillin. Both red and white bacterial colonies emerged on one plate. The red ones were  the correct clones revealing promoter embedded  successfully, while the white ones were negative . The red clones were picked out and cultured in LB medium for plasmid extraction.  Purified plasmids were digested with XbaI and PstI for confirmation. The bands  of 2000bp and 1000bp showed that the promoter had been embedded successfully.  At last, the plasmids we acquired were sent for sequencing, results show no  mutation exist. </p>
-
<a href="http://partsregistry.org/wiki/index.php?title=Part:K861171">
+
<p><strong>Cell culture fluorescence measurement. </strong></p>
-
Here
+
<p>The  correct clones were cultured in 96-well plate at 37℃ for 24 hours,then the fluorescence  and absorbance at 600 nm were recorded on a SpectraMax M2 plate reader. All  fluorescence was normalized with absorbance at 600 nm.The results represented  the fluorescence of every cell.<br>
-
</a>
+
  The fluorescence  of K861179 was about 10000 Relative Light Units. It did not vary with  concentrations of glucose. However we found a positive correlation between the  fluorescence of K861176 and concentration of glucose. At a glucose concentration  lower than 4mM, the fluorescence was very low, but at high concentration of  glucose like 100mM, the fluorescence was much less than that of K861179. </p>
-
.
+
  <p><strong>Capturing of the fluorescent image </strong></p>
-
</p>
+
  <p>Fluorescent  images indicated that all the cells were growing normally, because the size and  morphology were both the same with cells in LB medium.the fluorescence of the  cells in the images show the same discipline with results from the fluorescence  measurement experiments. Fluorescence of K861179 was very strong but it didn't  change with the glucose concentration. On the contrary, fluorescence of K861176  was relatively weak but increased with  concentration of glucose.</p>
 +
  <p><strong>Fluorescent analysis of cyto-imaging</strong></p>
 +
  <p>The results of FANCY is showed as bellow, single  cell was recognized from fluorescence images and fluorescence intensity was  caculated.In the table, datas show that RFP expression was activated in high  glucose concentration, which conforms well with results above.For more information about FANCY,click here.</p>
 +
  <p><strong>&nbsp;</strong></p>
 +
<p><strong>Discussion</strong></p>
 +
    <p align="left">The promoter  Pcar is a promoter designed for the <em>Eschaerichia  coli</em> which is derived from a constitutive promoter BBa_J23119. Pcar  includes the CRP-binding site and the RNA polymerase-binding site which overlap several base pairs. Therefore, because of the steric  hindrance between CRP and RNA polymerase, gene downstream of the promoter will  be repressed at high concentration of CRP. In the cells, low glucose  concentration results in increasing activity by  adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound  form, is able to bind tightly to the specific DNA site in the promoter and repress the  gene downstream. On the contrary, high  glucose concentration will result in the expression of the promoter.</p>
 +
      <p align="justify">&nbsp;</p>
</div>
</div>
<div class="passage divcell3">
<div class="passage divcell3">
Line 830: Line 815:
In this experiment, we wanted to test whether the ability of degrading fatty acids of our genetically modified bacteria was enhanced as expected by transforming plasmids constitutively expressing related genes in the beta oxidation pathway. The effects of the genes we have tested is listed in the following chart I. The ability was reflected by the change of the concentration of the fatty acids in the medium. It was measured by cupric-acetate soap reaction as described Protocols section.(此处可给一个链接) Each time we inoculated 50mg bacteria into 30ml M9 medium using fatty acid as sole carbon source, collecting the sample at the time as shown in the picture. Then the analysis of the free fatty acids was performed.
In this experiment, we wanted to test whether the ability of degrading fatty acids of our genetically modified bacteria was enhanced as expected by transforming plasmids constitutively expressing related genes in the beta oxidation pathway. The effects of the genes we have tested is listed in the following chart I. The ability was reflected by the change of the concentration of the fatty acids in the medium. It was measured by cupric-acetate soap reaction as described Protocols section.(此处可给一个链接) Each time we inoculated 50mg bacteria into 30ml M9 medium using fatty acid as sole carbon source, collecting the sample at the time as shown in the picture. Then the analysis of the free fatty acids was performed.
</p>
</p>
-
<p align="justify">
+
<p>
-
The following figures shows the effects on degrading fatty acids by expressing different genes in β- oxidation pathway in E.coli. They are under the regulation of promoters with different kinds of strength. J23107 and J23114 are constitutive promoters provided by the commitee. pfadR is the promoter designed by ourselves. It consists of the sequence of a constitutive promoter and the binding sequence of the transcription factor, FadR, which is the sensor of the fatty acids. FadE is the acyl-CoA dehydrogenase,which had been proved as performing the rate limiting reaction in the pathway. S-FadE is the counterpart of FadE in the bacteria Samonella. FadD is the acyl-CoA synthase. FadL, a transmembrane protein, is responsible for transporting fatty acids into the bacteria. The control we use is the E.coli expressing galU, a gene responsible for synthesize cellulose, as the control .</p>
+
-
<p align="justify">Based on the measurements of the consumption at given time, it concludes that overexpressing fadL increase the metabolizing ability no matter under the re regulation of J23114 or our designed promoter, pfadR. The advantage is more obvious when the time expands ( consumption at 18h and 24h) . It’s plausible because more fadL may transport more fatty acids into the bacteria. The increased inner fatty acids concentration is quite favorable. We also notice that the later one’s consumption is lower. It may attributes to the fact that our promoter is weaker than the J23114. If the copy number of fadL is less , its metabolizing rate will be slower. And the fact that the pfadR needs to be induced may also make the time needed to synthesize protein longer, which may make it less competitive. It opposes to our assumption that overexpressing the rate limiting enzyme fadE doesn’t have obvious effect. It may because the original level of fadE is enough, thus overexpression is not needed .The strength of the promoter doesn’t affects the rate much, which partially suggests the reason above.</p>
+
As our data suggests, PfadR- FadL and J23114- FadL can degrade the fatty acids better than the control. They are also faster than the control, bacteria express protein irrelevant to fatty acid degradaton of similar size.Others are not that obvious. The column figure is present as below. The result of the analysis of the variance is present in chart II.
-
<p align="justify">We found that the slope between 12h and 18h and between 18 and 24h are less than the others. It may because the bacteria has entered static status, the amount of bacteria becomes consistent .And after the first death phase, they entered log phase again. Since our inoculation is relatively large and the oleate is excessive, the situation that the bacteria has experience two life cycle is possible. A growth curve in the future can test the theory.
+
</p>
</p>
-
 
</div>
</div>
<div class="passage divcell4">
<div class="passage divcell4">
Line 872: Line 854:
</h3></a>
</h3></a>
<p><img src="http://partsregistry.org/wiki/images/e/e7/AdrA.jpg" width="500" height="620" hspace="2" vspace="1" border="2" align="top" /></p></br>
<p><img src="http://partsregistry.org/wiki/images/e/e7/AdrA.jpg" width="500" height="620" hspace="2" vspace="1" border="2" align="top" /></p></br>
-
<p align="justify">As can be seen from the plate. Clone with <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861073">AdrA constitutively expressed</a> using <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23107">BBa_J23107</a> is much more smaller compared to the control that only contain <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">the plasmids of RBS</a>, though the amount of bacteria is similar. This result showed that the AdrA was successfully expressed, elevating c-di-GMP level, leading to the increase expression of adhesins and inhibition of motility.</p>
+
<p align="justify">As can be seen from the plate. Clone with AdrA constitutively expressed using <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23107">BBa_J23107</a> is much more smaller compared to the control that only contain <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">the plasmids of RBS</a>, though the amount of bacteria is similar. This result showed that the AdrA was successfully expressed, elevating c-di-GMP level, leading to the increase expression of adhesins and inhibition of motility.</p>
</div>
</div>

Revision as of 22:07, 26 September 2012

Project Description

The above figure is the overview of our design

The utmost purpose of our project is to emancipate people from obesity. It can be achieved by genetically modifying a resident intestinal microbe, such as E.coli, to create a novel beneficial bacterial which is competent to eliminate the excessive absorption of calorie.

Fatty acids are our primary targets. To prevent the over in-take and accumulation of fatty acids, we will try to engineer microbes that can metabolize the excessive fatty acids in diet efficiently and effectively before they are absorbed by the host. To achieve this, we will overexpress the enzymes responsible for fatty acid degradation under the control of a natural sensor for concentration of fatty acids-- FadR, a repressor for the genes involved in fatty acid degradation. A constitutive promoter will be fused to the original binding site of FadR. If such a promoter is placed upstream of the target genes, they can only express when the FadR senses the high concentration of fatty acids and slides off the site on DNA. The gene expression will solely respond to concentration of fatty acids.

Also, since the glucose can be transformed into fatty acids in our body, we will try to transform the glucose into polymers, such as cellulose, which cannot further be degraded and absorbed by the host. Instead of contributing to the formation of fatty acids, the glucose is turned into a healthier substance. The polymers made from the glucose may facilitate the growth of other intestinal microbes which have been proved to be beneficial for maintaining a normal weight. Enzymes responsible for cellulose synthesis are accessible from other species of bacteria and can be implanted into E.coli. To sense the glucose concentration and respond exclusively to it, we choose CRP as a regulator. Specifically, we will change this activator into a repressor by overlapping its binding site downstream the constitutive promoter instead of in front of it. Then the relative gene can only be activated when the CRP cannot bind the site on DNA at high glucose concentration. This synthetic promoter may have broad applications. For example, it can be used in gene therapy for diabetes.

Another problem we will try to tackle is the survival and the colonization of the bacteria in intestine. It is commonly accepted that a species introduced to a new enviornment gets the chance of surviving and even being dominant if it can utilize an energy resource that cannot be used by any other species. According to the theory, the unmatchable ability of the E.coli to utilize the fatty acids as its carbon sources can already partially fulfill the goal. The adhesion to intestinal cells is another factor for its survival other than the energy requirement. We will try to increase the adhesion ability of the E.coli by enhancing its production of c-di-GMP, a second massager which has been reported to increase adhesion of bacteria.

Biological safety should be paid equal attention in the progress of designing novel probiotic. To prevent the uncontrolled reproduction of the modified E.coli in the intestine, we have designed a death system to wipe out the GMOs at will. It is designed to exploit the natural sensor for the signal molecule xylose to regulate its target, the endonuclease responsible for killing the cell quietly without setting off any immunological reaction. Also, Horizontal gene transfer will also trigger the death of the recipient.

To sum up, we not only propose a novel and interesting way to tackle the obese problems but also create the biological sensors for fatty acids and glucose which have broad applications in detection and therapy of related diseases.

Obesity: a serve global problem

Obesity refers to a health condition that body fat is accumulated to some extent. According to WHO, body mass index (BMI) is an index of weight-for-height that is commonly used to classify obesity in adults. It is a risk factor for various diseases, such as cardiovascular diseases (mainly heart disease and stroke), type 2 diabetes, musculoskeletal disorders (especially osteoarthritis), some cancers (endometrial, breast, and colon).



As it is shown in figure 1 and 2, a large amount of people from all over the world are overweight in both developed countries and developing contries and it is and will become more and more serve.



Figure 1(from reference [4]): Past and projected prevalence of overweight (BMI ≥25 kg/m2)

Figure 2: Prevalence of obesity in different countries.
(Picture from The Wellington Grey blog)

The Cause of Obesity

Obesity is most commonly caused by a combination of excessive food energy intake, lack of physical activity, and genetic susceptibility, although a few cases are caused primarily by genes, endocrine disorders, medications or psychiatric illness.

However, the problem of obesity emerged globally only several decades ago. Since the change of genome of a species requires a long time, the outbreak of obesity is unlikely to be caused by changes in human genome. For most individuals, controlling food intake and doing physical activity in a proper way are effective strategies to lose weight. But for some people whose health condition or current life pace keeps them away from systemic and regular exercise and dieting, modulate the composition of microorganisms in intestine might act as an alternative.

Reports by Gordon have shown that, apart from human genome, the collective genome of microorganisms (microbiome) in human intestine is associated with our obesity [1]. Furthermore, microbiome is able to be changed through control of food intake [1].

Two groups of beneficial bacteria are dominant in the human gut, the Bacteroidetes and the Firmicutes. The relative proportion of Firmicutes is increased in obese people by comparison with lean people [2].

Figure 3: How excess of energy contributes to obesity

Pertinent study by Gordon attested their initial hypothesis that changes in microbial component have a causal relationship with obesity, thus might have potential therapeutic implications [2] [3]. Colonization of germ-free mice with an ‘obese microbiota’ results in a significantly greater increase in total body fat than colonization with a ‘lean microbiota’ [3].
Figure from reference [3]


Present strategies to lose weight

Dieting, excercise, Drugs and surgery and major ways to lose weight. However, they all have many drawbacks. Dieting may cause nutritional imbalance and can be a heavy mental burden since the person may not be able to enjoy the food he want. Excercise requires regular time and is ineffective in many cases. Drugs and surgery may have many side effects and are many times costly.

Our idea

Previous situations and insights construct our theoretical fundament. We try to utilize synthetic biology to provide a cheap, convient, effective and safe approach for treating obesity. Instead of passive alternation of microbiota, we are trying to construct an engineered E.coli----- E.coslim to positively change microbiota in intestine. As Figure 3 shown, we place E.coslim in the role of sensing and consuming excessive energy, thus leads to the double effects: lowering the proportion of Firmicutes and increasing that of Bacteroidetes, and decreasing the energy available in one’s intestine.

To achieve these two goals, we designed four devices, fatty acids consumption, cellulose synthesis, colonization and death device of E.coslim.

References


[1] Ruth E. Ley1, Peter J. Turnbaugh1, Samuel Klein1 & Jeffrey I. Gordon1 Microbial ecology: Human gut microbes associated with obesity. Nature 444, 1022-1023 (21 December 2006)
[2] Peter J. Turnbaugh1, Ruth E. Ley1, Michael A. Mahowald1, Vincent Magrini2, Elaine R. Mardis1,2 & Jeffrey I. Gordon1 An obesity-associated gut microbiome with increased capacity for energy harvest. Vol 444|21/28 December 2006| doi: 10.1038/nature05414
[3] Ley RE. Obesity and the human microbiome. Curr Opin Gastroenterol. 2010 Jan; 26(1):5-11.
[4] Y Claire Wang et.al. Health and economic burden of the projected obesity trends in the USA and the UK. Lancet. 2011

Introduction

Fatty acids and sugar should be the primary targets for genetically engineered probiotics that can help people lose weight. For probiotics to degrade fatty acids and to convert glucose into cellulose, they must be able to sense and be regulated by exsitence of those substrates. Otherwise, the system may not only be not efficient but also may cause serious problem. However, there is no promoter exist in nature that can solely regulated by glucose or fatty acids. Therefore, to achieve our goals, we designed an indirect pathway and a direct synthetic promoter to sense and be regulated by glucose concentration. Also another synthetic promoter was designed to sense and be regulated by fatty acids.

Indirect Pathway Design

In a cell, the total amount of ATP, ADP and AMP molecules remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.

We embed gene cI of lambda phage(BBa_P0451) downstream promoter PcstA (BBa_K118011) activated by the binding of CRP, and genes of red fluorescence protein(RFP, BBa_I13507) respectively downstream the promoter BBa_R0051 repressed by protein cI. In this way we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as design, output of RFP will be increased following the elevation of glucose concentration, and vice versa.

Method

Construction of plasmid for indirect regulation pathway

In this experiment, RFP reported the function of the indirect regulation pathway.

K861173: BBa_I13507, an mRFP generator with RBS and terminator, was embedded after CRP activated promoter K118011.

K861172: BBa_P0451, a cI generator with RBS and terminator, was embedded after promoter BBa_K118011 activated by CRP.

K861169:  K861172 and I763007, a cI repressed RFP generator, were assembled .

K861174: BBa_K137115, constitutively expressing cI generator with promoter, RBS and terminator, was assembled to I763007.

All new composite parts mentioned above were transformed to competent cells of Escherichia coli str. DH5a. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.

Cell culture fluorescence measurement

Minimal medium with different concentration of glucose(1mM, 4mM, 10 mM , 20 mM , 50 mM ,100 mM) were transferred into a 96-well plate, 200 μL for each well. Then each well was inoculated with 2 μL of seed liquor which was activated overnight in M9 minimal medium with 50mM glucose at 37℃. The wells without inoculation were regarded as blank controls to revise the results. Under each condition, three parallel samples were setted. The plate was incubated at 37℃, 150rpm. Cell culture fluorescence was recorded on a SpectraMax M2 plate reader (Molecular Devices). Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm.

Capturing fluorescent image

Cell morphology was observed through fluorescence microscope, and the image of bacteria with of each glucose concentration were captured. To know more about these images, please click on Here.

Fluorescent analysis of cyto-imaging

A program named FANCY was  designed to recognize single cell and calculate the fluorescence strength according to the images. For more information, please click Here.

Results

Purified plasmids constructed before were digested with XbaI and PstI for confirmation. The agarose gel electrophoresis showed that the lengths were correct. At last, the plasmids were sent for sequencing. Results showed no mutation.

In the cell culture fluorescence measurement experiment, fluorescence of BBa_K861173 decreased coordinating with glucose concentration, while BBa_K861169 was reverse.The fluorescence of BBa_K861174 was too low to record, so we do not show it here. All of the results coincided with expected results indicating that we have successfully constructed the promoter which was activated by high concentration of glucose.

Fluorescent images indicated that all cells were growing normally, because the size and morphology were both the same as cells in LB medium. The fluorescence of the cells in the images show the same discipline with results from the fluorescence measurement experiments.
The results of FANCY are showed as bellow, which conforms well the results that showed above.

 

Discussion
All results of the three experiments indicate the device works as expected. Next, RFP will be replaced with genes of cellulose synthesis. So the exceeded glucose can be transformed into cellulose.
Although the indirect regulation pathway was tested effective,it works through a intermediate product, protein cI. This determines that the device will be less sensitive to glucose than a direct regulation pathway without intermediate.

 

Direct Regulatory Promoter Design

Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we altered a constitutive promoter (BBa_J23119) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on Standard), but we shall focus on the design itself now.

We designed promoter Pcar based on promoter BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region. Since steric hindrance of CRP dimer blocks the function of -10 region, gene downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results show, promoter Pcar works as we expect.

 

Methods

Design of the promoter Pcar which is activated by glucose

Promoter Pcar , glucose biosensor plasmid, is derived from constitutive promoter (BBa_J23119) by adding a CRP binding site upstream the promoter which has several base pairs overlapping with polymerase binding site. The sequence was synthesized with restriction enzyme cutting site for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. The sequence of promoter Pcar has cohesive terminus at both ends, so it is very convenient for us to construct the plasmid for functional detection.The sequence of Pcar is as followed:

Construction of plasmid for direct regulation pathway

In this experiment, RFP reported the function of the indirect regulation pathway.

K861179: BBa_I13507, an mRFP generator with RBS and terminator was embedded downstream the constitutive promoter BBa_J23119.

K861176: BBa_I13507 was embedded downstream the artificial promoter Pcar.

K861178: a constitutive expressed CRP(J23116+K861161) was assembled with K861176.

All new composite parts mentioned above were transformed to competent cells of Escherichia coli str. DH5a. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.

Functional detection

The same methods with that of the indirect regulation pathway were used to confirm that the promoter worked as expected. For details, please click Here.

Results

Construction of the plasmid for functional detection

The sizes of the Promoter Pcar and J23119 were less than 100 bp and  proved to be correct by the agarose gel electrophoresis . Restriction Digestion of the plasmid BBa_I13507 only have one lad on the agarose gel, it told that the plasmid was digested well. After transformation, competent cells were cultured on agar plate with 50 μg/L of ampicillin. Both red and white bacterial colonies emerged on one plate. The red ones were the correct clones revealing promoter embedded successfully, while the white ones were negative . The red clones were picked out and cultured in LB medium for plasmid extraction. Purified plasmids were digested with XbaI and PstI for confirmation. The bands of 2000bp and 1000bp showed that the promoter had been embedded successfully. At last, the plasmids we acquired were sent for sequencing, results show no mutation exist.

Cell culture fluorescence measurement.

The correct clones were cultured in 96-well plate at 37℃ for 24 hours,then the fluorescence and absorbance at 600 nm were recorded on a SpectraMax M2 plate reader. All fluorescence was normalized with absorbance at 600 nm.The results represented the fluorescence of every cell.
The fluorescence of K861179 was about 10000 Relative Light Units. It did not vary with concentrations of glucose. However we found a positive correlation between the fluorescence of K861176 and concentration of glucose. At a glucose concentration lower than 4mM, the fluorescence was very low, but at high concentration of glucose like 100mM, the fluorescence was much less than that of K861179.

Capturing of the fluorescent image

Fluorescent images indicated that all the cells were growing normally, because the size and morphology were both the same with cells in LB medium.the fluorescence of the cells in the images show the same discipline with results from the fluorescence measurement experiments. Fluorescence of K861179 was very strong but it didn't change with the glucose concentration. On the contrary, fluorescence of K861176 was relatively weak but increased with concentration of glucose.

Fluorescent analysis of cyto-imaging

The results of FANCY is showed as bellow, single cell was recognized from fluorescence images and fluorescence intensity was caculated.In the table, datas show that RFP expression was activated in high glucose concentration, which conforms well with results above.For more information about FANCY,click here.

 

Discussion

The promoter Pcar is a promoter designed for the Eschaerichia coli which is derived from a constitutive promoter BBa_J23119. Pcar includes the CRP-binding site and the RNA polymerase-binding site which overlap several base pairs. Therefore, because of the steric hindrance between CRP and RNA polymerase, gene downstream of the promoter will be repressed at high concentration of CRP. In the cells, low glucose concentration results in increasing activity by adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound form, is able to bind tightly to the specific DNA site in the promoter and repress the gene downstream. On the contrary, high glucose concentration will result in the expression of the promoter.

 

Fatty Acid Degradation Device

Purpose

To help people lose weight without the need of food restriction, we designed a genetically modified E.coli that can sense and degrade excessive fatty acids intake by the host. We hope that, together with other two devices we designed, we can introduce our E.coslim as resident in intestine to consume the excessive calories intake by the host and regulate intestinal microbiota.

Outline

Genes that are responsible for degradation and transportation of fatty acids (FAs) from E.coli K12 and from Salmonella enterica LT2 were cloned. Also, a promoter that can that can be regulated soley by fatty acids was also designed. By placing those fatty acid degradation genes downstream of the artificially designed promoter PfadR (BBa_K861060) that can sense the concentration of FAs, we hope to create a device that to degrade FAs only when the concentration of FAs is high.

Long chain fatty acids are firstly being imported by the transmembrane protein FadL. After FAs get into cells, a CoA will be added by inner membrane-associated FadD (acyl-CoA synthase). β-oxidation is initiated by FadE(acyl-CoA dehydrogenase), which will convert acyl-CoA into enoyl-CoA. The following cycles of hydration, oxidation, and thiolytic cleavage are carried out by tetrameric complex consisting of two FadA and two FadB proteins or two FadI and two FadJ in anaerobic condition. FadR is a transcriptional regulator that, when not binds to acyl-CoA, can either serve as an activator for fatty acid synthesis gene like FabA, FabB and etc. or a repressor for fatty acid degradation gene like FadA, FadB, FadD FadE, FadL, FadI, FadJ and etc. After long chain fatty acids are converted to fatty acyl- CoA by FadD, it can bind to FadR. The binding will alter the conformation of FadR, making FadR unable to bind to the DNA sequence it recognizes to fulfill its function. Therefore, FadR can no longer activate or repress the transcription of genes downstream FadR binding sites. However, to our knowledge, there is no promoter exists in nature that can respond solely to FadR since those promoters are often regulated by glucose concentration or oxidative stress and many other factors.
In our design, FadL, FadD, FadE, FadA, FadB FadI, FadJ and FadA from Escherichia coli K12, and FadA, FadB and FadE from Salmonella enterica LT2 are placed downstream a synthetic promoter PfadR to make them under the sole regulation of fatty acids concentration.

Progress

Cloning of the gene

First, the genome of Escherichia coli K12 str. DH5ɑ and Salmonella enterica LT2 (symbolized as S-) were got and amplified in PCR using primers for each gene. The sequences of the primers used are as bellow (5’---3’).
FadR Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG
Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC
FadA Forward: GGAATTCTCTAGAATGGAACAGGTTGTCATTGTCG
Reverse: GACTAGTTTAAACCCGCTCAAACACCGT
FadB Forward: GGAATTCTCTAGAATGCTTTACAAAGGCGACACC
Reverse: GACTAGTTTAAGCCGTTTTCAGGTCGCC
FadD Forward: GGAATTC TCTAGATTGAAGAAGGTTTGGCTTAACCG
Reverse: GACTAGTTCAGGCTTTATTGTCCACTTTGC
FadE Forward: GGAATTC TCTAGAATGATGATTTTGAGTATTCTCG
Reverse: GACTAGTTTACGCGGCTTCAACTTTCCG
FadL Forward: GGAATTC TCTAGAATGAGCCAGAAAACCCTG
Reverse: GACTAGTTAGAACGCGTAGTTAAAGTTAG
FadI Forward: GGAATTC TCTAGA ATGGGTCAGGTTTTACC
Reverse: GACTAGTTTATTCCGCCTCCAGAACCA
FadJ Forward: GGAATTCTCTAGAATGGAAATGACATCAGC
Reverse: GACTAGTTTATTGCAGGTCAGTTGCAGTTG
S-FadA Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG
Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC
S-FadB Forward: GGAATTCTCTAGAATGCTTTATAAAGGCGACACC
Reverse: GACTAGTTAAGCCGTTTTCAGAGAACC
S-FadE Forward: GGAATTCTCTAGAATGATGATTTTGAGTATTATCG
Reverse: GACTAGTTATGCGGCTTCGACTTTACGC

Design of the Promoter PfadR Repressed by Fatty Acids

Promoter PfadR, is derived from BBa_J23110. Specifically, FadR binding site of FadL gene is placed overlapping with the last 3 base pairs of BBa_J23110 The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. We use overlapping PCR to get the double strand DNA. The sequence design of PfadR is as followed:
Forward: GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT
Reverse: GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT

Construction of Biobricks

Fatty acid degradation project is divided into two parts: Promoter, and gene function
To discover the optimal combination of those fatty acid genes, we:
1. PCR to clone those genes in E.coli K12 and Salmonella enterica LT2
2. Restriction digest and ligate those gene into pSB1C3
3. Restriction digest and ligate those gene with RBS(B0030)
4. RBS-FadA, RBS-FadI, and RBS-S- FadA is ligated with both BBa_R0011 promoter and our PfadR
RBS-FadR, RBS-FadB, RBS-FadJ, RBS-FadE, RBS-FadD, RBS-FadL, RBS-S-FadB, and RBS-S-FadE are ligated with B0034
5.PROMOTER-RBS-FadA is ligated with RBS-FadB-Terminator, PROMOTER-RBS-FadI is ligated with RBS-FadJ-Terminator and PROMOTER-RBS-S-FadA is ligated with RBS-S-FadB-Terminator. RBS-FadE-Terminator, RBS-FadD-Terminator, RBS-FadL-Terminator, and RBS-S-FadE-Terminator, are ligated with BBa_R0011 promoter, PfadR and various constitutive promoters. For Promoter PfadR
1. promoter PfadR was synthesized using overlapping PCR
2. RFP reporter was ligated downstream the promoter and ligted into pSB6A1
3. J23116+ RBS+ FadR+ Terminator was ligated to PfadR+ RFP in pSB6A1

Experimental Procedure

We used cupric acetate-pyridine as a color developing reagent to determine fatty acid consumption of genetically modified bacteria. We had modified existing methods to extract free fatty acid in M9 medium. Also, we used IPTG induced promoter BBa_R0011 to see the expression of those proteins and extract proteins from cells. For more details, please see Protocol page.

Results

Characterization of each gene

In this experiment, we wanted to test whether the ability of degrading fatty acids of our genetically modified bacteria was enhanced as expected by transforming plasmids constitutively expressing related genes in the beta oxidation pathway. The effects of the genes we have tested is listed in the following chart I. The ability was reflected by the change of the concentration of the fatty acids in the medium. It was measured by cupric-acetate soap reaction as described Protocols section.(此处可给一个链接) Each time we inoculated 50mg bacteria into 30ml M9 medium using fatty acid as sole carbon source, collecting the sample at the time as shown in the picture. Then the analysis of the free fatty acids was performed.

图 As our data suggests, PfadR- FadL and J23114- FadL can degrade the fatty acids better than the control. They are also faster than the control, bacteria express protein irrelevant to fatty acid degradaton of similar size.Others are not that obvious. The column figure is present as below. The result of the analysis of the variance is present in chart II.

Colonization

Purpose

One big challenge of probiotics is their survival in intestine. We respond to this challenge by expressing gene adrA responsible for manufacturing the second messager c-di-GMP, a magic molecule that leads to inhibition of motility and increase of adhesion and division of E.coli.

Outline

AdrA protein can convert GTP into c-di-GMP, a magic second massager that, besides promoting the production of cellulose(for more details, see our celluose synthesis device), can reduce the expression of flagella and acute virulence gene simultaneously. In the same time, c-di-GMP can facilitate the synthesis of various adhesins and exopolysaccharides and can promote the proteolysis of replication inhibitors. As a result, AdrA makes cells become adhesive and promote the formation of biofilm, making the bacteria gain advantages to survive in the hostile environment of intestine.

Experimental Procedure

We tested the function of AdrA gene by plate assay. Formore details, please visit our protocol page.

Results


As can be seen from the plate. Clone with AdrA constitutively expressed using BBa_J23107 is much more smaller compared to the control that only contain the plasmids of RBS, though the amount of bacteria is similar. This result showed that the AdrA was successfully expressed, elevating c-di-GMP level, leading to the increase expression of adhesins and inhibition of motility.