Team:WHU-China/Project

From 2012.igem.org

(Difference between revisions)
Line 570: Line 570:
<h3>Device II: Cellulose Synthesis</h3>
<h3>Device II: Cellulose Synthesis</h3>
<h4>Outline</h4>
<h4>Outline</h4>
-
<p>
+
<p align="justify">
Cellulose is an essential material for keeping intestine peristalsis without producing energy, as prebiotics, feeding vegetarian bacteria flora (including Bacteroides, whose appropriate amount has proved important to prevent obesity<sup>[1]</sup>) of intestine as well. Thus, cellulose help people keep slim and healthy.
Cellulose is an essential material for keeping intestine peristalsis without producing energy, as prebiotics, feeding vegetarian bacteria flora (including Bacteroides, whose appropriate amount has proved important to prevent obesity<sup>[1]</sup>) of intestine as well. Thus, cellulose help people keep slim and healthy.
</p>
</p>
-
<p>
+
<p align="justify">
The developing device aims at transforming glucose into cellulose, thus producing cellulose as well as reducing energy intake. To achieve this goal, we cloned genes of enzymes responding to cellulose synthesis from the <i>Escherichia coli</i> str. DH5&alpha;, constructing functional expressional elements with these genes respectively downstream of promoter activated by glucose. In this way, cellulose synthetase complex is built artificially under regulation of glucose, repressed under low concentration of glucose and activated under high concentration of glucose.
The developing device aims at transforming glucose into cellulose, thus producing cellulose as well as reducing energy intake. To achieve this goal, we cloned genes of enzymes responding to cellulose synthesis from the <i>Escherichia coli</i> str. DH5&alpha;, constructing functional expressional elements with these genes respectively downstream of promoter activated by glucose. In this way, cellulose synthetase complex is built artificially under regulation of glucose, repressed under low concentration of glucose and activated under high concentration of glucose.
</p>
</p>
-
<p>
+
<p align="justify">
In the future, this device can be integrated to the assembled “E. coslim”, activated when excess glucose is sensed in intestine, converting to cellulose.
In the future, this device can be integrated to the assembled “E. coslim”, activated when excess glucose is sensed in intestine, converting to cellulose.
</p>
</p>
-
<p>
+
<p align="justify">
The same as device I (fatty acid metabolism), on one hand,we divide our work into two parallel sections. “Function” section includes a series of molecular biological manipulation on four genes of the cellulose synthetase complex and another two genes responding to producesubstrates for cellulose synthesis. On the other hand, the design, construction and function tests of glucose-activated promoter belong to “regulation” section.
The same as device I (fatty acid metabolism), on one hand,we divide our work into two parallel sections. “Function” section includes a series of molecular biological manipulation on four genes of the cellulose synthetase complex and another two genes responding to producesubstrates for cellulose synthesis. On the other hand, the design, construction and function tests of glucose-activated promoter belong to “regulation” section.
</p>
</p>
Line 594: Line 594:
<h5>Genes to be Cloned</h5>
<h5>Genes to be Cloned</h5>
-
<p>
+
<p align="justify">
4 genes, bcsA, bcsB, bcsZ and bcsC,from the rdar morphotype bacterium,are involved in cellulose biosynthesis.
4 genes, bcsA, bcsB, bcsZ and bcsC,from the rdar morphotype bacterium,are involved in cellulose biosynthesis.
<br/>
<br/>
Line 611: Line 611:
<h5>Indirect Regulation Pathway Design</h5>
<h5>Indirect Regulation Pathway Design</h5>
-
<p>
+
<p align="justify">
In a cell,  total amount of ATP, ADP and AMP remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.
In a cell,  total amount of ATP, ADP and AMP remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.
</p>
</p>
-
<p>
+
<p align="justify">
We embed gene <i>cI</i> of lambda phage downstream promoter PcstA (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a>) activated by the binding of CRP, and genes of cellulose synthesis respectively downstream the promoter <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_R0051">BBa_R0051</a> repressed by protein cI. In this way ,we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as supposed, cellulose production will be increased following the elevation of glucose concentration, and vice versa. For more information, click <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">Here</a>.
We embed gene <i>cI</i> of lambda phage downstream promoter PcstA (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a>) activated by the binding of CRP, and genes of cellulose synthesis respectively downstream the promoter <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_R0051">BBa_R0051</a> repressed by protein cI. In this way ,we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as supposed, cellulose production will be increased following the elevation of glucose concentration, and vice versa. For more information, click <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">Here</a>.
</p>
</p>
-
<P>
+
<p align="justify">
-
  <img src="http://2012.igem.org/wiki/images/3/38/Cellulose_1.png" width="694" height="585" hspace="2" vspace="1" border="2" align="center" />
+
  <img src="http://2012.igem.org/wiki/images/3/38/Cellulose_1.png" width="500" height="421" hspace="2" vspace="1" border="2" align="center" />
</P>
</P>
<h5>Direct Regulation Pathway Design</h5>
<h5>Direct Regulation Pathway Design</h5>
-
<p>
+
<p align="justify">
Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we modified a constitutive promoter (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">BBa_J23119</a>) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">Standard</a>), but we shall focus on the design itself now.
Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we modified a constitutive promoter (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">BBa_J23119</a>) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">Standard</a>), but we shall focus on the design itself now.
</p>
</p>
-
<p align="left">We designed promoter Pcar(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861171">BBa_K861171</a>) based on promoter BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region. Since steric hindrance of CRP dimer blocks the function of -10 region, genes downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results show, promoter Pcar works as we expect. For more information, please click <a href="http://partsregistry.org/wiki/index.php?title=Part:K861171">Here</a>. <img src="http://2012.igem.org/wiki/images/9/9b/Cellulose_2.png" width="382" height="584" hspace="2" vspace="1" border="2" align="top" />
+
<p align="left"> <img src="http://2012.igem.org/wiki/images/9/9b/Cellulose_2.png" width="382" height="584" hspace="2" vspace="1" border="2" align="top" />We designed promoter Pcar(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861171">BBa_K861171</a>) based on promoter BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region. Since steric hindrance of CRP dimer blocks the function of -10 region, genes downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results show, promoter Pcar works as we expect. For more information, please click <a href="http://partsregistry.org/wiki/index.php?title=Part:K861171">Here</a>.
</p>
</p>
Line 636: Line 636:
<h5>Clone of genes</h5>
<h5>Clone of genes</h5>
-
<p>
+
<p align="justify">
-
As for the genes that we cloned, there is no difference between <i>E. Coli</i> str. K12 MG1655 and more available DH5&alpha;.we purified and amplified these genes from genome of <i>Escherichia coli</i> str. DH5&alpha;?using PCR. The primers contain standard restriction enzyme cutting sites. The sequences of the primers used are as below.
+
As for the genes that we cloned, there is no difference between <i>E. Coli</i> str. K12 MG1655 and more available DH5&alpha;.we purified and amplified these genes from genome of <i>Escherichia coli</i> str. DH5&alpha;?using PCR. The primers contain standard restriction enzyme cutting sites. The sequences of the primers used are as below:
 +
</p>
 +
<p align="left">
<ul>
<ul>
<li>
<li>
Line 673: Line 675:
<h5>Construction of the plasmid expressing cellulose synthetase controlled by promoter we designed</h5>
<h5>Construction of the plasmid expressing cellulose synthetase controlled by promoter we designed</h5>
-
<p>
+
<p align="justify">
All coding sequences were assembled to RBS and terminator, afterwards, they were embedded downstream the promoter Pcar, which can be activated at high glucose concentration. If you want to know it for details, please click <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861171">Here</a>.
All coding sequences were assembled to RBS and terminator, afterwards, they were embedded downstream the promoter Pcar, which can be activated at high glucose concentration. If you want to know it for details, please click <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861171">Here</a>.
<br>The biobricks constructed were showed as bellow:
<br>The biobricks constructed were showed as bellow:
 +
</p>
 +
<p align="left">
<br>
<br>
<ul>
<ul>
Line 688: Line 692:
</p>
</p>
-
<p>
+
<p align="justify">
All new composite parts mentioned above were transformed to competent cells of <i>Escherichia coli</i> str. DH5&alpha;. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.
All new composite parts mentioned above were transformed to competent cells of <i>Escherichia coli</i> str. DH5&alpha;. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.
</p>
</p>
<h5>Detection of Cellulose Synthesis</h5>
<h5>Detection of Cellulose Synthesis</h5>
-
<p>
+
<p align="justify">
To detect the cellulose synthesis, we used cellulase to degrade cellulose in the cell culture. Then total reducing sugar in the culture was measured. So the difference of total reducing sugar between culture before and after treated with cellulase represents the total cellulose synthetised by the cell. For detailed information, please click <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861102">Here</a>.
To detect the cellulose synthesis, we used cellulase to degrade cellulose in the cell culture. Then total reducing sugar in the culture was measured. So the difference of total reducing sugar between culture before and after treated with cellulase represents the total cellulose synthetised by the cell. For detailed information, please click <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861102">Here</a>.
</p>
</p>
Line 702: Line 706:
Clone of genes
Clone of genes
</h5>
</h5>
-
<p>
+
<p align="justify">
The gene <i>bcsA</i> is 2619bp, <i>bcsB</i> is 2340bp, <i>bcsZ</i> is 1107 bp, <i>bcsC</i> is 3474bp, <i>galU</i> is 909bp and <i>galF</i> is 894 bp. After PCR amplification, DNA fragments were examined by agarose gel electrophoresis.All genes proved correct. Then the genes were digested with restriction enzymes and embedded into plasmid backbone pSB1A2. To confirm the accuracy of sequences, positive clones were sent for sequencing after transformation. And the results showed that no mutation existed in genes.
The gene <i>bcsA</i> is 2619bp, <i>bcsB</i> is 2340bp, <i>bcsZ</i> is 1107 bp, <i>bcsC</i> is 3474bp, <i>galU</i> is 909bp and <i>galF</i> is 894 bp. After PCR amplification, DNA fragments were examined by agarose gel electrophoresis.All genes proved correct. Then the genes were digested with restriction enzymes and embedded into plasmid backbone pSB1A2. To confirm the accuracy of sequences, positive clones were sent for sequencing after transformation. And the results showed that no mutation existed in genes.
</p>
</p>
-
<P>
+
<p align="justify">
  <img src="http://2012.igem.org/wiki/images/3/30/BcsA_B_Z_C_U_F.tif" width="720" height="600" hspace="2" vspace="1" border="2" align="top" />
  <img src="http://2012.igem.org/wiki/images/3/30/BcsA_B_Z_C_U_F.tif" width="720" height="600" hspace="2" vspace="1" border="2" align="top" />
</P>
</P>
Line 712: Line 716:
<h5>Detection of Cellulose Synthesis</h5>
<h5>Detection of Cellulose Synthesis</h5>
-
<p>
+
<p align="justify">
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
<br>
<br>

Revision as of 22:22, 24 September 2012

    aaaa

    aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa

    bbbb

    bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb

    ccc

    ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc

    ddd

    dddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddd

    Device II: Cellulose Synthesis

    Outline

    Cellulose is an essential material for keeping intestine peristalsis without producing energy, as prebiotics, feeding vegetarian bacteria flora (including Bacteroides, whose appropriate amount has proved important to prevent obesity[1]) of intestine as well. Thus, cellulose help people keep slim and healthy.

    The developing device aims at transforming glucose into cellulose, thus producing cellulose as well as reducing energy intake. To achieve this goal, we cloned genes of enzymes responding to cellulose synthesis from the Escherichia coli str. DH5α, constructing functional expressional elements with these genes respectively downstream of promoter activated by glucose. In this way, cellulose synthetase complex is built artificially under regulation of glucose, repressed under low concentration of glucose and activated under high concentration of glucose.

    In the future, this device can be integrated to the assembled “E. coslim”, activated when excess glucose is sensed in intestine, converting to cellulose.

    The same as device I (fatty acid metabolism), on one hand,we divide our work into two parallel sections. “Function” section includes a series of molecular biological manipulation on four genes of the cellulose synthetase complex and another two genes responding to producesubstrates for cellulose synthesis. On the other hand, the design, construction and function tests of glucose-activated promoter belong to “regulation” section.

    Description

    Genes to be Cloned

    4 genes, bcsA, bcsB, bcsZ and bcsC,from the rdar morphotype bacterium,are involved in cellulose biosynthesis.

    • BcsA is considered to be the catalytic subunit
    • BcsB can be activated the soon it binds to c-di-GMP
    • BcsZ encodes endo-1,4-D-glucanase which belongs to glycosyl hydrolase family Ⅷ. Activation of BcsZ is required for optimal synthesis and membrane translocation of cellulose
    • Although bcsC is transcribed constitutively, cellulose synthesis occurs only in the circumstances of AdrA
    • AdrA ,a diguanylate cyclase (DGC), cyclizestwo GTPs into c-di-GMP. In turn, the activity of cellulose synthase can be increased when binds to c-di-GMP. For more information of c-di-GMP, click Here
    • GalU catalyzes the addition of UTP to α-D-glucose 1-phosphate to yield UDP-D-glucose, which is the substrate for cellulose synthase complex
    • GalF is a predicted subunit of a GalU/GalF protein complex involved in colanic acid building blocks biosynthesis

    Indirect Regulation Pathway Design

    In a cell, total amount of ATP, ADP and AMP remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.

    We embed gene cI of lambda phage downstream promoter PcstA (BBa_K118011) activated by the binding of CRP, and genes of cellulose synthesis respectively downstream the promoter BBa_R0051 repressed by protein cI. In this way ,we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as supposed, cellulose production will be increased following the elevation of glucose concentration, and vice versa. For more information, click Here.

    Direct Regulation Pathway Design

    Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we modified a constitutive promoter (BBa_J23119) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on Standard), but we shall focus on the design itself now.

    We designed promoter Pcar(BBa_K861171) based on promoter BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region. Since steric hindrance of CRP dimer blocks the function of -10 region, genes downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results show, promoter Pcar works as we expect. For more information, please click Here.

    Progress

    Clone of genes

    As for the genes that we cloned, there is no difference between E. Coli str. K12 MG1655 and more available DH5α.we purified and amplified these genes from genome of Escherichia coli str. DH5α?using PCR. The primers contain standard restriction enzyme cutting sites. The sequences of the primers used are as below:

    • bcsA Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG
      Sense CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG
    • bcsB Antisense CCTGCAGTACTAGTATTACTCGTTATCCGGGTTAAGAC
      Sense CGAATTCTTCTAGAGATGAAAAGAAAACTATTCTGGATTTG
    • bcsZ Antisense CCTGCAGTACTAGTATTAGTGTGAATTTGCGCATTCCTGG
      Sense CGAATTCTTCTAGAGATGAATGTGTTGCGTAGTGGAATCG
    • bcsC Antisense CCTGCAGTACTAGTATTACCAGTCGGCGTAAGGTATCA
      Sense CGAATTCTTCTAGAGATGCGCAAATTCACACTAAACATATTC
    • galF Antisense CCTGCAGTACTAGTATTATTCGCTTAACAGCTTCTCG
      Sense CGAATTCTTCTAGAGATGACGAATTTAAAAGCAGTTATACC
    • galU Antisense CCTGCAGTACTAGTATTACTTCTTAATGCCCATCTCTTCT
      Sense CGAATTCTTCTAGAGATGGCTGCCATTAATACGAAAG
    Then the genes were digested with restriction enzymes and assembled to RBS (BBa_B0030) and terminator (BBa_B0024).

    Construction of the plasmid expressing cellulose synthetase controlled by promoter we designed

    All coding sequences were assembled to RBS and terminator, afterwards, they were embedded downstream the promoter Pcar, which can be activated at high glucose concentration. If you want to know it for details, please click Here.
    The biobricks constructed were showed as bellow:


    All new composite parts mentioned above were transformed to competent cells of Escherichia coli str. DH5α. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.

    Detection of Cellulose Synthesis

    To detect the cellulose synthesis, we used cellulase to degrade cellulose in the cell culture. Then total reducing sugar in the culture was measured. So the difference of total reducing sugar between culture before and after treated with cellulase represents the total cellulose synthetised by the cell. For detailed information, please click Here.

    Results

    Clone of genes

    The gene bcsA is 2619bp, bcsB is 2340bp, bcsZ is 1107 bp, bcsC is 3474bp, galU is 909bp and galF is 894 bp. After PCR amplification, DNA fragments were examined by agarose gel electrophoresis.All genes proved correct. Then the genes were digested with restriction enzymes and embedded into plasmid backbone pSB1A2. To confirm the accuracy of sequences, positive clones were sent for sequencing after transformation. And the results showed that no mutation existed in genes.

    Detection of Cellulose Synthesis

    aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
    aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
    aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
    aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
    aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
    aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
    aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa