Team:University College London/LabBook/Week9

From 2012.igem.org

(Difference between revisions)
(9-3)
(9-4)
Line 271: Line 271:
</html>
</html>
-
== 9-4==
+
== Thursday 9.8.12 ==
 +
 
 +
'''Aim:''' To check the selectivity of our antibiotic stocks. After growth on agar plates, our transformations frequently fail to grow after inoculation into falcons. This has led us to consider the possibility that the selection has not been strong enough, leading to the growth of untransformed cells.  Today we will set up the agar plates using the stocks we wish to test.
 +
 
 +
'''Method:'''
 +
Making plates
 +
 
 +
'''Step?:''' The table below indicates the plates that were made with each antibiotic. NB// we have several eppendorf stocks of antibiotics; the plate was labelled according to the eppendorf stock it came from. This is intended to identify any of our stocks which may not be of sufficient quality to create a selective agar.
 +
 
 +
{| class="wikitable"
 +
|-
 +
! Antibiotic Stock !! Presumed Concentration
 +
|-
 +
| Kanamycin 06 ||
 +
|-
 +
| Tetracycline 02 ||
 +
|-
 +
| Tetracycline 09||
 +
|-
 +
| Ampicillin 01 || 50ug/ml
 +
|-
 +
| Ampicillin 02|| 50ug/ml
 +
|-
 +
| Ampicillin 03 || 50ug/ml
 +
|-
 +
| Ampicillin 04 || 50ug/ml
 +
|}
 +
 
 +
 
 +
== Friday 10.8.12 ==
 +
 
 +
 
 +
'''Aim:''' To set up our samples on the plates made yesterday
 +
 
 +
'''Method:''' the plates from yesterday have been split into half (in order to prevent wasting resources). Each side is being treated as a separate sample.
 +
 
 +
Step?: The following table summarises the type of plates and their contents. Top10, W3110 and pTopDsh have no antibiotic resistance, and so they are our negative controls – there should be no growth except on drug-free agar.
 +
 
 +
 
<html>
<html>
</div><div class="experiment"></div><img id="9-5" src="http://2012.igem.org/wiki/images/6/6a/Ucl2012-labbook-graph9-5.png" /><div class="experimentContent">
</div><div class="experiment"></div><img id="9-5" src="http://2012.igem.org/wiki/images/6/6a/Ucl2012-labbook-graph9-5.png" /><div class="experimentContent">
</html>
</html>
 +
== 9-5==
== 9-5==
<html>
<html>

Revision as of 10:44, 21 August 2012

Contents

Monday 6.7.12

Aim: Inoculate the Plates that were transformed on Thursday. On Thursday we began Expt 8.5 by transforming the BioBricks, and our results on Friday indicated there was growth for all. (However, the negative control was contaminated, so we will have to be careful to assess the analytical restriction digest for correct products). The table below describes the BioBricks that were used:

The two constitutive promoters were used because we were never able to detect our previous constitutive promoter BBa_J23119 (Expt 7.3) and our 3A ligation of BBa_J23119 and BBa_B0034 failed (Expt 8.4). This does not necessarily indicate our transformation of BBa_J23119 has failed, but we decided to transform several more in case. The RBS promoter BBa_B0030 was transformed for the same reason. The Gas Vesicle Cluster was transformed because all previous attempts have failed.


Method


Picking Colonies Protocol
Step 1 – Creating culture media: In a sterile environment, set up X numbers of falcons, each with 5mls of media.


Step 2 - Inoculating Colonies into a Selective Broth:: Add Yul of antibiotic to reach desired antibiotic concentration.


(For Ampicillin this is 50ug/ml, For Kanamycin it is 25ug/ml, for Tetracycline it is 15ug/ml, and for Chloramphenicol it is 25ug/ml)


Step 4 – Selecting a Colony: Select a clear, isolated colony and using an inoculation hoop scoop up a colony onto the tip. Deposit in the falcon tube


Step 5 - Culture: Culture your falcon tubes overnight at a temperature of 37 oC. Leave for no longer than 16 hours.

Step 2 – Inoculating Colonies into a Selective Broth: The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.

Samples Volume Inoculated Broth (ml) Antibiotic (ug/ml)
BioBrick BBa_J23100 10ul Lysogeny Broth (5) Ampicillin(50ug/ml)
90ul
BBa_J23106 10ul
90ul
BBa_B0030 10ul
90ul
BBa_I750016 10ul
90ul

Tuesday 7

Aim: Results from Colony Picking

ResultsThe table below indicates there was growth for all BioBricks.

Biobrick Growth
1750016 sample 1 No Growth
1750016 sample 2 No Growth
1750016 sample 3 No Growth
B0030 sample 1 No Growth
B0030 sample 2 No Growth
B0030 sample 3 No Growth
J23100 sample 1 No Growth
J23100 sample 2 No Growth
J23100 sample 3 No Growth
J23106 sample 1 Growth
J23106 sample 1 Growth
J23106 sample 1 Growth

Conclusion: We are unsure why we have failed to get colonies for many of the BioBricks. Again, we are considering the possibility that our agar is not selective enough. Initially we thought this may be due to adding Antibiotic while the agar is too hot, leading to degradation of the sample. However this has been corrected in the protocol, but the problem is persisting. Instead we are considering running a troubleshoot by testing the selectivity of the various eppendorfs of antibiotic stocks we made at the beginning of the summer. If any show less selectivity then we can stop using them. This will be considered for later in the week. Meanwhile, we can miniprep and nanodrop BBa_J23106 (strong constitutive promoter)

Miniprep Protocol 1 (ANACHEM)

Step 1 - Pellet Cells: Pellet 1.5-5ml bacterial culture containing the plasmid by centrifugation g = 6000

Time = 2 min

Temperature = (15-25oC)

Step 2 - Resuspend Cells: Add 250ul S1 to the pellet and resuspend the cells completely by vortexing or pipetting. Transfer the suspension to a clean 1.5ml microcentrifuge tube.

Step 3 - Puncturing Cell Membrane: Add 250ul S2 gently mix by inverting the tube 4-6 times to obtain a clear lysate. Incubate on ice or at room temperature for NOT longer than 5 min.

Step 4 - Neutralising S2: Add 400ul Buffer NB and gently mix by inverting the tube 6-10 times, until a white precipitate forms.

Step 5 - Centrifuge:

g: 14000

Time:10 minutes

Temperature: (15-25oC)

Step 6 - Centrifuge: Transfer the supernatant into a column assembled in a clean collection tube (provided. Centrifuge:

g = 10,000

Time: 1 minute

Temperature: (15-25oC)

Step 7 - Wash Column: Discard the flow-through and wash the spin column by adding 700ul of Wash Buffer. Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 8 - Remove residual ethanol: Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 9 - Elute DNA: Place the column into a clean microcentrifuge tube. Add 50-100ul of Elution Buffer, TE buffer or sterile water directly onto column membrane and stand for 1 min. Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 10 - Storage: Store DNA at 4oC or -20oC

Nanodrop Protocol

Software ND-1000 Model:

Step 1: Initialise the spectrophotometer by pipetting 1 µ of clean water onto lower optic surface, lowering the lever arm and selecting ‘initialise’ in the ND-1000 software

Step 2: Wipe and add elution buffer as negative control. Click blank in ND-1000 software

Step 3: Wipe and add 1 µl sample

Step 4: On the software set lambda to 260nm

Step 5: Lower the lever arm and click measure in ND-1000 software

Step 6: Take readings for concentration and purity

Step 7: Once measurement complete, wipe surface


?What happened next?


Monday 6.7.12

Aim: Repeat the inoculation of the ligation products (J23119 + B0034) done last week. Innoculation is only done for the (J23119 + B0034), but not for the (starvation promoter + B0034) because that ligation did not transform.

Method

Picking Colonies Protocol
Step 1 – Creating culture media: In a sterile environment, set up X numbers of falcons, each with 5mls of media.


Step 2 - Inoculating Colonies into a Selective Broth:: Add Yul of antibiotic to reach desired antibiotic concentration.


(For Ampicillin this is 50ug/ml, For Kanamycin it is 25ug/ml, for Tetracycline it is 15ug/ml, and for Chloramphenicol it is 25ug/ml)


Step 4 – Selecting a Colony: Select a clear, isolated colony and using an inoculation hoop scoop up a colony onto the tip. Deposit in the falcon tube


Step 5 - Culture: Culture your falcon tubes overnight at a temperature of 37 oC. Leave for no longer than 16 hours.

Step 2 – Inoculating Colonies into a Selective Broth: The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.

Ligation No. innoculations Broth Antibiotic
J23119 + B0034 3

Tuesday 7

Aim: Check results of Colony Picking

Results: The table below indicates whether there was growth for the BioBricks ligations

Ligation Growth/No Growth
J23119+B0034 sample 1 Growth
J23119+B0034 sample 2 Growth
J23119+B0034 sample 3 Growth

Conclusion: We can proceed now to miniprep the samples, and run them on a gel to test the presence of a band

Method:

Miniprep Protocol 1 (ANACHEM)

Step 1 - Pellet Cells: Pellet 1.5-5ml bacterial culture containing the plasmid by centrifugation g = 6000

Time = 2 min

Temperature = (15-25oC)

Step 2 - Resuspend Cells: Add 250ul S1 to the pellet and resuspend the cells completely by vortexing or pipetting. Transfer the suspension to a clean 1.5ml microcentrifuge tube.

Step 3 - Puncturing Cell Membrane: Add 250ul S2 gently mix by inverting the tube 4-6 times to obtain a clear lysate. Incubate on ice or at room temperature for NOT longer than 5 min.

Step 4 - Neutralising S2: Add 400ul Buffer NB and gently mix by inverting the tube 6-10 times, until a white precipitate forms.

Step 5 - Centrifuge:

g: 14000

Time:10 minutes

Temperature: (15-25oC)

Step 6 - Centrifuge: Transfer the supernatant into a column assembled in a clean collection tube (provided. Centrifuge:

g = 10,000

Time: 1 minute

Temperature: (15-25oC)

Step 7 - Wash Column: Discard the flow-through and wash the spin column by adding 700ul of Wash Buffer. Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 8 - Remove residual ethanol: Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 9 - Elute DNA: Place the column into a clean microcentrifuge tube. Add 50-100ul of Elution Buffer, TE buffer or sterile water directly onto column membrane and stand for 1 min. Centrifuge:

g - 10,000

Time - 1 minute

Temperature: (15-25oC)

Step 10 - Storage: Store DNA at 4oC or -20oC

Electrophoresis Protocol

Preparing the Gel

Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water

Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.

Step 3: Cool solution under running cold water.

Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)

Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles

Running a gel

Step 6: Add 1 part loading buffer to five parts of loading sample

Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm

Step 8: Add 5ul of DNA ladder to lane 1

Step 9: Add samples to the remaining wells

Step 10: Run at 100 volts for 1hour and 15 minutes

Imaging the Gel

Step 11: Place gel in GelDoc 2000 chamber

Step 12: Turn GelDoc 2000 chamber on 

Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire

Step 14: Alter the exposure/settings to give a clear image.

TAE - Tris-acetate-EDTA

EDTA - ethylenediamine tetraacetic acid

?What do we conclude from the gel?

Monday 8.8.12

Aim: To repeat Expt 8.2, where we undertook PCR amplification of PSB1A3, PSB1C3, PSB1K3 for 3A assembly. While we achieved bands of the correct size for all three plasmid backbones in Expt 8.2, the nanodrop concentration for PSB1A3 and PSB1C3 was very low (unusable). Therefore we decided to repeat the PCR. As the concentration of PSB1K3 was not particularly high, we decided to repeat this again also.


Method: PCR protocol ??

Electrophoresis Protocol

Preparing the Gel

Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water

Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.

Step 3: Cool solution under running cold water.

Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)

Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles

Running a gel

Step 6: Add 1 part loading buffer to five parts of loading sample

Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm

Step 8: Add 5ul of DNA ladder to lane 1

Step 9: Add samples to the remaining wells

Step 10: Run at 100 volts for 1hour and 15 minutes

Imaging the Gel

Step 11: Place gel in GelDoc 2000 chamber

Step 12: Turn GelDoc 2000 chamber on 

Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire

Step 14: Alter the exposure/settings to give a clear image.

TAE - Tris-acetate-EDTA

EDTA - ethylenediamine tetraacetic acid

Conclusion: There were no products on the gel. We feel the poor nanodrop results from Expt 8.2, and the poor electrophoresis results from this Expt may be a result of the choice of polymerase. Our supervisors recommended we try Phusion Polymerase, which we will attempt tomorrow.


Tuesday 9.8.12

Aim: To repeat PCR with Phusion Polymerase to amplify the three plasmid backbones. As we had more confidence that this PCR reaction would work, we included an extra plasmid, pSB1T3, also required for ligation.

Method PCR

Electrophoresis Protocol

Preparing the Gel

Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water

Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.

Step 3: Cool solution under running cold water.

Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)

Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles

Running a gel

Step 6: Add 1 part loading buffer to five parts of loading sample

Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm

Step 8: Add 5ul of DNA ladder to lane 1

Step 9: Add samples to the remaining wells

Step 10: Run at 100 volts for 1hour and 15 minutes

Imaging the Gel

Step 11: Place gel in GelDoc 2000 chamber

Step 12: Turn GelDoc 2000 chamber on 

Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire

Step 14: Alter the exposure/settings to give a clear image.

TAE - Tris-acetate-EDTA

EDTA - ethylenediamine tetraacetic acid

Conclusion: Bands were detected, for all but one plasmid backbone (at the right region) INSERT PIC


Thursday 10.8.12

Aim: To carry out nanodrop for the PCR reaction of plasmids with phusion polymerase

Method

Nanodrop Protocol

Software ND-1000 Model:

Step 1: Initialise the spectrophotometer by pipetting 1 µ of clean water onto lower optic surface, lowering the lever arm and selecting ‘initialise’ in the ND-1000 software

Step 2: Wipe and add elution buffer as negative control. Click blank in ND-1000 software

Step 3: Wipe and add 1 µl sample

Step 4: On the software set lambda to 260nm

Step 5: Lower the lever arm and click measure in ND-1000 software

Step 6: Take readings for concentration and purity

Step 7: Once measurement complete, wipe surface

Plasmid λ260 λ 280
PSB1A3 (ng/μl) 45.7 45.4
PSB1C3 (ng/μl) 52.2 48.0
PSB1K3 (ng/μl) 57.9 59.4

Conclusion: The results of the nanodrop indicate that we have usable concentrations of the plasmids, though they are not particularly high. However, we can attempt to use these for 3A ligation.

Wednesday 8.8.12

Aim: To extract the Laccase gene for the Degradation module and the irrE gene for the Salt Tolerance module.


Method:

Protocol: Extracting Colony DNA (irrE) - in notes???

Protocol: Genomic Extraction

Protocol: Primer Design

Step?: The design of the primers is shown by the table below


Protocol: PCR

Step?: The table below gives the identity of the primers used for each reaction.

DNA Extracted Function Module Primer Pair Primer Primer Sequence
BBa_K729002 Laccase GeneDegradation LR1/LF1 LR1 gaatacggtctttttataccg
LF1 gaaataactatgcaacgtcg
REVLF2/LFTW0 REVLF2 gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg
LFTW0 gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg
BBa_K729001 irrESalt Tolerance STF1/ST2RSTF1 atggggccaaaagctaaagctgaagcc
ST2R tcactgtgcagcgtcctgcg
STF3/ST4R STF3 gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc
ST4R gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg


Thursday 9.8.12

Aim: Run a gel for the PCR reaction of irrE and Laccase carried out yesterday.

Method:

Electrophoresis Protocol

Preparing the Gel

Step 1: Within a conical flask, add 3ml 50X TAE, 1.5g Agarose, and 150ml RO water

Step 2: Heat for 1 min in microwave. Swirl. Heat again for 30s. If solution is clear stop. Else repeat.

Step 3: Cool solution under running cold water.

Step 4: Add 20ul ethidium bromide (normal concentration of EB solution is 500ug/ul)

Step 5: Pour into a sealed casting tray in a slow steady stream, ensuring there are no bubbles

Running a gel

Step 6: Add 1 part loading buffer to five parts of loading sample

Step 7: Position the gel in the tank and add TAE buffer, enough to cover the gel by several mm

Step 8: Add 5ul of DNA ladder to lane 1

Step 9: Add samples to the remaining wells

Step 10: Run at 100 volts for 1hour and 15 minutes

Imaging the Gel

Step 11: Place gel in GelDoc 2000 chamber

Step 12: Turn GelDoc 2000 chamber on 

Step 13: From computer: Quantity One > Scanner > Gel_Doc_Xr>Manuqal Acquire

Step 14: Alter the exposure/settings to give a clear image.

TAE - Tris-acetate-EDTA

EDTA - ethylenediamine tetraacetic acid

Results: The image belows shows that the gel failed to produce any products of the correct size. We feel the best explanation of this is that there was human error somewhere along the lines – leading to a mix up of the samples.


Thursday 9.8.12

Aim: inoculation of marine bacterium. We aim to grow up a stock of the marine bacterium Oceanibulbus indolifex, which has been selected as one of the chassis we wish to investigate.

Method Oceanibulbus was ordered from NCMB and recieved as a liquid stock. Step 1: Prepare agar plates Step 2: Dip an inoculation loop into the liquid stock of bacteria and spread over the surface of the agar Step 3: Leave the bacteria to grow overnight or over the weekend.


Friday 10.8.12

Aim: Check the results of O.indolifex culture

Results: The image below indicates there was growth for both inoculations of O.indolifex.


Thursday 9.8.12

Aim: To check the selectivity of our antibiotic stocks. After growth on agar plates, our transformations frequently fail to grow after inoculation into falcons. This has led us to consider the possibility that the selection has not been strong enough, leading to the growth of untransformed cells. Today we will set up the agar plates using the stocks we wish to test.

Method: Making plates

Step?: The table below indicates the plates that were made with each antibiotic. NB// we have several eppendorf stocks of antibiotics; the plate was labelled according to the eppendorf stock it came from. This is intended to identify any of our stocks which may not be of sufficient quality to create a selective agar.

Antibiotic Stock Presumed Concentration
Kanamycin 06
Tetracycline 02
Tetracycline 09
Ampicillin 01 50ug/ml
Ampicillin 02 50ug/ml
Ampicillin 03 50ug/ml
Ampicillin 04 50ug/ml


Friday 10.8.12

Aim: To set up our samples on the plates made yesterday

Method: the plates from yesterday have been split into half (in order to prevent wasting resources). Each side is being treated as a separate sample.

Step?: The following table summarises the type of plates and their contents. Top10, W3110 and pTopDsh have no antibiotic resistance, and so they are our negative controls – there should be no growth except on drug-free agar.


9-5

9-6