Team:Trieste/parts

From 2012.igem.org

(Difference between revisions)
 
(6 intermediate revisions not shown)
Line 9: Line 9:
             <div id="box_main"> <!-- start box_main -->
             <div id="box_main"> <!-- start box_main -->
                 <div class="box_contenuti">
                 <div class="box_contenuti">
-
<h2>List of the submitted Parts </h2>   
+
<h2>List of the Submitted Parts </h2>   
<h3>Click on the code of each part to have more information about the Biobrick, its construction, the results obtained and the relative link to the Registry.</h3>  
<h3>Click on the code of each part to have more information about the Biobrick, its construction, the results obtained and the relative link to the Registry.</h3>  
</br>
</br>
Line 101: Line 101:
<thead>
<thead>
<tr>
<tr>
-
<th>Name</th>
+
<th> Name</th>
-
<th>Seq 5'--> 3'</th>
+
<th> Seq 5'--> 3'</th>
-
<th>Notes</th>
+
<th> PCR Notes</th>
</tr>
</tr>
</thead>
</thead>
Line 116: Line 116:
<tr><td>T5EcoFw</td>          <td>CGAATTCATGAGATCTAAATCATAAAAAATTTATTTGCT</td>  <td>95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr>
<tr><td>T5EcoFw</td>          <td>CGAATTCATGAGATCTAAATCATAAAAAATTTATTTGCT</td>  <td>95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr>
<tr><td>T5XhoRev</td>        <td>TCTCGAGTTAGGATCCTTTCTCCTCTTTCTCTAGTAATA</td>  <td>95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr>
<tr><td>T5XhoRev</td>        <td>TCTCGAGTTAGGATCCTTTCTCCTCTTTCTCTAGTAATA</td>  <td>95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr>
 +
              <tr><td>Muta1/2FW</td>        <td>ATACTACGACGGTAAATGGT</td>  <td>95° 5' | 30x (93° 30'' | 45° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr>
 +
              <tr><td>Muta1/2REV</td>        <td>TACATCAGTATCGGTAGCAT</td>  <td>95° 5' | 30x (93° 30'' | 45° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr>
 +
              <tr><td>Muta7/8FW</td>        <td>GACCAAGCGATAACCGGATG</td>  <td>95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr>
 +
              <tr><td>Muta7/8REV</td>        <td>GTGAGATGATGGCCACGATT</td>  <td>95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr>
 +
              <tr><td>Muta9/10FW</td>      <td>GCGAGGTAACCTCGAACATG</td>  <td>95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr>
 +
              <tr><td>Muta9/10REV</td>      <td>CGGCGTATCGATAATTCACG</td>  <td>95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞</td></tr>
</tbody>
</tbody>
</table>
</table>
Line 124: Line 130:
             <div id="box_right"> <!-- start box_right -->
             <div id="box_right"> <!-- start box_right -->
             <ul id="sub_menu"><strong>
             <ul id="sub_menu"><strong>
-
                 <li><a href="https://2012.igem.org/Team:Trieste/parts">Overwiev</a></li>
+
                 <li class="select"><a href="https://2012.igem.org/Team:Trieste/parts">Overwiev</a></li>
                 <li><a href="https://2012.igem.org/Team:Trieste/parts/1">BBa_K875001 - Cumate Op</a></li>
                 <li><a href="https://2012.igem.org/Team:Trieste/parts/1">BBa_K875001 - Cumate Op</a></li>
                 <li><a href="https://2012.igem.org/Team:Trieste/parts/2">BBa_K875002 - Lac OP</a></li>
                 <li><a href="https://2012.igem.org/Team:Trieste/parts/2">BBa_K875002 - Lac OP</a></li>
Line 145: Line 151:
                     Follow us also:
                     Follow us also:
<a href="https://www.facebook.com/IGEMUNITS?ref=ts" target="_blank"><img src="https://static.igem.org/mediawiki/2012/f/f4/Ico_fb.png" alt="Facebook" class="fb" /></a>
<a href="https://www.facebook.com/IGEMUNITS?ref=ts" target="_blank"><img src="https://static.igem.org/mediawiki/2012/f/f4/Ico_fb.png" alt="Facebook" class="fb" /></a>
-
                         <a href="https://twitter.com/igemunits" target="_blank"><img src="https://static.igem.org/mediawiki/2012/2/21/Ico_twitter.png" alt="twitter" class="tw" /></a>
+
                         <a href="https://twitter.com/iGEMTrieste" target="_blank"><img src="https://static.igem.org/mediawiki/2012/2/21/Ico_twitter.png" alt="twitter" class="tw" /></a>
                     </div>
                     </div>
                 </div>
                 </div>

Latest revision as of 12:03, 26 October 2012

Parts Overview

More

List of the Submitted Parts

Click on the code of each part to have more information about the Biobrick, its construction, the results obtained and the relative link to the Registry.



Name Type Description
BBa_K875001 Regulatory T5 Cumate Operator
BBa_K875002 Regulatory T5 Lac Operator
BBa_K875003 Composit CymR
BBa_K875004 Composit T5LacO-LPP-OmpA-scFv
BBa_K875005 Composit T5LacO-LPP-OmpA-SIP
BBa_K875006 Composit T5LacO-LPP-PelB-scFv
BBa_K875007 Composit T5 LacO-LPP-PelB-SIP
BBa_K875008 Coding IPTG inducible Tse2 toxin
BBa_K875009 Coding LL 37 - Cathelicidin
BBa_K875020 Composit β-Glucosidase

Primers

Name Seq 5'--> 3' PCR Notes
Vr ATTACCGCCTTTGAGTGAGC 95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞
Vf2 TGCCACCTGACGTCTAAGAA 95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞
GlmSTn7Fw GCATGTGGAAGAGGTGATTG 95° 5' | 30x (93° 30'' | 53.8° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
GlmSTn7Rev ACTTTATTGTTCGCCCACA 95° 5' | 30x (93° 30'' | 53.8° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
B0015XhoRev ACTCGAGATTACTAGTTATAAACGCAGAAAGGCCCACCC 95° 5' | 30x (93° 30'' | 58° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
B0015EcoFw CGAATTCATCAGATCTCCAGGCATCAAATAAAACGAAAGG 95° 5' | 30x (93° 30'' |58° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
T5EcoFw CGAATTCATGAGATCTAAATCATAAAAAATTTATTTGCT 95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
T5XhoRev TCTCGAGTTAGGATCCTTTCTCCTCTTTCTCTAGTAATA 95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
Muta1/2FW ATACTACGACGGTAAATGGT 95° 5' | 30x (93° 30'' | 45° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
Muta1/2REV TACATCAGTATCGGTAGCAT 95° 5' | 30x (93° 30'' | 45° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
Muta7/8FW GACCAAGCGATAACCGGATG 95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
Muta7/8REV GTGAGATGATGGCCACGATT 95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
Muta9/10FW GCGAGGTAACCTCGAACATG 95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
Muta9/10REV CGGCGTATCGATAATTCACG 95° 5' | 30x (93° 30'' | 50° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞
Università degli studi di Trieste ICGEB Illy Fondazione Cassa di Risparmio
iGEM 2012 iGEM 2012 iGEM 2012 iGEM 2012 iGEM 2012 iGEM 2012
HTML Hit Counter