Team:TU Munich/Notebook/Labjournal

From 2012.igem.org

(Difference between revisions)
(Monday, August 20st)
(Colony PCR)
Line 15,336: Line 15,336:
'''Aim:'''
'''Aim:'''
 +
 +
 +
*'''Citrus''': 8 clones of PCR43/p175 were picked.
 +
* '''Lavendula''': 8 clones of PCR58/p133 (5 clones of transformation of August 17th, 3 clones of August 8th) and PCR58/p175 (8 of transformation of August 17th) were picked
 +
* plasmid DNA of PCR2/p133 clone 4 as positive control
 +
 +
 +
'''Citrus in pSB1C3''' (PCR42/p133)
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl
 +
|5x OneTaq Standard Reaction Buffer
 +
|-
 +
|0.5 µl
 +
|10 mM dNTPs
 +
|-
 +
|0.5 µl
 +
|10 µM O68
 +
|-
 +
|0.5 µl
 +
|10 µM O30
 +
|-
 +
|0.13 µl
 +
|OneTaq Hot Start DNA Polymerase
 +
|-
 +
|18.37 µl
 +
|dd water
 +
|-
 +
|25 µL
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Citrus in pYES''' (PCR42/p175)
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl
 +
|5x OneTaq Standard Reaction Buffer
 +
|-
 +
|0.5 µl
 +
|10 mM dNTPs
 +
|-
 +
|0.5 µl
 +
|10 µM O8
 +
|-
 +
|0.5 µl
 +
|10 µM O30
 +
|-
 +
|0.13 µl
 +
|OneTaq Hot Start DNA Polymerase
 +
|-
 +
|18.37 µl
 +
|dd water
 +
|-
 +
|25 µL
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Lavendula in pSB1C3''' (PCR56/p133)
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl
 +
|5x OneTaq Standard Reaction Buffer
 +
|-
 +
|0.5 µl
 +
|10 mM dNTPs
 +
|-
 +
|0.5 µl
 +
|10 µM O68
 +
|-
 +
|0.5 µl
 +
|10 µM O37
 +
|-
 +
|0.13 µl
 +
|OneTaq Hot Start DNA Polymerase
 +
|-
 +
|18.37 µl
 +
|dd water
 +
|-
 +
|25 µL
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Lavendula in pYES''' (PCR56/p175)
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl
 +
|5x OneTaq Standard Reaction Buffer
 +
|-
 +
|0.5 µl
 +
|10 mM dNTPs
 +
|-
 +
|0.5 µl
 +
|10 µM O8
 +
|-
 +
|0.5 µl
 +
|10 µM O37
 +
|-
 +
|0.13 µl
 +
|OneTaq Hot Start DNA Polymerase
 +
|-
 +
|18.37 µl
 +
|dd water
 +
|-
 +
|25 µL
 +
|'''TOTAL'''
 +
|}
 +
 +
* PCR program:
 +
{|cellspacing="0" border="1"
 +
|Initial denaturation
 +
|94 °C
 +
|10 min
 +
|-
 +
|30 cycles
 +
|95 °C
 +
|30 s
 +
|-
 +
|
 +
|50 °C
 +
|30 s
 +
|-
 +
|
 +
|68 °C
 +
|1 min 55 sec
 +
|-
 +
|Final extension
 +
|68 °C
 +
|5 min
 +
|-
 +
|Hold
 +
|4 °C
 +
|
 +
|}
 +
 +
 +
 +
 +
[[File:TUM12_LS_analytcolonyPCR4.png]]
 +
[[File:TUM12_LS_analytcolonyPCR5.png]]
 +
[[File:TUM12_LS_analytcolonyPCR6.png]]
 +
</div>
</div>
<div class="limonene">
<div class="limonene">
 +
=== Miniprep of ligation of 17th August===
=== Miniprep of ligation of 17th August===

Revision as of 10:20, 22 August 2012


Display subprojects:
Vector Design
Limonene
Coumaryl
Thaumatin
Caffeine
Constituve promoter
Light-switchable promoter

You can also click on individual experiments to show/hide them
Jump to:
Week 1: 13.6-17.6
Week 2: 18.6-24.6
Week 3: 25.6-1.7
Week 4: 2.7-8.7
Week 5: 9.7-15.7
Week 6: 16.7-22.7
Week 7: 23.7-29.7
Week 8: 30.7-5.8
Week 9: 6.8-12.8
Week 10: 13.8-19.8
1 kbp GeneRuler:

100 bp GeneRuler:

PageRuler Plus:

Contents

Labjournal


June 2012

Wednesday, June 13th

Exchange of the Multiple Cloning Site of pYES2

Investigator: Saskia, Daniela

Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2

Hybridisation of the primers O1 with O2 and O3 with O4

Primer preparation:

  • centrifugation
  • dilution in the denoted quantity in bidest. water (concentration = 100 pmol/µl)
  • centrifugation

Hybridisation:

volume reagent
34 µl ddH2O
5 µl PNK-buffer
2.5 µl Primer O1
2.5 µl Primer O2
1 µl PNK (10mM)
volume reagent
34 µl ddH2O
5 µl PNK-buffer
2.5 µl Primer O3
2.5 µl Primer O4
1 µl PNK (10mM)
  • 30 min 37 °C
  • 10 min 80 °C
  • put the Thermo Block with the mixture in a styrofoam box and let it cool down over night

Thursday, June 14th

Exchange of the Multiple Cloning Site of pYES2

Investigator: Saskia, Daniela

Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2

Digestion of pYES2 with HindIII and XbaI


volume reagent
12 µl Miniprep (pYES2 SH 1.7.3 with a concentration of 87.8 ng/µl)
5 µl NEB2
5 µl 10x BSA
2 µl XbaI (10 U/µl)
2 µl HinIII (10U/µl)
24 µl ddH2O

Incubation: 37 °C, 1.75 h


DNA preparative gel electrophoresis

  • gel: 1% with LMP-agarose
  • band 1: 10 µl DNA ladder (1kb)
  • band 2: 50 µl probe + 5 µl loading dye
  • 70 V, 90 min

TUM12 pYES2 verdaut.jpg

Gelextration

  • cut the bands (5.7-5.8 kb) and split it in two eppis
    • m1=165.3 mg
    • m2=211.1 mg
  • QIAquick Gel Extractrion Kit
    • eppi1: 495.9 µl QG-buffer
    • eppi2: 633.3 µl QG-buffer
    • step 6 was left out
    • step 9: 30µl buffer, 4 min incubation
  • the product was named P5

Transformation of plasmids from Prof. Schwab in E.coli XL-1 Blue

Investigator: Lara, Andrea

Aim of the experiment: Preparation of the plasmids for transformation

Overnight cultures of cells with limonenesynthase-plasmid from Prof. Schwab

  • resuspend 50 µl / 200 µl of competent cells with 50 ml LB medium
  • add 0,1 ml Ampicillin (100 µg/ml) and 0,28 ml Chloramphenicol (170 µ/ml) for strain 108
  • add 0,07 ml Kanamycin (50 µg/ml) and 0,28 ml Chloramphenicol (170 µ/ml) for strain 106
  • incubate at 37 °C

Friday, June 15th

Exchange of the Multiple Cloning Site of pYES2

Investigator: Saskia, Daniela

Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2

Analytical DNA gel electrophoresis

  • gel: 1.2 %
  • band 1: 10 µl DNA ladder (1kb)
  • band 2: 3 µl pYES2 digested + 7 µl TAE-buffer + 1 µl loading dye
  • band 3: 3 µl O5 + 7 µl TAE-buffer + 1 µl loading dye
  • band 4: 3 µl O6 + 7 µl TAE-buffer + 1 µl loading dye
  • band 5: 10 µl DNA ladder (100 bp)

TUM12 pYES und Primer.jpg

Ligation of Plasmid P5 (pYES2 digested) with the hybridized primers O5 and O6

volume reagent
4 µl pYES2 digested (P5)
1 µl O5
1 µl O6
2 µl T4-ligase buffer (10x)
0,5 µl T4 DNA-ligase
11.5 µl ddH2O

Negative control

volume reagent
4 µl pYES2 digested (P5)
2 µl T4-ligase buffer (10x)
0,5 µl T4 DNA-ligase
13.5 µl ddH2O
  • water bath 16 °C
  • after 3 h a probe for the transformation was taken
  • the rest was ligated over the weekend

Transformation of E. coli with ligated products (P6)

  • competent cells: SHXL1 Blue (by Simon)
  • Transformation with ligation product (P6) and negative control

results:

  • P6 (100 µl): 1 clone
  • P6 (concentrated): 30 clones
  • negative control (100 µl): 0 clones
  • negative control (concentrated): 6 clones

Transformation of plasmids from Prof. Schwab into E.coli XL-1 Blue

Investigator: Andrea

Aim of the experiment: Preparation of the plasmids for transformation

Determination of the concentration with Nano Drop

Sample concentration [ng/µl]
P3 1353
P4 no result
  • the strain 106 culture was not grown satisfying and were incubated for 2 more days

Miniprep of pGex-4T-1 of strain 108 from Prof. Schwab

  • see QIAprep Spin Miniprep Kit
  • stored as P3 (-20 °C)

Sunday, June 17th

Exchange of the Multiple Cloning Site of pYES2

Investigator: Saskia, Daniela

Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2

Picking clones for Miniprep

  • 10 clones of transformed E.coli with P6 were picked
  • medium: 5ml LB with Amp

Monday, June 18th

Exchange of the Multiple Cloning Site of pYES2

Investigator: Saskia, Daniela

Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2

Miniprep of transformed E.coli with P6

  • QIAprepS Spin Miniprep Kit
  • step 3: invert 2-3 times (don't shake to avoid destruction of genomic DNA)
  • the 10 Minipreps were named: P7 - P16


Determination of the concentration with Nano Drop

Sample concentration [ng/µl] 260/280
P7 157.6 2.32
P8 207.3 1.63
P9 171.2 2.02
P10 183.1 1.57
P11 160.4 2.2
P12 179.9 1.75
P13 179.2 2.07
P14 188.3 1.6
P15 166.7 2.05
P16 174.6 2.08

Controll digestion with HindIII XbaI and NgoMIV

  • Samples P7-P16: 2.5 µl
  • Negative controll pYES SH 1.7.3: 2.5 µl
  • Master Mix HindIII and XbaI: 17,5 µl for a 20 µl preparation
volume reagent
3 µl HindIII
3 µl XbaI
24 µl NEB2
24 µl 10x BSA
156 µl ddH2O
  • Master Mix NgoMIV: 17,5 µl for a 20 µl preparation
volume reagent
6 µl NgoMIV
24 µl NEB4
180 µl ddH2O

Incubation: 37 °C, 1.5 h

Analytical gel electrophoresis of P7-P16

  • gel: 1.5 %

gel 1:

  • band 1: 10 µl DNA ladder (1 kb)
  • band 2: 3 µl pYES2 SH 1.7.3 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
  • band 3 - 12: 3 µl P7-P16 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye

TUM12 pYES mit neuer MCS verd mit Xbal und HindIII.jpg

gel 2:

  • band 1: 10 µl DNA ladder (1 kb)
  • band 2: 3 µl pYES2 SH 1.7.3 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
  • band 3 - 12: 3 µl P7-P16 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye

TUM12 pYES mit neuer MCS verd mit NgoMIV.jpg

Tuesday, June 19th

Transformation of BBa_I742111 (Limonenesynthase) into E.coli XL-1 Blue

Investigator: Andrea

Aim of the experiment: Transformation

  • for each Biobrick 100 µl cells were used and pooled together with 2 µl of plasmid DNA
  • Incubation on ice for 30 min
  • 5 min heat shock at 37 °C
  • cells were prefilled with 1 ml of LB-medium and incubated in a cell-culture shaker at 37 °C for 45 min
  • 100 µl of these cell suspension were plated on antibiotic selection plates (Ampicillin)
  • cell suspension was centrifuged at 13000 rpm for 60 s for resuspending the pellet with 100 µl LB and plating also
  • incubation at 37 °C overnight

Wednesday, June 20th

Exchange of the Multiple Cloning Site of pYES2

Investigator: Saskia, Daniela

Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2

Sequencing of P13 and P14: pYES2 with new MCS sequencing primer:

  • 1.6 µM forward primer O9
  • DNA P13 and P14

The Multiple Cloning Site was exchanged successfully!!!

Transformation of BBa_I742111 (Limonenesynthase) into E.coli XL-1 Blue

Investigator: Daniela

Aim of the experiment: Transformation

Picking of Clones

  • 6 clones were picked
  • Incubation at 37 °C in LB + Amp

Thursday, June 21st

Transformation of BBa_I742111 and plasmids from Prof. Schwab into E.coli XL-1 Blue

Investigator: Lara, Andrea

Aim of the experiment: Controll of Transformation


Controll digestion

  • Sample P3
volume reagent
14 µl Plasmid-DNA
0,25 µl NcoI
2 µl Buffer Tango (Fermentas)
0,25 µl HindIII
2 µl Buffer Red (Fermentas)
1,5 µl ddH2O
  • Sample P4
volume reagent
6 µl Plasmid-DNA
0,25 µl EcoRI
2 µl Buffer EcoRI (Fermentas)
0,25 µl NotI
2 µl Buffer Orange (Fermentas)
9,5 µl ddH2O
  • Sample Biobrick-clones
volume reagent
5 µl Plasmid-DNA
0,25 µl EcoRI
2 µl Buffer EcoRI (Fermentas)
0,25 µl PstI
2 µl Buffer Orange (Fermentas)
10,5 µl ddH2O

Analytic Gelelectrophoresis

21.06.12.png

Friday, June 22nd

Transformation of E.coli XL1-Blue with pKS2µHyg-PAL-4Cl-CHS

Investigator: Ingmar, Volker

Aim of the experiment: Plasmid amplification

Operation Sequence:

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells
  • addition of 1 µl of the Plasmid pKS2µHyg-PAL-4Cl-CHS
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Amp-LB-plate
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate

Saturday, June 23rd

Quick Change mutagenis to remove NgoMIV from pYES2

Investigator: Ingmar, Volker

Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.

PCR
Reaction batch

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl Plasmid P7 pYes2_RFC25 MCS 1.1 template
0.5 µl 1:10 dilution of O38 (10 pmol/µL)
0.5 µl 1:10 dilution of O39 (10 pmol/µL)
17 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Ultra II DNA polymerase (2.5 U / µl)

PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 15 95°C 30 sec
55°C 1 min
68°C 6 min
  • The vector resulting from the PCR-product was named pYes2_RFC25 MCS 1.2.
  • Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.

Transformation into E.coli Xl1-Blue Operation Sequence

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells
  • addition of 1 µl of the Plasmid P7 pYes2_RFC25 MCS 1.2
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Amp-LB-plate
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate

Sunday, June 24th

Miniprep of E.coli XL1-Blue with pKS2µHyg-PAL-4Cl-CHS

Investigator: Ingmar, Volker

Aim of the experiment: Plasmid purification

Operation Sequence:

  • A single clone of E.coli XL1-Blue with pKS2µHyg-PAL-4Cl-CHS was picked an transferred to 5 ml LB Amp on saturday evening. Incubation overnight at 37°C 180 rpm.
  • Using a Quiagen kit a miniprep of the overnight culture was done.

Quick Change mutagenis to remove NgoMIV from pYES2

Investigator:´ Ingmar, Volker

Aim of the experiment: Removal of a NgoMIV restriction site in the backbone of pYes2.

Operational sequence:

  • A single clone of E. coli pYes2_RFC25 MCS 1.2 was picked an transferred to 5 ml LB Amp. Incubation overnight at 37°C 180 rpm.

Transformation of 2 Biobricks into E. coli XL1-Blue

Investigator: Jeffery Truong

Aim of the experiment: Transformation of Biobricks into E. coli for plasmid propagation for PCR with new RFC pre- and suffix primer in order to do protein fusions.

  • 2 Biobricks from the distribution kit were used: First, LexA (BBa_K105005, Plate 3 Well 9E) in the pSB1A2 plasmid with ampicillin resistance and second, the heme oxygenase (BBa_I15008, Plate 2 Well 13J) in the pSB2K3 plasmid with kanamycin resistance.
  • 10 µL of autoclaved H2O were added to each well on the distribution kit. The well immediately turned red which means that one does it right.
  • The now resuspended DNA liquids were transferred into a new ERG on ice.
  • CaCL2 competent E. coli XL1-Blue cells from the stock were gently defrezed on ice.
  • For each Biobrick 100 µL cells were used and pooled together with 2 µL of plasmid DNA in a ERG on ice.
  • Incubation on ice for 30 min.
  • 5 min heat shock at 37 °C.
  • Each ERG now is transferred in a new ERG prefilled with 1 mL of LB-medium and incubated in a cell-culture shaker at 37 °C for 45 min.
  • 100 µL of these cell suspension were plated on antibiotic selection plates (Ampicillin for LexA and Kanamycin for heme oxygenase).
  • The rest of the cell suspension is centrifuged at 13000 rpm for 60 s and the supernatant is discarded.
  • The pellet is resuspended with 100 µL for each ERG and is plated on another antibiotic selection plate
  • These 4 plates were put at 37 °C overnight

Monday, June 25th

Miniprep of E. coli XL1-Blue with pYes2_RFC25 MCS 1.2

Investigator: Alois, Martin

Aim of the experiment: proof of successful removal of NgoMIV in the backbone of pYes2

Operation Sequence:

  • Mini prep of pYes2 1.2. The resulting purified DNA is P33.
  • Control digest of pYes2_RFC25 MCS 1.2 and p13 (+ analytical gel electrophoresis: 90 V, 1 h:
*  15 µl ddH20
*   2 µl NEBuffer4
* 0,5 µl NgoMIV
* 2,5 µl pYes2 1.2/p13
* 37°C, 1 h.

Quick Change mutagenis to remove SpeI from pYES2_RFC25 MCS 1.2

Investigator: Ingmar, Volker

Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.

PCR
Reaction batch

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl Plasmid P33 template
0.5 µl 1:10 dilution of O44 (10 pmol/µL)
0.5 µl 1:10 dilution of O45 ((10 pmol/µL)
17 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Ultra II DNA polymerase (2.5 U / µl)

PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 15 95°C 30 sec
55°C 1 min
68°C 6 min
  • The procedure was furthermore applied to P13 and P14.
  • The vector resulting from the PCR-product was named pYes2_RFC25 MCS 1.3.
  • Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.

Transformation into E.coli Xl1-Blue Operation Sequence

  • This operation sequence was applied to the PCR prducts of P33, P13 and P14 respectively.
  • melting of 100 µl Ca-competent E.coli XL1-Blue cells
  • addition of 1 µl of the PCR product
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Amp-LB-plate
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate

Picking of E. coli cells on antibiotic selection plates: pSB1A2 plasmid with BBa_K105005 (LexA) and pSB2K3 plasmid BBa_I15008 (heme oxygenase)

Investigator: Jeffery Truong

Aim of the experiment: Picking colonies from transformed E. coli XL1-Blue, 4x picked for each Biobrick.

  • pSB1A2 plasmid with BBa_K105005 (LexA): Colonies were on both ampicillin selection plates, the one with diluted cell suspension and the one with concentrated E. coli cell suspension. Typical E. coli colony morphology. Picking was performed on the plate with diluted cell suspension.
  • pSB2K3 plasmid BBa_I15008 (heme oxygenase): Colonies were only on the kanamycin selection plate with concentrated cell suspension. The one with diluted susepension was empty. Typical but very small E. coli colonies. Picking was performed from the first plate.
  • Picked pipette tips was transferred into a special cell-culture tubes with air-permeable, but sterile cover. In each tube 4 mL of LB-medium + ampicillin (???)(for pSB1A2) or kanamycin (35 mg/mL) (for pSB2K3).
  • 4 colonies for each Biobrick was picked; total: 8 tubes overnight culture.
  • These tubes were transferred in a cell culture shaker at 37 °C and were incubated overnight

Tuesday, June 26th

Quick Change mutagenis to remove SpeI from pYes2_RFC25 MCS

Investigator: Ingmar

Aim of the experiment: Removal of a SpeI restriction site in the backbone of pYes2.

Operational sequence:

  • For each transformation of the PCR-products of P14 and P33 a single clone was picked an transferred to 6 ml LB Amp. Incubation overday at 37°C 180 rpm. The transfomation with the PCR product of P13 was not successfull. Therfore no clone could be picked.
  • Using a Quiagen kit a miniprep of the overnight culture was done.
  • The resulting purified DNA was aliquoted in new tubes labeled as follows:

PCR product of P33(transformation done by Ingmar): P29

PCR product of P33(transformation done by Saskia&Jara): P30

PCR product of P14(transformation done by Ingmar): P31

PCR product of P14(transformation done by Saskia&Jara): P32

  • Afterwards a control digestion of P29-P32 was done.

Reaction batch

Plasmid P29 P30 P31 P32
NEB4 buffer 2 µl 2 µl 2 µl 2 µl
DNA 2,5 µl 2,5 µl 5 µl 5 µl
SpeI-HF 0.25 µl 0.25 µl 0.25 µl 0.25 µl
NgoMIV 0.25 µl 0.25 µl
ddH2O 15 µl 15 µl 12.75 µl 12.75 µl
Sum 20 µl 20 µl 20 µl 20 µl
  • Incubation at 37 °C for 1h.
  • Verification of control digest by agarose gel electrophoresis:

20 µl of each digest product was mixed with 2 µl DNA loading buffer and loaded into the gel. The separation process lasted 1h at 90 V.

Gel picture of control digest with NgoMIV and SpeI

Verification of the PCR products P30, P31 and P33

Investigator: Saskia, Jara

Aim of the experiment: Verification of the PCR produts P30, P31 and P33

Nano Drop

Sample concentration [ng/µl] 260/280
P33 1072.6 1.01
P30 1588 1.28
P31 926.2 0.82

Analytical gel electrophoresis

  • gel: 1 %
  • band 1: 10 µl DNA ladder (1kb)
  • band 2: P30
  • band 3: P33
  • band 4: P31

Control of the competent cells and transformation with P20

Investigator: Saskia, Jara

Aim of the experiment: Control of the competent cells and transformation with P20 Transformation

  • competent cells: by Simon and Ingmar
  • plasmid: P20

result:

  • successful transformation: red colonies

PCR of PAL, 4CL, CHS, OMT (Coumaryl-CoA)

Investigator: Daniela, Mary

Determination of concentration of plasmids (Nanodrop): c(pKS2µHyg-PAL-4CL-CHS) = 500 ng/µl c (pOMT) = 20 ng/µl

PCR:

Name of tube Enzyme consensus (+)/ consensless (-) used Oligos
CHS - CHS - O13 and O24
CHS + CHS + O23 and O24
PAL - PAL - O15 and O16
PAL + PAL + O22 and O16
OMT - OMT - O17 and O26
OMT + OMT + O25 and O26
4CL - 4CL - O19 and O20
4CL + 4CL + O21 and O20


Reaction batch

volume reagent
5 µl 10x Pfu Ultra II buffer
4 µl dNTP's (each 2.5 mM)
0.5 µl Pfu Ultra II (2.5 U/µL)
5 µl 1:10 dilution of used forward primers (10µM)
5 µl 1:10 dilution of used reversed primers (10µM)
1 µl DNA (pKS2µHyg-PAL-4CL-CHS 50 ng/µL or pOMT 20 ng/µL)
29.5 µL bidest. sterile Water

PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 5 min (and adding Pfu Ultra after 3 min)
2 30 95°C 30 sec
46°C 2.5 min
72°C 1.5 min
3 72°C 5 min


PCR purification

  • Purification was done using QIAquick PCR Purification Kit (250)


Analytical Gel Electrophoresis: TUM12 20120629 PCR von p2µHyp-PAL-CHS-4CL und pOMT.jpg

-> going on with CHS, 4CL and OMT; the PCR of PAL will be repeated

Miniprep and analytical gel of picked transformed overnight culture with pSB1A2 plasmid with BBa_K105005 (LexA) pSB2K3 plasmid BBa_I15008 (heme oxygenase)

Investigator: Jeffery Truong, Georg Schützinger

Aim of the experiment: Plasmid isolation from the picked transformed overnight E. coli cells with pSB1A2 plasmid with BBa_K105005 (LexA) pSB2K3 plasmid BBa_I15008 (heme oxygenase).

  • The LB-medium with antibiotics of every tube was opaque which means that the picked cells were successfully inoculated.
  • Centrifugation step at 5000 rpm for 10 min at 16 °C.
  • Every single step now was performed on ice.
  • Miniprep (Qiagen Qiaprep spin) after manufacturer's protocoll.
  • Analytical restriction master mix was prepared after following scheme (Using XbaI and PstI):
    • 4.4 µL XbaI
    • 4.4 µL PstI
    • 17.6 µL Tango-buffer (10x)
    • 132 µL ELGA H2O
  • 17.5 µL from the master mix was poooled together with 2.5 µL of plasmid DNA. That corresponds to 2.5 µL of plasmid DNA, 0.25 µL XbaI, 0.25 µL PstI, 2 µL Tango-buffer (10x), 15 µL ELGA H2O.
  • Incubation at 37 °C for 120 min on a ERG heating unit.
  • BUT: error was performed during preparing the digested plasmid DNA for analytical gelelectrophoresis in the dilution step. 1:10 dilution of analyctical probe with DNA loading buffer:
    • 3.3 µL sample (contains already 1x loading buffer!)
    • 0.7 µL loading buffer (?x)
    • 6 µL TAE-buffer
  • Should have done: 3 µL sample + 1 µL loading buffer (10x) + 6 µL TAE-buffer (1x)
  • DNA-ladder preperation: 10 µL ladder stock solution + 10 µL DNA loading buffer + 80 µL TAE-buffer. 10 µL of this solution was pipetted in one gel pocket of the prepared 1% agarose gel including ehtiudiumbromid.
  • 20 µL of each samples were also pipetted into the gel pockets.
  • The gel pockets were pipetted after following scheme:
Heme oxygenase (colony 1) Heme oxygenase (colony 2) Heme oxygenase (colony 3) Heme oxygenase (colony 4) DNA-ladder LexA (colony 1) LexA (colony 2) LexA (colony 3) LexA (colony 4)
  • Gel electrophoresis at 90 V
  • After 20 min the resolution was still poor; 20 min longer.
  • Analytical Gel okay, but samples interchanged

Analytical gel after digestion with XbaI and PstI

Wednesday, June 27th

Repetition of analytic gel of 21st June

Investigator: Andrea

27.06.12.png

Friday, June 29th

Preparative digest of PCR-products of 4CL, CHS and OMT

Investigator: Katrin, Mary

each digestion will dure 2.5h at 37°C

  • CHS: digestion with Xba1 and HF-Age1 (both NEB)
volume reagent
25µl PCR-product
5µl Buffer NEB4
0.5µl BSA
1µl Xba1 (NEB; 20u/µl)
1µl HF-Age1 (NEB; 20u/µl)
17.5µl bidest. sterile H2O
  • OMT: digestion with Xba1 and HF-Age1 (both NEB)
volume reagent
25µl PCR-product
5µl Buffer NEB4
0.5µl BSA
1µl Xba1 (NEB; 20u/µl)
1µl HF-Age1 (NEB; 20u/µl)
17.5µl bidest. sterile H2O
  • 4CL: digestion with Xba1 and Pst1 (both Fermentas)
volume reagent
25µl PCR-product
5µl Buffer Tango
2µl Xba1 (Fermentas; 10u/µl)
3µl Pst1 (Fermentas; 10u/µl)
15µl bidest. sterile H2O

Preparative Gelelectrophoresis of PCR-products of 4CL, CHS

Investigator: Katrin, Mary

Gelextraction of 4CL+, 4CL-, CHS+, CHS- (bands are as expected; +=with consensus-sequence, -=without consensus-sequence)

preparative gel of 4CL

preparative gel of CHS


DNA-purification with Kit from Quiagen

Quick Change mutagenesis to remove PstI in URA3 from pYES2_RFC25 MCS 1.2

Investigator: Ingmar

Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.

PCR
Reaction batch

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl Plasmid P29 template
0.5 µl 1:10 dilution of O40 (10 pmol/µL)
0.5 µl 1:10 dilution of O41 ((10 pmol/µL)
17 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Turbo DNA polymerase (2.5 U / µl)

PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 15 95°C 30 sec
55°C 1 min
67°C 6.5 min
  • The procedure was furthermore applied to P31.
  • Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.

Transformation into E.coli Xl1-Blue Operation Sequence

  • This operation sequence was applied to the PCR prducts of P29 and P31 respectively.
  • melting of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • addition of 1 µl of the PCR product
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Amp-LB-plate
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate

Saturday, June 30th

Quick Change mutagenis to remove PstI in the URA 3 gene from pYes2_RFC25 MCS

Investigator: Ingmar

Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.

Operational sequence:

  • For each transformation of the PCR-products of P29 and P30 a single clone was picked an transferred to 6 ml LB Amp. Incubation overnight at 37°C 180 rpm. The transfomation with the PCR product of P31, P32 and P33 was not successfull. Therfore no clone could be picked from these plates and four instead of one clone was picked from the plates containing the transformations of P29.

July 2012

Sunday, July 1st

Quick Change mutagenis to remove PstI in the URA 3 gene from pYes2_RFC25 MCS

Investigator: Ingmar

Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.

Operational sequence:

  • Using a Quiagen kit a miniprep of the overnight culture was done.
  • The resulting purified DNA was aliquoted in new tubes labeled as follows:

1st PCR product of P29: P34

2nd PCR product of P29: P35

3rd PCR product of P29: P36

4th PCR product of P29: P37

PCR product of P30: P38

  • Afterwards a control digestion of P34-P38 was done.

Reaction batch

Plasmid P34 P35 P36 P37 P38
Fermentas 10x R buffer 0.5 µl 0.5 µl 0.5 µl 0.5 µl 0.5 µl
DNA 2 µl 2 µl 2 µl 2 µl 5 µl
PstI 0.25 µl 0.25 µl 0.25 µl 0.25 µl 0.25 µl
ddH2O 17.25 µl 17.25 µl 17.25 µl 17.25 µl 14.25 µl
Sum 20 µl 20 µl 20 µl 20 µl 20 µl
  • Incubation at 37 °C for 1h.
  • Verification of control digest by agarose gel electrophoresis:

20 µl of each digest product was mixed with 4 µl 6x DNA loading buffer and loaded into the gel. The separation process lasted 1h at 90 V.

Gel picture of control digest with PstI

  • All digest products show the expected two bonds at 3526 bp and at 2332 bp. The Miniprep product P35 was chosen to be used for the further Quickchange Mutagenesis.

Quick Change mutagenesis to remove PstI in the 2µ ori from pYES2_RFC25 MCS

Investigator: Ingmar

Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.

PCR
Reaction batch 1

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl Plasmid P35 template
0.5 µl 1:10 dilution of O42 (10 pmol/µL)
16.5 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Ultra II DNA polymerase (2.5 U / µl)

Reaction batch 2

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl Plasmid P35 template
0.5 µl 1:10 dilution of O43 (10 pmol/µL)
16.5 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Ultra II DNA polymerase (2.5 U / µl)


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 10 95°C 30 sec
55°C 1 min
67°C 6 min
  • Having completed the PCR cycling parameters listed above both PCR reaction batches were mixed together and the cycling parameters listed above were one time more applied.
  • Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.

Transformation into E.coli Xl1-Blue Operation Sequence

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • addition of 1 µl of the PCR product
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Amp-LB-plate
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate

Monday, July 2nd

Repetition of PCR of PAL

Investigator: Mary

Reaction batch

volume reagent
5 µl 10x Pfu Ultra II buffer
4 µl dNTP's (each 2.5 mM)
0.5 µl Pfu Ultra II (2.5 U/µL)
5 µl 1:10 dilution of used forward primers (10µM)
5 µl 1:10 dilution of used reversed primers (10µM)
1 µl DNA (pKS2µHyg-PAL-4CL-CHS 50 ng/µL)
29.5 µL bidest. sterile Water


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 2 min (and adding Pfu Ultra after 2 min)
2 30 95°C 30 sec
55°C 1 min
72°C 2.5 min
3 72°C 5 min

PCR of LexA with primers including the RFC25 pre- and suffix

Investigator: Jeffery Truong, Georg Schützinger

Aim of the experiment: The Biobrick BBa_K105005 (LexA) has a RFC10 pre- and suffix, but we need RFC25 pre- and suffix for protein fusion, so we have to do a PCR with primer containing the RFC25 pre- and suffix.

  • The received forward and reverse primer TUM12-LexA-fw and TUM12-LexA-rv are resuspended in 204 µL and 221 µL ELGA water as described in the data sheet to get a final primer concentration of 100 pmol/µL=100 µM. For the PCR reaction mixture we took 0.5 µL of these resuspended primer and add 4.5 µL of ELGA water to get a final primer concentration of 10 µM.
  • Clone 3 of BBa_K105005 (LexA) has beed choosen for the PCR (ERG No. P23).

PCR reaction mixture

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer
1 µl 10 µM Reverse Primer
0.25 µL OneTaq Hot Start DNA Polymerase (Finally: 1.25 units/50 µL)
1 µl Plasmid DNA (BBa_K105005) from P23 (Clone 3)
35.75 µL ELGA Water
=50 µL TOTAL
  • The PCR program was performed after following scheme:
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
55 °C 60 s
68 °C 60 s
Final extension 68 °C 5 min
Hold 4 °C overnight

Tuesday, July 3rd

Analytic gelelectrophoresis of cleaned up PCR product from LexA with primer containing RFC25 pre- and suffix

Investigator: Jeffery Truong

Aim of the experiment: Analytical gelelectrophoresis of cleaned up PCR product from LexA (BBa_K105005) with primer containing the RFC25 pre- and suffix (TUM12-LexA-fw and TUM12-LexA-rv).

  • The clean-up of the PCR product LexA (BBa_K105005) with primer containing the RFC25 pre- and suffix (TUM12-LexA-fw and TUM12-LexA-rv) was performed with the QIAquick PCR Purification Kit from Qiagen after manufacturer's protocoll.
  • 5 µL of the purificated PCR product was taken to perform a analytical gelelectrophoresis to verify the success of the PCR.
  • 1% agarose gel containing ethidium bromide was used for the analytical gelelectrophoresis.
  • The analytical gelelectrophoresis was performed for 60 min at 90 V.
  • Scheme of the gel:
100 bp ruler PCR product of BBa_105005 1000 bp ruler
  • Analytical gelelectrophoresis of PCR product of BBa_K105005 with primer TUM12-LexA-fw and TUM12-LexA-rv

LS: Plating of Schwab expression stains #106 & #108 which contain lavendula limonene synthase

Investigator: Lara

Aim of the experiment: To get colonies of BL21 strains containing lavendula LS for amplification and subsequent plasmid extraction.

  • Schwab strain #106 was plated on a chloramphenicol containing LB plate. #108 was plated on a amp+chlp containing LB plate. The plates were incubated at 37°C over night.

Quick Change mutagenis to remove PstI in the 2µ Ori from pYes2_RFC25 MCS

Investigator: Ingmar

Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.

Operational sequence:

  • From the transformation of the PCR-product of P35 two single clones were picked an transferred to 6 ml LB Amp. Incubation overnight at 37°C 180 rpm.

PCR of BBa_I742111 (Limonenesynthase) Clone 3 (Trafo 19.06.12)

Investigator: Andrea

PCR used forward primer with consensus sequence; PCR reaction mixture

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer O27
1 µl 10 µM Reverse Primer O30
0.25 µl OneTaq Hot Start DNA Polymerase (Finally: 1.25 units/50 µl)
1 µl Plasmid DNA (BBa_I742111) Clone 3
35.75 µl dd water
50 µL TOTAL

PCR used forward primer without consensus sequence; PCR reaction mixture

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer O28
1 µl 10 µM Reverse Primer O30
0.25 µl OneTaq Hot Start DNA Polymerase (Finally: 1.25 units/50 µl)
1 µl Plasmid DNA (BBa_I742111) Clone 3
35.75 µl dd water
50 µL TOTAL
  • The PCR program was performed after following scheme:
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
47 °C 30 s
68 °C 1,75 min
Final extension 68 °C 5 min
Hold 4 °C 1 h

Analytical Gelelectrophoresis

  • 5 µl DNA + 1 µl loading buffer

03.07.12.png

Wednesday, July 4th

Quick Change mutagenis to remove PstI in the 2µ Ori from pYes2_RFC25 MCS

Investigator: Ingmar

Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.

Operational sequence:

  • Using a Quiagen kit a miniprep of the overnight culture was done.
  • The resulting purified DNA was aliquoted in new tubes labeled as follows:

1st Transformation of P35: P43

2nd Transformation of P35: P44

  • Afterwards a control digestion of P43 and P44 was done.

Reaction batch

Plasmid P43 P44
Fermentas 10x R buffer 0.5 µl 0.5 µl
DNA 5 µl 5 µl
PstI 0.25 µl 0.25 µl
ddH2O 14.25 µl 14.25 µl
Sum 20 µl 20 µl
  • Incubation at 37 °C for 1h.
  • Verification of control digest by agarose gel electrophoresis:

20 µl of each digest product was mixed with 4 µl 6x DNA loading buffer and loaded into the gel. The separation process lasted 1h at 90 V.

Gel picture of control digest with PstI

  • All digest products show the expected bond at 5858 bp. The Miniprep product P40 was chosen to be used for the further Quickchange Mutagenesis.

Quick Change mutagenis to insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS

Investigator: Ingmar

Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector; operating purfication possibility via Strep-tag II.

PCR
Reaction batch

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl Plasmid P44
1 µl 1:10 dilution of O54 (10 pmol/µL)
1 µl 1:10 dilution of O55 ((10 pmol/µL)
16 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Turbo DNA polymerase (2.5 U / µl)

PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 16 95°C 30 sec
55°C 1 min
68°C 6 min
  • Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.

Transformation into E.coli Xl1-Blue Operation Sequence

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells
  • addition of 1 µl of the PCR product
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Amp-LB-plate
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate

Analytical Gelelektrophoresis of PCR-Products of PAL

Investigator: Mary

Aim of the experiment: purification and testing if PCR was successful

Purification of PCR-Products with purification kit from quiagen analytical gelelectrophoresis of PAL+, PAL-; expected band at 2,1 kb

Analytical Gel Electrophoresis: File:TUM12 20120704 PAL-PCR v2.tiff

-> PCR was not successful, no band at 2,1 kb

-> next steps: new Design of Primer and repetition of PCR with new primers


Picking of clones of Schwab expression stains #106 & #108

Investigator: Andrea

Aim of the experiment: Getting clones of cells with plasmids containing the gene for limonenesynthase and amplification of these clones for further plasmid preparation.

Picking of Clones

  • 2 clones of every stain were picked
  • Incubation at 37 °C in LB + Amp (#108) / LB + Kan (#106)

Preparative Gelelectrophoresis of PCR-products of OMT

Investigator: Mary, Katrin

Aim of the experiment: Purification of the previously digested DNA, test if digestion was successful

picture follows!

Gelextraction of OMT- and OMT+ (bands are as expected; +=with consensus-sequence, -=without consensus-sequence)

DNA-purification with Kit from Quiagen

Thursday, July 5th

Preparation of plasmids containing lavendula LS

Investigator: Lara

Aim: Purify Schwab plasmids containing lavendula limonene synthase

Experiment was conducted using Qiagen Plasmid Miniprep Kit.

P39: Plasmid from Schwab strain #106 (1); 35 ng/µl

P40: Plasmid from Schwab strain #106 (2); 72 ng/µl

P41: Plasmid from Schwab strain #108 (1); 240 ng/µl

P42: Plasmid from Schwab strain #108 (2); 120 ng/µl

Restriction digest of Schwab plasmids

Investigator: Lara

Aim: To check whether extracted plasmids from Schwab expression strains #106 & #108 are OK.

Digest of plasmid from strain #106 was conducted with the following protocoll:

500 ng Plasmid DNA

0,25 µl Nco1

0,25 µl Hind 3

2 µl Buffer Tango

dd H2O to a total volume of 20 µl.

Digest of plasmid from strain #108 was conducted with the following protocoll:

500 ng Plasmid DNA

0,25 µl EcoR1

0,25 µl Not1

2 µl Buffer Orange

dd H2O to a total volume of 20 µl.

(All enzymes and buffers were from Fermentas).

Analytical gel electrophoresis of digested Schwab plasmids

Investigator: Lara Aim: Check plasmids for insert.

Plasmids were digested, 2 µl loading dye (10x) was added to each sample. Gel was loaded in the following order:

1. 6 µl gene ruler 1 kb, 2.-6. 11 µl of: P39, P40, P41, P42, Coumaryl-Plasmid (Katrin)

TUM12 VerdauSchwabPlasmide0507.png

Analytical Gelelektrophoresis of plasmid pKS2µHyg-PAL-4Cl-CHS

Investigator: Katrin

Aim of the experiment: testing if PAL is part of the plasmid that was sent to us (troubleshooting because PCR of PAL was not successful)

digestion took 1 h at 37°C

  • digestion with ApaI (Fermentas)
volume reagent
9.3 µl plasmid pKS2µHyg-PAL-4Cl-CHS (miniprep)
2 µl Buffer B
0.5 µl ApaI (Fermentas; 10u/µl)
8.2 µl bidest. sterile H2O

analytical gelelectrophoresis: expected band at 3,14 kb (Gal-PAL-XK)

Analytical gelelectrophoresis of PCR product of PAL

-> experiment was successful, PAL is part of the plasmid pKS2µHyg-PAL-4Cl-CHS

Quick Change mutagenis to insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS

Investigator: Ingmar

Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector; operating purfication possibility via Strep-tag II.

Operational sequence:

  • From the transformation of the PCR-product of P44 two single clones were picked an transferred to 6 ml LB Amp. Incubation overday at 37°C 180 rpm.
  • Using a Quiagen kit a miniprep of the overnight culture was done.
  • The resulting purified DNA was aliquoted in new tubes labeled as follows:

1st picked clone of P44: P45

2nd picked clone of P44: P46

Minipreparation of biobricks BBa_J52028, BBa_E2030, BBa_E2020

Investigator: Martin, Alois

Aim: Getting "reporter proteins"

  • 10 µl water war added to the well of the distribution kit (=> red)
  • BBa_J52028: GFP with PEST191 tag => p51
  • BBa_E2030: EYFP, yeast optimized => p52
  • BBa_E2020: ECFP, yeast optimized => p53
  • Transformation + Minipreparation (Qiagen Plasmid Miniprep Kit)

Friday, July 6th

Quick Change mutagenis to insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS

  • Afterwards a control digestion of P45 and P46 was done.

Reaction batch

Plasmid P45 P46
Fermentas 10x O buffer 2 µl 2 µl
DNA 3 µl 3 µl
PstI 0.25 µl 0.25 µl
ddH2O 14.75 µl 14.75 µl
Sum 20 µl 20 µl
  • Incubation at 37 °C for 1h.
  • Verification of control digest by agarose gel electrophoresis:

20 µl of each digest product was mixed with 4 µl 6x DNA loading buffer and loaded into the gel. The separation process lasted 1h at 90 V.

Gel picture of control digest with PstI

  • All digest products show the expected bonds at 5858 bp. The Miniprep product P45 was chosen to check the insertion of Ala in front of the strep-tag II via DNA sequencing.

The results of the sequencing are shown below:

Sequencing results of P45 The sequencing results show that the insertion of Alanin in front of the Strep-tag II was not successful.

PCR of Schwab plasmid DNA to amplify gene for lavendula LS

Instructor: Lara

Aim: PCR of Schwab plasmids with primers which were designed to amplify the lavendula LS gene and to add RFC25 restriction sites.

3 different primer combinations were used:

1. O33/O37

2. O34/O37

3. O35/O37

Each primer combination was used for plasmid DNA amplification of P40 and P41.

PCR reaction mixture

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer
1 µl 10 µM Reverse Primer
0.25 µl OneTaq Hot Start DNA Polymerase (Final: 1.25 units/50 µl)
1 µl Plasmid DNA (BBa_I742111) Clone 3
35.75 µl dd water
50 µL TOTAL
  • The PCR program was performed after following scheme:
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
50 °C 30 s
68 °C 1,75 min
Final extension 68 °C 5 min
Hold 4 °C 1 h

Analytic Gel of PCR of Schwab plasmid DNA

Instructor: Andrea

06.07.12.png

Minipreparation of biobricks BBa_J52028, BBa_E2030, BBa_E2020

Investigator: Martin, Alois

Aim: Getting "reporter proteins"

  • 10 µl water war added to the well of the distribution kit (=> red)
  • BBa_J52028: GFP with PEST191 tag => p51
  • BBa_E2030: EYFP, yeast optimized => p52
  • BBa_E2020: ECFP, yeast optimized => p53
  • Transformation + Minipreparation (Qiagen Plasmid Miniprep Kit)

Saturday, July 7th

Quick Change mutagenesis to insert Ala in front of the Strep-tag II in pYES2_RFC25 MCS

Investigator: Ingmar

Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.

  • As the sequencing of the first attempt to introduce Ala in front of the Strep-tag II did not show a successfull insertion of Ala, the quickchange mutagense was performed once again with a modified setup. Presumably a formation of primer dimers was responsable for the experiment's results. Therefore the second PCR was operated in two steps as shown below.

PCR
Reaction batch 1

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl Plasmid P44 template
0.5 µl 1:10 dilution of O54 (10 pmol/µL)
16.5 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Turbo DNA polymerase (2.5 U / µl)

Reaction batch 2

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl Plasmid P44 template
0.5 µl 1:10 dilution of O55 (10 pmol/µL)
16.5 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Turbo DNA polymerase (2.5 U / µl)


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 10 95°C 30 sec
55°C 1 min
67°C 6 min
  • Having completed the PCR cycling parameters listed above both PCR reaction batches were mixed together and the cycling parameters listed above were one time more applied.
  • Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.

Transformation into E.coli Xl1-Blue Operation Sequence

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • addition of 1 µl of the PCR product
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Amp-LB-plate
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate

Transformation of E.coli XL1 blue with ADH1 promoter, ADH1 terminator and TEF2 promoter

Investigator: Georg

Monday, July 9th

Phycocyanobilin (PCB) extraction from dried Spirulina platensis powder (part 1/4)

Investigator: Jeff, Alois, Martin

Aim of the experiment: Phycocyanobilin (PCB) is a cofactor neeeded for the funtion of phytochrome B. Phycocyanobilin is covalently bound to Cys457 of phytochrome B. Saccharomyces cerevisiae does not contain endogenous PCB. For proof of concept PCB should be added to the medium. In the following experiment, PCB is extracted from dried Spirulina platensis powder.

Operational sequence:

  • 50 g of Spirulina platensis powder was (from concept-vitalprodukte.de) resuspended in 1.5 l of H2O (30 mg/l) in a beaker covered with aluminium foil.
  • Stirring for 10 min at RT.
  • Green Spirulina suspension was divided in 6 centrifuge bottles, covered in aluminium foil.
  • Centrifation at 10500 rpm at 4 °C (SLA-3000 rotor, Thermo Scientific) for 1 h.
  • Supernatant was discarded
  • 25 ml of MeOH added to each bottle and was heavily shaked to resuspend the pellet for the next cleaning step with MeOH.
  • Each bottle with the resuspended pellet were filled with MeOH to a final volume of 250 ml and shaked again to fully resuspend the pellet.
  • Centrifugation at 10500 rpm at 4 °C (SLA-3000 rotor, Thermo Scientific) for 10 min.
  • Supernatant was discarded.
  • The last 4 steps were repeated until the supernatant of the washed pellet was colorless or cyanblue but not green anymore (Regulary, it takes 3 or 4 times). Pellet should be cyanblue now.
  • The pellet of the 6 centrifuge tubes was collected in a sole centrifugation tube, covered in aluminium foil tube, by scratching it out with a small spoon.
  • The remaining rest of the pellet which cannot be scratched out were resuspended in a small amount of MeOH and were transformed from tube to tube with a interim shaking step.
  • This suspension was transferred into the tube with the scratched-out pellet.
  • Centrifugation at 10500 rpm at 4 °C (SLA-3000 rotor, Thermo Scientific) for 10 min.
  • Supernatant was discarded.
  • Finally washed pellet was stored, wrapped in foil overnight for the methanolysis next day.

Green dried Spirulina platensis powder Cyanblue Pellet after 4x of MeOH washing step Cyanblue supernatant of the last washing step with MeOH. It indicates that all the green chromophores are already washed out, which means that only the protein-bound phycocyanobilin is still arrested in he pellet Resuspended Pellet in MeOH to pool all the pellet Analytical sample of the dried pellet before the methanolysis for later analysis

Tuesday, July 10th

Phycocyanobilin (PCB) extraction from dried Spirulina platensis powder (part 2/4)

Investigator: Jeff, Alois, Martin

Aim of the experiment: Phycocyanobilin (PCB) is a cofactor neeeded for the funtion of phytochrome B. Phycocyanobilin is covalently bound to Cys457 of phytochrome B. Saccharomyces cerevisiae does not contain endogenous PCB. For proof of concept PCB should be added to the medium. In the following experiment, PCB is extracted from dried Spirulina platensis powder.

Operational sequence:

  • Washed pellet from the day before was resuspended in 500 ml MeOH.
  • Heat suspension in a 500 ml flask in a water bath at 70 – 75 ºC with a condensing coil cooled with water for 5 – 8 hrs.
  • After this, the suspension was transferred into a new centrifuge tube and centrifuged at 10500 rpm at 4 °C (SLA-3000 rotor, Thermo Scientific) for 20 min.
  • The supernatant was decanted trough a filter paper into new centrifugation tube and stored, wrapped in a aluminium foil, at -20 °C.
  • The pellets also was stored, wrapped in a aluminium foil, at -20 °C.

Plating of received E. coli containing biobricks

Investigator: Jeff

Aim of the experiment: The received biobricks were already transformed in E. coli and were in an agar stabs. These E. coli cells were transferred with an inoculation loop on antibiotic selection plates and were incubated over night.

Operational sequence:

  • Bacterias containing plasmids with biobricks were transferred with a sterile inoculation loop on antibiotic plates and were incubated at 37 °C overnight.
  • The biobricks were: BBa_K207001 in pSB1A2, BBa_K243006 in BBa_K157000, BBa_K300001 in K300007 (part for other subproject), BBa_K268000 in pSB6A0 (part for other subproject), BBa_K365005 RFC25 in pSB1C3, BBa_K365000 in pSB1C3, BBa_K207000 in pSB3K3, BBa_K165031 in pSB1AK3

Wednesday, July 11th

Phycocyanobilin (PCB) extraction from dried Spirulina platensis powder (part 3/4)

Investigator: Jeff, Alois, Martin

Aim of the experiment: Phycocyanobilin (PCB) is a cofactor neeeded for the funtion of phytochrome B. Phycocyanobilin is covalently bound to Cys457 of phytochrome B. Saccharomyces cerevisiae does not contain endogenous PCB. For proof of concept PCB should be added to the medium. In the following experiment, PCB is extracted from dried Spirulina platensis powder.

Operational sequence:

  • The pellet after the first methanolysis of the day before was undergone a second methanolysis step to ensure high efficiacy of PCB extraction. Operational sequence was performed like the first methanolysis including the centrifugation and filtering step. The pellet after the second methanolysis should be more colorless and the filtered supernatant was freezed, like the one from the first methanolysis, at -20 °C, wrapped in aluminium foil

Transformation of E. coli XL1-Blue with pGADT7 and pGBKT7 plasmid for Yeast-two-hybrid (Y2H)

Investigator: Jeff

Aim of the experiment: pGADT7 and pGBKT7 are plasmids containing the transcriptional activation domain or the DNA binding domain of the transcription activator Gal4. pGADT7 contains the transcriptional activation domain of gal4; we want to clone the the first 100 residues of Pif3 (BBa_K365000) into this plasmid. As a result we have a fusion contruct of Gal4 and Pif3, which is nescassary for the light-switchable promoter system. pGBKT7 is for backup, if the ordered biobricks are not working.

Operational sequence:

  • E. coli XL1-Blue are transformed with pGADT7 and pGBKT7 seperately after standard protocol of our lab.

Introducing new Saccharomyces cerevisiae strain (Y190 strain) from Schwab lab for Y2H

Investigator: Jeff

Aim of the experiment: The Y190 Saccharomyces cerevisiae is a special strain for Yeast-two-hybrid. This strain carries a Gal4 and Gal80 deletion to higher the signal/noise-ratio of protein-protein interactions. Reporter for protein-protein interactions are HIS3, lacZ and MEL1 and are encoded in the genomic DNA. Transformation markers are trp1, leu2 and cyhR2 and are encoded on the transformation plasmids.

Operational sequence:

  • The freshly plated Y190 cells are transferred with a inoculation loop from the original plate on a new YPD agar plate.
  • After 2 days the the plate was put in 4 °C.

Repetition of PCR of PAL

Investigator: Katrin, Daniela

Reaction batch

volume reagent
5 µl 10x Pfu Ultra II buffer
4 µl dNTP's (each 2.5 mM)
0.5 µl Pfu Ultra II (2.5 U/µL)
5 µl 1:10 dilution of used forward primers (10µM)
5 µl 1:10 dilution of used reversed primers (10µM)
1 µl DNA (pKS2µHyg-PAL-4CL-CHS 50 ng/µL)
29.5 µL bidest. sterile Water


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 2 min (and adding Pfu Ultra after 2 min)
2 30 95°C 30 sec
52°C 1 min
72°C 2.5 min
3 72°C 5 min

PCR purification

  • Purification was done using QIAquick PCR Purification Kit (250)

Analytical gelelektrophoresis of PCR-Products of PAL

-> PCR was not successful, no band at 2,1 kb (picture follows)

Preparative Digest of pYES_iGEM

Investigator: Katrin, Daniela


Digestion of P50 with Xbal and NgOMIV


volume reagent
10 µl P50 (concentration: 264.5 ng/µl)
2.5 µl NEB4
2.5 µl 10x BSA
1 µl XbaI (20 U/µl)
2 µl NgOMIV (10U/µl)
7 µl ddH2O

Incubation: 37 °C, 3 h

Digestion of P50 with Xbal and PstI


volume reagent
10 µl P50 (concentration: 264.5 ng/µl)
5 µl Tango buffer
2 µl XbaI
3 µl PstI
7.5 µl ddH2O

Incubation: 37 °C, 3 h

DNA preparative gel electrophoresis

  • gel: 1% with LMP-agarose
  • band 1: P50 digested with XbaI and PstI
  • band 2: P50 digested with XbaI and NgOMIV
  • 70 V, 90 min


Gelextration

  • cut the bands
  • QIAquick Gel Extractrion Kit was used
    • step 6 was left out
    • step 9: 30µl buffer, 4 min incubation

Ligation of digested P50 with digested PCR-products of PCR 15-20 (4CL, CHS and OMT)

Investigator: Katrin, Daniela

Concentration (Nano Drop:
4CL+ (PCR 15) = 40.3 ng/µl
4CL- (PCR 16) = 37.3 ng/µl
CHS+ (PCR 17) = 46.1 ng/µl
CHS- (PCR 18) = 51.2 ng/µl
OMT+ (PCR 19) = 22.3 ng/µl
OMT- (PCR 20) = 16.7 ng/µl

P50 digested with XbaI and PstI = 23.9 ng/µl (the digested Plasmid has the number P71)
P50 digested with XbaI and NgOMIV = 28.4 ng/µl (the digested Plasmid has the number P72)

  • required volumes were calculated using Lab Tools

4CL+ (PCR 15) with P50 digested with XbaI and PstI

volume reagent
5.27 µl P50 digested
2.73 µl 4CL+ (PCR 15)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

4CL- (PCR 16) with P50 digested with XbaI and PstI

volume reagent
5.13 µl P50 digested
2.87 µl 4CL- (PCR 16)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

CHS+ (PCR 17) with P50 digested with XbaI and NgOMIV

volume reagent
5.84 µl P50 digested
2.16 µl CHS+ (PCR 17)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

CHS- (PCR 18) with P50 digested with XbaI and NgOMIV

volume reagent
6 µl P50 digested
2 µl CHS- (PCR 18)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

OMT+ (PCR 19) with P50 digested with XbaI and NgOMIV

volume reagent
4.45 µl P50 digested
3.55 µl OMT+ (PCR 19)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

OMT- (PCR 20) with P50 digested with XbaI and NgOMIV

volume reagent
3.87 µl P50 digested
4,13 µl OMT- (PCR 20)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

Negative control

volume reagent
5 µl P50 digested with XbaI and PstI or NgOMIV
3 µl ddH2O
1 µl T4 DNA-ligase
1 µl T4-ligase buffer (10x)
  • water bath 16 °C


Thursday, July 12th

Genextraction and analytical digestion of CYC1-terminator, TEF1-promoter, and PGK1-Promoter from pSB1C3 and pSB1A2

Investigator: Georg

  • Genes from overnight cultures were extracted, using the Quiaprep gene extraction Kit. Extracted Plasmids then were analytically digested with XbaI and PstI (Fermentas).

Analytical digestion XbaI, PstI

Chemical Volume
XbaI 2,5 µl
PstI 2,5 µl
10xBuffer Tango 2 µl
Plasmid-DNA 2,5 µl
ddH2O 11,5 µl


  • Analytical gel was run (1% Agarose).

File:20120712-PGK1-P,-Cyc-T,-TEf

Phycocyanobilin (PCB) extraction from dried Spirulina platensis powder (part 4/4)

Investigator: Martin, Jeff, Alois

Aim of the experiment: Phycocyanobilin (PCB) is a cofactor neeeded for the funtion of phytochrome B. Phycocyanobilin is covalently bound to Cys457 of phytochrome B. Saccharomyces cerevisiae does not contain endogenous PCB. For proof of concept PCB should be added to the medium. In the following experiment, PCB is extracted from dried Spirulina platensis powder.

Operational sequence:

  • The supernatants (~1l in total) of the two previous experiments were pooled and put into a rotary evaporater in order to acquire a concentrate of approximately 100ml.
  • The settings of the rotary evaporater: ~160 millibars, waterbath temperature of 25-30°C
  • Furthermore, there were measures to be taken to protect the solution from direct sunlight: blinds down, aluminum foil wrapped around the waterbath
  • Afterwards we transfered the Methanol solution into a separating funnel and added another 100ml of aqua dest..
  • By means of adding chloroform we created two phases. The lower (chloroform) phase with the solved Phycocyanobilin was separated and put into another rotary evaporater flask. This step was repeated three times in order to get all the Phycocanobilin into the next step
  • Then the chloroform was completely removed in the rotary evaporater (same settings as before), the pure (?) Phycocyanobilin in the flask was solved in 60 ml DMSO, transfered into a new flask and frozen at -20 °C.

Picking of transformated (pGADT7 and pGBKT7) E. coli cells on antibiotic selection plates

Investigator: Jeff

Aim of the experiment: pGADT7 and pGBKT7 are plasmids containing the transcriptional activation domain or the DNA binding domain of the transcription activator Gal4. pGADT7 contains the transcriptional activation domain of gal4; we want to clone the the first 100 residues of Pif3 (BBa_K365000) into this plasmid. As a result we have a fusion contruct of Gal4 and Pif3, which is nescassary for the light-switchable promoter system. pGBKT7 is for backup, if the ordered biobricks are not working.

Operational sequence:

  • A E. coli colony was picked for each plasmid and was transferred in a tube containing 4 ml of LB-medium containing antibiotics (Amp for pGADT7 and Kan for pGBKT7).
  • Overnight culture at 37 °C in a cell-culture shaker.

Miniprep of transformated E. coli from overnight culture (8 plasmids containing biobricks)

Investigator: Andrea

Aim of the experiment: Miniprep of transformated E. coli from overnight culture to get the plasmids with biobricks

NanoDrop Measure

Plasmid Concentration
P73 41.6 ng/µl
P74 85.2 ng/µl
P75 72.4 ng/µl
P76 254.3 ng/µl
P77 74.4 ng/µl
P78 50.0 ng/µl
P79 46.2 ng/µl
P80 116.7 ng/µl
P81 77.1 ng/µl
P82 65.5 ng/µl

Analytical digestion and gelelectrophoresis of biobricks (8 plasmids containing biobricks)

Investigator: Jeff

Aim of the experiment: Checking whether the biobricks are part of the plasmid-backbone.

Operational sequence:

  • Reaction batch for each plasmid:
Reagent Volume in µl
Tango Buffer 10x 4 µl
XbaI (Fermentas) 0.25 µl
PstI (Fermentas) 0.5 µl
Plasmid DNA 2.5 µl
ddH2O 12.75 µl
TOTAL 20 µl
  • Incubation at 37 °C for 1 h 45 min.
  • Analytical gelelectrophoresis at 90 V for 1 h.
  • Order of gel-pockets:
100 bp ladder P82 P81 P80 P79 P76 P75 P74 P73 1 kbp ladder
OK BAD OK OK OK OK OK BAD
  • P73 and P81, both parts from Havard university are bad. To exclude errors, one should pick another colony for each plasmid and do again the analytical digestion and gelelectrophoresis after the miniprep.

Analytical gelelectrophoresis with XbaI and PstI

Transformation of Ligationproducts of pYES2 + OMT, 4Cl and CHS in E.coli

Investigator: Mary

  • adding 5µl ligation product in 100µl competent XL blue E.coli cells
  • incubation 30 min on ice
  • 5 min at 37°C
  • adding cells in 1 ml LB (Withouth antibiotica) and incubate at 37°C, 30 min, 180 rpm
  • plate on agar with Ampicillin over night

Repetition of PCR of PAL

Investigator: Daniela

Aim of the experiment: Repetition of PCR of PAL (so far not successful) with the use of different polymerase and try of 3 temperatures

only with PAL+, 3 different temperatures (see cycling parameters) and one batch at 52.5 °C with DMSO


Reaction batch

volume reagent
10 µl 5x Herculase II reaction buffer
0,5 µl dNTP Mix (each dNTP 2.5 mM)
1 µl Herculase II fusion DNA Polymerase
1,25 µl 1:10 dilution of used forward primers (O22)
1,25 µl 1:10 dilution of used reversed primers (O59)
1 µl 1:10 dilution of DNA (P19=pKS2µHyg-PAL-4CL-CHS 50 ng/µL) -> 5 ng/µL
35 µL ddH2O


Reaction batch with DMSO

volume reagent
10 µl 5x Herculase II reaction buffer
0,5 µl dNTP Mix (each dNTP 2.5 mM)
1 µl Herculase II fusion DNA Polymerase
1,25 µl 1:10 dilution of used forward primers (O22)
1,25 µl 1:10 dilution of used reversed primers (O59)
1 µl 1:10 dilution of DNA (pKS2µHyg-PAL-4CL-CHS 50 ng/µL) -> 5 ng/µL
1,5 µl DMSO (3% des Ansatzes)
33.5 µL ddH2O


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 2 min
2 30 95°C 30 sec
52.5°C 30 sec
72°C 4 min
3 72°C 3 min


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 2 min
2 30 95°C 30 sec
45°C 30 sec
72°C 4 min
3 72°C 3 min


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 2 min
2 30 95°C 30 sec
56.2°C 30 sec
72°C 4 min
3 72°C 3 min

Analytical gel electrophoresis

  • no bands at all (picture follows)
  • possibly due to low concentration of P19 (5 ng/µl)

Ligation of P93 (pSB1C3 digested with XbaI and AgeI) with digested PCR-products of PCR 17-20 (CHS and OMT)

Investigator: Daniela

Concentration (Nano Drop:
CHS+ (PCR 17) = 46.1 ng/µl
CHS- (PCR 18) = 51.2 ng/µl
OMT+ (PCR 19) = 22.3 ng/µl
OMT- (PCR 20) = 16.7 ng/µl

P93 (digested with XbaI and AgeI) = 4.8 ng/µl


CHS+ (PCR17) with P93 digested with XbaI and AgeI

volume reagent
7.04 µl P93
0.96 µl CHS+ (PCR 17)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

CHS- (PCR 18) with P93 digested with XbaI and AgeI

volume reagent
7.13 µl P93
0.87 µl CHS- (PCR18)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

OMT+ (PCR19) with P93 digested with XbaI and AgeI

volume reagent
6.19 µl P93
1.81 µl OMT+ (PCR19)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

OMT- (PCR20) with P50 digested with XbaI and AgeI

volume reagent
5.75 µl P93
2.25 µl OMT- (PCR20)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

Negative control

volume reagent
5 µl P93
3 µl ddH2O
1 µl T4 DNA-ligase
1 µl T4-ligase buffer (10x)
  • water bath 16 °C
  • products were named P94-P97

Preparative digest of PCR1-PCR7 and P50

Investigator: Andrea

Digestion of P50 with XbaI and NgoMIV

volume reagent
20 µl P50
4 µl NEB Buffer
0.4 µl BSA
1 µl XbaI (10 U/µl)
2 µl NgoMIV (10 U/µl)
27.4 µl ddH2O

Digestion of PCR1-PCR7 with XbaI and AgeI

volume reagent
25 µl PCR-Product
5 µl NEB Buffer
0.5 µl BSA
1 µl XbaI (10 U/µl)
1 µl AgeI (10 U/µl)
32.5 µl ddH2O

Incubation: 37 °C, 3 h

Preperative gel electrophoresis

Investigator: Andrea

Aim of the experiment: Analytical gel electrophoresis of products from restriction digest of plasmids PCR1 - PCR7 and PCR9

12.07.12 prep digest1.png

12.07.12 prep digest2.png

12.07.12 prep digest3.png

Ligation of digested PCR1-PCR7 (digested with XbaI and AgeI) with pSB1C3 (digested with XbaI and AgeI) and with pYESnew (digested with XbaI and NgoMIV)

Investigator: Andrea

Concentration (Nano Drop:
LIMS Citrus (PCR 1) = 13.4 ng/µl
LIMS Citrus (PCR 2) = 10.3 ng/µl
LIMS Lavendula (PCR 3) = 2.2 ng/µl
LIMS Lavendula (PCR 3) = 9.9 ng/µl
LIMS Lavendula (PCR 3) = 9.6 ng/µl
LIMS Lavendula (PCR 3) = 9.8 ng/µl
LIMS Lavendula (PCR 3) = 12.3 ng/µl

P50 (digested with XbaI and NgoMIV) = 10.3 ng/µl

P93 (digested with XbaI and AgeI) = 4 ng/µl


PCR1 with P50 digested with XbaI and AgeI/NgoMIV

volume reagent
4.89µl P50
3.11 µl PCR 1
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR2 with P50 digested with XbaI and AgeI/NgoMIV

volume reagent
4.38 µl P50
3.62 µl PCR2
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR3 with P50 digested with XbaI and AgeI/NgoMIV

volume reagent
1.64 µl P50
6.36 µl PCR3
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR4 with P50 digested with XbaI and AgeI/NgoMIV

volume reagent
4.3 µl P50
3.7 µl PCR4
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR5 with P50 digested with XbaI and AgeI/NgoMIV

volume reagent
4.26 µl P50
3.74 µl PCR5
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR6 with P50 digested with XbaI and AgeI/NgoMIV

volume reagent
4.26 µl P50
3.74 µl PCR6
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR7 with P50 digested with XbaI and AgeI/NgoMIV

volume reagent
7.83 µl P50
3.27 µl PCR7
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

Negative control

volume reagent
5 µl P50
3 µl ddH2O
1 µl T4 DNA-ligase
1 µl T4-ligase buffer (10x)


PCR1 with P93 digested with XbaI and AgeI

volume reagent
4.89 µl P93
3.11 µl PCR1
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR2 with P93 digested with XbaI and AgeI/NgoMIV

volume reagent
4.38 µl P93
3.62 µl PCR2
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR3 with P93 digested with XbaI and AgeI/NgoMIV

volume reagent
1.52 µl P93
6.48 µl PCR3
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR4 with P93 digested with XbaI and AgeI/NgoMIV

volume reagent
4.3 µl P93
3.7 µl PCR4
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR5 with P93 digested with XbaI and AgeI/NgoMIV

volume reagent
4.26 µl P93
3.74 µl PCR5
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR6 with P93 digested with XbaI and AgeI/NgoMIV

volume reagent
4.26 µl P93
3.74 µl PCR6
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

PCR7 with P93 digested with XbaI and AgeI/NgoMIV

volume reagent
4.72 µl P93
3.28 µl PCR7
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)
  • water bath 16 °C
  • products were named P100-P115

Friday, July 13th

PCR of P73, P80 and P81 to add RFC25 pre- and suffix

Investigator: Jeff, Saskia

Aim of the experiment: Introducing RFC25 pre- and suffix into parts of P73, P80 and P81.

Operational sequence:

  • PCR reaction mixture
volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer (For P73: O46 (TUM12-PhyBGal4bd-fw); for P80: O31 (TUM12-LSPS-fw); for P81: O50 (TUM12-Phyb-fw))
1 µl 10 µM Reverse Primer (For P73: O47 (TUM12-PhyBGal4bd-rv); for P80: O32 (TUM12-LSPS-rv ); for P81: O51 (TUM12-Phyb-rv))
0.25 µL OneTaq Hot Start DNA Polymerase (Finally: 1.25 units/50 µL)
1 µl Plasmid DNA (P80 or P73 or P81)
35.75 µL ELGA Water
=50 µL TOTAL
  • The gradient PCR program was performed after following scheme with following conditions (Tm=58  ΔG=5 °C; P73 in row 9(=61.1 °C); P80 in row 1 (=53.0 °C); P81 in row 7(=58.4 °C):
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
Tm=58 °C; ΔG=5 °C 150 s
68 °C 60 s
Final extension 68 °C 5 min
Hold 4 °C overnight

Miniprep, analcytical digestion and gelelectrophoresis of pGADT7 and pGBKT7

Investigator: Jeff, Saskia

Aim of the experiment:Miniprep, analcytical digestion and gelelectrophoresis of pGADT7 (tube P98, EcoRI and BamHI)and pGBKT7 (tube P99, BamHI and PstI)

Operational sequence:

  • Operated after standard protocol of the lab for analytical digestion and gelelectrophoresis.
  • Gel OK, like expected

Analytical digestion and gelelectrophoresis of pGADT7 (EcoRI and BamHI)and pGBKT7 (EcoRI and PstI).

Preperative digestion and gelelectrophoresis of P79 and O56???

Investigator: Jeff, Saskia, Georg

Aim of the experiment: Preperativ gelelectrophoresis and gel of digested PCR product of LexA (NgoMIV+PstI) and pSB1C3 containing the RFC25 compatible 20aa linker with RFC25 pre- and suffix (AgeI and PstI).

Operational sequence:

  • Operated after standard protocol of the lab for preperative digestion and gelelectrophoresis.
  • Gel OK, like expected.

Preperative digestion and gelelectrophoresis of digested PCR product of LexA (NgoMIV+PstI) and pSB1C3 containing the RFC25 compatible 20aa linker with RFC25 pre- and suffix  (AgeI and PstI)??? Digestion with AgeI and PstI.

Preparative digest of P19

Investigator:Daniela, Ingmar

Digestion of P19 with ApaI


volume reagent
20 µl P19 (concentration: 53.8 ng/µl)
4 µl Buffer B
2 µl ApaI (10 U/µl)
14 µl ddH2O

Incubation: 37 °C, 3 h

DNA preparative gel electrophoresis

  • gel: 1% with LMP-agarose
  • band 1: P50 digested with XbaI and PstI
  • band 2: P50 digested with XbaI and NgOMIV
  • 70 V, 90 min


Gelextration

  • cut the bands
  • QIAquick Gel Extractrion Kit was used
    • step 6 was left out
    • step 9: 30µl buffer, 4 min incubation

Gradient PCR of PAL to optimize the primer annealing temperature

Investigator: Ingmar

Aim of the experiment: As all PCR experiments to amplify the PAL gene contained in P19 failed, we decided to run a gradient PCR to optimize the primer annealing temperature.

PCR
Reaction batch

volume reagent
1 µl 10x Pfu Ultra II buffer
0.5 µl Plasmid P19 template
0.5 µl 1:10 dilution of O15 (10 pmol/µL)
0.5 µl 1:10 dilution of O59 (10 pmol/µL)
0.25 µl dNTP mix
7 µl ddH2O
0.25 µl Pfu Ultra II DNA polymerase (2.5 U / µl)


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 29 95°C 30 sec
gadient 33-47.5 °C 1 min
68°C 3 min
3 1 68°C 5 min
4 1 4°C infinity
  • Verification of the PCR by agarose gel electrophoresis:

10 µl of each PCR tube was mixed with 2 µl 6x DNA loading buffer and loaded into the gel. The separation process lasted 1h at 90 V in a 1% agarose gel.

Gel picture of gradient PCR of P19

  • A bond at the expected length of 2160 bp appears at 47 °C. Therefore a PCR using this primer annealing temperature will done on sunday.


Transformation of P94 - P97 (ligationproducts of pSB1C3 with CHS and OMT respectively) in E.coli

Investigator: Daniela

  • adding 5µl ligation product (P94-P97) in 100µl competent XL blue E.coli cells
  • incubation 30 min on ice
  • 5 min at 37°C
  • adding cells in 1 ml LB (Withouth antibiotica) and incubate at 37°C, 30 min, 180 rpm
  • plate on agar with Ampicillin over night

wrong antibiotica was used!!! Repetition follows!!! Nevertheless, some colonies could be observed.

Ligation of LIMS in pYESnew and pSB1C3

Investigator:Andrea

Transformation

  • adding 5µl ligation product (PCR1-PCR7) in 100µl competent XL blue E.coli cells
  • incubation 30 min on ice
  • 5 min at 37°C
  • adding cells in 1 ml LB (without antibiotica) and incubate at 37°C, 30 min, 180 rpm
  • plate on agar with Ampicillin (pYESnew) or Chloramphenicol (pSB1C3) over night

Preparation of YPD medium

Investigator: A lot of Alois, Martin


Manual for YPD production Yeast Extract Peptone Dextrose Medium (1 liter)

  • 1% yeast extract
  • 2% peptone
  • 2% dextrose (D-glucose)

1. Dissolve the following in 1000 ml of water:

  • 10 g yeast extract
  • 20 g peptone
  • 20 g dextrose (see note below if making plates)


2. Autoclave for 20 minutes on liquid cycle.


3. Store medium at room temperature. The shelf life is approximately one to two months.

Sunday, July 15th

PCR purification of PCR products of P73, P80 and P81 and analytical gelelectrophoresis

Investigator: Jeff

Aim of the experiment: PCR was performed to introduce restriction sites to the gene of interest. MfeI and BamHI for P73 and RFC25 pre- and suffix for P80 and P81. The aim is to contruct fusion proteins with the aid of these restriction sites.

Operational sequence:

  • PCR cleaning with Qiagen PCR purification kit after manufacturer's protocol.
  • Analytical gelelectrophoresis (1% agarose) at 90  for 60&min.

PCR of P73, P80 and P81. As expected the only working PCR is P80 because the miniprep of P73 and P81 from Havard university are already corrupt!

PCR of PAL consless using the optimized primer annealing temperature of 47 °C

Investigator: Ingmar

Aim of the experiment: Amplification of the PAL gene contained in P19.

PCR
Reaction batch

volume reagent
5 µl 10x Pfu Ultra II buffer
2.5 µl Plasmid P19 template
2.5 µl 1:10 dilution of O15 (10 pmol/µL)
2.5 µl 1:10 dilution of O59 (10 pmol/µL)
1.25 µl dNTP mix
35 µl ddH2O
1.25 µl Pfu Ultra II DNA polymerase (2.5 U / µl)


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 29 95°C 30 sec
47 °C 1 min
68°C 3 min
3 1 68°C 5 min
4 1 4°C infinity

PCR successful - Band at about 2,1 kb :

Analytical gelelectrophoresis of PCR product of PAL

Monday, July 16th

Preparative digestion and gelelectrophoresis of P86 and P55

Investigator:Georg Aim of the experiment: Digestion of CYC1-Terminator, ADH1-Promoter for ligation


  • Preparative digestion after manufacturer's advice (NEB) with 20 u PstI and 20 u XbaI in 1x Tango buffer with 25 µl DNA and 4 µl NEB4 10x buffer and 0,4 µl 100x BSA. Water was added to a volume of 40 µl. Restriction time was 3 hours at 37 °C; 3 hours.
  • Preparative gelelectrophoresis after laboratory's standart protocol. (70 V, 90 min)

Preparative digestion ADH1-p, CYC1-t.jpg

  • Gel was stored at -20 °C.

Preperative digestion and gelelectrophoresis of P98 and PCR26

Investigator: Jeff, Georg

Aim of the experiment: Construction of Gal4AD-Pif3, a part of the light-switchable promoter system.

Operational sequence:

  • Preperative digestion after manufacturer's (Fermentas) advise for double-digestion for EcoRI+BamHI and MfeI(MunI)+BamHI; EcoRI+BamHI: Buffer 2X Tango™, 2-fold excess of BamHI; MfeI(MunI)+BamHI: Buffer G.
  • Preperative gelelectrohphoresis after laboratory's standard protocol. (70 V, 90 min)

TUM12 20120716 prep gel.jpg

Plating of received E. coli containing biobrick BBa_K165055

Investigator: Jeff

Aim of the experiment: The received biobrick BBa_K165055 (LexA binding sites + mCYC + Kozak + YFPx2 + ADH1 terminator) were already transformed in E. coli and were in an agar stabs. These E. coli cells were transferred with an inoculation loop on antibiotic selection plates and were incubated over night.

Operational sequence:

  • Bacterias containing plasmids with biobricks were transferred with a sterile inoculation loop on antibiotic plates and were incubated at 37 °C overnight.
  • The biobricks was BBa_K165055 in BBa_J63009 plasmid (AmpR, low copy plasmid)

Preparatory culture of S. cerevisiae

Investigator: Alois, Martin

Aim of the experiment: In order to have sufficient viable cells to inoculate an experimental culture in which we want to compare the growth rate of s. cerevisiae with a strain of brewing yeast (34/70 s. pastorianus weihenstephan) we aim to establish a preparatory over night culture.

Operational sequence: A sample of -80°C stored s. cerevisiae (glycerol stock) is used to inoculate 20ml of YPD-medium. This is shaken overnight at 30°C.

Miniprep of plasmids containing lavendula limonene synthase/citrus limonene synthase

Investigator: Lara

Aim of the experiment: Extract plasmids (pYESnew and pBS1C3) that contain limonene synthase/citrus limonene synthase.

Miniprep with Qiagen Kit; Plasmids p116-p122. Restriction digest with Xba1 and Pst1.

Plasmid DNA concentrations:

p116: 285 ng/µl

p117: 337 ng/µl

p118: 520 ng/µl

p119: 370 ng/µl

p120: 320 ng/µl

p121: 320 ng/µl

p122: 335 ng/µl

Restriction digest of p116-p122

Investigator: Lara

Aim of the experiment: Analytical restriction digest of plasmids p116, p117, p118, p119, p120, p121, p122.


volume reagent
2 µl DNA
2 µl Buffer 4
0,25 µl Xba1
0,25 µl Pst1-HF
15,3 µl ddH2O

Incubation: 37 °C; 1,5 h

Restriction digest with Xba1 and Pst1-HF.

Analytical gel electrophoresis

Investigator: Lara

Aim of the experiment: Analytical gel electrophoresis of products from restriction digest of plasmids p116, p117, p118, p119, p120, p121, p122.

p116: PCR1/pYES

p117: PCR2/pYES

p118: PCR4/pYES

p119: PCR4/pSB1C3

p120: PCR5/pYES

p121: PCR6/pYES

p122: PCR7/pYES

TUM12 LS gelelectrophoresis1607.png

Midiprep of pSB1C3 (RFC25-compatible)

Investigator:Mary

Aim of the experiment: Get a lot of pSB1C3 for further experiments

Midipreparation of the pellet from over night cultures (E.coli, Transformed with pSB1C3 - RFC25; name in registry: K365005)

was done with the Midiprep Kit from Qiagen

Result was named as P123 and had the concentration: 469,5 ng/µl (100µl at all)

PCR-Products of PAL (consless): digestion, extraction and ligation

investigator: Daniela, Mary

Aim of the experiment: digestion of PCR-Products to gain the correct cutting sites for ligation in pYES2 and pSB1C3 afterwards

Purification of PCR-Products with PCR-Purification Kit

  • digestion with Xba1 and HF-Age1 (both NEB)
volume reagent
25µl PCR-product
5µl Buffer NEB4
0.5µl BSA
1µl Xba1 (NEB; 20u/µl)
1µl HF-Age1 (NEB; 20u/µl)
17.5µl bidest. sterile H2O

digestion took 3h at 37°C

  • extraction from preparative gel:

TUM 12 PAL consless (digested with Xba Age).png

PCR of PAL+cons using the optimized primer annealing temperature of 47 °C

Investigator: Daniela

Aim of the experiment: Amplification of the PAL cons gene contained in P19.

PCR
Reaction batch

volume reagent
5 µl 10x Pfu Ultra II buffer
2.5 µl Plasmid P19 template
2.5 µl 1:10 dilution of O22 (10 pmol/µL)
2.5 µl 1:10 dilution of O59 (10 pmol/µL)
1.25 µl dNTP mix
35 µl ddH2O
1.25 µl Pfu Ultra II DNA polymerase (2.5 U / µl)


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 29 95°C 30 sec
47 °C 1 min
68°C 3 min
3 1 68°C 5 min
4 1 4°C infinity

PCR was succesful, band at 2,1kb:

TUM12 120717 PCR PALconsens.jpg

Transformation of P94 - P97 (ligationproducts of pSB1C3 with CHS and OMT respectively) in E.coli

Investigator: Daniela

  • adding 5µl ligation product (P94-P97) in 100µl competent XL blue E.coli cells
  • incubation 30 min on ice
  • 5 min at 37°C
  • adding cells in 1 ml LB (without antibiotica) and incubate at 37°C, 45 min, 180 rpm
  • plate on agar with chloramphenicol over night

-> were succesfull: some colonies were grown

Tuesday, July 17th

Picking of transformed E. coli containing biobrick BBa_K165055

Preparative digest of P123 (pSB1C3 RFC25)

Investigator: Mary, Daniela


Digestion of P123 with Xbal/PstI and XbaI/AgeI


volume reagent
23.1 µl ddH2O
4 µl NEB4
0.4 µl 10x BSA
1 µl XbaI (20 U/µl)
1.5 µl PstI (10U/µl)
10 µl P123
volume reagent
23.35 µl ddH2O
4 µl NEB4
0.4 µl 10x BSA
1 µl XbaI (20 U/µl)
1.25 µl AgeI (10U/µl)
10 µl P123

Incubation: 37 °C, 3 h


DNA preparative gel electrophoresis

  • gel: 1% with LMP-agarose
  • band 1: P123 digested with XbaI and PstI
  • band 2: P123 digested with XbaI and AgeI
  • 70 V, 90 min


Gelextration

  • cut the bands
  • QIAquick Gel Extractrion Kit was used
    • step 6 was left out
    • step 9: 30µl buffer, 4 min incubation

Products were names as follows:

  • P123 digested with XbaI and PstI: P132
  • P123 digested with XbaI and AgeI: P133

PCR-Products of PAL (with consensussequence): digestion and extraction

investigator: Daniela, Mary

Aim of the experiment: digestion of PCR-Products to gain the correct cutting sites for ligation in pYES2 and pSB1C3 afterwards

Purification of PCR-Products with PCR-Purification Kit

  • digestion with Xba1 and HF-Age1 (both NEB)
volume reagent
25µl PCR-product
5µl Buffer NEB4
0.5µl BSA
1µl Xba1 (NEB; 20u/µl)
1µl HF-Age1 (NEB; 20u/µl)
17.5µl bidest. sterile H2O

digestion took 3h at 37°C

  • extraction from preparative gel:

TUM12 120717 PAL+ prepGel.jpg

Picking Clones of CHS and OMT in pSB1C3-RFC25

investigator: Daniela, Mary

Aim of the experiment: preculture over night for the miniprep next day

Repetition of ligation of PCR 15-20 (4CL, CHS and OMT) with pYES (P71 and P72 respectively)

Investigator: Mary, Daniela

Concentration (Nano Drop:
4CL+ (PCR 15) = 40.3 ng/µl
4CL- (PCR 16) = 37.3 ng/µl
CHS+ (PCR 17) = 46.1 ng/µl
CHS- (PCR 18) = 51.2 ng/µl
OMT+ (PCR 19) = 22.3 ng/µl
OMT- (PCR 20) = 16.7 ng/µl

P50 digested with XbaI and PstI = 23.9 ng/µl (the digested Plasmid has the number P71)
P50 digested with XbaI and NgOMIV = 28.4 ng/µl (the digested Plasmid has the number P72)

  • required volumes were calculated using Lab Tools

4CL+ (PCR 15) with P71

volume reagent
5.27 µl P71
2.73 µl 4CL+ (PCR 15)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

4CL- (PCR 16) with P71

volume reagent
5.13 µl P71
2.87 µl 4CL- (PCR 16)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

CHS+ (PCR 17) with P72

volume reagent
5.84 µl P72
2.16 µl CHS+ (PCR 17)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

CHS- (PCR 18) with P72

volume reagent
6 µl P72
2 µl CHS- (PCR 18)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

OMT+ (PCR 19) with P72

volume reagent
4.45 µl P72
3.55 µl OMT+ (PCR 19)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

OMT- (PCR 20) with P72

volume reagent
3.87 µl P72
4,13 µl OMT- (PCR 20)
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)

Negative control

volume reagent
5 µl P71 or P72
3 µl ddH2O
1 µl T4 DNA-ligase
1 µl T4-ligase buffer (10x)
  • water bath 16 °C


Transformation of ligationproducts of 4CL, OMT and CHS respectively in pYES in E.coli

Investigator: Mary,Daniela

  • adding 5µl ligation product in 100µl competent XL blue E.coli cells
  • incubation 30 min on ice
  • 5 min at 37°C
  • adding cells in 1 ml LB (without antibiotica) and incubate at 37°C, 45 min, 180 rpm
  • plate on agar with ampicillin over night

results:

  • CHS+ in pYES (P72) 100 µl: 7 clones
  • CHS- in pYES (P72) 100 µl: 9 clones
  • CHS+ in pYES (P72) Pellet: 111 clones
  • CHS- in pYES (P72) Pellet: 77 clones
  • 4CL+ in pYES (P71) 100 µl: 9 clones
  • 4CL- in pYES (P71) 100 µl: 3 clones
  • 4CL+ in pYES (P71) Pellet: 47 clones
  • 4CL- in pYES (P71) Pellet: 45 clones
  • OMT+ in pYES (P72) 100 µl: 7 clones
  • OMT- in pYES (P72) 100 µl: 5 clones
  • OMT+ in pYES (P72) Pellet: 30 clones
  • OMT- in pYES (P72) Pellet: 53 clones
  • negative control P71 100 µl: 14
  • negative control P71 Pellet: 71
  • negative control P72 100 µl: 7
  • negative control P72 Pellet: 64

Inoculation of YPD medium with S. cerevisiae and brewing yeast strain 34/70 (part 1/3)

investigator: Maddin, Aloisius

Aim of the experiment: Discrimination of growing ability in wort medium

4 different worts:

  • 21%, without hop
  • 21%, without hop, autoclaved
  • 16%, with hop
  • 16%, with hop, autoclaved

were diluted with ELGA to a solution of 12%. These 4 different worts were inoculated with 5ml of preparatory culture of S. cerevisiae and 1ml of brewing yeast strain 34/70 (provided by the Forschungsbrauerei, Weihenstephan). Start OD was measured at 550nm (for table see next experiment). Those 8 flasks were incubated over night at room temperature and 130 rpm.

Wednesday, July 18th

Ligation of plasmid pSB1C3 containing 20aaLinker with LexA and plasmid containing Gal4AD with Pif3 for fusion protein construction

Miniprep of overnight culture from picked transformed E. coli containing biobrick BBa_K165055

Inoculation of YPD medium with S. cerevisiae and brewing yeast strain 34/70 (part 2/3)

Investigators: Martin, Alois

Aim of the experiment: Discrimination of growing ability in wort medium.


After 12h of cultivating the optical density (OD) at 550nm was determined:


Assay Yeast Autoclaved Hop OD 0h OD 12h delta OD
A1 S. cerevisae No No 1.2 2.2 + 1.0
A2 S. cerevisae Yes No 2.0 2.6 + 0.6
A3 S. cerevisae No Yes 1.8 2.4 + 0.6
A4 S. cerevisae Yes Yes 2.4 2.7 + 0.3
B1 34/70 No No 1.6 2.5 + 0.9
B2 34/70 Yes No 3.0 2.9 - 0.1
B3 34/70 No Yes 2.2 2.5 + 0.3
B4 34/70 Yes Yes 2.7 2.8 + 0.1


After 12h of cultivating the S. cerevisiae is growing quite well. There is a tendency that the brewing yeast strain 34/70 is not capable to grow sufficiently in autoclaved (e.g. proteinfree) medium. Since the 34/70 was stored at 4°C over 5 days, directly used to inoculate the medium (no preparatory culture) and we only used 1ml to inoculate with (compared to 5ml of the preparatory culture of S. cerevisiae - because of obvious differences in opacity of the inoculation media) there is not yet a conclusion to be drawn. We decided to incubate for another 24h at least.

new Miniprep of P50 pYES2

Investigators: Andrea

NanoDrop concentration: 303.6 ng/µl (260/280: 1.89)

Transformation of P50 (pYes) in E.coli

Investigator: Katrin

Aim of the experiment: Get more P50(pYes) for further experiments

  • adding 2-3 µl of plasmid P50 in 100µl competent XL blue E.coli cells
  • incubation 30 min on ice
  • 5 min at 37°C
  • adding cells in 1 ml LB (withouth antibiotica) and incubate at 37°C, 30 min, 180 rpm
  • plate on agar with Ampicillin over night

Ligation of 4CL and PAL in pSB1C3-RFC25 and ligation of PAL in pYES

Investigator: Katrin, Daniela

Concentration (Nano Drop:
4CL+ (PCR 15) = 40.3 ng/µl
4CL- (PCR 16) = 37.3 ng/µl
PAL+ (PCR 32) = 25 ng/µl
PAL- (PCR 33) = 16.8 ng/µl

P132 (pSB1C3-RFC25 digested with Xbal and Pstl) = 33.5 ng/µl
P133 (pSB1C3-RFC25 digested with Xbal and AgeI) = 41.8 ng/µl

  • required volumes were calculated using Lab Tools

4CL+ (PCR 15) with P132 (pSB1C3-RFC25)

volume reagent
2.64 µl P132
5.36 µl 4CL+ (PCR 15)
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
9 µl ddH2O

4CL- (PCR 16) with P132 (pSB1C3-RFC25)

volume reagent
2.51 µl P132
5.49 µl 4CL- (PCR 16)
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
9 µl ddH2O

PAL+ (PCR 32) with P133 (pSB1C3-RFC25)

volume reagent
1.29 µl P133
6.71 µl PAL+ (PCR 32)
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
9 µl ddH2O

PAL- (PCR 33) with P133 (pSB1C3-RFC25)

volume reagent
0.91 µl P133
7.09 µl PAL- (PCR 33)
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
9 µl ddH2O

PAL+ (PCR 32) with P72 (pYES)

volume reagent
3.55 µl P72
4.45 µl PAL+ (PCR 32)
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
9 µl ddH2O

PAL- (PCR 33) with P72 (pYES)

volume reagent
2.79 µl P72
5.21 µl PAL- (PCR 33)
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
9 µl ddH2O

Negative control:

volume reagent
5 µl P72, P132 or P133
12 µl ddH2O
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
  • water bath 16 °C

Miniprep of CHS and OMT in pSB1C3-RFC25

Investigator: Daniela

Aim of the experiment: Extract plasmids (pSB1C3-RFC25) that contain CHS and OMT

QIAprepS Spin Miniprep Kit

  • step 3: invert 2-3 times (don't shake to avoid destruction of genomic DNA)

the Minipreps were named as follows:

  • P135: CHS+ in pSB1C3-RFC25 (c = 150.9 ng/µl)
  • P136: CHS- in pSB1C3-RFC25 (c = 204 ng/µl)
  • P137: OMT+ in pSB1C3-RFC25 (c = 179.3 ng/µl)
  • P138: OMT- in pSB1C3-RFC25 (c = 146.7 ng/µl)

Control digest of CHS and OMT in pSB1C3-RFC25

Investigator: Katrin, Daniela

Aim of the experiment: Test whether the ligation of CHS and OMT in pSB1C3 was successful

volume reagent
2.5 µl P135 / P136 / P137 / P138
0.25 µl Xbal (20U/µl)
0.25 µl AgeI (20U/µl)
2 µl NEB4 (10x)
0.2 µl BSA (100x)
14.8 µl ddH2O

TUM12 20120718 P135-P138.jpg

  • pSB1C3: 2070 bp
  • CHS: 1173 bp
  • OMT: 1059 bp

It seems as if the ligation was successful. However it is strange that the band of OMT is lower that the one of CHS. we had the wrong information about the length of OMT -> the right length of OMT is 1059 bp, so everything is fine :)

Picking clones of 4CL, CHS and OMT in pYES

investigator: Katrin, Daniela

Aim of the experiment: preculture over night for the miniprep next day

Thursday, July 19th

Transformation of P124+PCR29 and P126+PCR31

Investigator: Daniela

Aim of the experiment: Transformation of the ligation of P124+PCR29 and P126+PCR31 overnight, to see if ligation has been successful.

Operational sequence:

  • P124+PCR29 ->Chlp
  • negative control: NK1 ->Chlp
  • P126+PCR31 ->Amp
  • negative control: NK2 ->Amp


  • adding 5µl ligation product in 100 µl competent XL blue E.coli cells
  • incubation 30 min on ice
  • 5 min at 37°C
  • adding cells in 1 ml LB (without antibiotica) and incubate at 37°C, 30 min for ampicillin and 45 min for chloramphenicol, 180 rpm
  • plate on agar with ampicillin or chloramphenicol over night

EDIT from 20.07.2012: Unfortunately, no colonies for P124+PCR29 can be identified but colonies on from the concentrated pellet of P126+PCR31 ligation, BUT more but very small colonies on the control plate from the pellet. For further identification the colonies of the ligation has been picked on 21.07.2012 for miniprep and analytical digestion and gelelectrophoresis.

Restriction digest of P79

Investigator: Roman

Aim of the experiment: Double digest of p79 with Xba1 and Age1 to prepair it for ligation with an N- terminal nuclear localization signal sequence

40 µl composition

  • 18 µl plasmid DNA
  • 1 µl Age1
  • 1 µl Xba1
  • 4 µl NEBuffer 4 (10x)
  • 15,6 µl ddH2O
  • 0,4 µl BSA (100x)

The mixture was incubated over night at 37 °C

Oligohybridization of single-stranded DNA for creating SV40 nuclear localization signal for fusion proteins for translocating them into the nucleus

Investigator: Jeff

Aim of the experiment: Oligohybridization of single-stranded DNA (TUM12-SV40-fw and TUM12-SV40-rv)for creating SV40 nuclear localization signal for fusion proteins for translocating them into the nucleus

Operational sequence:

  • 25 µL of 100 pM of TUM12-SV40-fw and 25 µL of 100 pM TUM12-SV40-rv in one ERG
  • Heating up to 95 °C for 30 min
  • Cooling at RT in a styropor box overnight.

Inoculation of YPD medium with S. cerevisiae and brewing yeast strain 34/70 (part 3/3)

Investigators: Andrea, (Martin, Alois)

Aim of the experiment: Discrimination of growing ability in wort medium.


After 40h of cultivating the optical density (OD) at 550nm was determined:


Assay Yeast Autoclaved Hop OD 0h OD 12h OD 40h delta OD
A1 S. cerevisae No No 1.2 2.2 2.5 + 1.3
A2 S. cerevisae Yes No 2.0 2.6 2.7 + 0.7
A3 S. cerevisae No Yes 1.8 2.4 2.6 + 0.8
A4 S. cerevisae Yes Yes 2.4 2.7 2.8 + 0.4
B1 34/70 No No 1.6 2.5 2.8 + 1.2
B2 34/70 Yes No 3.0 2.9 3.0 0
B3 34/70 No Yes 2.2 2.5 2.8 + 0.6
B4 34/70 Yes Yes 2.7 2.8 2.9 + 0.2


After 40h of cultivating the S. cerevisiae is growing comparably to the brewing yeast strain, though we seem to have entered a phase of substrate limitation. Autoclaved media lack solved protein and is thus for neither of the yeasts a satisfying medium; added hop also represses their growth (S. cerevisiae shows a higher susceptability - which seems logic, since the brewing yeast is selected to survive and prosper in beer brewing environment).

The next step would be to brew with our "laboratory strain" S. cerevisiae.

Preparative digest of PCR1 and PCR2 and P50 and P123

Investigator: Andrea

Digestion of PCR1 and PCR2 with XbaI and AgeI

volume reagent
10 µl PCR-Product
2 µl NEB Buffer
0.2 µl BSA
1 µl XbaI (10 U/µl)
1 µl AgeI (10 U/µl)
7 µl ddH2O

Digestion of P50 with XbaI and NgoMIV

volume reagent
10 µl P50
4 µl NEB Buffer
0.4 µl BSA
1 µl XbaI (10 U/µl)
2 µl NgoMIV (10 U/µl)
22.6 µl ddH2O

Digestion of P123 with XbaI and AgeI

volume reagent
20 µl P123
4 µl NEB Buffer
0.4 µl BSA
1 µl XbaI (10 U/µl)
1 µl AgeI (10 U/µl)
14 µl ddH2O

Incubation: 37 °C, 3 h

Preparative gel

Investigator: Andrea

  • 40 µl pSB1C3 + 4 µl loading dye
  • 40 µl pYES2 + 4 µl loading dye
  • 20 µl PCR1 + 2 µl loading dye

19.07.12-prep-gel.png

Ligation of digested PCR1 (digested with XbaI and AgeI) with pSB1C3 (digested with XbaI and AgeI)

Investigator: Andrea

Concentration (Nano Drop:
LIMS Citrus (PCR 1) = 18.6 ng/µl

P50 (digested with XbaI and NgoMIV) = 24.9 ng/µl

P123 (digested with XbaI and AgeI) = 44.5 ng/µl


PCR1 with P123 digested with XbaI and AgeI/NgoMIV

volume reagent
1.19µl P123
6.81 µl PCR 1
1 µl T4 DNA Ligase
1 µl T4-ligase buffer (10x)
  • water bath 16 °C over night

Miniprep of 4CL, CHS and OMT in pYES (P71 and P72)

Investigator: Daniela

Aim of the experiment: Extract plasmids (pYES) that contain 4CL, CHS and OMT

The day before 2 clones were picked for each enzyme.

QIAprepS Spin Miniprep Kit

  • step 3: invert 2-3 times (don't shake to avoid destruction of genomic DNA)

Concentration:

  • 4CL+ in pYES clone 1: c = 172.5 ng/µl
  • 4CL- in pYES clone 1: c = 192.1 ng/µl
  • CHS+ in pYES clone 1: c = 136.6 ng/µl
  • CHS- in pYES clone 1: c = 85.7 ng/µl
  • OMT+ in pYES clone 1: c = 116.0 ng/µl
  • OMT- in pYES clone 1: c = 129.7 ng/µl
  • 4CL+ in pYES clone 2: c = 160.0 ng/µl
  • 4CL- in pYES clone 2: c = 144.5 ng/µl
  • CHS+ in pYES clone 2: c = 128.5 ng/µl
  • CHS- in pYES clone 2: c = 116.2 ng/µl
  • OMT+ in pYES clone 2: c = 142.8 ng/µl
  • OMT- in pYES clone 2: c = 134.5 ng/µl


Control digest of 4CL, CHS and OMT in pYES

Investigator: Daniela

Aim of the experiment: Test whether the ligation of 4CL, CHS and OMT in pYES was successful

volume reagent
2.5 µl 4CL+ in pYES clone 1 / 4CL- in pYES clone 1
0.25 µl Xbal (20U/µl)
0.25 µl PstI (20U/µl)
2 µl NEB4 (10x)
0.2 µl BSA (100x)
14.8 µl ddH2O
volume reagent
3 µl 4CL+ in pYES clone 2
0.25 µl Xbal (20U/µl)
0.25 µl PstI (20U/µl)
2 µl NEB4 (10x)
0.2 µl BSA (100x)
14.3 µl ddH2O
volume reagent
3.5 µl 4CL- in pYES clone 2
0.25 µl Xbal (20U/µl)
0.25 µl PstI (20U/µl)
2 µl NEB4 (10x)
0.2 µl BSA (100x)
13.8 µl ddH2O
volume reagent
3.5 µl CHS+ in pYES clone 1 / OMT+ in pYES clone 1 / OMT- in pYES clone 1 / CHS+ in pYES clone 2 / OMT+ in pYES clone 2 / OMT- in pYES clone 2
0.25 µl Xbal (20U/µl)
0.25 µl AgeI (20U/µl)
2 µl NEB4 (10x)
0.2 µl BSA (100x)
13.8 µl ddH2O
volume reagent
4 µl CHS- in pYES clone 2
0.25 µl Xbal (20U/µl)
0.25 µl AgeI(20U/µl)
2 µl NEB4 (10x)
0.2 µl BSA (100x)
13.3 µl ddH2O
volume reagent
5 µl CHS- in pYES clone 1
0.25 µl Xbal (20U/µl)
0.25 µl AgeI(20U/µl)
2 µl NEB4 (10x)
0.2 µl BSA (100x)
12.3 µl ddH2O

expected bands:

  • pYES: about 5800bp
  • 4CL: 1685bp
  • CHS: 1173bp
  • OMT: 1222bp

TUM 12 20120719 4CL, CHS, OMT in pYES clones1.jpg TUM 12 20120719 4CL, CHS, OMT in pYES clones2.jpg

Transformation of ligationsproducts of 4CL and PAL in pSB1C3-RFC25 and of PAL in pYES in E.coli (see July, 18th)

Investigator: Daniela

  • 4CL+ (PCR15) in pSB1C3-RFC25 (P132) ->Chlp
  • 4CL- (PCR16) in pSB1C3-RFC25 (P132) ->Chlp
  • PAL+ (PCR32) in pSB1C3-RFC25 (P133) ->Chlp
  • PAL- (PCR33) in pSB1C3-RFC25 (P133) ->Chlp
  • PAL+ (PCR32) in pYES(P72) ->Amp
  • PAL- (PCR33) in pYES(P72) ->Amp
  • negative control: P72 ->Amp
  • negative control: P132 ->Chlp
  • negative control: P133 ->Chlp


  • adding 5µl ligation product in 100 µl competent XL blue E.coli cells
  • incubation 30 min on ice
  • 5 min at 37°C
  • adding cells in 1 ml LB (without antibiotica) and incubate at 37°C, 30 min for ampicillin and 45 min for chloramphenicol, 180 rpm
  • plate on agar with ampicillin or chloramphenicol over night

Friday, July 20th

Gel purification of Xba1/ Age1 digested P79

Investigator: Roman

Aim of the Experiment: Aim of the experiment is the purification of the double digested vector p79 (pSB1C3_RFC25_Linker), in which the N- terminal SS is to be cloned.

Operational sequence:

  • The mixture was seperated by gel electrophoresis (LMP agarose)
  • The DNA was cut out of the gel (2 pieces) and weight ==> 200 mg each piece.
  • Afterwards the plasmid DNA was extracted as described in the Quiagen Gel Purification protocol.Elution was performed in two steps (à 25 µl) with elution buffer (heated up to 40°). To improve the yeald of plasmid DNA during the elution, the column was incubated at RT for about 4 minutes before centrifugation

Miniprep of transformed E. coli XL1-Blue with pYES2 new from P50 tube (4x), BBa_K365005 (4x), BBa_K207000 (1x)and BBa_K207001 (1x)

Investigator: Jeff

Aim of the study:: Miniprep

Operational sequence:

  • Miniprep has been performed after manufacturer's protocol. QIAGEN - QIAprep Spin Miniprep Kit.

Analytical digestion and gelelectrophoresis of P152, P155, P156, P157, P158, P159, P160, P161

Investigator: Jeff

Aim of the study: Analytical digestion and gelelectrophoresis of P152, P155, P156, P157, P158, P159, P160, P161, to prove the insert and backbone size.

Operational sequence:

  • Analytical digestion and gelelectrophoresis were performed after lab's standard protocol.
  • Digestion with XbaI and PstI-HF in Buffer 4.

TUM12 20120720 anal.jpg

Picking from the overnight transformation of the ligated P126+PCR31

Investigator: Jeff

Aim of the study: Picking from the overnight transformation of the ligated P126+PCR31, to see whether ligation is successful or not.

Operational sequence:

  • Picking and overnight culture after standard laboratory's protocol. (AmpR LB-medium)

PCR of P23 (LexA, BBa_K105005) to indroduce RFC25 pre- and suffix because last ligation was not successful

Investigator: Jeff

Aim of the experiment: Last ligation with LexA was not successful and the tube with the PCR product was empty from the ligation, so one has to do another PCR for another ligation.

Operational sequence:

  • Clone 3 (tube P23) of BBa_K105005 (LexA) has beed choosen for the PCR.

PCR reaction mixture

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer
1 µl 10 µM Reverse Primer
0.25 µL OneTaq Hot Start DNA Polymerase (Finally: 1.25 units/50 µL)
1 µl Plasmid DNA (BBa_K105005) from P23 (Clone 3)
35.75 µL ELGA Water
=50 µL TOTAL
  • The PCR program was performed after following scheme:
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
55 °C 60 s
68 °C 60 s
Final extension 68 °C 5 min
Hold 4 °C overnight
  • Freezed at -20 °C. Stil has to be purified with PCR purification kit on the next day

Control digest of pYES (P153 and P154)

Investigator: Mary, Ingmar, Daniela

Aim of the experiment: Test whether the vector pYES is right.

volume reagent
1.5 µl P153
0.25 µl AgeI (20U/µl)
2 µl NEB4 (10x)
16.25 µl ddH2O
volume reagent
1.5 µl P153
0.25 µl Xbal (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
14.25 µl ddH2O
volume reagent
1.5 µl P153
0.25 µl Xbal (20U/µl)
0.25 µl AgeI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
14 µl ddH2O
volume reagent
1.5 µl P153
0.25 µl Xbal (20U/µl)
0.25 µl PstI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
14 µl ddH2O
volume reagent
1.5 µl P153
0.25 µl NgoMIV (10U/µl)
2 µl NEB4 (10x)
16.25 µl ddH2O
volume reagent
1.5 µl P153
0.25 µl NgoMIV (10U/µl)
0.25 µl PstI (20U/µl)
0.25 µl SpeI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
13.75 µl ddH2O
volume reagent
2.8 µl P154
0.25 µl AgeI (20U/µl)
2 µl NEB4 (10x)
14.95 µl ddH2O
volume reagent
2.8 µl P154
0.25 µl Xbal (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
12.95 µl ddH2O
volume reagent
2.8 µl P154
0.25 µl Xbal (20U/µl)
0.25 µl AgeI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
12.7 µl ddH2O
volume reagent
2.8 µl P154
0.25 µl Xbal (20U/µl)
0.25 µl PstI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
12.7 µl ddH2O
volume reagent
2.8 µl P154
0.25 µl NgoMIV (10U/µl)
2 µl NEB4 (10x)
14.95 µl ddH2O
volume reagent
2.8 µl P154
0.25 µl NgoMIV (10U/µl)
0.25 µl PstI (20U/µl)
0.25 µl SpeI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
12.45 µl ddH2O


  • P153

TUM12 20120720analyt.verdau P153.jpg


  • P154

TUM12 20120720 ana verdau P154.jpg

The vector seems to be correct. However NgoMIV did not digest the plasmid properly.

Saturday, July 21st

Miniprep of transformed E. coli XL1-Blue with ligation product of P126+PCR31

Investigator: Jeff

Aim of the study: Miniprep

Operational sequence:

  • Miniprep has been performed after manufacturer's protocol. QIAGEN - QIAprep Spin Miniprep Kit.

Analytical digestion and gelelectrophoresis of the minipreps of transformed E. coli XL1-Blue with ligation product of P126+PCR31

Investigator: Jeff

Aim of the experiment: To see whether ligation ist successful.

  • Reaction batch for each plasmid:
Reagent Volume in µl
Tango Buffer 10x 4 µl
NdeI (Fermentas) 0.5 µl
BamHI (Fermentas) 0.5 µl
Plasmid DNA 2.5 µl
ddH2O 12.5 µl
TOTAL 20 µl
  • Incubation at 37 °C for 1 h 30 min.
  • Analytical gelelectrophoresis at 90 V for 1 h.
  • Order of gel-pockets:
100 bp ladder P172 P173 P174 1000 bp ladder
corrupt corrupt corrupt

TUM12 20120721 anal.jpg

  • Ligation was not successful!

PCR purification of PCR products from P23

Investigator: Jeff

Aim of the experiment Purification of PCR products from P23.

Operational sequence:

  • The 4 tubes with PCR products of P23 were purificated with the PCR purification kit from Qiagen after manufacturer'S protocol.

Sunday, July 22nd

Preparative digest of pYes2 RFC 25 and ligation with PCR products PCR 15 - 20 and 32+33

Investigator: Ingmar

Aim of the experiment: Intsert the genes of PAL, 4CL, CHS and OMT in pYEs2 RFC 25 in order to test their expression in yeast.


Preparative digest of P 154 with XbaI and NgoMIV and of P 153 with XbaI and PstI

volume reagent
7 µl ddH2O
2.5 µl NEB 4 buffer
2.5 µl Tango buffer
4 µl XbaI (10 U/µl)
4 µl NgoMIV (10 U/µl)
30 µl P 153
volume reagent
10 µl ddH2O
4 µl Tango buffer
2 µl XbaI (10 U/µl)
4 µl PstI (10 U/µl)
20 µl P 154

Incubation: 37 °C, 3 h


DNA preparative gel electrophoresis

  • gel: 1% with LMP-agarose
  • Each digest product was mixed with an adequate volume of DNA loading buffer and loaded into the gel
  • The separation process lasted 90 min at 70 V.

Gel picture of control digest with PstI

  • All digest products show the expected bonds at 5849 bp (digest with XbaI and NgoMIV) and 5785 bp (digest with XbaI and PstI) respectively.


Gelextration

  • cut the bands
  • QIAquick Gel Extractrion Kit was used
    • step 6 was left out
    • step 9: 30µl buffer, 4 min incubation

Products were named as follows:

  • P154 digested with XbaI and NgoMIV: P175
  • P153 digested with XbaI and PstI: P176

Ligation

PCR product Volume Vector Volume Volume T4 DNA Ligase Volume T4 DNA Ligase buffer Volume ddH20 New Plasimd Number
PCR15 5.25 P 176 2.75 1 µl 2 µl 9 µl P 177
PCR16 5.25 P 176 2.75 1 µl 2 µl 9 µl P 178
PCR 17 7.2 P 175 0.8 1 µl 2 µl 9 µl P 179
PCR 18 7.2 P 175 0.8 1 µl 2 µl 9 µl P 180
PCR 19 7.1 P 175 0.9 1 µl 2 µl 9 µl P 181
PCR 20 7.1 P 175 0.9 1 µl 2 µl 9 µl P 182
PCR 32 7.25 P 175 0.75 1 µl 2 µl 9 µl P 183
PCR 33 7.5 P 175 0.5 1 µl 2 µl 9 µl P 184

Monday, July 23rd

Miniprep of PAL, 4CL in pSB1C3 and PAL in pYES

Investigator: Mary

Aim of the experiment: Extract plasmids (pYES and pSB1C3-RFC25) that contain 4CL and PAL´

The day before one clone were picked for each enzyme from plates from 19th July 2012.

QIAprepS Spin Miniprep Kit

  • step 3: invert 2-3 times (don't shake to avoid destruction of genomic DNA)

Concentration:

  • 4CL+ (PCR15) in pSB1C3-RF25 (P132): c = 340 ng/µl -> new name of Ligationproduct after Miniprep: P185
  • 4CL- (PCR16) in pSB1C3-RF25 (P132): c = 385 ng/µl -> new name of Ligationproduct after Miniprep: P186
  • PAL+ (PCR32) in pSB1C3-RF25 (P133): c = 395 ng/µl -> new name of Ligationproduct after Miniprep: P187
  • PAL- (PCR33) in pSB1C3-RF25 (P133): c = 255 ng/µl -> new name of Ligationproduct after Miniprep: P188
  • PAL+ (PCR32) in pYES (P72): c = 190 ng/µl
  • PAL- (PCR33) in pYES (P72): c = 238 ng/µl


Control digest of 4CL, PAL in pSB1C3-RFC25 and PAL in pYES

Investigator: Mary

Aim of the experiment: Test whether the ligation of 4CL, PAL in pSB1C3-RFC25 and PAL in pYES was successful

Plasmids are taken from miniprep from 23.07.2012

volume reagent
2.5 µl 4CL+ in pSB1C3-RFC25 / 4CL- in pSB1C3-RFC25
0.25 µl Xbal (20U/µl)
0.25 µl PstI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
13 µl ddH2O
volume reagent
2.5 µl PAL+ in pSB1C3-RFC25 / PAL- in pSB1C3-RFC25
0.25 µl Xbal (20U/µl)
0.25 µl AgeI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
13 µl ddH2O
volume reagent
2.5 µl PAL+ in pSB1C3-RFC25 / PAL- in pSB1C3-RFC25
0.25 µl Xbal (20U/µl)
0.25 µl AgeI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
13 µl ddH2O


expected bands:

  • pYES: about 5800bp
  • pSB1C3-RFC25: 2070bp
  • 4CL: 1685bp
  • PAL: 2151bp

TUM12 120723 kontrollverdau wdh.jpg

Ligation of PAL+/- in pYES was not succesful Ligation of PAL+/- and 4CL+/- in pSB1C3-RFC25 were succesful! (pSB1C3 is overlapping with PAL)

APT Solubilisation and Transformation

Investigator: Mary

Aim of the experiment: solubilisation of the synthetic gene of APT and transformation of sent plasmid (including APT) in E.coli to copy it if necessary

short zentrifugation of sent product and adding 50µl bidest. H2O to it (5µg in 50µl = concentration of 0.1 µg/µl) the dissolved product was named as G1 (as Geneproduct number 1) and stored at -20°C

2µl of solved product used for transformation in Ecoli (Kit of Quiagen) and Amp-resistance (said GeneArt) Plating cells on Agar with Amp, 37°C over night


Preparative digest of APT

Investigator: Mary

Aim of the experiment: Extraction of the sequence of APT out of the sent plasmid.

volume reagent
10µl ddH2O
4 µl NEB 4 buffer
4 µl BSA (10x)
1 µl XbaI (20 U/µl)
1 µl AgeI (20 U/µl)
20 µl solubilised APT-product (see Solubilisation APT)

Incubation: 37°C, 2.5h


Bond at 1244bp as expected:


TUM12 120723 prepGel von APT.jpg

The bond was cutted out of the gel and stored at -20°C (P189)

Transformation of ligationsproducts of 4CL, CHS, OMT and PAL in pYES in E.Coli (Ligation see 22th of July)

Investigator: Mary

Aim of the experiment: ligation of enzymes in pYES to transform it into yeast if this was successful.

  • 4CL+ (PCR15) in pYES (P176) -> new name: P177
  • 4CL- (PCR16) in pYES (P176) -> new name: P178
  • CHS+ (PCR17) in pYES (P175) -> new name: P179
  • CHS- (PCR18) in pYES (P175) -> new name: P180
  • OMT+ (PCR19) in pYES (P175) -> new name: P181
  • OMT- (PCR20) in pYES (P175) -> new name: P182
  • PAL+ (PCR32) in pYES (P175) -> new name: P183
  • PAL- (PCR33) in pYES (P175) -> new name: P184
  • adding 5µl ligation product in 100 µl competent XL blue E.coli cells
  • incubation 30 min on ice
  • 5 min at 37°C
  • adding cells in 1 ml LB (without antibiotica) and incubate at 37°C, 30 min 180 rpm
  • plate on agar with ampicillin and incubate over night at 37°C

Gel- purification of hybridized oligos: SV40 SS (Tube PCR34)

Investigator: Roman Aim of the experiment: Purification of the hybridized oligos in order to make them ready for ligation in pSB1C3 Operational Sequence:

  • oligos were seperated by gel electrophoresis (LMP agarose)
  • picture:

preparative gel electrophoresis

  • afterwards the DNA was cut out and extracted with the Quiagen Gel- purification kit as described in the manufacturer's protocol. Elution was performed in two steps á 25 µl elution buffer. DNA was collected in one tube, which was annotated with PCR34 purif.
  • determined concentration (NanoDrop): ca. 385 ng/µl

Tuesday, July 24nd

Gelextraction of APT digested with Xbal and AgeI (P189)

Investigator: Daniela

Gelextration

  • QIAquick Gel Extractrion Kit was used
  • the product was named P189
  • concentration: c = 9.1 ng/µl

Ligation of APT (P189) in pSB1C3-RFC25 (P133)

Investigator: Daniela

APT (P189) in pSB1C3-RFC25 (P133)

volume reagent
0.86 µl P133
7.14 µl APT (P189)
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
9 µl ddH2O

Negative control:

volume reagent
0.86 µl P133
16.14 µl ddH2O
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
  • water bath 16 °C

NanoDrop determination of PCR34- PCR38

Investigator:Roman

Aim: Determination of the concentration of the samples previously to the ligation

Determined values:

PCR Product Concentration in ng/µl
PCR34 385 (hybridized oligos)
PCR35 41,2
PCR36 39,5
PCR37 41,9
PCR38 57,4
  • PCR38 will be used in following restriction digest

Restriction digest of p123 and PCR38 with NgoMIV and Pst1

Investigator: Roman Aim of the experiment: To prepare samples of p123 (pSB1C3 RFC25) and PCR38 for a following ligation Operational sequence: p123 was digested in a 40 µl preparation (miniprep product):

Substance Volume
Plasmid- DNA 20 µl
Enzyme NgoMIV 2 µl
Enzyme Pst1 2 µl
Buffer 4 4 µl
ddH2O 12 µl

PCR38 was digested in a 50 µl preparation (PCR product)

Substance Volume
Purified PCR product 25
Enzyme NgoMIV 2 µl
Enzyme Pst1 2 µl
Buffer 4 5 µl
ddH2O 16 µl

The preparations were incubated at 37°C for 3h and then stored at -20°C in box The tubes were annotated with "p123_doubledigest_NgoMIV+Pst1_unpurified_20120724" and "PCR38_doubledigest_NgoMIV+Pst1_unpurified_20120724" Afterwards, the samples were load on a 1% universal agarose gel and separated at 100 V for ca. 45 min. Corresponding gel- bands were cut out and stored at -20°C over night until extraction.

Ligation of p151 and PCR34

Investigator: Roman

Aim: Ligation of fragments previously to a transformation

Operational Sequence: Length of fragments:

  • p151: 2070 bp; c = 9,5 ng/µl
  • PCR34: 67 bp; c = 385 ng/µl

20 µl preparation:

Substance Volume
p151- DNA 11 µl
PCR34- DNA 3 µl (out of a 1/100 dilution)
Ligase 0,5
T4 Ligase Buffer 2 µl
ddH2O 3,5 µl

Negative controls were prepared the same way, using 3 µl of ddH2O instead of PCR34- DNA. The preparation was incubated 30 min at room temperature and then over night at 16°C (water bath). Afterwards, the samples were stored at 4°C until the transformation.

Ligation of p126 and PCR31

Investigator: Roman

Aim:Ligation of fragments previously to a transformation

Operational Sequence: Length of fragments:

  • p126: 7961 bp; c = 46 ng/µl
  • PCR34: 306 bp; c = 11,3 ng/µl

10 µl preparation:

Substance Volume
p126- DNA 2 µl
PCR31- DNA 1 µl
Ligase 0,5
T4 Ligase Buffer 1 µl
ddH2O 5,5 µl

Negative controls were prepared the same way, using 1 µl of ddH2O instead of PCR31- DNA. The preparation was incubated 30 min at room temperature and then over night at 16°C (water bath).

Ligation of p175 with "PCR1, 19.7.2012" and p144

Investigator: Roman

Aim: Ligation of fragments previously to a transformation

Operational Sequence: Length of fragments:

  • p175: 5900 bp; c = 107,3 ng/µl
  • PCR1: 1680 bp; c = 18 ng/µl
  • p144: ??? bp; c = ???

10 µl preparation:

Substance Volume
p175- DNA 1 µl
PCR1/ p144- DNA 3 µl
Ligase 0,5
T4 Ligase Buffer 1 µl
ddH2O 4,5 µl

Note: This preparation was not made optimal, due to use of a wrong fragment lengths (PCR1 and p144, respectively) during the calculation of the volumes. Negative controls were prepared the same way, using 3 µl of ddH2O instead of PCR fragment. The preparation was incubated 30 min at room temperature and then over night at 16°C (water bath).

Preparation of yeast SCU Minimal Medium for Plates

Investigator: Katrin, Daniela

  • The recipe was taken from the pYES2 manual.
  • The ingredients were dissolved in 900 ml dest. water (ELGA) corresponding to the recipe. Lysine was only available as lysine-dihydrochloride, therefore 0.149 g instead of 0.1 g were used. Uracil was omited.
  • The medium was divided in 2 x 450 ml. One will later be used as the induction medium through the addition of galactose the other one will be used as the non-induction medium (addition of glucose). Sugar solutions will be added after autoclaving to prevent maillard-reaction.
  • 10 g agar and a magnetic stir bar were added to each preparation
  • Autoclaving.
  • Glucose solution: 10 g glucose were dissolved in 50 ml ELGA.
  • Galactose solution: 10 g galactose were dissolved in 50 ml ELGA.
  • No raffinose will be used.
  • Autoclaving

Transformation of APT in pSB1C3-RFC25 (P190)

Investigator: Daniela

  • APT (P189) in pSB1C3 (P133) -> new name: P190
  • Negative control P133


  • adding 5µl ligation product in 100 µl competent XL blue E.coli cells
  • incubation 30 min on ice
  • 5 min at 37°C
  • adding cells in 1 ml LB (without antibiotica) and incubate at 37°C, 45 min 180 rpm
  • plate on agar with chloramphenicol and incubate over night at 37°C

Picking Clones of 4CL, CHS, OMT and PAL in pYES and APT in original plasmid

investigator: Daniela

Aim of the experiment: preculture over night for the miniprep next day

Wednesday, July 25th

Restriction digest of p123 with Xba1 and Age1

Investigator: Roman

Aim of the experiment: Aim of the experiment is the preparation of the vector pSB1C3 RFC25 (p123) for a ligation with the PCR fragment PCR34 (as repetition for the ligation of p151 with PCR34, which has probably not worked, due to low vector concentration.

Operational sequence: 30 µl preparation for restriction digest of p123

Substance Volume
p123- DNA 10 µl (results in ca. 5µg DNA)
Xba1- RE 1 µl
Age1- RE 1 µl
NEBuffer 4 3 µl
ddH2O 15 µl

The preparation was incubated at 37°C for 3,5 h. Afterwards the fragments were purificated by means of a preparative gel electrophoresis (see below).

Restriction digest of p123 with Age1 and Pst1

Investigator: Roman

Aim of the experiment: Aim of the experiment is the preparation of the pSB1C3- Vector (p123) for a ligation with PCR38 (which has been digested with NgoMIV and Pst1).

Operational sequence: 30 µl preparation for restriction digest of p123

Substance Volume
p123- DNA 10 µl (results in ca. 5µg DNA)
Pst1- RE 1 µl
Age1- RE 1 µl
NEBuffer 4 3 µl
ddH2O 15 µl

The preparation was incubated at 37°C for 3,5 h. Afterwards the fragments were purificated by means of a preparative gel electrophoresis (see below).

Gel extraction of PCR38 and p123 (both digested with NgoMIV and Pst1)

Investigator: Roman

Aim of the experiment: The separated PCR38 and p123 (pSB1C3 RFC25) DNA- fragments from yesterday's restriction digest (both NgoMIV and Pst1) are to be extracted from agarose- gel (which has been stored at -20°C over night), to make them ready for further usage.

Operational sequence: The extraction was performed as described in the manual of the Quiagen Gel- extraction kit. Elution was performed with 30 µl of elution- buffer EB in two steps (à 15 µl), temperated at 50°C. Concentration was determined with NanoDrop:

  • PCR38: 17,3 ng/µl
  • p123: 37,2 ng/µl

Tubes were annotated with p191 (p123 NgoMIV/Pst1) and p192 (PCR38 NgoMIV/Pst1).

Gel purification of p123 (Xba1/Age1 double digest) and p123 (Age1/Pst1 double digest)

Investigator: Roman

Aim of the experiment: Aim of the experiment is the purification of two different double digested p123 samples, to make them ready for ligation with the inserts PCR38 and PCR34, respectively.

Operational sequence: The samples were loaded on a 1% universal agarose gel and separated at 100 V for about 45 min. Afterwards, the corresponding gel- bands were cut out and weight. Extraction from gel was performed as described in the manufacturers protocoll (Quiagen gel extraction kit). Changes: Elution was performed in one step with 30µl ddH2O (autoclaved) temperated at 50°C. Concentrations were determined with NanoDrop:

  • p123 (Xba1/Age1): 70,8 ng/µl
  • p123 (Pst1/Age1): 59,1 ng/µl

The tubes were annotated with p206 (p123 Age1/Pst1) and p207 (p123 Age1/Xba1).

Ligation of p123 (Age1/Pst1) and PCR38

Investigator: Roman

Aim of the experiment: Ligation of the fragments p123 and PCR38

Operational sequence: Length of fragments:

  • p123: 2070 bp; c = 59,1 ng/µl
  • PCR38: 617 bp; c = 17,3 ng/µl

20 µl preparation:

Substance Volume
p123- DNA 3 µl (ca. 180 ng vector- dna)
PCR38- DNA 10 µl
Ligase 0,5
T4 Ligase Buffer 2 µl
ddH2O 4,5 µl

Negative controls were prepared the same way, using 10 µl of ddH2O instead of PCR38- DNA. The preparation was incubated 30 min at room temperature and then over night at 16°C (water bath). Afterwards, the samples were stored at 4°C in the fridge until transformation.

Ligation of p123 (Age1/Xba1) and PCR34

Investigator: Roman

Aim of the experiment: Ligation of fragments p123 and PCR34 Operational sequence: Length of fragments:

  • p123: 2070 bp; c = 70,8 ng/µl
  • PCR34: 67 bp; c = 3,85 ng/µl (1:100 dilution of original sample)

20 µl preparation:

Substance Volume
p123- DNA 3 µl (ca. 210 ng vector- dna)
PCR34- DNA 6 µl (out of 1:100 dilution)
Ligase 0,5
T4 Ligase Buffer 2 µl
ddH2O 8,5 µl

Negative controls were prepared the same way, using 6 µl of ddH2O instead of PCR34- DNA. The preparation was incubated 30 min at room temperature and then over night at 16°C (water bath). Afterwards, the samples were stored at 4°C in the fridge until transformation.

Miniprep of 4CL, CHS, OMT, PAL in pYes and APT in original plasmid from GeneArt

Investigator: Katrin

Aim of the experiment: extraction of plasmids (pYes2) that contain 4CL, CHS, OMT, PAL; extraction of original plasmid from GeneArt with APT

QIAprepS Spin Miniprep Kit

  • step 3: invert 2-3 times (don't shake to avoid destruction of genomic DNA)

the Minipreps were named as follows:

  • P193: 4CHL+ in pSB1C3-RFC25 (c = 110,7 ng/µl)
  • P194: 4CL- in pYEs (c = 342,8 ng/µl)
  • P195: CHS+ in pYEs (c = 423,6 ng/µl)
  • P196: CHS- in pYEs (c = 92,1 ng/µl)
  • P197: OMT+ in pYEs (c = 394,6 ng/µl)
  • P198: OMT- in pYEs (c = 183,0 ng/µl)
  • P199: PAL+ in pYEs (c = 138,4 ng/µl)
  • P200: PAL- in pYEs (c = 464,5 ng/µl)
  • P201: APT in original plasmid (c = 260,0 ng/µl)

Transformation of Ligation-products into E.coli XL-1 Blue

Investigator: Andrea

  • for each Biobrick 100 µl cells were used and pooled together with 5 µl of ligation product from the 24th of july

(3 hours at 16°C and over night at 4 °C) and from the 19th of july (5 days at 16°C)

  • Incubation on ice for 30 min
  • 5 min heat shock at 37 °C
  • cells were prefilled with 1 ml of LB-medium and incubated in a cell-culture shaker at 37 °C for 40 min
  • 100 µl of these cell suspension were plated on antibiotic selection plates (ligations in pYES: Ampicillin; ligations in pSB1C3: Chloramphenicol)
  • cell suspension was centrifuged at 13000 rpm for 90 s for resuspending the pellet with 100 µl LB and plating also
  • incubation at 37 °C overnight

Thursday, July 26th

Transformation of ligation products of P126+PCR31, P151+PCR34, P123+PCR38 and P123+PCR34 in E. coli XL1-Blue

Investigator: Jeff

Aim of the experiment:Transformation of ligation products of P126+PCR31 (AmpR), P151+PCR34 (CamR), P123+PCR38 (CamR) and P123+PCR34 (CamR) in E. coli XL1-Blue

Operational sequence:

  • Performed after lab's standard protocol.

Miniprep of APT in pSB1C3-RFC25 and control digestion with Xba1 and Pst1

Investigator: Mary

Aim of the experiment: extraction of plasmid (pSB1C3-RFC25) that contains APT and testing if ligation was succesful; three clones were picked the day before

Miniprep

QIAprepS Spin Miniprep Kit

  • step 3: invert 2-3 times (don't shake to avoid destruction of genomic DNA)

the Minipreps were named as follows:

  • APT in pSB1C3-RFC25 clone 1: c=96 ng/µl
  • APT in pSB1C3-RFC25 clone 2: c=108 ng/µl
  • APT in pSB1C3-RFC25 clone 3: c=97 ng/µl

Control digest


volume reagent
2.5 µl 4CL+/-, PAL+/-, CHS+/-, OMT+/-, APT+/-
0.25 µl Xbal (20U/µl)
0.25 µl PstI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
13 µl ddH2O


expected bands:

  • pSB1C3-RF25: 2070bp
  • APT: 1244bp

TUM12 120726 APT in pSB1C3.jpg

Control digest of 4CL, PAL, CHS, OMT, APT in pYES

Investigator: Mary

Aim of the experiment: Test whether the ligation of 4CL, PAL, CHS, OMT, APT in pYES was successful

Plasmids are taken from miniprep from 25.07.2012

volume reagent
2.5 µl 4CL+/-, PAL+/-, CHS+/-, OMT+/-, APT+/-
0.25 µl Xbal (20U/µl)
0.25 µl PstI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
13 µl ddH2O


expected bands:

  • pYES: about 5800bp
  • 4CL: 1685bp
  • PAL: 2151bp
  • CHS: 1173bp
  • OMT: 1222bp
  • APT: 1244bp

TUM12 120726 pYDS controldigest.jpg

pour on yeast agarplates

Investigator: Mary

Aim of the experiment: prepare selection-agarplates without Uracil (Some plates including glucose, some including galactose)

it was strange that the agar was still pretty liquid after waiting for one hour.

see pYES-manual

Picking of clones of transformation from 25.07.

Investigator: Lara

Aim: Amplification of clones for extraction of plasmids and subsequent proof of functional ligation.


6 clones were picked for each ligation (PCR1 in pYESnew, PCR2 (p144) in pYESnew and PCR in pSB1C3. Clones containing pYESnew were put into 4 ml LB with 4 µl of ampillicin stock solution, clones containing pSB1C3 were put into chloramphenicol-containing media. Incubation at 37 °C over night.

Transformation of plasmids P40&P42 into E.coli XL1 blue

Investigator: Lara

Aim:

Transformation of plasmids P40 and P42 into E.coli XL1 blue to get plasmids of higher quality. P40&P42 are directly extracted from the expression strain BL21(DE). The quality of the plasmids might not be sufficient for Quickchange site-directed mutagenesis. Therefore transformation into E.coli XL1 blue and subsequent plasmid preparation to get plasmids with sufficient quality for SDM.

Procedure:

100 μl of competent XL1 blue cells were thawed on ice. 1 µl plasmid DNA (P40 or P42) was added. Incubation for 30 min on ice. 5 min heatshock at 37°C. 1 ml of LB medium without antibiotic was added, incubation for 45 min at 180 rpm/37°C. After incubation, 100 µl of the cell suspension were plated on antibiotic containing plates (P40: Kan, P42: Amp). The remaining solution was centrifuged for 60 sec, resuspended in 100 µl LB and plated, as well. Incubation at 37 °C over night.

Friday, July 27th

Picking from the overnight transformation of ligated P126+PCR31, P151+PCR34, P123+PCR38 and P123+PCR34 in E. coli XL1-Blue

Investigator: Jeff

Aim of the experiment Picking of transformated E. coliXL1-Blue with ligation product of P126+PCR31 (AmpR), P151+PCR34 (CamR), P123+PCR38 (CamR) and P123+PCR34 (CamR).

Procedure

  • Colonies were picked with pipette tips and transformed into a new cell-culture tube with 4 ml of LB-medium and antibiotics and were put overnight in a 180 rpm cell culture shaker at 37 °C. P126+PCR31 (AmpR), P151+PCR34 (CamR), P123+PCR38 (CamR) and P123+PCR34 (CamR)

Transferring E. coliXL1-Blue colonies, transformed with BBa_I15008 (heme oxygenase) and BBa_K105005 (LexA), from old antibiotic plates on new plates

Investigator: Jeff

Aim of the experiment With a sterile incolation loop the colonies were transferred on a new antibiotic plate, because the plates are already 4 weeks old.

Procedure

  • Incolation loop was put for few second into the flame of a Bunsen burner
  • Colonies from plate with BBa_I15008 (heme oxygenase, KanR) and BBa_K105005 (LexA, AmpR) were transferred on a new antibiotic plate
  • Overnight-culture at 37 °C

Miniprep and control digest of PAL in pYES picked on thursday 26th July

Investigator: Ingmar

Aim of the experiment: Test whether the ligation of PAL in pYES was successful

Miniprep Using a Quiagen Miniprep kit a plasmid isolation of two picked clones of the PAL+ in pYes2 RFC25 ligation was done. The miniprep product of the first clone was named P219, the one of the second clone P220. Both were used for the following control digest.

control digest

volume reagent
2.5 µl PAL+
0.25 µl Xbal (20U/µl)
0.25 µl PstI (20U/µl)
2 µl NEB4 (10x)
2 µl BSA (10x)
13 µl ddH2O


expected bands:

  • pYES:5819bp
  • PAL: 2151bp

TUM12 Coumaryl P219 und P220 27.07.2012.jpg

As the picture only shows one band at the expected length of the vecotr backbone the ligation was not successfull and will be repeated with a reduced quotient of insert to vector of 3.

Ligation of PAL+ (PCR32) and APT (P189) with pYes2 RFC25 (P175)

Investigator: Ingmar

Aim of the experiment: Insert the genes of PAL and APT in pYEs2 RFC 25 in order to test their expression in yeast.

Ligation

PCR product Volume Vector Volume Volume T4 DNA Ligase Volume T4 DNA Ligase buffer Volume ddH20 New Plasimd Number
PAL+ (PCR32) 6.6 P 175 1.4 1 µl 2 µl 9 µl P 221
APT (P 189) 7.06 P 175 0.94 1 µl 2 µl 9 µl P 222
control: ddH2O 7 P 175 1 1 µl 2 µl 9 µl

The Ligation product of PAL+ and pYes was labeled P233, the one of APT and pYes P234.

Plasmid extraction of plasmids PCR1/pYes, P144/pYES, PCR1/pSB1C3

Investigator: Lara

Aim of the experiment: Extract plasmids from ligation of PCR1 in pYES, P144 in pYES and PCR1 in pSB1C3 for further analytical restriction digest. (6 clones were picked for each ligation and plasmids subsequently extracted.)

Prodedure: Plasmids were extraced by using Qiagen plasmid miniprep kit.

Following concentrations were obtained:

1_1 - 1_6

  • PCR1 in pYESnew clone 1: c=66 ng/µl
  • PCR1 in pYESnew clone 2: c=182 ng/µl
  • PCR1 in pYESnew clone 3: c=98 ng/µl
  • PCR1 in pYESnew clone 4: c=326 ng/µl
  • PCR1 in pYESnew clone 5: c=87 ng/µl
  • PCR1 in pYESnew clone 6: c=156 ng/µl

2_1 - 2_6

  • P144(PCR2) in pYESnew clone 1: c=195 ng/µl
  • P144(PCR2) in pYESnew clone 2: c=202 ng/µl
  • P144(PCR2) in pYESnew clone 3: c=198 ng/µl
  • P144(PCR2) in pYESnew clone 4: c=77 ng/µl
  • P144(PCR2) in pYESnew clone 5: c=95 ng/µl
  • P144(PCR2) in pYESnew clone 6: c=200 ng/µl

3_1 -3_6

  • PCR1 in pSB1C3-RFC25 clone 1: c=116 ng/µl
  • PCR1 in pSB1C3-RFC25 clone 2: c=110 ng/µl
  • PCR1 in pSB1C3-RFC25 clone 3: c=116 ng/µl
  • PCR1 in pSB1C3-RFC25 clone 4: c=112 ng/µl
  • PCR1 in pSB1C3-RFC25 clone 5: c=139 ng/µl
  • PCR1 in pSB1C3-RFC25 clone 6: c=80 ng/µl

Restriction digest of plasmids from 6 clones each of PCR1/pYESnew, P144(PCR2)/pYESnew, PCR1/pSB1C3

Investigator: Lara

Aim of the experiment: Analytical restriction digest of plasmids to check for insert.


volume reagent
3 µl DNA
2 µl Buffer 4
0,25 µl Xba1
0,25 µl Spe1-HF
0,2 µl BSA(100x)
14,3 µl ddH2O

Incubation: 37 °C; 1,5 h

A mastermix for 19 samples was made.


Analytical gel electrophoresis

Investigator: Lara

Aim of the experiment: Analytical gel electrophoresis of products from restriction digest.

TUM12 LS analytgel2707 1.png

TUM12 LS analytgel2707 2.png

Small-Scale Yeast Transformation of 4CL, CHS, OMT and PAL- in pYES

Investigator: Daniela

Aim of the experiment:Transformation of P193 - P198 and P200 in Yeast

The protocol on page 13 of the pYES2 manual was used.

Only modifications are noted:

step 1: inoculate in 4 ml YPD medium

step 2: OD600 = 10 -> to determine a OD600 of 0.4 in 50 ml, 2.5 ml yeast suspension and 47.5 ml YPD medium were used (1:20 dilution)

steps 3 and 4: centrifugation for 5 min, 4 °C

step 5: room temperature was about 35 °C

step 6:

1 µg plasmid DNA

  • P193: c = 110.7 ng/µl -> 9 µl
  • P194: c = 342.8 ng/µl -> 3 µl
  • P195: c = 423.6 ng/µl -> 2.4 µl
  • P196: c = 92.1 ng/µl -> 11 µl
  • P197: c = 394.6 ng/µl -> 2.5 µl
  • P198: c = 183.4 ng/µl -> 5.5 µl
  • P200: c = 464.5 ng/µl -> 2.2 µl

100 µg denatured sheared salmon sperm: the one from Simon was used -> 10 µl

step 8: incubation was carried out at 35 °C because the thermoblock did not achieve a lower temperature

The SCU- plates are incubated at 30°C over the weekend.

Colonies were grown on 2 plates (31.07.2012): CHS+ : 1 colony OMT+ : 3 colonies

-> repetition of transformation on plates with glucose!

Saturday, July 28th

Miniprep of picked E. coli XL1-Blue transformated with ligation products of P126+PCR31, P151+PCR34, P123+PCR38 and P123+PCR34

Sunday, July 29th

Picking of clones from PAL+ for a overnight culture

Investigator: Ingmar

Aim of the experiment:Inoculation of LB medium with clones picked from the transfomation of P183 (PAL+ (PCR32) in pYES (P175)) done on Monday, 23rd July in order to test on monday wheather the Ligation was successfull. Operationale sequence:

  • Two clones were picked an transferred to 6 ml LB medium containing 1:1000 Ampicillin.
  • Incubation overnight at 37°C, 180 rpm.

Monday, July 30th

Analytical digestion and gelelectrophoresis of the plasmids P221-P232

Investigator: Saskia

Aim of the experiment: Analytical digest of P221-P223 with NdeI and BamHI and of P224-P232 with XbaI and AgeI-HF and analytical gelelectrophoresis .

Procedure:

  • Analytical restriction digest and gelelectrophoresis of P221-P223 with NdeI and BamHI
  • Reaction batch for each plasmid:
Reagent Volume in µl
Tango Buffer 10x 4 µl
BamHI (NEB) 0.5 µl
NdeI (NEB) 0.5 µl
Plasmid DNA 2.5 µl
ddH2O 12.5 µl
TOTAL 20 µl
  • Incubation at 37 °C for 1 h 20 min.
  • Analytical gelelectrophoresis (1%) at 90 V for 40-45 min.
  • Analytical restriction digest and gelelectrophoresis of P224-P232 with XbaI and AgeI-HF
  • Reaction batch for each plasmid:
Reagent Volume in µl
NEBuffer4 10x 2 µl
BSA 100x 0.2 µl
XbaI (Fermentas) 0.25 µl
AgeI-HF (Fermentas) 0.25 µl
Plasmid DNA 2.5 µl
ddH2O 14.8 µl
TOTAL 20 µl
  • Incubation at 37 °C for 1 h 20 min.
  • Analytical gelelectrophoresis (1%) at 90 V for 40-45 min.
  • Order of gel-pockets:
1 kbp ladder P221 P222 P223 100 bp ladder
Corrupt Corrupt Corrupt

TUM12 20120730 gel1 P221-P223.jpg

  • Order of gel-pockets:
1 kbp ladder P224 P225 P226 P227 P228 P229 P230 P231 P232 100 bp ladder
Corrupt Corrupt Corrupt Corrupt Corrupt Corrupt ?Questionable? ?Questionable? ?Questionable?

TUM12 20120730 Gel2 P224-P232.jpg

Transformation of ligation products of PAL+ (PCR32) and APT(P189) in pYES2 RFC 25 (P175)into E.coli Xl1-Blue

Investigator: Ingmar

Aim of the experiment:Transformation of the ligation products of PAL+ (PCR32), APT (P189) and the negative control in pYes in XL1 Blue. Operation Sequence

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • addition of 5 µl of the ligation products
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Amp-LB-plate
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate

Miniprep and control digest of PAL+ in pYES picked on sunday 29th July

Investigator: Ingmar

Aim of the experiment: Test whether the ligation of PAL in pYES was successful

Miniprep

Using a Quiagen Miniprep kit a plasmid isolation of two picked clones of the PAL+ in pYes2 RFC25 ligation was done. The miniprep product of the first clone was named P235, the one of the second clone P236. Both were used for the following control digest.

control digest


volume reagent
2.5 µl PAL+
0.25 µl Xbal (10U/µl)
0.25 µl PstI (10U/µl)
2 µl Tango (10x)
15 µl ddH2O


expected bands:

  • pYES:5795bp
  • PAL: 2201bp

TUM12 PAL+ (P235+P236) analytical digest 30.07.2012.jpg

The picture shows in both cases the two expected bands at 5795 bp an 2201 bp. Therefore the ligation was successfull.

Miniprep of Schwab plasmids P40 & P42 from E.coli XL1 blue

Investigator: Lara

Aim of experiment: Get plasmids carrying lavendula limonene synthase gene for subsequent site-directed mutagenesis.

Plasmid concentrations:

  • P40 clone 1: 155 ng/µl
  • P40 clone 2: 114 ng/µl
  • P42 clone 1: 40 ng/µl
  • P42 clone 2: 32 ng/µl

Analytical restriction digest of extracted Schwab plasmids carrying Lavendula LS

Investigator: Lara

Aim of experiment: Check whether insert is OK.

  • Digest of P40 clone 1 and clone 2
volume reagent
2.5 µl plasmid DNA
0.25 µl NcoI
0.25 µl HindIII
2 µl Buffer Tango (10x)
15 µl ddH2O
  • Digest of P42 clone 1 and clone 2
volume reagent
4.5 µl plasmid DNA
0.25 µl EcoRI
0.25 µl NotI
2 µl Buffer Orange (10x)
13 µl ddH2O

Incubation for 1,5 h at 37°C.

TUM12 LS analytgel2 3007.png

Clones renamed:

  • P40 clone 1: now P241
  • P40 clone 2: now P242
  • P42 clone 1: now P243
  • P42 clone 2: now P244

Analytical restriction digest of plasmids containing citrus LS (repetition of digest from July, 27th)

Investigator: Lara

Aim of experiment: Check whether ligations PCR1/pYESnew, P144(PCR2)/pYESnew and PCR1/pSB1C3 have worked. This time, a standard protocol with 2,5 µl of DNA was used. Furthermore, Pst-1 HF was used instead of Spe1 (as on Friday, July 27th).


  • Digest of plasmids PCR1/pYESnew clone 1,3,5 and 6; P144(PCR2)/pYESnew clone 1,3,5 and 6; PCR1/pSB1C3 clone 1,5 and 6.


volume reagent
2.5 µl plasmid DNA
0.25 µl Pst1-HF
0.25 µl Xba1
2 µl NEB Buffer 4 (10x)
2 µl BSA (10x)
13 µl ddH2O


Incubation for 1,5 h at 37 °C.

TUM12 LS analytgel3007.png

Tuesday, July 31st

Picking from the overnight transformation of ligated P123+PCR38 in E. coli XL1-Blue from July, 27th

Investigator: Jeff, Georg

Aim of the experiment: Repeat picking from the overnight transformation of ligated P123+PCR38 in E. coli XL1-Blue because the last 3 picked colonies are negative.

Procedure:

  • Colonies were picked with pipette tips and transformed into a new cell-culture tube with 4 ml of LB-medium and antibiotics and were put overnight in a 180 rpm cell culture shaker at 37 °C. P123+PCR38 (CamR).

Quickchange of Schwab plasmid P40 clone 1

Investigator: Lara


Aim of experiment: Remove Age1 restriction site in gene coding for lavendula limonene synthase.

PCR

volume reagent
2.5 µl 10x Pfu Ultra II buffer
2 µl Plasmid P241
1 µl 1:10 dilution of O60 (10 pmol/µL)
1 µl 1:10 dilution of O61 (10 pmol/µL)
18 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Ultra II DNA polymerase (2.5 U / µl)

PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 12 95°C 30 sec
55°C 1 min
68°C 7 min
  • Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.

Transformation into E.coli Xl1-Blue

  • thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • addition of 1 µl of the SDM PCR product
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Kan-LB-plate
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Kan-LB-plate

Preparative digest of PCR1, PCR2 with XbaI and AgeI (additional positive control P155)

Investigator: Andrea

Digestion of PCR1, PCR2 and P155 (pYES) with XbaI and AgeI

volume reagent
8 µl PCR1
4 µl NEB Buffer
0.4 µl BSA
1 µl XbaI (20 U/µl)
1 µl AgeI (20 U/µl)
25,6 µl ddH2O
volume reagent
10 µl PCR2
4 µl NEB Buffer
0.4 µl BSA
1 µl XbaI (20 U/µl)
1 µl AgeI (20 U/µl)
23,6 µl ddH2O
volume reagent
10 µl P155
4 µl NEB Buffer
0.4 µl BSA
1 µl XbaI (20 U/µl)
1 µl AgeI (20 U/µl)
23,6 µl ddH2O

Mastermix of Buffer, BSA and Enzymes was added to the DNA and water.

Incubation: 37 °C, 3 h

preparative gel electrophoresis

Investigator: Andrea

  • PCR1 / PCR2: ca. 1600 bp
  • P155: ca. 5800 bp

31.07.12 prepgel.png

Ligation of digested PCR1 with P133 (pSB1C3) and P175 (pYES) (XbaI and AgeI)

Investigator: Andrea

Concentration (Nano Drop:
LIMS Citrus (PCR 1) = ? ng/µl
LIMS Citrus (PCR 2) = ? ng/µl
P175 = 107,3 ng/µl
P133 = 41.8 ng/µl


PCR1 and P175

volume reagent
1 µl P175
14,27 µl PCR 1
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
1,73 µl ddH2O


PCR1 and P133

volume reagent
2,4 µl P133
14,27 µl PCR 1
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
0,33 µl ddH2O


PCR2 and P175

volume reagent
1 µl P175
11,99 µl PCR 2
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
4,01 µl ddH2O


PCR2 and P133

volume reagent
2,4 µl P133
11,99 µl PCR 2
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
2,61 µl ddH2O


Negativ control P175

volume reagent
1 µl P175
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
16 µl ddH2O


Negativ control P133

volume reagent
2,4 µl P175
1 µl T4 DNA Ligase
2 µl T4-ligase buffer (10x)
14,4 µl ddH2O
  • water bath 16 °C over night

Media and plates for yeast transformation

Investigator: Martin, Alois

Aim of the experiment: Producing media and plates for yeast transformation (according to pYes_manual_kommentiert)

  • YPD-Medium, YPD-plates, 10X TE, 10X LiAc, 1x LiAc/0.5x TE

August 2012

Wednesday, August 1st

Miniprep of picked E. coli XL1-Blue transformated with ligation products of P123+PCR38

Investigator: Jeff, Dennis

Aim of the experiment: Miniprep of picked E. coli XL1-Blue transformated with ligation products of P123+PCR38.

Procedure:

  • Miniprep was performed after manufacturer's protocol. (P251-P260)

Analytical digestion and gelelectrophoresis of Miniprep E. coli XL1-Blue transformated with ligation products of P123+PCR38 and of pGBKT7 plasmid

Investigator: Dennis, Jeff

Aim of the experiment: Analytical digestion and gelelectrophoresis of Miniprep E. coli XL1-Blue transformated with ligation products of P123+PCR38 to see whether the ligation was successful and of pGBKT7 plasmid to see if the MfeI and BamHI restriction enzymes work.

Procedure:

  • Mastermix for digestion with XbaI+AgeI-Hf of ligation products of P123+P38:
Reagent Volume in µl
Buffer 4 (10x) 22 µl
BSA (100x) (NEB) 2.2 µl
XbaI (NEB) 1.75 µl
AgeI-Hf (NEB) 1.75 µl
ddH2O 162.8 µl
TOTAL MASTERMIX 192.5 µl
  • 17.5 µl of Mastermix + 2.5 µl of the plasmid DNA (P251-P260)
  • Composition for analytical restriction digestion of P99 with MfeI+BamHI
Reagent Volume in µl
Buffer G (10x) 2 µl
MfeI (NEB) 0.25 µl
BamHI (NEB) 0.25 µl
Plasmid DNA (P99; pGBKT7) 2.5 µl
ddH2O 15 µl
TOTAL 20 µl
  • Analytic Gelelectrophoresis for 1 h at 90 V.
  • Order of gel-pockets:
1 kbp ladder P251 P252 P253 P254 P255 P256 P257 P258 P259 P260 100 bp ladder
100 ladder Corrupt Corrupt Corrupt Corrupt Corrupt Corrupt Corrupt Corrupt Corrupt Corrupt 1 kb ladder

TUM12 20120801 20aaLexA.jpg

  • Order of gel-pockets:
100 bp ladder P99 control digestion with MfeI+BamHI P99 control undigested P123 control undigested 100 bp ladder (accidently)
Okay Okay Okay

TUM12 20120801 p99 verd p99 unverd. p123 unverd edit.jpg

→MfeI and BamHI are working! (Expected DNA strands for P99 digestion at 731 bp, 2443 bp and 4129 bp; that's what we got.)

Preperative digestion and gelelectrophoresis of PCR37 with XbaI+AgeI-HF

Investigator: Jeff

Aim of the experiment:

Procedure:

volume reagent
25 µl PCR37
5 µl NEBuffer 4 (10x)
0.5 µl BSA (100x)
1 µl XbaI (20 U/µl)
1 µl AgeI-HF (20 U/µl)
17.5 µl ddH2O
=50 µl TOTAL

Gel extraction of preperative gelelectrohphoresis of PCR37

Investigator: Jeff

Aim of the experiment:

Ligation of PCR39+P207 for cloning LexA with new RFC25 pre- and suffix into a plasmid

Investigator: Jeff

Aim of the experiment:

Procedure

Substance Volume
P207 (digested plasmid DNA (P123) with XbaI and AgeI-HF) 1.42 µl (~100 ng vector dna)
PCR39 (digested insert DNA (PCR37) with XbaI and AgeI-HF) 10.17 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 5.91 µl
TOTAL =20 µl

PCR of P80 to introduce RFC25 pre- and suffix to Pif3

Investigator: Jeff

Aim of the experiment:

Procedure:


  • PCR reaction mixture
volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer O31 1:10 dilution (TUM12-LSPS-fw)
1 µl 10 µM Reverse Primer O32 1:10 dilution (TUM12-LSPS-rv )
0.25 µL OneTaq Hot Start DNA Polymerase (Finally: 1.25 units/50 µL)
1 µl Plasmid DNA P80
35.75 µL ELGA Water
=50 µL TOTAL
  • The PCR program was performed after following scheme with following conditions
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
55 °C 60 s
68 °C 30 s
Final extension 68 °C 5 min
Hold 4 °C infinite

PCR purification of PCR of P80

Investigator: Jeff

Aim of the experiment:

Preparative digestion of pYesII with SwaI and PvuII

  • Preparative digestion of pYesII
Reagent Volume in µl
SwaI 2 µl
PvuII 2 µl
Neb3 buffer 4 µl
BSA 0,4 µl
H20 31,6 µl
Volume 40 µl

Geldigestion was performed with SwaI and BSA at room temperature for 2,5 hours. Afterwards PvuII was added and digested another 2,5 hours at 37 C

Nanodrop measurement of P245-P250

Gelextraction was performed according to gelextraction protocol

Probe: Concentration: P245 4,5 ng/µl P246 7,5 ng/µl P247 22,7 ng/µl P248 21,1 ng/µl P249 3,3 ng/µl P250 3,8 ng/µl

Transformation of ligation products and quickchange products

Investigator: Lara

Aim: Transformation of ligation products (ligation July 31st) and quickchange products (repetition, quickchange of July 31st).

Transformation into E.coli Xl1-Blue

  • thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • addition of 1 µl of the SDM PCR product or 5 µl of ligation product
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Kan-LB-plate (Quickchange product), Amp-plate (pYES) or Chloramphenicol (pSB1C3)
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an antibiotic containing LB-plate

Miniprep and control digest of APT in pYES

Investigator: Katrin

Aim of the experiment: Test whether the ligation of APT in pYES was successful

Miniprep

Using a Quiagen Miniprep kit, a plasmid isolation of three picked clones of a APT in pYes2 RFC25 ligation was done. The miniprep products were named P261 (1st clone), P262 (2nd clone) and P263 (3rd clone).All three of them were used for the following control digest.

The resulting plamid-concentrations (measured with nanodrop) were clone 1 (P261): 149,0 ng/µl clone 2 (P262): 153,5 ng/µl clone 3 (P263): 158,4 ng/µl


control digest


volume reagent
2.5 µl APT (clones 1,2,3)
0.25 µl Xbal (10U/µl)
0.25 µl AgeI (10U/µl)
2 µl NEB 4 (10x)
2 µl BSA (10x)
13 µl ddH2O


expected bands (pYes has 2 AgeI restriction site):

  • pYES fragment 1:5398 bp
  • pYes fragment 2: 451
  • APT: 1244 bp


IM000269 APT pyes kontrolle.jpg The picture shows the expected bands for clones 1 and 3

Media and plates for yeast transformation

Investigator: Martin, Alois

Aim of the experiment: Producing media and plates for yeast transformation (according to pYes_manual_kommentiert)

  • 20% glucose, 20x SC stock (without uracil and without yeast nitrogen base), SC plates with glucose

Thursday, August 2nd

Transformation of ligation product P207/PCR39

Investigator: Lara

Aim: Transformation of ligation products P207/PCR39 and P207/NK.

Transformation into E.coli Xl1-Blue

Unfortunately the lab assistents went home so that the incubation times had to be shortened.

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • addition of 5 µl of the ligation products
  • incubation on ice for 25 min
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubation at 37°C and 180 rpm for 25 min
  • plating of 100 µl on an Chlp-LB-plate
  • sedimenting the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspension of the sediment in 100 µl LB-medium and plating it as well on an Chlp-LB-plate

Gelextraction of pYesII -f1,-Gal4

pYes II extraction was performed according to manufacturers protocoll

Concentration was measured with nanodrop

Probe: Concentration P265 12,8 ng/µl P264 12,9 ng/µl

Circularization of linearized plasmid backbone pYesII

volume reagent
3,9 µl pYes2
1 µl T4 ligase
5 µl T4 ligase buffer
2,5 µl PEG 4000
35,1 µl H20
50 µl Volume

Ligation was performed over night at 16 C Negative control was done with H20 in exchange to pYES2

Repetition of Quickchange mutagenesis of lavendula limonene synthase

Investigator: Lara


Aim: No colonies were observable after second transformation of quickchange PCR products. Therefore the quickchange pcr reaction was repeated with a modified protocol:


PCR

Reaction batch 1

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl Plasmid P242
0.5 µl 1:10 dilution of O60 (10 pmol/µL)
16.5 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Turbo DNA polymerase (2.5 U / µl)

Reaction batch 2

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl Plasmid P242
0.5 µl 1:10 dilution of O61 (10 pmol/µL)
16.5 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Turbo DNA polymerase (2.5 U / µl)


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 10 95°C 30 sec
55°C 1 min
68°C 7 min
  • Having completed the PCR cycling parameters listed above both PCR reaction batches were mixed together and the cycling parameters listed above were once more applied.
  • Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.

! Unfortunately someone turned off the heat block, so that the reaction tube was below 37 °C (approx. 25 °C) for about 45 min. After recognition (after one hour of incubation), the heat block was turned on again and the reaction tube was incubated for another 30 min.


Transformation into E.coli Xl1-Blue

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • addition of 1 µl of the PCR product
  • incubation on ice for 25 min
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubation at 37°C and 180 rpm for 25 min
  • plating of 100 µl on an Kan-LB-plate
  • sedimenting the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspension of the sediment in 100 µl LB-medium and plating it as well on an Kan-LB-plate

PCR of C-LS3 (BBa_I742111, Trafo 16.6)

Investigator: Lara

Aim: To get more PCR product in case another preparative digest is needed.


Primer with consensus sequence

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer O27
1 µl 10 µM Reverse Primer O30
0.25 µl OneTaq Hot Start DNA Polymerase (Finally: 1.25 units/50 µl)
1 µl Plasmid DNA (BBa_I742111) Clone 3
35.75 µl dd water
50 µL TOTAL


Primer without consensus sequence

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer O28
1 µl 10 µM Reverse Primer O30
0.25 µl OneTaq Hot Start DNA Polymerase (Finally: 1.25 units/50 µl)
1 µl Plasmid DNA (BBa_I742111) Clone 3
35.75 µl dd water
50 µL TOTAL
  • The PCR program was performed after following scheme:
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
47 °C 30 s
68 °C 1,75 min
Final extension 68 °C 5 min
Hold 4 °C 1 h


Analytical gel electrophoresis

TUM12 LS AnalytGel0308.png

Preparation of YPD Medium and Picking of S. cerevisiae clones

Investigator: Lara, Katrin


YPD Yeast Extract Peptone Dextrose Medium (1 liter) the following substances were dissolved in 1000 ml of water and then autoclaved

  • 1% yeast extract
  • 2% peptone
  • 2% dextrose (D-glucose)


Picking of two clones of S. cerevisiae DD (17.17.2012): The clones were put into YPD medium and incubated at 30 °C over night. Additional 0,8 g Glucose were added to one of the cell culture tubes.

Friday, August 3rd

Transformation of E.coli XL1 blue with ligation product P207/PCR39

Investigator: Lara


Aim: Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation of E.coli XL1 blue with ligation products P207/PCR39 and P207/NK.


Transformation into E.coli Xl1-Blue

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • addition of 5 µl of the ligation products
  • incubation on ice for 30 min
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubation at 37°C and 180 rpm for 45 min
  • plating of 100 µl on an Chlp-LB-plate
  • sedimenting the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspension of the sediment in 100 µl LB-medium and plating it as well on an Chlp-LB-plate

Analytical restriction digest of quickchange products

Investigator: Lara


Aim: Check whether site directed mutagenesis to eliminate Age1 restriction site has worked.


Quickchange PCR product purification: The Quickchange PCR products were purified with Qiagen PCR Purification Kit before analytical restriction digest:

  • P241 SDM: 7 ng/µl
  • P242 SDM: 63 ng/µl


Restriction digest of p241 SDM (31.7.), p242 SDM (2.8.) and p242 (as positive control)

volume reagent
2.5 µl plasmid DNA
0.25 µl Age1-HF
2 µl NEBuffer 4
2 µl BSA (10x)
13.25 µl ddH2O


Analytical Gel

1. Standard (1 kb Gene Ruler)

2. p242, digested with Age1 (positive control)

3. p241 SDM

4. p241 SDM, digested with Age1

5. p242 SDM

6. p242 SDM, digested with Age1

7. PCR 42

8. PCR 43


TUM12 LS Quickchange Analytgel.png

Transformation of E.coli XL1 blue with P242 SDM

Investigator: Lara


Aim: Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation with P242 SDM.


Transformation into E.coli Xl1-Blue

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • two transformations: 1. addition of 1 µl of the purified Quickchange PCR product; 2. addition of 4 µl of the purified Quickchange PCR product
  • incubation on ice for 30 min
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubation at 37°C and 180 rpm for 45 min
  • plating of 100 µl on an Kan-LB-plate
  • sedimenting the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspension of the sediment in 100 µl LB-medium and plating it as well on an Kan-LB-plate

Repetition of small-Scale Yeast Transformation of 4CL, CHS, OMT, PAL and APT in pYES

Investigator: Mary

Aim of the experiment:Transformation of P193 - P198, P200, P236, P263 and GFP (as a positive control - from simon) in Yeast

The protocol on page 13 of the pYES2 manual was used.


Only modifications are noted:

step 1: inoculate in 4 ml YPD medium

step 2: OD600 = 9 -> to determine a OD600 of 0.4 in 50 ml, 2.2 ml yeast suspension and 42.5 ml YPD medium were used, 5ml 20% Glucose was added (wrong information about the YPD-medium: we suggested that Glucose caramelizes when autoclaved together with medium - but it is not the case! Only agar and glucose will caramelize).


steps 3 and 4: centrifugation for 5 min, 4 °C


step 6:

1 µg plasmid DNA

  • P193: c = 110 ng/µl -> 9.1 µl
  • P194: c = 342 ng/µl -> 2.9 µl
  • P195: c = 423 ng/µl -> 2.4 µl
  • P196: c = 92 ng/µl -> 10.8 µl
  • P197: c = 394 ng/µl -> 2.5 µl
  • P198: c = 183 ng/µl -> 5.5 µl
  • P200: c = 464 ng/µl -> 2.2 µl
  • P236: c = 291 ng/µl -> 3.4 µl
  • P263: c = 158 ng/µl -> 6.3 µl
  • Positive control: 2.19/4 (pYES2+EGFP) c = 200 ng/µl -> 5µl

100 µg denatured sheared salmon sperm: the one from Simon was used -> 10 µl


step 7:

7 ml 50% PEG3350 was synthesized (3.5 g in 7 ml bidest.water) 6.4 ml 50% PEG3350 + 800 µl 10x LiAc + 800 µl 10x TE were mixed


The cells were plated out on SC-U plates with Glucose and incubated the weekend at 30°C

Transformation of E.coli XL1 blue with ligation products

Investigator: Katrin

Aim: Transformation of ligation products PCR2/P133, PCR1/P133, MK/P133, PCR2/P175, MK/P175

Transformation into E.coli Xl1-Blue

  • thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • of 1 µl of the SDM PCR product or 5 µl of ligation product
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 45 min
  • plate 100 µl on an Amp-plate (pYES (P175) or Chloramphenicol-plate (pSB1C3, P133)
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an antibiotic containing LB-plate

Sunday, August 5th

PCR of pGBKT7 (P99) to introduce RFC pre- and suffix to Gal4 DNA binding domain (Gal4DBD/Gal4BD)

Investigator: Jeff

Aim of the experiment:PCR of pGBKT7 (P99) to introduce RFC pre- and suffix to Gal4 DNA binding domain (Gal4DBD/Gal4BD) for fusion protein construction of N'-PhyB(N-Terminus)-20aaLinker-GalDBD-C'. (If there is time one can direcly clone PhyB in the C-Terminus of Gal4DBD directly.)

Procedure:

  • PCR with primer: TUM12-Gal4BD-fw and TUM12-Gal4BD-rv
  • Reaction batch:
volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 100 µM Forward Primer O73 (TUM12-Gal4BD-fw)
1 µl 100 µM Reverse Primer O74 (TUM12-Gal4BD-rv)
0.25 µL OneTaq Hot Start DNA Polymerase (Finally: 1.25 units/50 µL)
1 µl Plasmid DNA P99
35.75 µL ddH2O
=50 µL TOTAL
  • The PCR program was performed after following scheme with following conditions
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
57 °C 30 s
68 °C 30 s
Final extension 68 °C 5 min
Hold 4 °C infinite

Transfer of old transformed E. coli XL-1 blue from old antibiotic plates to new antibiotic plates and of old Y190 S. cerevisiae strain to a new YPD plates

Investigator: Jeff

Aim of the experiment: Transfer of old transformed E. coli XL-1 blue from old antibiotic plates to new antibiotic plates and of old Y190 S. cerevisiae strain to a new YPD plates.

Procedure:

  • Transformed E. coli XL1-Blue: With an incolution loop under sterile conditions the bacteria colonies from the plates were transferred by dilution plating on new antibiotic plates. Attempts were made to take all the colonies to have a multiclonal plate.
  • The E. coli XL1-Blue plates from these transformations were taken:
Parts for Phycocyanobilin synthesis:
BBa_I15008 in pSB2K3 (KanR): Heme oxygenase
Parts for N'-SV40NLS-PhyB(NT)-20aaLinker-LexA-C' and N'-PhyB(NT)-20aaLinker-Gal4DBD-C'/N'-SV40NLS-PhyB(NT)-20aaLinker-Gal4DBD-C' construction:
BBa_K207000 in pSB3K3 (KanR): PhyB(621NT)-GalDBD BBa_K207001 in pSB1A2 (AmpR): PhyB(621NT) BBa_K105005 in pSB2K3 (KanR): LexA DNA binding protein pGBKT7 (KanR): Yeast-two-hybrid vector with C-terminal MCS after Gal4 DNA binding domain (Gal4DBD/Gal4BD)
Parts for N'-Gal4AD-linker-Pif3 construction:
BBa_K365000 in pSB1C3 (CamR): Pif3(100NT) pGADT7 AD (AmpR): Yeast-two-hybrid vector with C-terminal MCS after Gal4 transcription activation domain (Gal4AD)
Oligopeptide linkers for linkage of two functional independent protein domains:
BBa_K365005 in pSB1C3 (CamR): 20 amino acids long linker with RFC25 pre- and suffix BBa_K243006 in BBa_K157000 (AmpR): 12 amino acids long linker (Gly-Gly-Ser-Gly)x3
Synthetical promoter constructs for LexA based Y2H:
BBa_K165055 in BBa_J63009 (AmpR): LexA binding sites + mCYC + Kozak + YFPx2 + ADH1 terminator BBa_K165031 in pSB1AK3 (AmpR, KanR): LexA binding sites + mCYC
  • Y190 S. cerevisiae: With an incolution loop under sterile conditions the yeast colonies from the plates were transferred by dilution plating on new YPD plates. Attempts were made to take all the colonies to have a multiclonal plate.
Genotype:
MATa ura3-52 his3-200 ade2-101 lys2-801 trp1-901 leu2-3, 112 gal4Δ gal80Δ cyhR2 LYS2 : : GAL1(UAS)-HIS3(TATA)-HIS3 MEL1 URA3 : : GAL1UAS-GAL1TATA-lacZ
Reporters:
HIS3 lacZ MEL1
Transformation markers
trp1 leu2 cyhR2

Picking from the overnight transformation of ligated P207+PCR39 product in E. coli XL1-Blue

Investigator: Jeff

Aim of the experiment: Picking from the overnight transformation of ligated P207+PCR39 product in E. coli XL1-Blue from the August, 2nd and August, 3rd.

Procedure:

  • 4 colonies from August, 2nd and 4 colonies from August, 3rd were taken. Total: 8 colonies.
  • Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4 ml of LB-medium and antibiotics. These tubes were put overnight in a 180 rpm cell culture shaker at 37 °C. P207+PCR39 (CamR).

Picking of E. coli XL1-Blue transformed with BBa_K165055

Investigator: Jeff

Aim of the experiment: Picking of E. coli XL1-Blue transformed with BBa_K165055.

Procedure:

  • 2 colonies were taken.
  • Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4 ml of LB-medium and antibiotics. These tubes were put overnight in a 180 rpm cell culture shaker at 37 °C. BBa_K165055 in BBa_J63009 (AmpR).

Picking of E. coli XL1-Blue transformed with pGADT7 AD

Investigator: Jeff

Aim of the experiment: Picking of E. coli XL1-Blue transformed with pGADT7 AD.

Procedure:

  • 2 colonies were taken.
  • Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4 ml of LB-medium and antibiotics. These tubes were put overnight in a 180 rpm cell culture shaker at 37 °C. pGADT7 AD (AmpR).

Picking of clones of transformation August, 1st, 2nd and 3rd

Investigator: Jeff

Aim: Picking.

Procedure:

  • 3 or 4 clones were picked for each ligation. Clones containing pYES2-new were put into 4 ml LB with 4 µl of ampillicin stock solution, clones containing pSB1C3 were put into chloramphenicol containing media. Incubation at 37 °C overnight.

Monday, August 6th

Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR39

Investigator: Jeff, Dennis

Aim of the experiment: Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR39

Procedure:

  • Miniprep was done after manufacturer's protocol for 8 picked colonies. (P285-P292)

Analytical digestion and gelelectrophoresis of miniprep P285-P292

Investigator: Jeff, Dennis

Aim of the experiment: Analytical digestion with NgoMIV+PstI-HF and gelelectrophoresis of miniprep P285-P292.

Procedure:

  • Mastermix for NgoMIV+PstI-HF
volume reagent
22 µl NEBuffer 4 (10x)
2.75 µl NgoMIV
2.75 µl PstI-HF
165 µl ddH2O
=192.5 µl TOTAL
  • Reaction batch
volume reagent
2,5 µl Plasmid-DNA (P285-P292)
17,5 µl Mastermix for NgoMIV+PstI-HF
=20 µl TOTAL
100 bp ladder DNA ladder P285 P286 P287 P288 P289 P290 P291 P292 P295 P296 1 kbp ladder DNA ladder
Corrupt Ligation successful Ligation successful Ligation successful Ligation successful Ligation successful Ligation successful Ligation successful please see next subsection plase see next subsection

TUM12 20120806 anal Gel No1.JPG

Analytical digestion and gelelectrophoresis of miniprep P295, P296

Investigator: Jeff, Dennis

Aim of the experiment: Analytical digestion with XbaI+PstI-HF and gelelectrophoresis of miniprep P295 and P296.

Procedure:

  • Digestion reaction batch
volume reagent
2.5 µl Plasmid-DNA (P295, P296)
0.25 µl XbaI
0.25 µl PstI-HF
2 µl NEBuffer 4 (10x)
0.2 µl BSA (100x)
14.8 µl ddH2O
=20 µl TOTAL
100 bp ladder DNA ladder P285 P286 P287 P288 P289 P290 P291 P292 P295 P296 1 kbp ladder DNA ladder
Please see last subsection Please see last subsection Please see last subsection Please see last subsection Please see last subsection Please see last subsection Please see last subsection Please see last subsection corrupt corrupt

TUM12 20120806 anal Gel No1.JPG

Analytical digestion and gelelectrophoresis of miniprep P293, P294

Investigator: Jeff, Dennis

Aim of the experiment: Analytical digestion and gelelectrophoresis of miniprep P2P93, P294 to see whether the enzymes EcoRI and BamHI are working. Because the size of the insert is too short, the backbone is additionally cut with Eco91I (cuts only 1x in the backbone). So digestion were done with EcoRI+Eco91I and BamHI+Eco91I.

Procedure

  • Reaction batch for P293:
volume reagent
2.5 µl Plasmid-DNA (P293)
0.25 µl EcoRI (Fermentas)
0.25 µl Eco91I (Fermentas)
2 µl Buffer 0 (Fermentas)
15 µl ddH2O
=20 µl TOTAL
  • Reaction batch for P294:
volume reagent
2.5 µl Plasmid-DNA (P293)
0.5 µl BamHI (Fermentas)
0.25 µl Eco91I (Fermentas)
4 µl Tango-Buffer (10x) (Fermentas)
12.75 µl ddH2O
=20 µl TOTAL
100 bp ladder DNA ladder P293 (digested with EcoRI+Eco91I) P294 (digested with BamHI+Eco91I) PCR48 PCR49 P230 P231 1 kbp ladder DNA ladder
2 DNA strands are visible and have expected length 2 DNA strands are visible and have expected length Please see next subsection Please see next subsection Please see next subsection Please see next subsection

TUM12 20120806 anal Gel No2.jpg

Analytical digestion and gelelectrophoresis of miniprep P230 and P232

Investigator: Jeff, Dennis

Aim of the experiment: Analytical digestion and gelelectrophoresis of miniprep P230 and P232 to check whether the oligohybrdization product PCR34 has been successful ligated to pSB1C3 with RFC25 pre- and suffix.

Procedure:

  • Reaction batch for P230 and P231:
volume reagent
2,5 µl Plasmid-DNA (P285-P292)
17,5 µl Mastermix for NgoMIV+PstI-HF (please see subsection: "Analytical digestion and gelelectrophoresis of miniprep P285-P292 ")
=20 µl TOTAL
100 bp ladder DNA ladder P293 P294 PCR48 PCR49 P230 P231 1 kbp ladder DNA ladder
Please see next subsection Please see next subsection Please see next subsection Please see next subsection 91 bp long insert seems to be visible after manual gain of signal 91 bp long insert seems to be visible after manual gain of signal
  • To be sure, one has to sequence this with the iGEM primer VF2 (O68) and VR (O69).

TUM12 20120806 anal Gel No2 edit.jpg

Analytical gelelectrophoresis of PCR48 and PCR49

Investigator: Jeff, Dennis

Aim of the experiment: Analytical gelelectrophoresis of PCR48 and PCR49 to check whether the PCR has been successful.

Procedure:

100 bp ladder DNA ladder P293 P294 PCR48 PCR49 P230 P231 1 kbp ladder DNA ladder
Please see next subsection Please see next subsection PCR was successful PCR was successful Please see next subsection Please see next subsection

TUM12 20120806 anal Gel No2.jpg

Preperative digestion of P289

Investigator: Jeff

Aim of the experiment: Preperative digestion and gelelectrophoresis of P289 in order to fuse insert (LexA with RFC25 pre- and suffix) into the N-terminus of 20aa linker in pSB1C3 (P206). Intermediate construction: N'-20aaLinker-LexA-C'. Final construction should be N'-SV40NLS-PhyB(642NT/908NT)-20aaLinker-LexA-C'.

Procedure:

  • Reaction batch:
volume reagent
20 µl Plasmid 289
4 µl NEBuffer 4 (10x)
2 µl NgoMIV (10 U/µl)
1 µl PstI-HF (20 U/µl)
11 µl ddH2O
=40 µl TOTAL
  • Preperative gelelectrophoresis was done the next day

Extraction of ADH1-Promoter, CYC1-Terminator, TEF1-Promoter

Investigator: Georg

Aim of the experiment: Miniprep of overnight cultures of transformed E. coli XL1-Blue

Procedure:

  • Miniprep was done after manufactuer's protocol for 3x3 colonies.

PCR of TEF1-Terminator, TEF2-Promoter and ADH1-Terminator

Investigator: Georg

Aim of the experiment: Amplification of TEF1-Terminator, TEF2-Promoter from genomic DNA of Saccharomyces cerevisiae and ADH1-Terminator from yeast Vector PGADT7 AD

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer
1 µl 10 µM Reverse Primer
0.25 µl OneTaq Hot Start DNA Polymerase (Final: 1.25 units/50 µl)
1,3µl P237/ 1µl P98
33.75 µl dd water
50 µL TOTAL


  • The PCR program was performed after following scheme:
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
56 °C 1 min
68 °C 2 min
Final extension 68 °C 5 min
Hold 4 °C 1 h

Preparative digestion of PCR products and TEF1-,ADH1-Promoter with XbaI and PstI

Investigator: Georg

  • Mastermix for XbaI+PstI-HF
volume reagent
12 µl NEBuffer 4 (10x)
3 µl XbaI
3 µl PstI-HF
1,2 µl BSA 100x
20,8 µl ddH2O
=40 µl TOTAL
  • Mastermix for XbaI+PstI-HF
volume reagent
15 µl NEBuffer 4 (10x)
3 µl XbaI
3 µl PstI-HF
1,5 µl BSA 100x
27,5 µl ddH2O
=50 µl TOTAL

Ligation of lavendula LS and citrus LS with pSB1C3 and pYES

Procedure

Substance Volume
P175 1 µl (~100 ng vector dna)
PCR 42 RL 0.8 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 15.7 µl
TOTAL =20 µl

Miniprep of Ligation of PCR1 and PCR2 in P133 or P175

Investigator: Andrea

Using a Quiagen Miniprep kit. The miniprep products were named P266-P284.

The resulting plamid-concentrations (measured with nanodrop) were

  • P 266: 1,3 ng/µl
  • P 267: 0,2 ng/µl
  • P 268: 1,0 ng/µl
  • P 269: 13,5 ng/µl
  • P 270: 10,3 ng/µl
  • P 271: 12,1 ng/µl
  • P 272: 14,7 ng/µl
  • P 273: 12,8 ng/µl
  • P 274: 13,2 ng/µl
  • P 275: 9,4 ng/µl
  • P 276: 8,5 ng/µl
  • P 277: 12,4 ng/µl
  • P 278: 10,2 ng/µl
  • P 279: 7,1 ng/µl
  • P 280: 5,7 ng/µl
  • P 281: 8,0 ng/µl
  • P 282: 8,6 ng/µl
  • P 283: 31,4 ng/µl
  • P 284: 12,6 ng/µl

PCR of Schwab plasmid Quickchange-DNA to amplify gene for lavendula LS

Instructor: Andrea

Aim: PCR of Schwab plasmids after Quickchange-Mutagenesis with primers which were designed to amplify the lavendula LS gene and to add RFC25 restriction sites.

3 different primer combinations were used:

1. O33/O37

2. O34/O37

3. O35/O37

Each primer combination was used for plasmid DNA amplification of P283.

PCR reaction mixture

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer
1 µl 10 µM Reverse Primer
0.25 µl OneTaq Hot Start DNA Polymerase (Final: 1.25 units/50 µl)
3 µl Plasmid DNA P283
33.75 µl dd water
50 µL TOTAL
  • The PCR program was performed after following scheme:
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
50 °C 30 s
68 °C 1,75 min
Final extension 68 °C 5 min
Hold 4 °C 1 h

Preparation of SC-U medium with 2% glucose (300ml) or galactose (700 ml) for expression in Saccharomyces cerevisiae

Investigator: Daniela

1 l medium:

  • One alliquot (50 ml) of amino acis prepared by Alois Bräuer was used
  • 6.7 g yeast nitrogen base
  • 850 ml ELGA water
  • after dissolving, the solution was divided into 270 ml and 630 ml
  • autoclaving

Sugar solution were prepared separately:

  • 6 g glucose were dissolved in 30 ml ELGA water
  • 14 g galactose were dissolved in 70 ml ELGA water
  • autoclaving

After autoclaving:

  • 30 ml of glucose solution were added to 270 ml SC-U medium
  • 70 ml of galactose solution were added to 630 ml SC-U medium

Inoculation of Saccharomyces cerevisiae colonies of transformation products from August, 3rd

Investigator: Daniela

Aim of the experiment: First step of the expression protocol in Saccharomyces cerevisiae

Inoculation of a single colony of Saccaromyces cerevisiae transformed with enzymes PAL+/-, 4CL+/-, CHS+/-, OMT+/-, APT and the positive control GFP in pYES, respectively in 15 ml of SC-U medium with 2% glucose. Incubation at 30°C over night.

Tuesday, August 7th

Plating of received E. coli containing biobricks BBa_K181000, BBa_K365002 and BBa_K365003

Investigator: Jeff

Aim of the experiment: The received biobricks were already transformed in E. coli and were in an agar stabs. These E. coli cells were transferred with an inoculation loop on antibiotic selection plates and were incubated over night. The received biobricks were: BBa_K181000 (This is the PcyA gene, known to convert biliverdin to phycocyanobilin, codon optimized for S. cerevisiae (baker's yeast). ), BBa_K365002 (This part consists in the first 908 amino-acids of Phytochrome B from A. thaliana.) and BBa_K365003 (This part consists in the first 642 amino-acids of Phytochrome B from A. thaliana.).

Procedure:

  • Bacterias containing plasmids with biobricks were transferred with a sterile inoculation loop on antibiotic plates and were incubated at 37 °C overnight.
  • The biobricks were: BBa_K181000 in BBa_J63010 (AmpR), BBa_K365002 in pSB1C3 (CamR) and BBa_K365003 in pSB1C3.

Preperative gelelectrophrosis of digested P289

Investigator: Jeff, Dennis

Aim of the experiment: Preperative digestion and gelelectrophoresis of P289 in order to fuse insert (LexA with RFC25 pre- and suffix) into the N-terminus of 20aa linker in pSB1C3 (P206). Intermediate construction: N'-20aaLinker-LexA-C'. Final construction should be N'-SV40NLS-PhyB(642NT/908NT)-20aaLinker-LexA-C'.

Procedure:

  • Gelelectorphoresis was performed on a 1% low-melting agarose gel at 70  for 1.5 h.
  • DNA strand at about 600-700 bp was cut out
  • Cut out band was purified with gel extraction kit from Qiagen after manufacturer's protocol.

TUM12 20120807 prep gel lexa rfc25.jpg

Ligation of P206+P310

Investigator: Jeff, Dennis

Aim of the experiment: Ligation of P206+P310

Procuedure: Reaction batch

Substance Volume
P206 1.7 µl (~100 ng vector DNA)
P310 8.5 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 7.3 µl
TOTAL =20 µl

Preperative digestion and gelelectrophrosis of P123 and P80

Investigator: Jeff

Aim of the experiment: Preperative digestion and gelelectrophoresis of P80 and P123 in order to fuse insert (Pif3 with RFC25 pre- and suffix) of P80 into the C-terminus of 20aa linker in pSB1C3 (P123). Intermediate construction: N'-Pif3-20aaLinker-C'. Final construction should be N'-Pif3-20aaLinker-Gal4AD-C'.

Procedure:

  • Reaction batch for P123:
volume reagent
20 µl Plasmid-DNA P123
4 µl NEBuffer 4 (10x)
1 µl EcoRI-HF (20 U/µl)
2 µl NgoMIV (10 U/µl)
13 µl ddH2O
=40 µl TOTAL
  • Reaction batch for P80:
volume reagent
20 µl Plasmid-DNA P80
4 µl NEBuffer 4 (10x)
0.44 µl BSA (100x)
1 µl EcoRI-HF (20 U/µl)
1 µl AgeI (20 U/µl)
13.6 µl ddH2O
=40 µl TOTAL
  • Gelelectorphoresis was performed on a 1% low-melting agarose gel at 70  for 1.5 h.
  • DNA strand at about 300 bp from P80 was cut out. And the band from P123 at about 2.1 kbp was cut out.
  • Cut out bands were purified with gel extraction kit from Qiagen after manufacturer's protocol.
P80 digested with EcoRI-HF+AgeI-HF 100 bp ladder DNA ladder P123 digested with EcoRI-HF+NgoMIV 1 kbp ladder DNA ladder
Gel OK Gel OK

TUM12 20120807 prep Gel Pif3RFC25 pSB11C320aaLinker.JPG

Ligation of P311+P312

Investigator: Jeff

Aim of the experiment: Ligation of P311+P312

Procuedure: Reaction batch

Substance Volume
P312 1.92 µl (~100 ng vector DNA)
P311 6.38 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 9.2 µl
TOTAL =20 µl

Picking of received E. coli containing biobricks BBa_K181000, BBa_K365002 and BBa_K365003

Investigator: Jeff

Aim of the experiment: Picking of received E. coli containing biobricks BBa_K181000, BBa_K365002 and BBa_K365003.

Procedure:

  • For each biobrick 1 coloniy was taken with a pipette tip and transferred into a cell-culture tube with 4  of LB-medium and antibiotics (CamR for BBa_K365002 and BBa_K365003, AmpR for BBa_K181000).
  • These 3 tubes were put overnight in a 180 rpm cell culture shaker at 37 °C.

Preparative restriction digest of PCR 56,57,58 (lavendula LS) and PCR 42,43 (citrus LS)

Investigator: Lara

Aim: Prepare digested PCR fragments for further ligation into pYES and pSB1C3.


volume reagent
25 µl PCR products
5 µl NEBuffer 4 (10x)
0.5 µl BSA (100x)
1 µl XbaI (20 U/µl)
1 µl AgeI-HF (20 U/µl)
17.5 µl ddH2O
=50 µl TOTAL
  • A mastermix for 16 reactions was produced.
  • PCR products were digested at 37 °C for 3 hours.

P187 was used as positive control for restriction digest:

  • 3 µl p187 + 15 µl of Mastermix (see above)

Gelelectrophoresis:

Gel 1:

1. Gene ruler 1 kb

2. PCR 42

3. PCR 43

5. P187

Gel 2:

1. Gene ruler 1 kb

2. PCR 56

3. PCR 57

4. PCR 58

TUM12 LS 0808 prepgel2.png TUM12 LS 0808 prepgel1.png


Digested PCR products (PCR 42 RL, PCR 43 RL, PCR 56 RL, PCR 57 RL, PCR 58 RL) are stored in the iGEM PCR product box at -20°C.

  • RL = ready for ligation

Analytical restriction digest of ligation products after miniprep

Investigator: Lara

Aim: Check ligation of PCR 1 and PCR 2 into pYES and pSB1C3.


volume reagent
20 µl miniprep products
2.3 µl NEBuffer 4 (10x)
0.2 µl BSA (100x)
0.25 µl XbaI (20 U/µl)
0.25 µl Pst1-HF (20 U/µl)
=23 µl TOTAL
  • Incubation at 37°C for 2 h.


Gelelectrophoresis:

TUM12 LS 0808 analytgel2.png TUM12 LS 0808 analytgel1.png

Ligation of lavendula LS and citrus LS with pSB1C3 and pYES

Investigator: Lara

Aim: Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pYES.

Procedure

PCR 42 RL in pYES (p175)

Substance Volume
P175 1 µl (~100 ng vector dna)
PCR 42 RL 0.8 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 15.7 µl
TOTAL =20 µl

PCR 42 RL in pSB1C3 (p133)

Substance Volume
P133 2.5 µl (~100 ng vector dna)
PCR 42 RL 2.5 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 12.5 µl
TOTAL =20 µl

PCR 43 RL in pYES (p175)

Substance Volume
P175 1 µl (~100 ng vector dna)
PCR 43 RL 1.5 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 15.0 µl
TOTAL =20 µl

PCR 43 RL in pSB1C3 (p133)

Substance Volume
P133 2.5 µl (~100 ng vector dna)
PCR 43 RL 4 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 11 µl
TOTAL =20 µl

PCR 56 RL in pYES (p175)

Substance Volume
P175 1 µl (~100 ng vector dna)
PCR 56 RL 2 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 14.5 µl
TOTAL =20 µl

PCR 56 RL in pSB1C3 (p133)

Substance Volume
P133 2.5 µl (~100 ng vector dna)
PCR 56 RL 6 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 9 µl
TOTAL =20 µl

PCR 57 RL in pYES (p175)

Substance Volume
P175 1 µl (~100 ng vector dna)
PCR 57 RL 2 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 14.5 µl
TOTAL =20 µl

PCR 57 RL in pSB1C3 (p133)

Substance Volume
P133 2.5 µl (~100 ng vector dna)
PCR 57 RL 6 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 9 µl
TOTAL =20 µl

PCR 58 RL in pYES (p175)

Substance Volume
P175 1 µl (~100 ng vector dna)
PCR 58 RL 2 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 14.5 µl
TOTAL =20 µl

PCR 58 RL in pSB1C3 (p133)

Substance Volume
P133 2.5 µl (~100 ng vector dna)
PCR 58 RL 6 µl (~3x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 9 µl
TOTAL =20 µl

Negative control/pYES (p175)

Substance Volume
P175 1 µl (~100 ng vector dna)
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 16.5 µl
TOTAL =20 µl

Negative control/pSB1C3 (p133)

Substance Volume
P133 2.5 µl (~100 ng vector dna)
T4 ligase 0.5 
T4 ligase buffer 2 µl
ddH2O 15 µl
TOTAL =20 µl
  • ligation over night at 16 °C (waterbath).

Eppis with Ligation products are stored in two 50 ml Falcon tubes at -20°C (lowest drawer)!


Induction of PAL,4CL,CHS,OMT,APT and GFP in pYES in S. cerevisiae in SC-U medium with 2% galactose

Investigator: Mary, Daniela

Aim of the experiment: Expression of all enzymes in Saccharomyces cerevisiae.

enzyme OD600 volume to be pelleted [ml]
PAL+ 3.246 6.2
PAL- 3.604 5.5
4CL+ 3.875 5.2
4CL- 4.0 5.0
CHS+ 3.685 5.43
CHS- 6.68 5.43
OMT+ 3.795 5.27
OMT- 4.085 4.896
APT 3.415 5.86
GFP 3.855 5.188

Incubation at 30 °C over night.

Preparation of solutions for generating chemo competent E.Coli- cells

Investigator: Roman

Procedure:

Required solutions (for a 24ml suspension of competent cells)

  • 0,1 M MgCl2
  • 0,05 M CaCl2
  • 0,05 M CaCl2, 15% v/v glycerine

Prepared volumes:

  • 30 ml CaCl2, 15% v/v glycerine; 0,22g CaCl2 were mixed with 4,5 ml glycerine and 25,5 ml bidestillated water and autoclaved
  • 500 ml MgCl2; 10,17g MgCl2 were mixed with 500 ml bidestillated water and autoclaved
  • 250 ml CaCl2; 1,84g CaCl2 were mixed with 250 ml bidestillated water and autoclaved

Preparation of competent cells see next day.

Wednesday, August 8th

Miniprep of overnight culture of E. coli containing biobricks BBa_K181000, BBa_K365002 and BBa_K365003

Investigator: Jeff, Dennis

Aim of the experiment: Miniprep of overnight culture of E. coli containing biobricks BBa_K181000, BBa_K365002 and BBa_K365003.

Procedure:

  • Miniprep with Kit from Qiagen after manufacturer's protocol

Preperative digestion and gelelectrophoresis of P27 and P315

Investigator: Jeff, Dennis

Aim of the experiment:

Procedure:

  • Reaction batch for P27:
volume reagent
25 µl Plasmid-DNA P27
4 µl NEBuffer 4 (10x)
0.4 µl BSA (100x)
1 µl XbaI (20 U/µl)
1 µl PstI-HF (20 U/µl)
8.6 µl ddH2O
=40 µl TOTAL
  • Reaction batch for P315:
volume reagent
25 µl Plasmid-DNA P27
4 µl NEBuffer 4 (10x)
0.4 µl BSA (100x)
1 µl XbaI (20 U/µl)
1 µl PstI-HF (20 U/µl)
8.6 µl ddH2O
=40 µl TOTAL
P27 digested with XbaI+PstI-HF BBa_I15008: Heme oxygenase 1 (HO1) 100 bp DNA ladder P315 digested with XbaI+PstI-HF BBa_K181000: PcyA 1 kbp DNA ladder
Backbone and insert correct Backbone and insert correct

TUM12 20120808 prep Gel 1.jpg

Analytical digestion and gelelectrophoresis of P313 BBa_K365002: PhyB(908NT)and P314 BBa_K365003 : PhyB(642NT)

Investigator: Jeff, Dennis

Aim of the experiment:

Procedure:

  • Reaction batch for P313 (BBa_K365002):
volume reagent
2.5 µl Plasmid-DNA P313
2 µl NEBuffer 4 (10x)
0.2 µl BSA (100x)
0.25 µl XbaI (20 U/µl)
0.25 µl PstI-HF (20 U/µl)
14.8 µl ddH2O
=20 µl TOTAL
  • Reaction batch for P314 (BBa_K365003):
volume reagent
2.5 µl Plasmid-DNA P313
2 µl NEBuffer 4 (10x)
0.2 µl BSA (100x)
0.25 µl XbaI (20 U/µl)
0.25 µl PstI-HF (20 U/µl)
14.8 µl ddH2O
=20 µl TOTAL
100 bp DNA ladder P313 digested with XbaI+PstI-HF (BBa_K365002: PhyB(908NT) P314 digested with XbaI+PstI-HF (BBa_K365003: PhyB(642NT) 1 kbp DNA ladder
Backbone and insert correct Backbone and insert correct

TUM12 20120808 anal Gel 3.jpg

Transformation of E. coli XL1-Blue with ligation products P206+P310 and P312+P311

Investigator: Jeff

Aim of the experiment: Transformation of E. coli XL1-Blue with ligation products P206+P310 (N'-20aaLinker-LexA-C' construction) and P312+P311 (N'-Pif3-20aaLinker-C')

Procedure:

  • Transformation was performed after standard transformation protocol from the lab.
  • Transformated E. coli XL1-Blue cells were plated on antibiotic plates and were put at 37 °C overnight.
  • P206+P310 (CamR), P312+P311 (CamR)

Picking of E. coli XL1-Blue colonies containing BBa_K365000

Investigator: Jeff

Aim of the experiment: Picking of E. coli XL1-Blue colonies containing BBa_K365000 to a miniprep on the nextday from the overnight culture.

Procedure:

  • 3 colonies were picked with pipette tips and transferred into a new cell-culture tube with 4 ml of LB-medium and chloramphenicol. These tubes were put overnight in a 180 rpm cell culture shaker at 37 °C.

Miniprep of ligation products of transformation from August 3rd

Investigator: Lara


Aim: Get transformed plasmids for further analytical restriction digest to check whether ligation worked.


Procedure: Miniprep was done using Qiagen miniprep kit.

  • PCR1/p175 clone 1: 200 ng/µl
  • PCR1/p175 clone 2: 260 ng/µl
  • PCR1/p175 clone 3: 460 ng/µl
  • PCR1/p175 clone 4: 450 ng/µl
  • PCR2/p175: 222 ng/µl
  • PCR2/p133 clone 1: 145 ng/µl
  • PCR2/p133 clone 2: 150 ng/µl
  • PCR2/p133 clone 3: 140 ng/µl
  • PCR2/p133 clone 4: 510 ng/µl


Eppis containing miniprep products were stored in 50 ml Falcon tubes at the lowest drawer of -20°C. --> will be thrown away in case ligation hasn't worked.

Analytical restriction digest of miniprep products

Investigator: Lara


Aim: Analytical restriction digest to check whether ligation of Tuesday, July 31st has worked.

volume reagent
2.5 µl plasmid DNA
0.25 µl Xba1
0.25 µl Spe1
2 µl NEBuffer 4
0,2 µl BSA (100x)
14.8 µl ddH2O
  • Incubation for 1.5 h at 37°C.

Analytical Gel

1. Standard (1 kb Gene Ruler)

2. PCR1/p175 clone 1

3. PCR1/p175 clone 2

4. PCR1/p175 clone 4

5. PCR1/p175 clone 3

6. PCR2/p175

7. PCR2/p133 clone 1

8. PCR2/p133 clone 2

9. PCR2/p133 clone 3

10.PCR2/p133 clone 4 --> successful!

TUM12 LS analytgel 0808.png

Transformation of ligation products from ligation of August 7th

Investigator: Lara

Aim: Transform E.coli XL 1 blue with ligation products to produce colonies containing plasmid DNA.

Transformation into E.coli Xl1-Blue

  • thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • adding of 5 µl of ligation products
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • adding of 1 ml LB-medium without antibiotics to the cells and incubation at 37°C and 180 rpm for 60 min
  • plating of 100 µl of the cells on an Amp-plate (pYES (P175) or Chloramphenicol-plate (pSB1C3, P133)
  • sedimentation of the leftover in a centrifuge (30 - 60 sec, 13 000 rpm), resuspension of the sediment in 100 µl LB-medium and plating it as well on an antibiotic containing LB-plate

Cell lysis of S. cerevisiae

Investigator: Mary,Daniela

Aim of the experiment:Receive (hopefully) expressed enzymes.


The protocol 'Expression Hefe' (Dropbox) was used. If you want to repeat the experiment please read comments before you start.

You should make a glycerol stock of clones picked. You should as well take a sample of the uninduced yeast and do a cell lysis to be able to compare the induced and uninduced status.


Preparation of sodium phosphate buffer (50 mM):

  • 1 M Na2HPO4x2H2O (M = 177.99 g/mol): 1.7799 g dissolved in 10 ml ELGA water
  • 1 M NaH2PO4x2H2O (M = 156.01 g/mol): 0.468 g dissolved in 3 ml ELGA water
  • 8.095 ml Na2HPO4 and 1.905 ml NaH2PO4 and 190 ml ELGA water were mixed -> pH should be 7.5 but in our case it wasn't. Therefore we used all of the Na2HPO4, but could only achieve an pH of 7.47.


Preparation of PMSF (100 mM)->solution is in the fridge:

  • 0.0174 g were dissolved in 1 ml isopropanol (techn.)


Preparation of breaking buffer:

  • 11.25 ml sodium phosphate buffer (50 mM)
  • 750 µl Glycerol (80%)
  • 24 µl EDTA


Preparation of breaking buffer with PMSF:

  • 6 ml of breaking buffer
  • 60 µl of PMSF (100 mM)


Preparations for SDS gel the next day:

The absorption A280 was measured with Nano Drop. The SDS gel should be loaded with 30 µg protein, each assay was filled up with buffer to a total volume of 10 µl. 2.5 µl 5xLaemmlired were added and all assays were denatured at 95 °C for 5 min.

enzyme concentration [mg/ml] (A280) concentration of 1:10 dilution [mg/ml] (A280) volume of 1:10 dilution with 30 µg protein [µl]
PAL+ 64.024 7.946 3.78
PAL- 61.140 8.605 3.486
4CL+ 85.65 9.459 3.17
4CL- 54.166 7.443 not applied on the gel
CHS+ 65.338 6.045 4.96
CHS- 51.167 6.135 4.89
OMT+ 49.128 5.453 5.5
OMT- 62.074 4.193 7.15
APT 42.554 4.787 6.27
GFP 36.443 4.247 7.06


Preparation chemocompetent E.Coli- cells

Investigator: Roman, Simon

Operational sequence:

The competent cells were prepared as described in the protocoll:

  • 600ml LB medium were inoculated with 6ml of an E.Coli XL1 blue overnight culture and grown to an OD550 of 0,67
  • centrifugation and washing of the cells as described in the protocol
  • cells were aliquoted as 100µl suspensions in the cold room
  • storage at -80°C

Thursday, August 9th

PCR amplification of a fragment of P313

Investigator: Roman

Aim of experiment: Amplification of wanted fragment

Operational Sequence:

PCR- reaction batch was prepared as follows:

substrate volume in µl
ddH2O 35,75
One Taq Standard Reaction Buffer (5x) 10
Plasmid template (p313) 1
Primer O70 (10 µM) 1
Primer O72 (10 µM) 1
dNTP (10 mM) 1
Polymerase One Taq 0,25

Negative control was prepared the same way, with 1 µl ddH2O instead of plasmid template.


PCR temperature program:

  • initial heating: 94°C for 30s
  • 30 cycles
  • denaturation: 94°C for 30s
  • annealing: 67°C for 60s
  • elongation: 68°C for 3 min
  • final elongation: 68°C for 5 min
  • 4°C

Afterwards, the PCR reaction tubes were stored over night in the fridge at 4 °C

Miniprep of picked E. coli XL1-Blue containing BBa_K365000

Investigator: Dennis

Aim of the experiment: Miniprep of picked E. coli XL1-Blue containing BBa_K365000. From those minipreps PCRs should be done to introduce RFC25 pre- and suffixes and MfeI and BamHI restriction sites.

Procedure:

  • Miniprep was performed with Qiaprep Spin miniprep kit from Qiagen.
  • Miniprep was performed after manufacturer's protocol.

Preperative digestion and gelelectrophoresis of P324

Investigator: Dennis

Aim of the experiment: Preperative digestion and gelelectrophoresis of P324 for fusion protein construction the plasmid containing the phytochrome interacting factor 3 including the RFC25 pre- and suffix was digested with NgoMIV and PstI-HF.

Procedure:

  • Reaction batch:
volume reagent
20 µl Plasmid-DNA Pxxx
4 µl NEBuffer 4 (10x)
2 µl NgoMIV (10 U/µl)
1 µl PstI-HF (20 U/µl)
13 µl ddH2O
=40 µl TOTAL
  • After 2-3 h of incubation time at 37 °C the reaction mix was mixed with 4.44 µl DNA running buffer (10x) and was pipetted into a gelpocket of an 1% low-melting agarose gel.
  • The gel was running for about 1  at 80 V
  • Then the gel extraction kit from Qiagen was used for extracting the linearized insert from the agarose gel.

TUM12 20120809 dennis präp verdau baa36500.jpg

Picking from the overnight transformation of ligated P206+P310 product and P312+P311 product in E. coli XL1-Blue

Investigator: Dennis

Aim of the experiment: Picking from the overnight transformation of ligated P206+P310 product and P312+P311 product in E. coli XL1-Blue from August, the 8th.

Procedure:

  • 5 colonies from P206+P310 transformated cells and 5 colonies from P312+P311 transformated cells were picked.
  • Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4 ml of LB-medium and chloramphenicol. These tubes were put overnight in a 180 rpm cell culture shaker at 37 °C.

Picking of colonies of transformation (August 8th)

Investigator: Lara


Aim: Get cells for miniprep for further analytical restriction digest to check whether ligation has worked.


Procedure: Picking of 3 clones each of PCR42/p175, PCR43/p175, PCR56/p175, PCR57/p175, PCR58/p175 into 4 ml LB with Amp and PCR42/p133, PCR43/p133, PCR56/p133, PCR57/p133, PCR58/p133 into 4 ml with Chlp. Inbucation at 37°C (shaker) over night.

SDS-PAGE of crude protein extract after induced expression of PAL, 4CL, CHS, OMT, APT and GFP in yeast

Investigator: Daniela

Aim of the experiment: Getting the right concentration of protein for the western blot.

The preparation of the samples was already described on August, 8th.

  • 12 % gel
  • 6 µl Unstained Protein MW Marker (Thermo Scientific)
  • 12.5 µl sample

TUM12 120809 SDS-PAGE.jpg


Mass of enzymes:

  • PAL = 76.880 kDa
  • 4CL = 61.053 kDa
  • CHS = 42.713 kDa
  • OMT = 39.265 kDa
  • APT = 45.481 kDa

The enzymes of the coumaroyl pathway were not detectable within the other proteins. However the gel looks good, therefore the same concentrations were used for the western blot.

Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast

Investigator: Daniela


Aim of the experiment: Detecion of enzymes via Strep-tag


SDS-PAGE:

The supernatant of the lysis reaction (see August, 8th) was diluted 1:10 with ELGA water. The absorption A280 was measured with Nano Drop. The SDS gel should be loaded with 30 µg protein, each assay was filled up with buffer to a total volume of 10 µl. 2.5 µl 5xLaemmlired were added and all assays were denatured at 95 °C for 5 min.

enzyme concentration of 1:10 dilution [mg/ml] (A280) volume of 1:10 dilution with 30 µg protein [µl]
PAL+ 8.585 3.49
PAL- 7.824 3.83
4CL+ 10.218 2.94
CHS+ 12.875 2.33
CHS- 7.245 4.14
OMT+ 8.158 3.68
OMT- 5.002 6
APT 5.15 5.82
GFP 4.805 6.24
  • 12 % gel
  • 120 V, 1.5 h


Blotting:

  • blotting of proteins on a nitrocellulose membrane (Whatman)
  • 50mA, 1 h


Blocking:

  • wash 3x5min with PBS-T0.1
  • the membrane is blocked over night at 4 °C on a shaking device

Retransformations with pSB1C3

Investigator: Roman

Aim of experiment: Aim of the experiment was on the one hand to fill up the stock of usable pSB1C3 for both, the caffeine and the whole team. On the other hand, the experiment was used as a test for previously prepared competent E.Coli cells

Operational sequence: The used vectors for the transformations were pSB1C3 RFC25 (p123), and pSB1C3 containing CHS- from the coumaroyl group (p136). Vector lengths are 2070 bps and xxx bps, respectively).

Transformations:

  • Transformation of (old) chemo competent e.coli cells, used up to now, and the newly prepared with p123
  • Transformation of the new chemo competent e.coli cells with p136 with two slightly different methods:
    • as described in previous protocolls, with an heat shock at 37°C for 5 minutes
    • with an heat shock at 42°C for 30 seconds, followed by an incubation on ice for 30 minutes (before the cells being incubated with LB- medium)

The reaction batches were plated out on chloramphenicol containing LB- agar plates (both, unconcentrated and concentrated, i.e. resuspended in ca. 100 µl LB medium). Plates were incubated over night at 37°C.

Friday, August 10th

Analytical gelelectrophoresis of PCR product of P313 to introduce RFC25 pre- and suffix

Investigator: Roman

Aim of the experiment: Analytical gelelectrophoresis of PCR product of P313 to introduce RFC25 pre- and suffix to see wether the PCR was successful.

Procedure:

  • The PCR product was first purificated with PCR purification kit from Qiagen
  • Analytical gelelectrophoresis was performed at 90 V for ~1 h.
  • PCR was successful!

TUM12 20120810 anal PCR313.jpg (3 µl of PCR solution were analyzed on gel)

Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P206+P310 and ligated P312+P311

Investigator: Dennis, Roman

Aim of the experiment: Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P206+P310 and ligated P312+P311.

Procedure:

  • Miniprep was done with the Qiagen Qiaprep spin miniprep kit and was performed after manufacturer's protocol.

Transformation analysis and preparation of over- night cultures

Investigator:Roman

Aim of the experiment: Analysis of the transformation with old and new chemocompetent E.Coli- cells and preparation of over night (over weekend, respectively) cultures, to amplificate the vector pSB1C3

Results:

  • All plates showed a lot of colonies
  • The concentrated plates were quite overgrown, the unconcentrated ones showed single colonies
  • no difference could be detected between transformation with 42°C heat shock (followed by 30 min incubation on ice, see previous day) and 37°C heat shock

Newly prepared competent cells seem to work, further investigations (e.g. plating out with different antibiotics), see below.

Operational sequence: Liquid cultures of the following transformants were prepared:

  • XL1-blue with p123 (old competent cells used)
  • XL1-blue with p123 (new competent cells used)
  • XL1- blue with p136

To prepare the over night cultures, 4ml of LB medium containing chloramphenicol (4µl) were inoculated with a pipet- tip and incubated at room temperature over the weekend with 180 rpm.

Plating of newly generated chemocompetent cells with different antibiotics

Investigator: Roman

Aim: Test, if prepared competent cells (untransformed) are sensitive to different antibiotics

Operational sequence:

Used antibiotics:

  • ampicillin
  • kanamycin
  • tetracyclin
  • chloramphenicol

100µl of untransformed, melted E.Coli- cells were plated and incubated over the weekend at room temperature. No growth should occure.

Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast - continued

Investigator: Daniela


Aim of the experiment: Detecion of enzymes via Strep-tag


Detection:

  • via Streptavidin-AP (1:4000) ->7ml, Streptavidin-AP diluted in PBST0.1
  • 1h incubation, be sure that the whole membrane is covered with Streptavidin-AP solution.

Developing:

  • 15 ml AP-buffer mixed with 45 µl BCIP (50 mg/ml in DMF) and 7.5 µl NBT (75 mg/ml in 70 % DMF)
  • incubation: about 30 min

TUM12 120810WesternBlot.jpg


Expected bands:

PAL: length: 716, mass = 76,880 kDa

4CL: no strep-tag ->negative control (length: 561, mass = 61.053 kDa)

CHS: length: 390, mass = 42.713 kDa

OMT: length: 352, mass = 39.265 kDa

APT: length: 411, mass = 45.481 kDa

GFP: mass: 26.9 kDa ->positive control

Miniprep

Investigator: Dennis

Minipreps are stored in a disposal bag on the lowest drawer of -20°C.

Saturday, August 11th

Repetition of SDS-PAGE and Western Blot of crude protein extract after induced expression of PAL, 4CL, CHS, OMT, APT and GFP in yeast

Investigator: Ingmar

Aim of the experiment: Execute the Western Blot using the StrepMab Classic antibody in order to test whether the immunospecifity is better. Furthermore one of the first SDS-PAGEs was done with an increased protein concentration.

Operational sequence

  • To test wheather the increased protein concentrations lead to overloaded bonds, two SDS-PAGE gels which have been stained with Coomassie brilliant blue afterwards were run parallely to the ones for the Western blots.
  • The preparation of the samples was executed as describes on August, 8th.
  • 12 % SDS-PAGE gel, width of the collection gel: 2 mmm
  • 6 µl Unstained Protein MW Marker (Thermo Scientific) for the staining with Coomassie brilliant blue and 6 µl Prestained Protein MW Marker (Thermo Scientific)for the western blots.
  • 15 µl sample
  • SDS gel with 30 µg protein of each sample:

SDS PAGE of diluted crude cell extracts

Mass of enzymes:

  • PAL = 76.880 kDa
  • 4CL = 61.053 kDa
  • CHS = 42.713 kDa
  • OMT = 39.265 kDa
  • APT = 45.481 kDa
  • SDS gel with maximal protein concentration using 15 µl of the crude cell extract:

SDS PAGE of concentrated crude cell extracts

Mass of enzymes:

  • PAL = 76.880 kDa
  • 4CL = 61.053 kDa
  • CHS = 42.713 kDa
  • OMT = 39.265 kDa
  • APT = 45.481 kDa

The enzymes of the coumaroyl pathway were not detectable within the other proteins. However the gels look good, therefore the same concentrations were used for the western blot.

Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast

Investigator: Ingmar


Aim of the experiment: Detecion of enzymes via Strep-tag using Strep MAB classic


SDS-PAGE:

Two separate approaches were executed: First, one Wester Blot was prepared using 30 µg protein of each sample as described by Daniela Dichtler on 09.08.2012. Second, a maximal protein concentration was used by utilizing undiluted crude cell extract. 10 µl of diluted an undiluted cell extract supernatant were mixed with 2.5 µl 5xLaemmlired and incubated at 95 °C for 5 min.

  • 12 % SDS-PAGE gel, width of the collection gel: 2 mmm
  • 6 µl Prestained Protein MW Marker (Thermo Scientific)
  • 12.5 µl sample
  • 90 V as long as the samples cross the collecting gel, afterwards 110 V until the dye is close to the lower end of the gel.


Blotting:

  • blotting of proteins on a nitrocellulose membrane (Whatman) according to the protocol of Nadine Kallweit
  • 50mA per gel, 1 h


Blocking:

  • wash 3x7.5min with PBS-T0.1
  • the membrane is blocked over night at 4 °C on a shaking device with 3 % BSA in PBS-T0.1

Sunday, August 12th

Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast - continued

Investigator: Ingmar


Aim of the experiment: Detecion of enzymes via Strep-tag


Detection:

  • wash 3x 7,5 moin with PBS-T0.1
  • 1h incubation with Strep MAB-classic primary antibody (10 ml per gel)
  • wash 3x 7,5 moin with PBS-T0.1
  • 1h incubation with DAKO rabbit anti-mouse secondary antibody wich is conjugated to alkaline peroxidase(10 ml per gel)

Developing:

  • wash 2x 5 min with PBS-T 0.1 and 2x 5 min with PBS. Brandish the membranes afterwards for 2 min in AP-buffer.
  • Add 15 ml AP-buffer mixed with 45 µl BCIP (50 mg/ml in DMF) and 7.5 µl NBT (75 mg/ml in 70 % DMF)
  • Incubation until the bonds become sufficiently visible, here 10-15 min.
  • Western Blot using diluted samples:

Western Blot of diluted crude cell extracts

Expected bands:

PAL: length: 716, mass = 76,880 kDa

4CL: no strep-tag ->negative control (length: 561, mass = 61.053 kDa)

CHS: length: 390, mass = 42.713 kDa

OMT: length: 352, mass = 39.265 kDa

APT: length: 411, mass = 45.481 kDa

GFP: mass: 26.9 kDa ->positive control

  • Western Blot using concentrated samples:

Western Blot of concentrated crude cell extracts

PAL: length: 716, mass = 76,880 kDa

4CL: no strep-tag ->negative control (length: 561, mass = 61.053 kDa)

CHS: length: 390, mass = 42.713 kDa

OMT: length: 352, mass = 39.265 kDa

APT: length: 411, mass = 45.481 kDa

GFP: mass: 26.9 kDa ->positive control

On both gels the desired proteins can not be detected doubtless. Therefore several taks have to be done:

  • Sequencing of the used genconstructs
  • Sample taking after variable time after inducton in order to optimizie the amount of desired protein.
  • Test different blocking techniques for the Western Blot to reduce the background signal.

Monday, August 13th

Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P206+P310 products (P327-P331)

Investigator: Jeff

Aim of the experiment: Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P206+P310. P327-P331 (N'-Pif3-20aaLinker-C').

Procedure:

  • Mastermix for analytical digestion with NgoMIV+PstI-HF
volume reagent
12 µl NEBuffer 4 (10x)
1.5 µl NgoMIV
1.5 µl PstI-HF
90 µl ddH2O
=105 µl TOTAL
  • 17.5 µl of the mastermix for NgoMIV+PstI-HF was added to 2.5 µl of plasmid DNA of P327, P328, P329, P330, P331.
  • Incubation for 2 h at 37 °C.

Order of gel-pockets:

100 bp ladder DNA ladder P327 (digested with NgoMIV+PstI-HF) P328 (digested with NgoMIV+PstI-HF) P329 (digested with NgoMIV+PstI-HF) P330 (digested with NgoMIV+PstI-HF) P331 (digested with NgoMIV+PstI-HF) P310 control (before ligation and already digested with NgoMIV+PstI-HF) 1 kbp ladder DNA ladder
Ligation/Fusion was successful! Ligation/Fusion was successful! Ligation/Fusion was successful! Ligation/Fusion was successful! Ligation/Fusion was successful! Control OK!

TUM12 20120813 anal gel p327-p331 p310.jpg

Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P312+P311 products (P332-P336)

Investigator: Jeff

Aim of the experiment: Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P206+P310. P327-P331 (N'-20aaLinker-LexA-C').

Procedure:

  • Mastermix for analytical digestion with EcoRI-HF+AgeI-HF
volume reagent
12 µl NEBuffer 4 (10x)
1.2 µl BSA (100x)
1.5 µl EcoRI-HF
1.5 µl AgeI-HF
88.8 µl ddH2O
=105 µl TOTAL
  • 17.5 µl of the mastermix for EcoRI-HF+AgeI-HF was added to 2.5 µl of plasmid DNA of P332, P333, P334, P335, P336.
  • Incubation for 2 h at 37 °C.

Order of gel-pockets:

100 bp ladder DNA ladder P332 (digested with EcoRI-HF+AgeI-HF) P333 (digested with EcoRI-HF+AgeI-HF) P334 (digested with EcoRI-HF+AgeI-HF) P335 (digested with EcoRI-HF+AgeI-HF) P336 (digested with EcoRI-HF+AgeI-HF) P311 control (before ligation and already digested with EcoRI-HF+AgeI-HF) 1 kbp ladder DNA ladder
Ligation/Fusion was successful! Ligation/Fusion was successful! Ligation/Fusion was successful! Ligation/Fusion was successful! Ligation/Fusion was successful! Control OK!

TUM12 20120813 anal gel p332-p336 p311.jpg

Preperative digestion of PCR41 (Pif3 100NT)

Investigator: Jeff

Aim of the experiment: Contruction of N'-SV40NLS-Gal4AD-pGADT7 AD linker-Pif3(100NT)-C'.

Procedure:

  • Reaction batch:
volume reagent
25 µl PCR41
5 µl Buffer G (10x)
2 µl BamHI (10 U/µl)
2 µl MfeI (MunI) (10 U/µl)
16 µl ddH2O
=50 µl TOTAL

Preperative digestion of PCR48 (Gal4DBD)

Investigator: Jeff

Aim of the experiment: To backup amplificated Gal4DBD with RFC25 pre- and suffix in pSB1C3.

Procedure:

  • Reaction batch:
volume reagent
25 µl PCR48
5 µl NEBuffer 4 (10x)
0.5 µl BSA (100x)
1 µl XbaI (20 U/µl)
1 µl PstI-HF (20 U/µl)
17.5 µl ddH2O
=50 µl TOTAL
  • WRONG DIGESTION, THERE IS NO PstI-HF SITE IN THE PCR PRODUCT! IT SHOULD HAVE BEEN XbaI+AgeI-HF

Preperative digestion of PCR65 (PhyB 908NT)

Investigator: Jeff

Aim of the experiment: To backup amplificated PhyB (908NT) with RFC25 pre- and suffix in pSB1C3.

Procedure:

  • Reaction batch:
volume reagent
25 µl PCR65
5 µl NEBuffer 4 (10x)
0.5 µl BSA (100x)
1 µl XbaI (20 U/µl)
1 µl PstI-HF (20 U/µl)
17.5 µl ddH2O
=50 µl TOTAL
  • WRONG DIGESTION, THERE IS NO PstI-HF SITE IN THE PCR PRODUCT! IT SHOULD HAVE BEEN XbaI+AgeI-HF

Preperative digestion of P292

Investigator: Jeff

Aim of the experiment: Only the backbone of this part is needed; this part including LexA is used because to see if the double digest work. If it doesn't work, there won't be 2 DNA strands. Backbone was cut out for ligation with SV40NLS (PCR34).

Procudure:

  • Reaction batch:
volume reagent
20 µl P292
4 µl NEBuffer 4 (10x)
0.4 µl BSA (100x)
1 µl XbaI (20 U/µl)
1 µl PstI-HF (20 U/µl)
13.6 µl ddH2O
=40 µl TOTAL
  • WRONG DIGESTION! IT SHOULD HAS BEEN XbaI+AgeI-HF! BUT IT CAN BE USED FOR OTHER PURPOSES

Preperative digestion of P293 (Gal4AD)

Investigator: Jeff

Aim of the experiment: Contruction of N'-SV40NLS-Gal4AD-pGADT7 AD linker-Pif3(100NT)-C'.

Procedure:

  • Reaction batch:
volume reagent
20 µl P293
8 µl Buffer Tango (10x)
4 µl EcoRI (10 U/µl)
2 µl BamHI (10 U/µl)
6 µl ddH2O
=40 µl TOTAL

Preperative gelelectrophoresis of digested PCR41, PCR48, PCR65

Investigator: Jeff

Aim of the experiment: Preperative gelelectrophoresis of digested PCR41, PCR48, PCR65.

Procedure:

  • Preperative gelelectrophoresis was performed at 70 V for 90 min.
  • 5.55 µl of DNA loading buffer (10x) was added to each of the digested PCR products.

Order of gel-pockets:

PCR41 digested MfeI+BamHI 100 bp ladder DNA ladder PCR48 digested with XbaI+PstI-HF 1 kbp ladder DNA ladder PCR65 digested with XbaI+PstI-HF
Okay! Length OK but wrong digestion, should have been XbaI+AgeI-HF Length OK but wrong digestion, should have been XbaI+AgeI-HF

TUM12 20120813 prep gel pcr41 pcr48 pcr65.jpg

Preperative gelelectrophoresis of digested P292 and P293

Investigator: Jeff

Aim of the experiment: Preperative gelelectrophoresis of digested P292 and P293

Procedure:

  • Preperative gelelectrophoresis was performed at 70 V for 90 min.
  • 4.44 µl of DNA loading buffer (10x) was added to each of the digested plasmid products.

Order of gel-pockets:

P292 digested XbaI+PstI-HF 100 bp ladder DNA ladder P293 digested with EcoRII+BamHI 1 kbp ladder DNA ladder
Length OK but wrong digestion, should have been XbaI+AgeI-HF Okay!

TUM12 20120813 prep gel p292 p293.jpg

Ligation of P71+P322

Investigator: Jeff

Aim of the experiment: Ligation of P71+P322.

Procedure:

  • Reaction batch:
volume reagent
4.18 µl P71
3.63 µl P322
2 µl T4 ligase buffer (10x)
0.25 µl T4 ligase (5 U/µl)
9.69 µl ddH2O
=20 µl TOTAL
  • No negative control because there was no sufficient amount of P71 anymore.
  • The ligation was performed at room temperature for 1 h after manufacturer's protocol.

Ligation of P71+P323

Investigator: Jeff

Aim of the experiment: Ligation of P71+P323.

Procedure:

  • Reaction batch:
volume reagent
4.18 µl P71
5.01 µl P323
2 µl T4 ligase buffer (10x)
0.25 µl T4 ligase (5 U/µl)
8.31 µl ddH2O
=20 µl TOTAL
  • No negative control because there was no sufficient amount of P71 anymore.
  • The ligation was performed at room temperature for 1 h after manufacturer's protocol.

Ligation of P206+P337

Investigator: Jeff

Aim of the experiment: Ligation of P206+P337.

Procedure:

  • Reaction batch:
volume reagent
1.69 µl P206
7.62 µl P337
2 µl T4 ligase buffer (10x)
0.25 µl T4 ligase (5 U/µl)
8.19 µl ddH2O
=20 µl TOTAL
  • Negative control was performed with P206 only wihtout insert, i. e. the only difference is that ddH2O was used instead of P337 in the reaction batch.
  • The ligation was performed at room temperature for 1 h after manufacturer's protocol.

Ligation of P342+PCR66

Investigator: Jeff

Aim of the experiment: Ligation of P342+PCR66.

Procedure:

  • Reaction batch:
volume reagent
1.04 µl P342
1.92 µl PCR66
2 µl T4 ligase buffer (10x)
0.25 µl T4 ligase (5 U/µl)
14.54 µl ddH2O
=20 µl TOTAL
  • Negative control was performed with P342 only wihtout insert, i. e. the only difference is that ddH2O was used instead of PCR66 in the reaction batch.
  • The ligation was performed at room temperature for 1 h after manufacturer's protocol.

Transformation of E. coli XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66

Investigator: Jeff

Aim of the experiment: Transformation of E. coli XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66.

Procedure:

  • 5 µl of the ligation products (P71+P322, P71+P323, P206+P337 and P342+PCR66) and their negative controls (P206 NK, P324 NK) were added to 100 µl of CaCl2 competent E. coli XL1-Blue cells on ice.
  • 30 min incubation on ice.
  • 5 min heat shock at 37 °C
  • Adding of 1 ml LB-medium to each tube.
  • Incubation for 45 min at 37 °C in the 180 rpm cell-culture shaker.
  • 100 µl of those cell suspension were plated on suitable antiotic plates.
  • The rest were centrifuged for 1 min at 13000 rpm and the supernatant was dicarded.
  • The pellet was resuspended in 100 µl of LB-medium and this concentrated cell suspension was plated again on suitable antbiotic plates.

Quick Change mutagenesis to remove SpeI(at 684 bp) in the 4CL and SpeI (at 470 bp) in CHS

Investigator: Ingmar

Aim of the experiment: Generation of RFC 25 compatible versions of the 4CL and CHS genes. Used plasmids

  • pYes
    • 4Cl+: P193
    • 4CL-: P194
    • CHS+: P195
    • CHS-: P196
  • PSB1C3
    • 4CL+ P185
    • 4CL-: P186
    • CHS+: P135
    • CHS-: P136

PCR
Reaction batch 1

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl DNA
0.5 µl 1:10 dilution of O81 for 4 CL and O83 for CHS (10 pmol/µL)
16.5 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Ultra II DNA polymerase (2.5 U / µl)

Reaction batch 2

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl DNA
0.5 µl 1:10 dilution of O82 for 4 CL and O84 for CHS (10 pmol/µL)
16.5 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Ultra II DNA polymerase (2.5 U / µl)


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 10 95°C 30 sec
55°C 1 min
67°C 6 min
  • Having completed the PCR cycling parameters listed above both PCR reaction batches were mixed together and the cycling parameters listed above were one time more applied.
  • Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.

Transformation into E.coli Xl1-Blue Operation Sequence

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • addition of 1 µl of the PCR product
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Amp-LB-plate
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate

Analysis of plated, untransformed chemocompetent E.Coli- cells

Investigator: Roman

Aim: To test the prepared chemocompetent E.Coli- cells.

Results:

  • Plate with kanamycin: no colonys (as expected)
  • Plate with ampicillin: no colonys (as expected)
  • Plate with tetracyclin: full (as expected, due to natural resistance)
  • Plate with chloramphenicol: 12 colonies (not expected, should be empty)

The plating on a chloramphenicol containing plate will be repeated, at 37°C over night instead of room temperature over the weekend, because perhaps chloramphenicol is degraded by the bacteria after two days

small-Scale Yeast Transformation of pYES without insert

Investigator: Katrin, Ingmar

Aim of the experiment:Transformation of P152 (pYes without insert) in Yeast

The protocol on page 13 of the pYES2 manual was used. To ensure a positive result, two transformations were made.


Only modifications are noted:

step 1: inoculate in 4 ml YPD medium

step 2: OD600 = 5,6 -> to determine a OD600 of 0.4 in 50 ml, 3 ml yeast suspension and 50 ml YPD medium were used.


steps 3 and 4: centrifugation for 5 min, 4 °C


step 6:

1 µg plasmid DNA

  • P152: c = 156.8 ng/µl -> 6,4 µl

100 µg denatured sheared salmon sperm: the one from Simon was used -> 10 µl

The cells were plated out on SC-U plates with Glucose and incubated at 30°C

Plasmid isolation of p123 and p136

Investigator: Roman

Aim: Aim of the experiment was the isolation of p123 out of transformed (see friday) XL-1 blue chemo competent e.coli- cells. Old and newly prepared competent cells were used (see friday). Besides, p136 was isolated out of transformed cells, which is pSB1C3 with CHS- inserted. The whole experiment should provide an adequate amount of pSB1C3 backbone for the caffeine team, because we want to insert our three genes in this vector.

Operational Sequence:

The plasmid preparation was performed as described in the manufacturers protocoll (Quiagen Miniprep Kit). Elution was done with 50 µl Elution Buffer in one step. Due to the incubation of the liquid cultures at room temperature over the weekend instead of 37°C over night, the pellet was a bit smaller than usual, resulting in concentrations of only:

  • 51,9 ng/µl (p123, old competent cells used)
  • 57,8 ng/µl (p123, new competent cells used)
  • 59,2 ng/µl (p136)

Restriction digest of p123 and p136 and preparative gel electrophoresisb

Investigator: Roman

Aim:

Preparation of Xba1 and Pst1 digested pSB1C3 backbone, to be able to ligate the three caffeine genes into it.

Operational sequence

Reaction batch:

volume reagent
50 µl (ca. 2-3 µg) p123/p136
6 µl 10x Buffer NEB 4
0,6 µl BSA (100x)
2 µl Xba1 RE
2 µl Pst1- HF RE
=60 µl TOTAL

Afterwards, about 6 µl of 10x loading dye were added and the fragments were separated by preparative gel electrophoresis, with the CHS- fragment being about 1300 bp in length.

TUM12 20120813 p123 p136 Xba1Pst1.jpg

From left to right:

DNA- Ladder pSB1C3_Xba1Pst1 pSB1C3_CHS-_Xba1Pst1 DNA- Ladder

Dilution of gen- synthesis products and transformation

Investigator: Roman

Aim:

Dilution of dried pUCIDT- Amp vector, which contains the gene synthesis products. Afterwards, transformation of pUCIDT_CaXMT1, pUCIDT_CaMXMT1 and pUCIDT_CaDXMT1 in chemo competent XL-1 blue e.coli- cells, to make the genes available for cloning in pSB1C3 and pYES2.

Operational sequence

Basical vector data of pUCIDT

  • length: 2752 bp
  • resistance: ampicillin

About 2 µg of dried vector (containing our inserts) were delivered. By dilution with 20 µl bidestillated water (after centrifugation), a final concentration of about 100 ng/µl was adjusted.

Transformation

Transformation in chemo competent cells was performed as previously described. Unconcentrated plating (100 µl) was performed on ampicillin containing LB agar plates, whereas the rest of the transformation- batch was stored in the fridge at 4°C (previous experiments showed, that unconcentrated plating led to enough colonies). The plates were incubated at room temperature over the next two days.

Repetition of plating of newly prepared chemo competent cells

Investigator: Roman

Aim:

Test of newly prepared chemo competet cells, due to present chloramphenicol resistance

Operational sequence

Because 12 colonies were grown on chloramphenicol containing agar plates after incubation at room temperature over the weekend (although "empty" competent XL1- blue cells were used), this plating was repeated and incubation was carried out at 37°C over night.

Preparative restriction digest and gel electrophoresis of the preprothaumatin plasmid and pYes2

Investigator: Maddin, Aloisius

Aim: Cloning of preprothaumatin on pYes2

Operational sequence

Preparative restriction digest:

  • 5 µl pYes2; 1 µl XbaI; 1 µl SpeI; 5 µl 10x NEBuffer 4;0,5 µl BSA; 37.5 µl ddH2O; 37 °C, 1 h.
  • 10 µl Preprothaumatinplasmid (gene synthesis!); 1 µl XbaI; 1 µl SpeI; 5 µl 10x NEBuffer 4; 0,5 µl BSA; 32.5 µl ddH2O; 37 °C, 1 h.
  • Preparative gel electrophoresis: expected lengths for pYes2: backbone: 5.8 kb, (insert: 62 bp); expected length for preprothaumtin plasmid: backbone: 2.2 kb, insert: 721 bp.
  • Gel extraction according to QIAqick® Gel Extraction Kit. Not successful, EtOH was forgotten.
  • Transformation of E. coli XL1-Blue with the preprothaumatin plasmid (selection with amp).


Tuesday, August 14th

Analysis of plated XL1-blue chemo competent e.coli (untransformed)

Investigator: Volker

Aim:

Test of prepared chemo competent cells (empty) due to present resistance for chloramphenicol

Results

Again 14 colonies have grown on the plate, after incubating at 37°C over night. One can presume, that the newly prepared competent cells have taken up any plasmid providing chloramphenicol resistance (e.g. pSB1C3), makin them unuseful for our experiments. The uptake probably took place when inoculating the LB medium, one day befor the cells were prepared, because a sample of our old competent cells was used for the inoculation instead of a plated colony of e.coli- XL1-blue.

Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue

Investigator: Jeff

Aim of the experiment: Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue.

Procedure:

  • 5 colonies of each transformation from P71+P322 (AmpR), P71+P323 (AmpR), P206+P337 (CamR) and P342+PCR66 (AmpR) transformated cells were picked.
  • Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4 ml of LB-medium and antibiotics (P71+P322 (AmpR), P71+P323 (AmpR), P206+P337 (CamR) and P342+PCR66 (AmpR)). These tubes were put overnight in a 180 rpm cell culture shaker at 37 °C.

Reapeat of transformation of E. coli XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th

Investigator: Jeff

Aim of the experiment: Reapeat of transformation of E. coli XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th. The reason is that the freshly prepared competent cells are contaminated with a foreign plasmid.

Procedure:

  • 5 µl of the ligation products (P71+P322, P71+P323, P206+P337 and P342+PCR66) and their negative controls (P206 NK, P324 NK) were added to 100 µl of CaCl2 competent E. coli XL1-Blue cells on ice.
  • 30 min incubation on ice.
  • 5 min heat shock at 37 °C
  • Adding of 1 ml LB-medium to each tube.
  • Incubation for 45 min at 37 °C in the 180 rpm cell-culture shaker.
  • 100 µl of those cell suspension were plated on suitable antiotic plates.
  • The rest were centrifuged for 1 min at 13000 rpm and the supernatant was dicarded.
  • The pellet was resuspended in 100 µl of LB-medium and this concentrated cell suspension was plated again on suitable antbiotic plates. Accidently, only the pellet of P342+PCR66 and P342 NK was plated.

Analytical restriction digest of ligation products of 10.08. after miniprep

Investigator: Andrea

Aim: Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pYES and pSB1C3.


volume reagent
20 µl miniprep products
2 µl NEBuffer 4 (10x)
0.2 µl BSA (100x)
0.25 µl XbaI (20 U/µl)
0.25 µl Pst1-HF (20 U/µl)
=20 µl TOTAL
  • Master-Mix: 7 µl Enzyme, 56 µl NEB-Buffer, 5,6 µl BSA, 414,4 µl ddH2O
  • 2,5 µl DNA added to 17,5 µl Master-Mix
  • Incubation at 37°C for 1,5 h.


Gelelectrophoresis:

14 08 2012 analytgel1 bearbeitet.jpg

14 08 2012 analytgel2 bearbeitet.jpg

14 08 2012 analytgel3 bearbeitet.jpg

  • ligation failed

Preparation of material for protein expression in yeast

Investigator: Ingmar, Katrin

Aim of the experiment:Preparation of media for protein expression in yeast (expression will be done on thursday, august 16th)

  • The following media were made:


SC-U medium (synthetic complete medium, without uracil)

  • 0.67% yeast nitrogen base (without amino acids)
  • 2% carbon source (i.e. glucose or galactose)
  • 0.01% (adenine, arginine, cysteine, leuine, lysine, threonine, tryptophan)
  • 0.005% (aspartic acid, histidine, isoleucine, methionine, phenylalanine, proline, serine, tyrosine, valine)

--> Production:We produced 1l of induction media(containig 2% galactose and 1 l of growth media(containing 2% glucose). A 50ml AS-aliquot and 6.7g Yeast Nitrogen Base were dissolved in 850ml water and autoklaved. Parallely 100 ml solutions with 20 % galactose and galactose respectively were autoclaved and mixed with 900 ml of the other media afterwards.

Breaking buffer

  • 50 mM sodium phosphate buffer, pH 7,5
  • 1 mM EDTA
  • 5% (v/v) glycerol
  • 1 mM PMSF

Minipreparation of the preprothaumatin plasmid (gene synthesis)

Investigator: Martianus, Aloisius

  • p343, p344, p345.

Wednesday, August 15th

Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66

Investigator: Jeff

Aim of the experiment: Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.

Procedure:

  • Miniprep was done with the Qiagen Qiaprep spin miniprep kit and was performed after manufacturer's protocol.

Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P71+P322 and P71+P323 products

Investigator: Jeff

Aim of the experiment: Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P71+P322 (P352-P356) and P71+P323 products (P357-P361).

Procedure:

  • Mastermix for analytical digestion with XbaI+PstI-HF
volume reagent
22 µl NEBuffer 4 (10x)
2.2 µl BSA (100x)
2.75 µl XbaI (20 U/µl)
2.75 µl PstI-HF (20 U/µl)
162.8 µl ddH2O
=192.5 µl TOTAL
  • 17.5 µl of the mastermix for XbaI+PstI-HF was added to 2.5 µl of plasmid DNA of P352-P356.
  • Incubation for 2 h at 37 °C.
  • Analytical gelelectrophoresis was performed at 90 V for 60 min.
100 bp ladder DNA ladder P352 P353 P354 P355 P356 P357 P358 P359 P360 P361 1 kbp ladder DNA ladder
Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed
  • Only the linearized backbone (pYES2 new with ~6 kbp) is visible but no inserts were visible.

TUM12 20120815 anal gel 01.jpg

Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P206+P337 products

Investigator: Jeff

Aim of the experiment: Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P206+P337 products (P352-P366).

Procedure:

  • Mastermix for analytical digestion with NgoMIV+PstI-HF
volume reagent
12 µl NEBuffer 4 (10x)
1.5 µl NgoMIV (10 U/µl)
1.5 µl PstI-HF (20 U/µl)
90 µl ddH2O
=105 µl TOTAL
  • 17.5 µl of the mastermix for NgoMIV+PstI-HF was added to 2.5 µl of plasmid DNA of P362-P366.
  • Incubation for 2 h at 37 °C.
  • Analytical gelelectrophoresis was performed at 90 V for 60 min.
100 bp ladder DNA ladder P362 P363 P364 P365 P366 1 kbp ladder DNA ladder
Digestion not worked properly? Seems like it was successful but digestion does not work properly. Ligation failed Digestion not worked properly? Seems like it was successful but digestion does not work properly. Ligation failed Digestion not worked properly? Seems like it was successful but digestion does not work properly.
  • For P362, P364 and P366, it seems that the digestion does not work properly, the expected band around 2-2.1 kbp and ~360 bp were only weak.

TUM12 20120815 anal gel 02.jpg

Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P342+PCR66 products

Investigator: Jeff

Aim of the experiment: Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P342+PCR66 products (P367-P371).

Procedure:

  • Mastermix for analytical digestion with NdeI+BamHI
volume reagent
24 µl Tango (10x)
6 µl NdeI (10 U/µl)
6 µl BamHI (10 U/µl)
69 µl ddH2O
=105 µl TOTAL
  • 17.5 µl of the mastermix for NdeI+BamHI was added to 2.5 µl of plasmid DNA of P367-P371.
  • Incubation for 2 h at 37 °C.
  • Analytical gelelectrophoresis was performed at 90 V for 60 min.
100 bp ladder DNA ladder P367 P368 P369 P370 P371 1 kbp ladder DNA ladder
Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed
  • Ligation failed, even no Backbone was visible (~8 kbp)!

TUM12 20120815 anal gel 03.jpg

Transformation of E.coli XL1 blue with ligation products

Investigator: Andrea

Aim: Transformation of ligation products PCR42/P133, PCR43/P133, P56/P133, P57/P133, P58/P133, PCR42/P175, P43/P175, P56/P175, P57/P175, P58/P175

Transformation into E.coli Xl1-Blue

  • thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • add 5 µl of ligation product
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 45 min
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an antibiotic containing LB-plate (Amp-plate (pYES (P175) or Chloramphenicol-plate (pSB1C3, P133))

repetition of analytical restriction digest of ligation products of 10.08. after miniprep

Investigator: Andrea

Aim: Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pYES and pSB1C3.


volume reagent
20 µl miniprep products
2 µl NEBuffer 4 (10x)
0.2 µl BSA (100x)
0.25 µl XbaI (20 U/µl)
0.25 µl SpeI (20 U/µl)
=20 µl TOTAL
  • Master-Mix: 7 µl Enzyme, 56 µl NEB-Buffer, 5,6 µl BSA, 414,4 µl ddH2O
  • 2,5 µl DNA added to 17,5 µl Master-Mix
  • Incubation at 37°C for 2 h.


Gelelectrophoresis:

15.08.12 analytgel1 bearbeitet.png

15.08.12 analytgel2 bearbeitet.png

15.08.12 analytgel3 bearbeitet.png

  • ligation failed

Picking of colonies of transformation (August 3rd and August 8th)

Investigator: Katrin


Aim: Get cells for miniprep for further analytical restriction digest to check whether ligation has worked.


Procedure:

  • Picking of 10 clones each of PCR42/p175 and PCR56/p175 (Trafo 08.08.)
  • Picking of 3 clones of PCR2/P133 (Trafo 03.08.)
  • Picking of 1 clone of PCR2/P175 (Trafo 03.08.)
  • clones were put into 4 ml LB with Amp (P175) or Chlp (P133)
  • Inbucation at 37°C (shaker) over night.

Preparation of cells for protein expression in yeast

Investigator: Katrin

Aim of the experiment:Picking transformed Saccharomyces cerevisae cells for protein expression in yeast (expression will be done on Thursday, August 16th)

  • Inocultion of overnight cultures: one clone from each plates with PAL+/-, CHS+/-, 4CL+/-, OMT1+/-, APT, GFP was picked,resuspended in 15 ml SCU medium with glucose and incubated at 30 °C overnight

Thursday, August 16th

Analytic digestion and gelelectrophoresis of P362, P364 and P366

Investigator: Jeff

Aim of the experiment: Analytic digestion and gelelectrophoresis of P362, P364 and P366 because the analytical digestion from the day before does not work properly.

Procedure:

  • Mastermix for analytical digestion with NgoMIV+PstI-HF
volume reagent
8 µl NEBuffer 4 (10x)
2 µl NgoMIV (10 U/µl)
1 µl PstI-HF (20 U/µl)
59 µl ddH2O
=70 µl TOTAL
  • 17.5 µl of the mastermix for NgoMIV+PstI-HF was added to 2.5 µl of plasmid DNA of P362, P364 and P366.
  • Incubation for 90 min at 37 °C.
  • Analytical gelelectrophoresis was performed at 90 V for 60 min.
100 bp ladder DNA ladder P362 P364 P366 1 kbp ladder DNA ladder
Ligation failed Ligation failed Ligation succesfull, but to be sure, sequencing has to be performed!

TUM12 20120816 anal gel 01.jpg

Sequencing of P366

Investigator: Jeff

Aim of the experiment: Succesful fusion of 20aa Linker + Pif3 has to be proven. Sequencing was performed by Eurofins.

Procedure:

  • Preparing sequencing primer VF2 for Eurofins (c=2 pmol/µl)
volume reagent
0.4 µl O68 (100 pmol/µl)
19.6 µl ddH2O
=20 µl (2 pmol/µl TOTAL
  • 15 µl of P366 was pippetted in a new tube for sequencing.
  • Both tubes were sent to Eurofins
  • Sequencing results:
TATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAA
GGATGATTTCTGGAATTCGCGGCCGCTTCTAGATGGCCGGCGCGAGCGGCGCGGGCGGCA
GCGAAGGCGGCGGCAGCGAAGGCGGCACCAGCGGCGCGACCACCGGCATGCCTCTGTTTG
AACTTTTCAGGCTCACCAAAGCTAAGCTTGAATCTGCTCAAGACAGGAACCCTTCTCCAC
CTGTAGATGAAGTTGTGGAGCTGGTGTGGGAAAATGGTCAGATATCAACTCAAAGTCAGT
CAAGTAGATCGAGGAACATTCCTCCACCACAAGCAAACTCTTCAAGAGCTAGAGAGATTG
GAAATGGCTCAAAGACGACTATGGTGGACGAGATCCCTATGTCAGTGCCATCACTAATGA
CGGGTTTGAGTCAAGACGATGACTTTGTTCCATGGTTGAATCATCATACCGGTTAATACT
AGTAGCGGCCGCTGCAGTCCGGCAAAAAAACGGCAAGGTGTCACCACCCTGCCCTTTTTC
TTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCG
CTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATC
CACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAG
GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCA
TCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCA
GGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGTCGCTTACCGG
ATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAG
GTATCTCAGTTCGGTGTAGGTCG
  • Sequencing is fine!

Preperative digestion of PCR48 (Gal4DBD)

Investigator: Jeff

Aim of the experiment: To backup amplificated Gal4DBD with RFC25 pre- and suffix in pSB1C3.

Procedure:

  • Reaction batch:
volume reagent
17 µl PCR48
5 µl NEBuffer 4 (10x)
0.5 µl BSA (100x)
1 µl XbaI (20 U/µl)
1 µl AgeI-HF (20 U/µl)
23.5 µl ddH2O
=50 µl TOTAL

Preperative digestion of PCR65 (PhyB 908NT)

Investigator: Jeff

Aim of the experiment: To backup amplificated PhyB (908NT) with RFC25 pre- and suffix in pSB1C3.

Procedure:

  • Reaction batch:
volume reagent
7 µl PCR65
5 µl NEBuffer 4 (10x)
0.5 µl BSA (100x)
1 µl XbaI (20 U/µl)
1 µl AgeI-HF (20 U/µl)
35.5 µl ddH2O
=50 µl TOTAL

Preperative digestion of P231

Investigator: Jeff

Aim of the experiment: Preperative digestion of P231 for ligation to N-terminal SV40 nuclear localization signal. But sequencing result has first to be awaited.

Procedure:

  • Reaction batch:
volume reagent
20 µl P231
4 µl NEBuffer 4 (10x)
0.4 µl BSA (100x)
1 µl AgeI(20 U/µl)
1 µl PstI-HF (20 U/µl)
13.6 µl ddH2O
=40 µl TOTAL

Preperative digestion of P235

Investigator: Jeff

Aim of the experiment: Preperative digestion of P235 for get the pYES2newMCS backbone for cloning heme oxygenase (HO1) and phycocyanobilin:ferredoxin oxidoreductase (PcyA) into pYES2newMCS.

Procedure:

  • Reaction batch:
volume reagent
20 µl P235
4 µl NEBuffer 4 (10x)
0.4 µl BSA (100x)
1 µl XbaI(20 U/µl)
1 µl PstI-HF (20 U/µl)
13.6 µl ddH2O
=40 µl TOTAL

Preperative gelelectrophoresis of digested PCR48 and PCR65

Investigator: Jeff

Aim of the experiment: Preperative gelelectrophoresis of digested PCR48 and PCR65.

Procedure:

  • Preperative gelelectrophoresis was performed at 70 V for 90 min.
  • 5.55 µl of DNA loading buffer (10x) was added to each of the digested plasmid products.

Order of gel-pockets:

100 bp ladder DNA ladder PCR48 digested XbaI+AgeI-HF PCR65 digested with XbaI+AgeI-HF 1 kbp ladder DNA ladder
Length OK! Length OK!

TUM12 20120816 prep gel pcr48 pcr65.jpg

Preperative gelelectrophoresis of digested P231 and P235

Investigator: Jeff

Aim of the experiment: Preperative gelelectrophoresis of digested P231 and P235

Procedure:

  • Preperative gelelectrophoresis was performed at 70 V for 90 min.
  • 4.44 µl of DNA loading buffer (10x) was added to each of the digested plasmid products.

Order of gel-pockets:

P231 digested XbaI+AgeI-HF 100 bp ladder DNA ladder P235 digested with XbaI+AgeI-HF 1 kbp ladder DNA ladder
Length OK! Length OK!
  • From digested P235 only the backbone was cut out for further ligations.

TUM12 20120816 prep gel p231 p235.jpg

PCR amplification of a fragment of P313 to introduce RFC25 pre- and suffix

Investigator: Jeff

Aim of experiment: Amplification of wanted fragment of P313 (PhyB 908-NT) to introduce RFC25 pre- and suffix.

Operational Sequence:

  • 2 tubes were prepared
  • PCR reaction batch was prepared as follows:
substrate volume in µl
ddH2O 35.75
One Taq Standard Reaction Buffer (5x) 10
Plasmid template (P313) 1
Primer O70 (10 µM) 1
Primer O72 (10 µM) 1
dNTP (10 mM) 1
Polymerase One Taq 0,25

PCR temperature program:

  • initial heating: 94°C for 30s
  • 30 cycles
  • denaturation: 94°C for 30s
  • annealing: 67°C for 60s
  • elongation: 68°C for 3 min
  • final elongation: 68°C for 5 min
  • 4°C

Afterwards, the PCR reaction products were cleaned with the Qiagen's PCR purification kit after manufacturer's protocol and were stored over night in the fridge at 4 °C

Miniprep of the 10 h culture of transformated E. coli XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66

Investigator: Jeff

Aim of the experiment: Miniprep of the 10 h culture of transformated E. coli XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.

Procedure:

  • Miniprep was done with the Qiagen Qiaprep spin miniprep kit and was performed after manufacturer's protocol.

Ligation of P207+PCR69

Investigator: Jeff

Aim of the experiment: Ligation of P207+PCR69 to backup Gal4DBD with RFC25 pre- ans suffix on pSB1C3.

Procedure:

  • Reaction batch:
volume reagent
1.41 µl P207
7.19 µl PCR69
2 µl T4 ligase buffer (10x)
0.25 µl T4 ligase (5 U/µl)
9.15 µl ddH2O
=20 µl TOTAL
  • Negative control was performed with P207 only wihtout insert, i. e. the only difference is that ddH2O was used instead of PCR69 in the reaction batch.
  • The ligation was performed at 16 °C overnight.

Ligation of P207+PCR70

Investigator: Jeff

Aim of the experiment: Ligation of P207+PCR70 to backup PhyB(908 NT) with RFC25 pre- ans suffix on pSB1C3.

Procedure:

  • Reaction batch:
volume reagent
1.12 µl P207
16.38 µl PCR70
2 µl T4 ligase buffer (10x)
0.25 µl T4 ligase (5 U/µl)
=20 µl TOTAL
  • Negative control was performed with P207 only wihtout insert, i. e. the only difference is that ddH2O was used instead of PCR70 in the reaction batch.
  • The ligation was performed at 16 °C overnight.

Picking from the transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue from Tuesday, the 14th

Investigator: Jeff

Aim of the experiment: Picking from the transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue from Tuesday, the 14th because the same transformation the day before failed because the competent cells were contaminated, e. g. they already carries a plasmid.

Procedure:

  • 5 colonies of each transformation from P71+P322 (AmpR), P71+P323 (AmpR), P206+P337 (CamR) and P342+PCR66 (AmpR) transformated cells were picked from the transformation from Tuesday, the 14th.
  • Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4 ml of LB-medium and antibiotics (P71+P322 (AmpR), P71+P323 (AmpR), P206+P337 (CamR) and P342+PCR66 (AmpR)). These tubes were put 10 h in a 180 rpm cell culture shaker at 37 °C.

Induction, Incubation and cell disruption of S.c. containing PAL+/-, 4Cl+, CHS+/-, OMT+/-, APT and GFP

Investigator: Ingmar, Katrin

Aim of the experiment: Take samples at variable times after induction and disrupt the cells in order to optimize the amount of desired protein. Procedure:

  • at 13:30h the overnight culture was diluted in 50 ml SC-U medium conataining 2 % galactose until an OD600 of 0.4.
  • beginning 4h after induction every 3 h samples were taken and cells were disrupted according to "Expression in Saccharomyces cerevisiae" of Huang FC, Studart-Witkowski C & Schwab W 2010. The supernatant of the disrupted cells were used for protein concentration appreciation using the nanodrop photometer. Afterwards they were stored at -80°C.

Gel extraction of p123 and p136

Investigator: Roman

Aim:

Extraction of pSB1C3 (digested with Xba1 and Pst1, = p123 and p136; digest was made on Monday) out of agarose gel.

Operational Sequence

Gel extraction was performed as described the manufacturers protocol (Quiagen). However, the determined concentrations (NanoDrop) were quite low:

  • 8 ng/µl for p123 (Xba/Pst1)
  • 11 ng/µl for p136 (Xba1/Pst1)

This results in a yield of only about 20% (original concentrations were between 50 and 60 ng/µl) Thus, a new over night culture was prepared (see below) to gain a higher initial concentration of plasmid DNA. The next gel extraction will be performed with bidestillated water (instead of elution buffer EB), temperated at 50°C.

Restriction digest of p373 (pYES2 new MCS RFC25)

Investigator: Roman

Aim:

Restriction digest of pYES2 new with Xba1 and Pst1-HF to be able to clone the caffeine genes into.

Operational Sequence

Reaction batch:

volume reagent
4µl NEBuffer 4 (10x)
0,4µl BSA (100x)
2µl XbaI (20 U/µl)
2µl PstI-HF (20 U/µl)
11,6µl ddH2O
=40µl TOTAL

The reaction batch was incubated for 2.5h at 37°C.

Picture:

TUM12 20120816 pYES2newXba1Pst1.jpg

From left to right:

DNA- Ladder pYES2newMCS_Xba1Pst1

Picking of transformed e.coli- XL1-blue cells and preparation of liquid cultures

Investigator: Roman

Aim:

Preparation of liquid over night cultures of the following transformants:

Operational sequence:

  • pUCIDT_CaXMT1
  • pUCIDT_CaMXMT1
  • pUCIDT_CaDXMT1
  • pSB1C3_CHS- (=p136)

Two colonies of each plate were picked and used for inoculation of 6ml LB medium, containing the respective antibiotic (ampicillin or chloramphenicol). The tubes were incubated at 37°C over night.

Gel extraction of p373 (=pYES2 new MCS RFC25)

Investigator: Roman

Aim:

Extraction of Xba1 and Pst1 digested pYES2 new out of agarose gel, to make it ready for ligation

Operational sequence:

Gel extraction was performed as described in the manufacturers protocoll. However, bidestillated water was used for elution (30µl). Besides, the water was heated up to 37°C and also the 5 minutes of incubation (before final centrifugation) was done on the heating block at 37°C.

NanoDrop

Concentration of the extracted plasmid was determined with NanoDrop and resulted in a concentration of 75,9 ng/µl. As of now, all elution steps in gel extraction procedures will be performed at these conditions.

PCR of C-LS3 (BBa_I742111, Trafo 19.6)

Investigator: Andrea

Aim: To get more PCR product in case another preparative digest is needed.


Primer with consensus sequence

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer O27
1 µl 10 µM Reverse Primer O30
0.25 µl OneTaq Hot Start DNA Polymerase (Finally: 1.25 units/50 µl)
1 µl Plasmid DNA (BBa_I742111) Clone 3
35.75 µl dd water
50 µL TOTAL


Primer without consensus sequence

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer O28
1 µl 10 µM Reverse Primer O30
0.25 µl OneTaq Hot Start DNA Polymerase (Finally: 1.25 units/50 µl)
1 µl Plasmid DNA (BBa_I742111) Clone 3
35.75 µl dd water
50 µL TOTAL
  • The PCR program was performed after following scheme:
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
47 °C 30 s
68 °C 1,75 min
Final extension 68 °C 5 min
Hold 4 °C 1 h

PCR of Schwab plasmid Quickchange-DNA to amplify gene for lavendula LS

Instructor: Andrea

Aim: PCR of Schwab plasmids after Quickchange-Mutagenesis with primers which were designed to amplify the lavendula LS gene and to add RFC25 restriction sites.

3 different primer combinations were used:

1. O33/O37

2. O34/O37

3. O35/O37

Each primer combination was used for plasmid DNA amplification of P283.

PCR reaction mixture

volume reagent
10 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
1 µl 10 µM Forward Primer
1 µl 10 µM Reverse Primer
0.25 µl OneTaq Hot Start DNA Polymerase (Final: 1.25 units/50 µl)
3 µl Plasmid DNA P283
33.75 µl dd water
50 µL TOTAL
  • The PCR program was performed after following scheme:
Initial denaturation 94 °C 30 s
30 cycles 94 °C 30 s
50 °C 30 s
68 °C 1,75 min
Final extension 68 °C 5 min
Hold 4 °C 1 h

Miniprep of pYES clones picked on August 15th

Investigator: Andrea


Aim: Get transformed plasmids for further ligations.


Procedure: Miniprep was done using Qiagen miniprep kit.

  • concentrations: see "Inventarliste"

Miniprep of ligation products of transformation from August 3rd and August 8th

Investigator: Andrea


Aim: Get transformed plasmids for further analytical restriction digest to check whether ligation worked.


Procedure: Miniprep was done using Qiagen miniprep kit.

  • 1: 84 ng/µl
  • 2: 75 ng/µl
  • 3: 115 ng/µl
  • 4: 107 ng/µl
  • 5: 97 ng/µl
  • 6: 112 ng/µl
  • 7: 63 ng/µl
  • 8: 53 ng/µl
  • 9: 87 ng/µl
  • 10: 107 ng/µl
  • 11: 92 ng/µl
  • 12: 48 ng/µl
  • 13: 107 ng/µl
  • 14: 105 ng/µl
  • 15: 118 ng/µl
  • 16: 106 ng/µl
  • 17: 80 ng/µl
  • 18: 84 ng/µl
  • 19: 90 ng/µl
  • 20: 97 ng/µl
  • 21: 250 ng/µl
  • 22: 60 ng/µl
  • 23: 41 ng/µl
  • 24: 275 ng/µl

Eppis containing miniprep products were stored in an disposal bag at the upper drawer of -20°C. --> will be thrown away in case ligation hasn't worked.

Preparative restriction digest of PCR 56,57,58 (lavendula LS) and PCR 42,43 (citrus LS)

Investigator: Andrea

Aim: Prepare digested PCR fragments for further ligation into pYES and pSB1C3.


volume reagent
25 µl PCR products
5 µl NEBuffer 4 (10x)
0.5 µl BSA (100x)
1 µl XbaI (20 U/µl)
1 µl AgeI-HF (20 U/µl)
17.5 µl ddH2O
=50 µl TOTAL
  • A mastermix for 6 reactions was produced (30µl NEB-Buffer, 3µl BSA, 6µl per enzyme, 105µl ddH2O).
  • PCR products were digested at 37 °C for 3 hours.

P187 was used as positive control for restriction digest (XbaI and AgeI).

Before Gelelectrophoresis Dephosphorylation of several fragments was done (see next part) !

Gelelectrophoresis:

16.08.12 prepgel1 bearbeitet.png 16.08.12 prepgel4 bearbeitet.png


Digested PCR products (still in gel) are stored in an disposal bag at the upper drawer of -20°C.

Dephosphorylation of digested PCR 42, PCR 43, PCR 56, PCR 57 and PCR 58

Investigator: Andrea


Aim: Dephosphorylation of digested PCR products to avoid religation of the insert and enhance ligation rate.

  • Befor Dephosphorylation procedure can be performed, the PCR Purification Kit of Qiagen needs to be used for purifying the digest solution (for removing enymes and buffer) !!!

Procedure: Use of SAP from Fermentas

  • fill up the 50 µl digest solution to 60 µl with ddH20 (10 µl ddH2O were added)
  • add each 6µl SAP-Buffer and 1 µl SAP
  • mix
  • incubate at 37°C for 30 min
  • inactivation at 65°C for 15 min


Preparative restriction digest of P343, P344, P345, P152 (pYES) and P286 (pSB1C3)

Investigator: Andrea

Aim: Prepare digested Preprothaumatin plasmids for further ligation into pYES and pSB1C3.


volume reagent
20 µl PCR products
4 µl NEBuffer 4 (10x)
0.4 µl BSA (100x)
1 µl XbaI (20 U/µl)
1 µl SpeI-HF (20 U/µl)
13.6 µl ddH2O
=40 µl TOTAL
  • A mastermix for 6 reactions was produced (24µl NEB-Buffer, 2.4µl BSA, 6µl per enzyme, 81.6µl ddH2O).
  • plasmids were digested at 37 °C for 3 hours.

P187 was used as positive control for restriction digest (XbaI and AgeI).

Before Gelelectrophoresis Dephosphorylation of vectors (pYES and pSB1C3) was done (see next part) !

Gelelectrophoresis:

16.08.12 prepgel2 bearbeitet.png 16.08.12 prepgel3 bearbeitet.png

pSB1C3 digested with XbaI and AgeI was lost during gelelectrophoresis

Digested PCR products (still in gel) are stored in an disposal bag at the upper drawer of -20°C.

Dephosphorylation of digested pSB1C3 and pYES (with XbaI and SpeI)

Investigator: Andrea


Aim: Dephosphorylation of digested vectors to avoid religation and enhance ligation rate.

  • Befor Dephosphorylation procedure can be performed, the PCR Purification Kit of Qiagen needs to be used for purifying the digest solution (for removing enymes and buffer) !!!

Procedure: Use of SAP from Fermentas

  • fill up the 50 µl digest solution to 60 µl with ddH20 (10 µl ddH2O were added)
  • add each 6µl SAP-Buffer and 3 µl SAP
  • mix
  • incubate at 37°C for 30 min
  • inactivation at 65°C for 15 min

Friday, August 17th

Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P71+P322 and P71+P323 products

Investigator: Jeff

Aim of the experiment: Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P71+P322 (P379-P383) and P71+P323 products (P384-P388).

Procedure:

  • Mastermix for analytical digestion with XbaI+PstI-HF
volume reagent
22 µl NEBuffer 4 (10x)
2.2 µl BSA (100x)
2.75 µl XbaI (20 U/µl)
2.75 µl PstI-HF (20 U/µl)
162.8 µl ddH2O
=192.5 µl TOTAL
  • 17.5 µl of the mastermix for XbaI+PstI-HF was added to 2.5 µl of plasmid DNA of P379-P388 in an ERG.
  • Incubation for 2 h at 37 °C.
  • Analytical gelelectrophoresis was performed at 90 V for 60 min.
100 bp ladder DNA ladder P379 P380 P381 P382 P383 P384 P385 P386 P387 P388 1 kbp ladder DNA ladder
Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed Ligation failed
  • Only the linearized backbone (pYES2 new with ~6 kbp) is visible but no inserts were visible.

TUM12 20120817 anal gel 01.jpg

Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P206+P337 products

Investigator: Jeff

Aim of the experiment: Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P206+P337 products (P389-P393).

Procedure:

  • Mastermix for analytical digestion with NgoMIV+PstI-HF
volume reagent
12 µl NEBuffer 4 (10x)
1.5 µl NgoMIV (10 U/µl)
1.5 µl PstI-HF (20 U/µl)
90 µl ddH2O
=105 µl TOTAL
  • 17.5 µl of the mastermix for NgoMIV+PstI-HF was added to 2.5 µl of plasmid DNA of P389-P393 in an ERG.
  • Incubation for 2 h at 37 °C.
  • Analytical gelelectrophoresis was performed at 90 V for 60 min.
100 bp ladder DNA ladder P389 P390 P391 P392 P393 1 kbp ladder DNA ladder
Ligation failed Ligation successful! Ligation successful! Ligation failed Ligation failed
  • Succesful ligation for P390 and P391. 20aaLinker-PIF3 ready for further fusion!

TUM12 20120817 anal gel 02.jpg

Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P342+PCR66 products

Investigator: Jeff

Aim of the experiment: Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P342+PCR66 products (P394-P398).

Procedure:

  • Mastermix for analytical digestion with NdeI+BamHI
volume reagent
24 µl Tango (10x)
6 µl NdeI (10 U/µl)
6 µl BamHI (10 U/µl)
69 µl ddH2O
=105 µl TOTAL
  • 17.5 µl of the mastermix for NdeI+BamHI was added to 2.5 µl of plasmid DNA of P394-P398.
  • Incubation for 2 h at 37 °C.
  • Analytical gelelectrophoresis was performed at 90 V for 60 min.
100 bp ladder DNA ladder P394 P395 P396 P397 P398 1 kbp ladder DNA ladder
Ligation failed Ligation successful! Ligation successful! Ligation successful! Ligation successful!
  • Ligation for P395-P398! These construct is finished (N'SV40NLS-Gal4AD-Linker-Pif3-C')! Only the RFC10 pre- and suffixes are missing. Next step for this fusion construct is to introduce RFC10 pre- and suffix and ligate it to pSB1C3 and pYES2new for expression. And sequencing has to be done!

TUM12 20120817 anal gel 03.jpg

Transformation of E. coli XL1-Blue with ligation products of P207+PCR69 and P207+PCR70

Investigator: Jeff

Aim of the experiment: Transformation of E. coli XL1-Blue with ligation products of P207+PCR69 and P207+PCR70.

Procedure:

  • 5 µl of the ligation products (P207+PCR69 and P207+PCR70) and their negative controls (P206 NK (PCR69), P206 NK (PCR70)) were added to 100 µl of CaCl2 competent E. coli XL1-Blue cells on ice.
  • 30 min incubation on ice.
  • 5 min heat shock at 37 °C
  • Adding of 1 ml LB-medium to each tube.
  • Incubation for 45 min at 37 °C in the 180 rpm cell-culture shaker.
  • 100 µl of those cell suspension were plated on chloramphenicol plates.
  • The rest were centrifuged for 1 min at 13000 rpm and the supernatant was dicarded.
  • The pellet was resuspended in 100 µl of LB-medium and this concentrated cell suspension was plated again on chloramphenicol plates.
  • Incubation at 37 °C overnight.

Transformation of E.coli Xl1-Blue with ligation of TEF1-p, CYC1-t with psb1c3 and pYES2 selfligation

5 µl of each ligation reaction were transferred to 100 µl of competent cells. Cells were kept on ice for 30 min. Cells were heatshocked for 5 min. at 37 C Cells were incubated for 45 min. at 37 C Cells that were transformed with psb1c3 ligation product were transferred on Agarplates with Chla. Cells with pYesII ligation product were palste on Amp Agar plates.

Preparation of probes for sequencing

For sequencing of ligation product of Tef1-p, ADH1-p, Tef1-t and ADH1-t, with vector psb1c3 ligation products were diluted on a concentration between 50 ng/µl and 100 ng/µl at a min. volume of 15 µl. Sequencing primers were diluted to 2 µM at an min. volume of 15 µl

ADH1-P (188 ng/µl):2 = 7,5 µl (P401) + 7,5 µl H20 ADH-T (153,5 ng :2 = 7,5 µl + 7,5 µl H20 TEF1-P (207,8 ng/µl) :3 = 5 µl + 10 µl H20 Tef1-T (202,2 ng/µl) :3 = 5 µl + 10 µl H20 TEF2 (12,3 ng/µl)= 6,1 µl (TEF2-p) + 8,9 µl H20 = 5 ng/µl

Sequencing primer: VF2 for ADH1-p, ADH1-t, TEF1-p, TEF1-t. VR for ADH1-p rv. TEF2p_fw for TEF2-p

Quick Change mutagenesis to remove EcoRI(at 310 bp) in the 4CL

Investigator: Ingmar

Aim of the experiment: Generation of an RFC 25 compatible version of the 4CL gene.

PCR
Reaction batch 1

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl DNA
0.5 µl 1:10 dilution of O79 (10 pmol/µL)
16.5 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Ultra II DNA polymerase (2.5 U / µl)

Reaction batch 2

volume reagent
2.5 µl 10x Pfu Ultra II buffer
4 µl DNA
0.5 µl 1:10 dilution of O80 (10 pmol/µL)
16.5 µl ddH2O
0.5 µl dNTP mix
0.5 µl Pfu Ultra II DNA polymerase (2.5 U / µl)


PCR cycling parameters

Segment Cycles Temperature Time
1 1 95 °C 30 sec
2 10 95°C 30 sec
55°C 1 min
67°C 6 min
  • Having completed the PCR cycling parameters listed above both PCR reaction batches were mixed together and the cycling parameters listed above were one time more applied.
  • Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.

Transformation into E.coli Xl1-Blue Operation Sequence

  • melting of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • addition of 1 µl of the PCR product
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
  • plate 100 µl on an Amp-LB-plate
  • sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate

Gel extraction of digested PCR products

Investigator: Lara


Aim: Extract digested PCR products for further ligation.


Due to previous phosphatase treatment (and presumably application of only 20 µl on the preparative gel), concentrations of products were very low:

  • PCR 42: 10 ng/µl
  • PCR 43: 10 ng/µl
  • PCR 56: 10 ng/µl
  • PCR 57: 13 ng/µl
  • PCR 58: 14 ng/µl

Digested products are stored in a disposal bag at the upper drawer of -20°C (label: Andrea, miniprep 16.8.)

Ligation of PCR 42, 43, 56, 57 and 58 with pYES (p175) and pSB1C3 (p133)

Investigator: Lara

Aim: Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pYES.

Procedure

PCR 42 in pYES (p175)

Substance Volume
P175 0.5 µl (~50 ng vector dna)
PCR 42 8 µl (~6x of n(vector))
T4 ligase 0.25 
T4 ligase buffer 1 µl
ddH2O 0.25 µl
TOTAL =10 µl

PCR 42 in pSB1C3 (p133)

Substance Volume
P133 1.2 µl (~50 ng vector dna)
PCR 42 20 µl (~6x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2.5 µl
TOTAL =24.2 µl

PCR 43 in pYES (p175)

Substance Volume
P175 0.5 µl (~50 ng vector dna)
PCR 43 8 µl (~6x of n(vector))
T4 ligase 0.25 
T4 ligase buffer 1 µl
ddH2O 0.25 µl
TOTAL =10 µl

PCR 43 in pSB1C3 (p133)

Substance Volume
P133 1.2 µl (~50 ng vector dna)
PCR 43 20 µl (~6x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2.5 µl
TOTAL =24.2 µl

PCR 56 in pYES (p175)

Substance Volume
P175 0.5 µl (~50 ng vector dna)
PCR 56 8 µl (~6x of n(vector))
T4 ligase 0.25 
T4 ligase buffer 1 µl
ddH2O 0.25 µl
TOTAL =10 µl

PCR 42 in pSB1C3 (p133)

Substance Volume
P133 1.2 µl (~50 ng vector dna)
PCR 56 20 µl (~6x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2.5 µl
TOTAL =24.2 µl

PCR 57 in pYES (p175)

Substance Volume
P175 0.5 µl (~50 ng vector dna)
PCR 57 6.5 µl (~6x of n(vector))
T4 ligase 0.25 
T4 ligase buffer 1 µl
ddH2O 1.75 µl
TOTAL =10 µl

PCR 57 in pSB1C3 (p133)

Substance Volume
P133 1.2 µl (~50 ng vector dna)
PCR 57 18 µl (~6x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2.5 µl
TOTAL =22.2 µl

PCR 58 in pYES (p175)

Substance Volume
P175 0.5 µl (~50 ng vector dna)
PCR 58 6.0 µl (~6x of n(vector))
T4 ligase 0.25 
T4 ligase buffer 1 µl
ddH2O 2.25 µl
TOTAL =10 µl

PCR 58 in pSB1C3 (p133)

Substance Volume
P133 1.2 µl (~50 ng vector dna)
PCR 58 16.5 µl (~6x of n(vector))
T4 ligase 0.5 
T4 ligase buffer 2.5 µl
TOTAL =20.7 µl

Negative control/pYES (p175)

Substance Volume
P175 0,5 µl (~50 ng vector dna)
T4 ligase 0.25 
T4 ligase buffer 1 µl
ddH2O 8.25 µl
TOTAL =10 µl

Negative control/pSB1C3 (p133)

Substance Volume
P133 1.2 µl (~50 ng vector dna)
T4 ligase 0.5 
T4 ligase buffer 2.5 µl
TOTAL =25 µl


  • ligation for 2 h at room temperature.
  • 5 µl of ligation product was transformed. The remaining products were incubated at 16 °C (waterbath) for the weekend.


Gel extraction of digested product

Investigator: Lara


Aim: Extract digested prepro-thaumatin for further ligation.


Due to previous phosphatase treatment (and presumably application of only 20 µl on the preparative gel), concentrations of products were very low:

  • P343: 5 ng/µl
  • P344: 5 ng/µl
  • P345: 5 ng/µl
  • pSB1C3: 9 ng/µl
  • pYES: 7 ng/µl

Digested products are stored in a disposal bag at the upper drawer of -20°C (label: Andrea, miniprep 16.8.)

Analytical restriction digest of miniprep (miniprep 16.8., ligations 31.7. and 7.8.)

Investigators: Katrin (digest), Lara (gelelectrophoresis)


Aim: Check whether ligations have worked (transformation products of 3.8. (ligation 31.7.) & 8.8. (ligation 7.8.))


volume reagent
3 µl plasmid DNA
0.5 µl Not 1
2 µl Puffer O (Fermentas)
14.5 µl ddH2O

Gelelectrophoresis:

Gel1: Gene Ruler 1kb, 1, 2, 3, 4, 5, 6, 7, 8, 9

Gel2: Gene Ruler 1kb, 10, 11, 12, 13, 14, 15, 16, 17

Gel3: Gene Ruler 1kb, 18, 19, 20, 21, 22, 23, 24

TUM12 LS analytgel1 1708.png TUM12 LS analytgel2 1708.png TUM12 LS analytgel3 1708.png


Transformation of ligation products

Investigator: Lara


Aim: Transform E.coli XL 1 blue with ligation products (PCR42/p133, PCR42/p175, PCR43/p133, PCR43/p175, PCR56/p133, PCR56/p175, PCR57/p133, PCR57/p175, PCR58/p133, PCR58/p175) to produce colonies containing plasmid DNA.


Transformation into E.coli Xl1-Blue

  • thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
  • adding of 5 µl of ligation products
  • incubation for 30 min on ice
  • heat shock for 5 min at 37 °C
  • adding of 1 ml LB-medium without antibiotics to the cells and incubation at 37°C and 180 rpm for 45 min
  • plating of 100 µl of the cells on an Amp-plate (pYES (P175) or Chloramphenicol-plate (pSB1C3, P133)
  • sedimentation of the leftover in a centrifuge (60 sec, 13 000 rpm), resuspension of the sediment in 100 µl LB-medium and plating it as well on an antibiotic containing LB-plate

Isolation of of plasmids pUCIDT_Insert and pSB1C3

Investigator: Roman

Aim: Isolation of plasmids pUCIDt_CaXMT1, pUCIDT_CaMXMt1, pUCIDT_CaDXMT1 and pSB1C3_CHS- out of 6 ml of an over night culture (2-fold batch for each plasmid)

Operational sequence:

Plasmids were isolated as described in the manufacturers protocoll (Quiagen). Elution was performed with 50µl buffer EB in one step.

Determined concentrations:

  • pUCIDT_CaXMT1 A: 170 ng/µl
  • pUCIDT_CaXMT1 B: 156 ng/µl
  • pUCIDT_CaXMT1 A: 144 ng/µl
  • pUCIDT_CaXMT1 B: 143 ng/µl
  • pUCIDT_CaXMT1 A: 128 ng/µl
  • pUCIDT_CaXMT1 B: 100 ng/µl
  • pSB1C3_CHS- A: 73 ng/µl
  • psb1C3_CHS- B: 108 ng/µl

Restriction digest of isolated plasmids

Investigator: Roman

Aim: Digest of plasmids with Xba1 and Pst1 to gain the caffeine- synthesis genes and pSB1C3 backbone, respectively.


Operational Sequence:

For restriction digest, the isolated plasmids pUCIDT_CaXMT1A, pUCIDT_CaMXMT1A, pUCIDT_CaDMT1A and pSB1C3_CHS-B were used (highest concentrations).

Reaction batch:

reagent volume
ddH2O 13,6 µl
Plasmid-DNA 20 µl
Enzyme Pst1HF 1 µl
Enzyme Xba1 1 µl
10x NEB Buffer 4 4 µl
BSA 100x 0,4 µl
TOTAL 40 µl

The reaction batch was incubated at 37°C für 1.5 h. Afterwards, the fragments were seperated by preparative agarose gel electrophoresis (see picture below).

Gel- picture 1:

TUM12 20120817 pUCIDT InsertsAuB.jpg

From left to right:

DNA- Ladder pUCIDT_CaXMT1_Xba1Pst1 pUCIDT_CaMXMT1_Xba1Pst1 pUCIDT_CaXMT1_uncut

Gel- picture 2:

20120817 pUCIDT InsertCundpSB1C3(p136).jpg

From left to right:

DNA- Ladder pUCIDT_CaDXMT1_Xba1Pst1 pSB1C3_CHS-_Xba1Pst1 pSB1C3_CHS-_uncut

Gel extraction and NanoDrop determination of separated DNA fragments

Investigator: Roman

Aim: Extraction of DNA fragments and determination of concentration previously to the ligation

Operational sequence: The extraction was performed as described in the manufacturers protocoll (Quiagen). Elution was performed with 30µl water (bidestillated) instead of elution buffer. Furthermore, the water has been heated up to 50°C and also the incubation before final centrifugation was performed on the heating block at 50°C.

NanoDrop determination

  • CaXMT1: 21,4 ng/µl
  • CaMXMT1: 15,1 ng/µl
  • CaDMT1: 20,6 ng/µl
  • pSB1C3: 20 ng/µl

(all digested with Xba1 and Pst1)

Ligation of genes envolved in caffeine synthesis into pYES2new and pSB1C3

Investigator: Roman

Aim: Ligation of the genes, which are responsible for caffeine synthesis, into pYES2new (for further expression studies) and pSB1C3 (to create BioBricks).

Operational Sequence:

The following reaction batch refers to a molar ratio of 1:3 between vector and insert.

Reaction batch:

reagent volume
pYES2new 1,5 µl (ca. 120 ng)
InsertA: CaXMT1 3,5 µl (ca. 70 ng)
InsertB: CaMXMT1 5 µl (ca. 70 ng)
InsertC: CaDXMT1 3,5 µl (ca. 70 ng)
Ligase 1 µl
10x Ligase Buffer 2 µl
ddH2O ad 20 µl

The batch was incubated over the weekend at 16°C in the water bath.

Saturday, August 18th

Picking of plated transformated E. coli XL1-Blue colonies with ligated P207+PCR69 and P207+PCR70

Investigator: Jeff

Aim of the experiment: Picking of plated E. coli XL1-Blue colonies, transformed with ligated P207+PCR69 and P207+PCR70 on August, the 17th.

Procedure:

  • 10 colonies of each transformation from P207+PCR69 (CamR) and P207+PCR70 (CamR) transformated cells were picked.
  • Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4 ml of LB-medium and chloramphenicol. These tubes were put 10 h in a 180 rpm cell culture shaker at 37 °C.

Colony PCR of clones of PCR58/p133 (transformation 17.8.)

Investigator: Lara

Aim: Introduce new method to allow for higher throughput of clone screenings.

  • make sure you have PCR tubes and cell culture tubes labeled sufficiently. you need to have one pcr tube and one cell culture tube for each colony.
  • pick a colony with a sterile toothpick or pipet tip, smear some of the cells onto the wall of the pcr tube (a bit of pressure and smearing) and subsequently put the toothpick into a cell culture tube with LB-medium and antibiotic.


19 Clones of PCR58/p133 (transformation of August 17th) were picked + 1 clone of 4CL+(PCR15)/p132 as positive control


volume reagent
2 µl 5x OneTaq Standard Reaction Buffer
1 µl 10 mM dNTPs
0.15 µl 40 µM O68
0.15 µl 40 µM O69
0.1 µl OneTaq Hot Start DNA Polymerase
1 µl Plasmid DNA (BBa_I742111) Clone 3
5.6 µl dd water
10 µL TOTAL
  • The PCR program was performed after following scheme:
Initial denaturation 95 °C 6 min
35 cycles 95 °C 30 s
53 °C 30 s
72 °C 1.75 min
Final extension 72 °C 10 min
Hold 4 °C 1 h

TUM12 LS analytcolonyPCR1.png TUM12 LS analytcolonyPCR2.png

  • Colony PCR failed (and/or failed ligation, in case "negative" positive control was picked)

Analytical restriction digest of different clones

Investigator: Lara


Aim: Repetition of analytical digestion of products of miniprep on August 16th (clone 6,11,24) and August 10th (PCR56/p175 clone 1; PCR56/p175 clone 3; PCR57/p175 clone 2, PCR58/p175 clone 1)

volume reagent
5 µl plasmid DNA
0.3 µl Xba1
0.3 µl Spe1
2 µl NEBuffer 4
0.2 µl BSA (100x)
12.2 µl ddH2O
  • Incubation for 1 h at 37°C.

TUM12 LS analytgel 1808.png

Sunday, August 19th

Miniprep of the overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR69 and P207+PCR70

Investigator: Jeff

Aim of the experiment: Miniprep of the overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR69 and P207+PCR70.

Procedure:

  • Miniprep was done with the Qiagen Qiaprep spin miniprep kit and was performed after manufacturer's protocol.

Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligation products of P207+PCR69 and P207+PCR70

Investigator: Jeff

Aim of the experiment: Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligation products of P207+PCR69 and P207+PCR70.

Procedure:

  • Mastermix for analytical digestion with XbaI+AgeI-HF:
volume reagent
42 µl NEBuffer 4 (10x)
4.2 µl BSA (100x)
5.25 µl XbaI (20 U/µl)
5.25 µl AgeI-HF (20 U/µl)
310.8 µl ddH2O
=367.5 µl TOTAL
  • 17.5 µl of the mastermix for XbaI+AgeI-HF was added to 2.5 µl of prepped plasmid DNA of P408-P427.
  • Analytical gelelectrophoresis was performed at 90 V for 1 h.
100 bp ladder DNA ladder P408 P409 P410 P411 P412 P413 P414 P415 P416 P417 1 kbp ladder DNA ladder
Ligation successful! Gal4DBD ready for protein fusion! Ligation successful! Gal4DBD ready for protein fusion! Ligation successful! Gal4DBD ready for protein fusion! Ligation successful! Gal4DBD ready for protein fusion! Ligation successful! Gal4DBD ready for protein fusion! Ligation successful! Gal4DBD ready for protein fusion! Ligation successful! Gal4DBD ready for protein fusion! Ligation successful! Gal4DBD ready for protein fusion! Ligation successful! Gal4DBD ready for protein fusion! Ligation successful! Gal4DBD ready for protein fusion!

TUM12 20120819 anal gel 01.jpg

100 bp ladder DNA ladder P418 P419 P420 P421 P422 P423 P424 P425 P426 P427 1 kbp ladder DNA ladder
Ligation failed! Ligation failed! Ligation failed! Ligation failed! Ligation successful! PhyB(908-NT) ready for protein fusion! Ligation failed! Ligation failed! Ligation failed! Ligation failed! Ligation failed!

TUM12 20120819 anal gel 02.jpg

Picking Clones for Ingma and Roman

Investigator: Volker

4 Clones for each plate were picked in apropiate media at 1.40 AM => please do not prep before 12 AM!
Eight of them are in the 30° incubator on the right side. If you read this at the right time please put them into the 37°C incubator if there is not some space and prep them in the second round. Thanks!

  • From Ingmas plates p187, p196 and p193 no clones could be picked because there were no single colonies
  • on all positive plates there was a sufficient number of clones (50-300)
  • Romans negative controle plates had no (Bneg) and 6 (Yneg) clones which is good / acceptable
  • on all positive plates there was a sufficient number of clons (30-200)

Monday, August 20st

Preperative digestion and gelelectrophoresis of P422, P331, P417, P290

Investigator: Jeff

Aim of the experiment: Preperative digestion and gelelectrophoresis of P422 (AgeI+PstI-HF), P331 (NgoMIV+PstI-HF), P417 (NgoMIV+PstI-HF), P290 (XbaI+PstI).

Procedure:

  • Reaction batch for P422:
volume reagent
20 µl P422
4 µl NEBuffer 4 (10x)
0.4 µl BSA (100x)
1 µl AgeI(20 U/µl)
1 µl PstI-HF (20 U/µl)
13.6 µl ddH2O
=40 µl TOTAL
  • Reaction batch for P331:
volume reagent
20 µl P331
4 µl NEBuffer 4 (10x)
2 µl NgoMIV(10 U/µl)
1 µl PstI-HF (20 U/µl)
13 µl ddH2O
=40 µl TOTAL
  • Reaction batch for P417:
volume reagent
20 µl P417
4 µl NEBuffer 4 (10x)
2 µl NgoMIV(10 U/µl)
1 µl PstI-HF (20 U/µl)
13 µl ddH2O
=40 µl TOTAL
  • Reaction batch for P290:
volume reagent
20 µl P290
4 µl NEBuffer 4 (10x)
0.4 µl BSA (100x)
1 µl XbaI(20 U/µl)
1 µl AgeI-HF (20 U/µl)
13.6 µl ddH2O
=40 µl TOTAL
  • These reaction batches were incubated for 3 h at 37 °C.
  • Following gelelectrophoresis was performed with whole digestion batch after adding 4.44 µl of DNA loading buffer (10x) to each digestion batch at 70 V for 1.5 h on 1% low-melting agarose gel.
  • Pocket order:
P422 (AgeI-HF+PstI-HF) 100 bp DNA ladder P331 (NgoMIV+PstI-HF) 1 kbp DNA ladder
Backbone incl. PhyB was cut out Insert was cut out

TUM12 20120820 prep gel p422 p331.jpg

  • Pocket order:
P417 (NgoMIV+PstI-HF) 100 bp DNA ladder P290 (XbaI+PstI-HF) 1 kbp DNA ladder
Insert was cut out Backbone was cut out

TUM12 20120820 prep gel p417 p290.jpg

Sequencing of P395, P398, P422, P331, PCR2/P133 Klon 4

Investigator: Jeff

Aim of the experiment: Sequencing of P395, P398, P422, P331, PCR2/P133 Klon 4.

Procedure:

  • Plasmid concentrations were measured by nanodrop to calculate the dilution factor to have a concentration between 50 ng/µl and 100 ng/µl.
  • Plasmid concentration, determinated by nanodropping.
Plasmid Concentration in ng/µl
P395 465.6
P398 391.8
P422 375.8
P331 210.9
PCR2/P133 Klon 4 469.1
  • To get an end concentration between 50-100 ng/µl and an end volume of 15 µl, the dilution was performed as following:
Plasmid Concentration in ng/µl
P395 1:5 dilution: 3 µl plasmid + 12 µl ddH2O
P398 dilution: 1:4 dilution: 3.75 µl plasmid + 11.25 µl ddH2O
P422 1:4 dilution: 3.75 µl plasmid + 11.25 µl ddH2O
P331 1:3 dilution: 5 µl plasmid + 10 µl ddH2O
PCR2/P133 Klon 4 1:5 dilution: 3 µl plasmid + 12 µl ddH2O
  • Also the VF2 forward primer must have a end concentration of 2 ng/µl. So a mastermix for everybody was done with O68 (100 ng/µl)
O68 (VF2, 100 pmol/µl) 20 µl
ddH2O 980 µl
TOTAL (2 pmol/µl) 1000 µl
  • 15 µl was sent with each of P422, P331 and PCR2/P133 Klon 4 in a seperate ERG.

Ligation of P436+P437 and P206+P438

Investigator: Jeff

Aim of the experiment: Ligation of P436+P437 (PhyB(908NT) + 20aaLinker-LexA)and P206+P438 (20aaLinker + Gal4DBD.

Procedure:

  • Reaction batch for P436+P437:
volume reagent
1.11 µl P436
4.21 µl P437
2 µl T4 ligase buffer (10x)
0.5 µl T4 ligase (1 U/µl)
12.18 µl ddH2O
=20 µl TOTAL
  • Reaction batch for P206+P438:
volume reagent
1.69 µl P207
4.92 µl P438
2 µl T4 ligase buffer (10x)
0.5 µl T4 ligase (1 U/µl)
10.89 µl ddH2O
=20 µl TOTAL
  • These ligation batches including their negative controls, which only contain ddH2O instead of the insert, were put on a 16 °C waterbath and were incubated overnight.

Ligation of pYES2 without f1-origin and Gal-promoter

  • Reaction batch for pYes2 circulation:
volume reagent
10,5 µl T4-Ligase
6,72 µl (100 ng) Dig. pYes 2
10 µl PEG 4000
10 µl 10,5 x T4 ligase buffer
68,28 µl H20
= 106 µl total

The mastermix was heated up to 72 C for 5 min bevore T4 ligase was added. It was separated in one reaction at room temperature and one reaction over night at 16 C.

Transformation of E.coli Xl1-blue

To 100 µl competent cells of E. coli Xl1-blue 10 µl of the pYes II Ligation reaction were added. Cells were kept on ice for 30 minutes. Heatshock was done at 37 C for 5 minutes Cells were incubated for 45 minutes in 1 ml LB-medium at 37 C Transformed cells were transferred on Agar plates with ampicillin

Preparative gelrun of TEF1-p, ADH1-p psb1c3 after digestion with PstI and SpeI

After preparative digestion with PstI and SpeI, 44,4 µl of each reaction were transferred onto an agarose gel. Gelrun was performed at 70 Volt for 90 min.

Picking colonies of E.coli Xl1-blue, transforemed with Tef2-p + psb1c3 and Cyc-t + psb1c3

15 colonies from Tef2-p and 6 from Cyc-t were picked and transferred into LB-medium with 1x Chloramphenicole. Incubation was performed over night at 37 C.

Colony PCR

Investigator: Lara


Aim: Establish colony PCR to increase speed of clone screening.

  • make sure you have PCR tubes and cell culture tubes labeled sufficiently. you need to have one pcr tube and one cell culture tube for each colony.
  • pick a colony with a sterile toothpick or pipet tip, smear some of the cells onto the wall of the pcr tube (a bit of pressure and smearing) and subsequently put the toothpick into a cell culture tube with LB-medium and antibiotic.


  • Citrus: 8 clones of PCR43/p175 were picked.
  • Lavendula: 8 clones of PCR58/p133 (5 clones of transformation of August 17th, 3 clones of August 8th) and PCR58/p175 (8 of transformation of August 17th) were picked
  • plasmid DNA of PCR2/p133 clone 4 as positive control


Citrus

volume reagent
5 µl 5x OneTaq Standard Reaction Buffer
0.5 µl 10 mM dNTPs
0.5 µl 10 µM O28
0.5 µl 10 µM O30
0.13 µl OneTaq Hot Start DNA Polymerase
18.37 µl dd water
25 µL TOTAL

Lavendula

volume reagent
5 µl 5x OneTaq Standard Reaction Buffer
0.5 µl 10 mM dNTPs
0.5 µl 10 µM O35
0.5 µl 10 µM O37
0.13 µl OneTaq Hot Start DNA Polymerase
18.37 µl dd water
25 µL TOTAL
  • PCR program:
Initial denaturation 94 °C 10 min
30 cycles 95 °C 30 s
59 °C 30 s
68 °C 1 min 55 sec
Final extension 68 °C 5 min
Hold 4 °C

Labels of the cell culture tubes/PCR tubes:

1-8: PCR43/p175

9: PCR2/p133 clone 4 (positive control)

10-17: PCR58/p175

18-22: PCR58/p133, transformation of August 17th

23-25: PCR58/p133, transformation of August 8th


TUM12 LS analytcolonyPCR3.png TUM12 LS analytcolonyPCR4.png TUM12 LS analytcolonyPCR5.png

Miniprep

Investigator: Dennis

Aim: Miniprep of over night cultures with number 1,2,6,7,9,12,13,15,16,18 (clones that were picked for colony PCR on saturday, PCR58/p133).

The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 40 µl of elution buffer (Kit) at room temperature, with the columns having been incubated 5 minutes at room temperature before the final centrifugation.


Miniprep products are stored in a Eppi tube in the lowest drawer at -20°C.


Miniprep

Investigator: Saskia

Aim: Miniprep of over night cultures with number 3,5,8,10,11,14,17 (clones that were picked for colony PCR on saturday, PCR58/p133).

The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 40 µl of elution buffer (Kit) at room temperature, with the columns having been incubated 5 minutes at room temperature before the final centrifugation.

Number Concentration in ng/µl
3 254.7
5 223.4
8 339.4
10 303.5
11 162.4
14 142.1
17 151.8

Miniprep products are stored in a 50 ml Falcon tube in the lowest drawer at -20°C. (Falcon tube label: Miniprep Saskia 20.8.)

Ligation of insert and pYes

Investigator: Martin y Aloís


Aim: Ligate the extracted plasmids of the experiment before

Due to the small yield we only were able to run 4 ligations:

  1: pSB1C3 and P343
  I: pSB1C3 and P343 OVER NIGHT at 16 °C
  4: pYes and P343
 IV: pYes and P344 OVER NIGHT at 16 °C

1 and 4 were directly transformed in E. Coli - to be picked the next day.

Transformation of over-weekend ligation of caffeine synthesis genes in pSB1C3 and pYES2new

Investigator: Saskia

Aim: Transformation of the ligation

Operational Sequence

The transformation procedure was carried out as previously described, whereas the entire ligation batch was used for transformation in XL1 blue chemo competent e.coli-cells. The 30 minutes on ice incubation was followed by the heat shock at 37°C for 5 minutes and an incubation at 180 rpm at 37°C for about 45 minutes. Afterwords, the suspension was plated on appropriate plates (pSB1C3 transformants with chloramphenicol, pYES2new transformants with ampicillin) and incubated at 37°C over night. Besides, the pellet was also plated out (resuspension in about ca. 100 µl LB medium).

Note: This transformation was performed without knowing, that a transformation with 5 µl of every ligation batch was already done on saturday. Furthermore, clone picking and preparing of over night liquid cultures was made, too (on sunday).

Miniprep of picked clones of possible positive pSB1C3_Caffeine_involved_gene and pYES2new_caffeine_involved_gene transformants

Investigator: Roman, Saskia

Aim:

Isolation of plasmids pSB1C3 and pYES2, to check for uptaken inserts by an analytical restriction digest.

Operational sequence:

The putative positive clones were picked and used for inoculation on monday, 1 am. Thus, the plasmid preparation took place at 3 pm. Four clones of each plate had been picked. The plates were stored in the fridge, at 4°C. The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 40 µl of elution buffer (Kit) at room temperature, with the columns having been incubated 5 minutes at room temperature before the final centrifugation.

Plasmidconcentration: Nanodroplet

pSB1C3_Caffeine_involved_gene Concentration in ng/µl
B1A 196.5
B1B 220.6
B1C 203.8
B1D 190.6
B2A 273.1
B2B 225.2
B2C 209.2
B2D 161.7
B3A 235.3
B3B 228.5
B3C 228.1
B3D 226.4
pYES2new_caffeine_involved_gene Concentration in ng/µl
Y1A 117.5
Y1B 200.9
Y1C 175.8
Y1D 206.7
Y2A 266.1
Y2B 306.2
Y2C 290.6
Y2D 302.7
Y3A 278.4
Y3B 162.7
Y3C 117.6
Y3D 211.3

Analytical digest of pSB1C3_Caffeine_involved_gene and pYES2new_caffeine_involved_gene plasmids

Investigator: Saskia

Aim:

Analytical digest of B1A-D, B2A-D, B3A-D, Y1A-D, Y2A-D, Y3A-D with PstI ans XbaI to controll the ligation of the inserts in pSB1C3 and pYES2new.

Procedure:

  • Digestion reaction batch
volume reagent
2.5 µl Plasmid-DNA (P295, P296)
0.25 µl XbaI
0.25 µl PstI-HF
2 µl NEBuffer 4 (10x)
0.2 µl BSA (100x)
14.8 µl ddH2O
=20 µl TOTAL

Digestion over night at 37 °C.

Tuesday, August 21st

Transformation of overnight ligation with P436+P437 and P206+P438 in E. coli XL1-Blue

Investigator: Jeff

Aim of the experiment: Transformation of overnight ligation with P436+P437 and P206+P438 in E. coli XL1-Blue.

Procedure:

  • 5 µl of the ligation products (P436+P437 and P206+P438) and their negative controls (P436 NK, P206 NK) were added to 100 µl of CaCl2 competent E. coli XL1-Blue cells on ice.
  • 30 min incubation on ice.
  • 5 min heat shock at 37 °C
  • Adding of 1 ml LB-medium to each tube.
  • Incubation for 45 min at 37 °C in the 180 rpm cell-culture shaker.
  • 100 µl of those cell suspension were plated on chloramphenicol plates.
  • The rest were centrifuged for 1 min at 13000 rpm and the supernatant was dicarded.
  • The pellet was resuspended in 100 µl of LB-medium and this concentrated cell suspension was plated again on new chloramphenicol plates.
  • Incubation at 37 °C overnight.

Miniprep of "positive" colonies of colony PCR

Investigator: Lara

Aim: Get plasmid DNA of the plasmids that were identified as insert-positive clones.

Clones 2, 8, 11, 13, 18 & 20 of colony PCR (20.8.) were miniprepped.

  • Clone 2: 214 ng/µl
  • Clone 8: 142 ng/µl
  • Clone 11: 152 ng/µl
  • Clone 13: 252 ng/µl
  • Clone 18: 132 ng/µl
  • Clone 20: 210 ng/µl

Plasmid DNA is stored in a 50 ml Falcon tube at the lowest drawer of -20°C. (label: Miniprep 21.8. Lara)

Analytical restriction digest of miniprep products 21.8. ("positive" clones of colony PCR) and miniprep products 20.8.

Investigator: Lara

Aim: Check whether clones contain insert. Gel 1: Some clones that were picked for colony PCR of Saturday, August 18th. Gel 2: Clones that were identified as positive in colony PCR of Monday, August 20th.

volume reagent
5 µl plasmid DNA
0.25 µl Xba1
0.25 µl Spe1
2 µl NEBuffer 4
0.2 µl BSA (100x)
12.3 µl ddH2O
  • digest at 37°C for 2.5h.

TUM12 LS analytgel2108 gel1.png TUM12 LS analytgel2108.png

Colony PCR

Investigator: Lara

Aim:


  • Citrus: 8 clones of PCR43/p175 were picked.
  • Lavendula: 8 clones of PCR58/p133 (5 clones of transformation of August 17th, 3 clones of August 8th) and PCR58/p175 (8 of transformation of August 17th) were picked
  • plasmid DNA of PCR2/p133 clone 4 as positive control


Citrus in pSB1C3 (PCR42/p133)

volume reagent
5 µl 5x OneTaq Standard Reaction Buffer
0.5 µl 10 mM dNTPs
0.5 µl 10 µM O68
0.5 µl 10 µM O30
0.13 µl OneTaq Hot Start DNA Polymerase
18.37 µl dd water
25 µL TOTAL

Citrus in pYES (PCR42/p175)

volume reagent
5 µl 5x OneTaq Standard Reaction Buffer
0.5 µl 10 mM dNTPs
0.5 µl 10 µM O8
0.5 µl 10 µM O30
0.13 µl OneTaq Hot Start DNA Polymerase
18.37 µl dd water
25 µL TOTAL

Lavendula in pSB1C3 (PCR56/p133)

volume reagent
5 µl 5x OneTaq Standard Reaction Buffer
0.5 µl 10 mM dNTPs
0.5 µl 10 µM O68
0.5 µl 10 µM O37
0.13 µl OneTaq Hot Start DNA Polymerase
18.37 µl dd water
25 µL TOTAL

Lavendula in pYES (PCR56/p175)

volume reagent
5 µl 5x OneTaq Standard Reaction Buffer
0.5 µl 10 mM dNTPs
0.5 µl 10 µM O8
0.5 µl 10 µM O37
0.13 µl OneTaq Hot Start DNA Polymerase
18.37 µl dd water
25 µL TOTAL
  • PCR program:
Initial denaturation 94 °C 10 min
30 cycles 95 °C 30 s
50 °C 30 s
68 °C 1 min 55 sec
Final extension 68 °C 5 min
Hold 4 °C



TUM12 LS analytcolonyPCR4.png TUM12 LS analytcolonyPCR5.png TUM12 LS analytcolonyPCR6.png


Miniprep of ligation of 17th August

Investigator: Andrea

The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 50 µl of elution buffer (Kit) at room temperature, with the columns having been incubated 5 minutes at room temperature before the final centrifugation.

Number Concentration in ng/µl
3 254.7
5 223.4
8 339.4
10 303.5
11 162.4
14 142.1
17 151.8

Miniprep products are stored in a disposal bag in the middle drawer at -20°C. (label: Miniprep 21.08. Andrea)

Analytical restriction digest of miniprep (miniprep 21.08.)

Investigators: Andrea


Aim: Check whether ligations have worked (ligation of 17th August)


volume reagent
3 µl plasmid DNA
0.5 µl Xba 1
0.5 µl Spe-HF 1
2 µl NEB
0,2 µl BSA
12.5 µl ddH2O

Gelelectrophoresis:

  • expected:

Limonensynthase 1600 bp

pYES2 (P175) 5800 bp

pSB1C3 (P133) 2000 bp

21.08.12 analytgel1 Andrea bearbeitet.png

21.08.12 analytgel2 Andrea bearbeitet.png

21.08.12 analytgel3 Andrea bearbeitet.png

  • positive ligations:

Gel 2, PCR57 in P133 (pSB1C3), Klon 2

Gel 3, PCR1 in P175 (pYES2), Klon 2

Miniprep of 4CL in psB1C3 and pYES after Quick Change from August 17th

Investigator: Saskia, Daniela


Overnight culutres were grown too long. To obtain bacteria with plasmids we exchanged the media and let them grow for another 6 hours. A Miniprep was done afterwards.

Using a Quiagen Miniprep kit, a plasmid isolation of three picked clones of a APT in pYes2 RFC25 ligation was done.

The resulting plamid-concentrations (measured with nanodrop) were:

4CL- pYES clone 1: 181.8 ng/µl

4CL- pYES clone 2: 167.5 ng/µl

4CL- pYES clone 3: 158.3 ng/µl

4CL- pYES clone 4: 136.2 ng/µl


4CL+ pYES clone 1: 88.4 ng/µl

4CL+ pYES clone 2: 143.5 ng/µl

4CL+ pYES clone 3: 144.4 ng/µl

4CL+ pYES clone 4: 104.9 ng/µl


4CL- pSB1C3 clone 1: 170.4 ng/µl

4CL- pSB1C3 clone 2: 248.8 ng/µl

4CL- pSB1C3 clone 3: 231.1 ng/µl

4CL- pSB1C3 clone 4: 254.2 ng/µl


4CL+ pSB1C3 clone 1: 272.8 ng/µl

4CL+ pSB1C3 clone 2: 220.5 ng/µl

4CL+ pSB1C3 clone 3: 220.1 ng/µl

4CL+ pSB1C3 clone 4: 170.1 ng/µl


Analytical DNA-gelelectrophoresis of pSB1C3_Caffeine_involved_gene and pYES2new_caffeine_involved_gene plasmids after digestion with PstI and XbaI

Investigator: Roman, Saskia

Aim:

Analytical DNA-gelelectrophoresis of B1A-D, B2A-D, B3A-D, Y1A-D, Y2A-D, Y3A-D with PstI ans XbaI to controll the ligation of the inserts in pSB1C3 and pYES2new.

Procedure: Analytical gelelectrophoresis was performed at 90 V for 1 h.

Gel 1 up:

20120821 analGel1.jpg

1 kp ladder DNA ladder B1A B1B B1C B1D B2A B2B B2C B2D B3A B3B B3C

Gel 1 below:

TUM12 20120821 analGel1unten.jpg

1 kp ladder DNA ladder B1D Y1A Y1B Y1C Y1D

gel 2:

TUM12 20120821 analGel2.jpg

1 kp ladder DNA ladder Y2A Y2B Y2C Y2D Y3A Y3B Y3C Y3D

Preparation for transformation of pYESnew with caffeine genes in yeast

Investigator: Saskia

Aim:

Transformation of S. cerevisiae INVSc1 with pYESnew with CaXMT1, CaMXMT1 and CaDXMT1.

Procedure:

production of YPD medium as described in the pYES manual

Incubation of S. cerevisiae INVSc1 in 4 ml YPD as described in the pYES manual