Team:TU Munich/Notebook/Labjournal

From 2012.igem.org

(Difference between revisions)
(Colony PCR)
(Undo revision 300635 by AndiB (talk))
 
(1537 intermediate revisions not shown)
Line 1: Line 1:
{{Team:TU_Munich/Header}}
{{Team:TU_Munich/Header}}
{{Team:TU_Munich/LabHeader}}
{{Team:TU_Munich/LabHeader}}
 +
{{Team:TU_Munich/ExCol}}
 +
__NOTOC__
<html>
<html>
<body>
<body>
         <form id="labselect"><fieldset class="ui-widget ui-widget-content ui-corner-left">
         <form id="labselect"><fieldset class="ui-widget ui-widget-content ui-corner-left">
-
         <b>Display subprojects:</b><br>
+
         <b>Display:</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="vector_design" id="ui-test1" /><b style="color: rgb(166, 126, 166)">Vector Design</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="vector_design" id="ui-test1" /><b style="color: rgb(166, 126, 166)">Vector Design</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="limonene" id="ui-test2" /><b style="color: rgb(116, 183, 112)">Limonene</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="limonene" id="ui-test2" /><b style="color: rgb(116, 183, 112)">Limonene</b><br>
-
<input class="labcheckbox" type="checkbox" name="category" value="coumaryl" id="ui-test3" /><b style="color: rgb(255, 122, 97)">Coumaryl</b><br>
+
<input class="labcheckbox" type="checkbox" name="category" value="coumaryl" id="ui-test3" /><b style="color: rgb(255, 122, 97)">Xanthohumol</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="thaumatin" id="ui-test4" /><b style="color: rgb(202, 85, 85)">Thaumatin</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="thaumatin" id="ui-test4" /><b style="color: rgb(202, 85, 85)">Thaumatin</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="caffeine" id="ui-test5" /><b style="color:rgb(192, 167, 4)">Caffeine</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="caffeine" id="ui-test5" /><b style="color:rgb(192, 167, 4)">Caffeine</b><br>
-
<input class="labcheckbox" type="checkbox" name="category" value="constitutive_promoter" id="ui-test6" /><b style="color: rgb(115, 208, 255)">Constituve promoter</b><br>
+
<input class="labcheckbox" type="checkbox" name="category" value="constitutive_promoter" id="ui-test6" /><b style="color: rgb(115, 208, 255)">Constitutive promoter</b><br>
-
<input class="labcheckbox" type="checkbox" name="category" value="light_switchable_promoter" id="ui-test7" /><b style="color: rgb(0, 32, 96)">Light-switchable promoter</b><br>
+
<input class="labcheckbox" type="checkbox" name="category" value="light_switchable_promoter" id="ui-test7"  
-
<br><i>You can also click on individual experiments to show/hide them</i><br>
+
/><b style="color: rgb(0, 32, 96)">Light-switchable promoter</b><br>
 +
        <input class="labcheckbox" type="checkbox" name="category" value="ethanol_inducible_promoter" id="ui-test8"
 +
/><b style="color: rgb(0, 102, 0)">Ethanol-inducible promoter</b><br>
 +
        <input class="labcheckbox" type="checkbox" name="category" value="integration" id="ui-test9" /><b style="color: rgb(222, 77, 185)">Genome integration</b><br>
 +
        <br><a href="#" id="ExAll">Expand All ...</a><br>
 +
        <a href="#" id="ColAll">Collapse All ...</a><br>
 +
 
 +
        <br><i>You can also click on individual experiments to show/hide them</i><br>
         <b>Jump to:</b><br>
         <b>Jump to:</b><br>
-
         <a href="#Wednesday.2C_June_13th" class="openjune">Week 1: 13.6-17.6</a><br>
+
         <a href="#Week_1">Week 1</a> 13.6-17.6<br>
-
         <a href="#Monday.2C_June_18th" class="openjune">Week 2: 18.6-24.6</a><br>
+
         <a href="#Week_2">Week 2</a> 18.6-24.6<br>
-
         <a href="#Monday.2C_June_25th" class="openjune openjuly">Week 3: 25.6-1.7</a><br>
+
         <a href="#Week_3">Week 3</a> 25.6-1.7<br>
-
         <a href="#Monday.2C_July_2nd" class="openjuly">Week 4: 2.7-8.7</a><br>
+
         <a href="#Week_4">Week 4</a> 2.7-8.7<br>
-
         <a href="#Monday.2C_July_9th" class="openjuly">Week 5: 9.7-15.7</a><br>
+
         <a href="#Week_5">Week 5</a> 9.7-15.7<br>
-
         <a href="#Monday.2C_July_16th" class="openjuly">Week 6: 16.7-22.7</a><br>
+
         <a href="#Week_6">Week 6</a> 16.7-22.7<br>
-
         <a href="#Monday.2C_July_23rd" class="openjuly">Week 7: 23.7-29.7</a><br>
+
         <a href="#Week_7">Week 7</a> 23.7-29.7<br>
-
         <a href="#Monday.2C_July_30th" class="openjuly openaugust">Week 8: 30.7-5.8</a><br>
+
         <a href="#Week_8">Week 8</a> 30.7-5.8<br>
-
         <a href="#Monday.2C_August_6th" class="openaugust">Week 9: 6.8-12.8</a><br>
+
         <a href="#Week_9">Week 9</a> 6.8-12.8<br>
-
         <a href="#Monday.2C_August_13th" class="openaugust">Week 10: 13.8-19.8</a><br>
+
         <a href="#Week_10">Week 10</a> 13.8-19.8<br>
-
         <a href="#Monday.2C_August_20th" class="openaugust">Week 11: 20.8-26.8</a><br>
+
         <a href="#Week_11">Week 11</a> 20.8-26.8<br>
-
         <a href="#Monday.2C_August_27th" class="openaugust">Week 12: 27.8-2.9</a><br>
+
        <a href="#Week_12">Week 12</a> 27.8-2.9<br>
 +
         <a href="#Week_13">Week 13</a> 3.9-9.9<br>
 +
        <a href="#Week_14">Week 14</a> 10.9-16.9<br>
 +
        <a href="#Week_15">Week 15</a> 17.9-23.9<br>
 +
        <a href="#Week_16">Week 16</a> 24.9-27.9
         </fieldset>
         </fieldset>
         </form>
         </form>
Line 41: Line 54:
= Labjournal =
= Labjournal =
<hr/>
<hr/>
 +
 +
P1-923 and PCR1-73 are the tube numbers for plasmids/PCR products from our [[Team:TU_Munich/Notebook/Inventory|inventory list (most of the descriptions are in german)]]
 +
 +
For a shorter summary of what happened each week, see our [[Team:TU_Munich/Notebook/Meetings|meeting protocols]].
<div class="labbook">
<div class="labbook">
-
=June 2012=
+
 
-
<div class="month" id="MJune_2012">
+
=Week 1=
 +
<!--
 +
<p class="vector_design">'''Vector Design (4 Experiments):''' </p>
 +
* Exchange of Multiple Cloning Site of pTUM104
 +
 
 +
<p class="limonene">'''Limonene (2 Experiments):''' </p>
 +
* Transformation with limonene plasmids from Prof. Schwab
 +
 
 +
<html><a class="WDetails" href="#Week_1" id="Week_1">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_1">
=='''Wednesday, June 13th'''==
=='''Wednesday, June 13th'''==
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2 ===
+
===Exchange of the Multiple Cloning Site of pTUM104 ===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Hybridisation of the primers O1 with O2 and O3 with O4'''
'''Hybridisation of the primers O1 with O2 and O3 with O4'''
Line 110: Line 137:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2 ===
+
===Exchange of the Multiple Cloning Site of pTUM104 ===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
-
 
+
-
'''Digestion of pYES2 with HindIII and XbaI'''
+
 +
'''Digestion of pTUM104 with HindIII and XbaI'''
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 143: Line 169:
Incubation: 37 °C, 1.75 h
Incubation: 37 °C, 1.75 h
-
 
'''DNA preparative gel electrophoresis'''
'''DNA preparative gel electrophoresis'''
Line 151: Line 176:
*70 V, 90 min
*70 V, 90 min
-
[[File:TUM12_pYES2_verdaut.jpg]]
+
[[File:TUM12_pYES2digested.jpg]]
'''Gelextration'''
'''Gelextration'''
Line 185: Line 210:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Analytical DNA gel electrophoresis'''
'''Analytical DNA gel electrophoresis'''
Line 199: Line 224:
*band 4: 3 µl O6 + 7 µl TAE-buffer + 1 µl loading dye
*band 4: 3 µl O6 + 7 µl TAE-buffer + 1 µl loading dye
*band 5: 10 µl DNA ladder (100 bp)
*band 5: 10 µl DNA ladder (100 bp)
-
[[File:TUM12_pYES_und_Primer.jpg]]
+
[[File:TUM12_pYES2_and_primer.jpg]]
'''Ligation of Plasmid P5 (pYES2 digested) with the hybridized primers O5 and O6'''
'''Ligation of Plasmid P5 (pYES2 digested) with the hybridized primers O5 and O6'''
Line 288: Line 313:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Picking clones for Miniprep'''
'''Picking clones for Miniprep'''
Line 299: Line 324:
</div>
</div>
 +
</div>
 +
 +
=Week 2=
 +
<!--
 +
<p class="vector_design">'''Vector Design (4 Experiments):'''</p>
 +
* Exchange of Multiple Cloning Site of pTUM104
 +
* Quick Change mutagenisis of pTUM104 for RFC25 compatibility
 +
 +
<p class="limonene">'''Limonene (3 Experiments):'''</p>
 +
* Transformation with limonene BioBricks
 +
 +
<p class="coumaryl">'''Xanthohumol (2 Experiments):'''</p>
 +
* Amplification of plasmids containing the genes for the enzymes PAL, 4Cl and CHS
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (1 Experiment):'''</p>
 +
* Transformation with heme oxygenase and LexA BioBricks to them RFC25 compatible later on
 +
 +
<html><a class="WDetails" href="#Week_2" id="Week_2">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_2">
== '''Monday, June 18th''' ==
== '''Monday, June 18th''' ==
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Miniprep of transformed E.coli with P6'''
'''Miniprep of transformed E.coli with P6'''
Line 312: Line 357:
*step 3: invert 2-3 times (don't shake to avoid destruction of genomic DNA)
*step 3: invert 2-3 times (don't shake to avoid destruction of genomic DNA)
*the 10 Minipreps were named: P7 - P16
*the 10 Minipreps were named: P7 - P16
-
 
'''Determination of the concentration with Nano Drop'''
'''Determination of the concentration with Nano Drop'''
Line 408: Line 452:
gel 1:  
gel 1:  
*band 1: 10 µl DNA ladder (1 kb)
*band 1: 10 µl DNA ladder (1 kb)
-
*band 2: 3 µl pYES2 SH 1.7.3 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
+
*band 2: 3 µl pTUM104 SH 1.7.3 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
-
[[File:TUM12_pYES_mit_neuer_MCS_verd_mit_Xbal_und_HindIII.jpg]]
+
[[File:TUM12_pYES_new_mcs_digested_with_Xbal_and_HindIII.jpg]]
gel 2:
gel 2:
*band 1: 10 µl DNA ladder (1 kb)
*band 1: 10 µl DNA ladder (1 kb)
-
*band 2: 3 µl pYES2 SH 1.7.3 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
+
*band 2: 3 µl pTUM104 SH 1.7.3 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
-
[[File:TUM12_pYES_mit_neuer_MCS_verd_mit_NgoMIV.jpg]]
+
[[File:TUM12_pYES_new_mcs_digested_with_NgoMIV.jpg]]
</div>
</div>
Line 447: Line 491:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
-
'''Sequencing of P13 and P14: pYES2 with new MCS'''
+
'''Sequencing of P13 and P14: pTUM104 with new MCS'''
sequencing primer:
sequencing primer:
*1.6 µM forward primer O9
*1.6 µM forward primer O9
Line 483: Line 527:
'''Aim of the experiment:''' Controll of Transformation
'''Aim of the experiment:''' Controll of Transformation
-
 
'''Controll digestion'''
'''Controll digestion'''
Line 565: Line 608:
== '''Friday, June 22nd''' ==
== '''Friday, June 22nd''' ==
-
 
<div class="coumaryl">
<div class="coumaryl">
Line 587: Line 629:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove NgoMIV from pYES2 ===
+
=== Quick Change mutagenis to remove NgoMIV from pTUM104 ===
'''Investigator:''' Ingmar, Volker
'''Investigator:''' Ingmar, Volker
-
'''Aim of the experiment:''' Generation of an RFC 25 compatible version of the pYes2 Vector.
+
'''Aim of the experiment:''' Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 679: Line 721:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove NgoMIV from pYES2 ===
+
=== Quick Change mutagenis to remove NgoMIV from pTUM104 ===
-
'''Investigator:´''' Ingmar, Volker
+
'''Investigator:''' Ingmar, Volker
-
'''Aim of the experiment:''' Removal of a NgoMIV restriction site in the backbone of pYes2.
+
'''Aim of the experiment:''' Removal of a NgoMIV restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 690: Line 732:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Transformation of 2 Biobricks into ''E. coli'' XL1-Blue ===
=== Transformation of 2 Biobricks into ''E. coli'' XL1-Blue ===
Line 721: Line 764:
</div>
</div>
 +
</div>
 +
 +
=Week 3=
 +
<!--
 +
<p class="vector_design">'''Vector Design (9 Experiments):'''</p>
 +
* Quick Change mutagenisis of pTUM104 for RFC25 compatibility and
 +
 +
<p class="limonene">'''Limonene (1 Experiment):'''</p>
 +
* Repetition of analytical gelectrophoresis
 +
 +
<p class="coumaryl">'''Xanthohumol (3 Experiments):'''</p>
 +
* PCR of PAL, 4CL, CHS, OMT
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (2 Experiments):'''</p>
 +
* Verification of transformations (positive)
 +
<html><a class="WDetails" href="#Week_3" id="Week_3">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_3">
== '''Monday, June 25th''' ==
== '''Monday, June 25th''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Miniprep of ''E. coli'' XL1-Blue with pYes2_RFC25 MCS 1.2 ===
+
=== Miniprep of ''E. coli'' XL1-Blue with pTUM104_RFC25 MCS 1.2 ===
'''Investigator:''' Alois, Martin
'''Investigator:''' Alois, Martin
-
'''Aim of the experiment:''' proof of successful removal of NgoMIV in the backbone of pYes2
+
'''Aim of the experiment:''' proof of successful removal of NgoMIV in the backbone of pTUM104
Operation Sequence:
Operation Sequence:
-
* Mini prep of pYes2 1.2. The resulting purified DNA is P33.
+
* Mini prep of pTUM104 1.2. The resulting purified DNA is P33.
-
* Control digest of pYes2_RFC25 MCS 1.2 and p13 (+ analytical gel electrophoresis: 90 V, 1 h:
+
* Control digest of pTUM104_RFC25 MCS 1.2 and p13 (+ analytical gel electrophoresis: 90 V, 1 h:
  *  15 µl ddH20
  *  15 µl ddH20
  *  2 µl NEBuffer4
  *  2 µl NEBuffer4
  * 0,5 µl NgoMIV
  * 0,5 µl NgoMIV
-
  * 2,5 µl pYes2 1.2/p13
+
  * 2,5 µl pTUM104 1.2/p13
  * 37°C, 1 h.
  * 37°C, 1 h.
</div>
</div>
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove SpeI from pYES2_RFC25 MCS 1.2 ===
+
=== Quick Change mutagenis to remove SpeI from pTUM104_RFC25 MCS 1.2 ===
'''Investigator:''' Ingmar, Volker
'''Investigator:''' Ingmar, Volker
-
'''Aim of the experiment:''' Generation of an RFC 25 compatible version of the pYes2 Vector.
+
'''Aim of the experiment:''' Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 805: Line 866:
|}
|}
*The procedure was furthermore applied to P13 and P14.
*The procedure was furthermore applied to P13 and P14.
-
*The vector resulting from the '''PCR-product was named pYes2_RFC25 MCS 1.3'''.
+
*The vector resulting from the '''PCR-product was named pTUM104_RFC25 MCS 1.3'''.
*Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.
*Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.
Line 843: Line 904:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove SpeI from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove SpeI from  pTUM104_RFC25 MCS ===
'''Investigator:''' Ingmar
'''Investigator:''' Ingmar
-
'''Aim of the experiment:''' Removal of a SpeI restriction site in the backbone of pYes2.
+
'''Aim of the experiment:''' Removal of a SpeI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 965: Line 1,026:
<div class="coumaryl">
<div class="coumaryl">
-
=== PCR of PAL, 4CL, CHS, OMT (Coumaryl-CoA) ===
+
=== PCR of PAL, 4CL, CHS, OMT (Xanthohumol-CoA) ===
'''Investigator: Daniela, Mary'''
'''Investigator: Daniela, Mary'''
Line 994: Line 1,055:
| 4CL + || 4CL || +|| O21 and O20
| 4CL + || 4CL || +|| O21 and O20
|}
|}
-
 
'''Reaction batch'''
'''Reaction batch'''
Line 1,056: Line 1,116:
|-
|-
|}
|}
-
 
PCR purification
PCR purification
*Purification was done using QIAquick PCR Purification Kit (250)
*Purification was done using QIAquick PCR Purification Kit (250)
-
 
Analytical Gel Electrophoresis:
Analytical Gel Electrophoresis:
Line 1,124: Line 1,182:
=== Repetition of analytic gel of 21st June===
=== Repetition of analytic gel of 21st June===
-
'''Investigator: Andrea'''
+
'''Investigator: Andrea, Lara'''
 +
 
 +
Buffer systems were adjusted. -> only use of one buffer per reaction.
[[File:27.06.12.png|400px]]
[[File:27.06.12.png|400px]]
Line 1,201: Line 1,261:
[[File:29.06. prepgelCHS.jpg|500px|preparative gel of CHS]]
[[File:29.06. prepgelCHS.jpg|500px|preparative gel of CHS]]
-
 
DNA-purification with Kit from Quiagen  
DNA-purification with Kit from Quiagen  
Line 1,208: Line 1,267:
<div class="vector_design">
<div class="vector_design">
-
===  Quick Change mutagenesis to remove PstI in URA3 from pYES2_RFC25 MCS 1.2 ===
+
===  Quick Change mutagenesis to remove PstI in URA3 from pTUM104_RFC25 MCS 1.2 ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 1,287: Line 1,346:
== '''Saturday, June 30th''' ==
== '''Saturday, June 30th''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
* For each transformation of the PCR-products of P29 and P30 a single clone was picked an transferred to 6 ml LB Amp. Incubation overnight at 37°C 180 rpm. The transfomation with the PCR product of P31, P32 and P33 was not successfull. Therfore no clone could be picked from these plates and four instead of one clone was picked from the plates containing the  transformations of P29.
* For each transformation of the PCR-products of P29 and P30 a single clone was picked an transferred to 6 ml LB Amp. Incubation overnight at 37°C 180 rpm. The transfomation with the PCR product of P31, P32 and P33 was not successfull. Therfore no clone could be picked from these plates and four instead of one clone was picked from the plates containing the  transformations of P29.
-
</div>
 
</div>
</div>
-
=July 2012=
 
-
<div class="month" id="MJuly_2012">
 
== '''Sunday, July 1st''' ==
== '''Sunday, July 1st''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 1,378: Line 1,434:
<div class="vector_design">
<div class="vector_design">
-
===  Quick Change mutagenesis to remove PstI in the 2µ ori from pYES2_RFC25 MCS  ===
+
===  Quick Change mutagenesis to remove PstI in the 2µ ori from pTUM104_RFC25 MCS  ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 1,432: Line 1,488:
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 1,476: Line 1,531:
</div>
</div>
 +
</div>
 +
 +
=Week 4=
 +
<!--
 +
<p class="vector_design">'''Vector Design (6 Experiments):'''</p>
 +
* Further Quickchanges for RFC25 compatibility and insertion of Ala before the strep tag
 +
 +
<p class="limonene">'''Limonene (8 Experiments):'''</p>
 +
* Transformation with Schwab plasmids
 +
* PCR of both Schwab and BioBrick to make them RFC25 compatible
 +
 +
<p class="coumaryl">'''Xanthohumol (4 Experiments):'''</p>
 +
* Repetition of PCR with PAL and troubleshooting
 +
 +
<p class="thaumatin">'''Thaumatin (2 Experiments):'''</p>
 +
* Miniprepping reporter BioBricks gfp/egfp/yfp
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (1 Experiment):'''</p>
 +
* Transformation with BioBricks
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (2 Experiments):'''</p>
 +
* PCR of LexA BioBricks to introduce RFC25
 +
 +
<html><a class="WDetails" href="#Week_4" id="Week_4">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_4">
== '''Monday, July 2nd''' ==
== '''Monday, July 2nd''' ==
<div class="coumaryl">
<div class="coumaryl">
Line 1,509: Line 1,590:
|bidest. sterile Water
|bidest. sterile Water
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 1,651: Line 1,731:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 1,662: Line 1,742:
<div class="limonene">
<div class="limonene">
-
=== PCR of BBa_I742111 (Limonenesynthase) Clone 3 (Trafo 19.06.12) ===
+
=== PCR of BBa_I742111 (Limonenesynthase) Clone 3 (Transformation of 19.06.12) ===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
Line 1,764: Line 1,844:
== '''Wednesday, July 4th''' ==
== '''Wednesday, July 4th''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 1,815: Line 1,895:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to  insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS  ===
+
=== Quick Change mutagenis to  insert Ala in front of the Strep - tag II in pTUM104_RFC25 MCS  ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector; operating purfication possibility via Strep-tag II.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector; operating purfication possibility via Strep-tag II.
'''PCR'''<br>
'''PCR'''<br>
Line 1,895: Line 1,975:
===Analytical Gelelektrophoresis of PCR-Products of PAL===
===Analytical Gelelektrophoresis of PCR-Products of PAL===
-
 
'''Investigator: Mary'''
'''Investigator: Mary'''
Line 1,910: Line 1,989:
-> next steps: new Design of Primer and repetition of PCR with new primers  
-> next steps: new Design of Primer and repetition of PCR with new primers  
-
 
-
 
</div>
</div>
Line 2,006: Line 2,083:
Plasmids were digested, 2 µl loading dye (10x) was added to each sample. Gel was loaded in the following order:
Plasmids were digested, 2 µl loading dye (10x) was added to each sample. Gel was loaded in the following order:
-
1. 6 µl gene ruler 1 kb, 2.-6. 11 µl of: P39, P40, P41, P42, Coumaryl-Plasmid (Katrin)
+
1. 6 µl gene ruler 1 kb, 2.-6. 11 µl of: P39, P40, P41, P42, Xanthohumol-Plasmid (Katrin)
[[File:TUM12_VerdauSchwabPlasmide0507.png]]
[[File:TUM12_VerdauSchwabPlasmide0507.png]]
Line 2,044: Line 2,121:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS ===
+
=== Quick Change mutagenis to insert Ala in front of the Strep - tag II in pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector; operating purfication possibility via Strep-tag II.  
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector; operating purfication possibility via Strep-tag II.  
Operational sequence:
Operational sequence:
Line 2,077: Line 2,154:
== '''Friday, July 6th''' ==
== '''Friday, July 6th''' ==
<div class="vector_design">
<div class="vector_design">
-
===Quick Change mutagenis to insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS===
+
===Quick Change mutagenis to insert Ala in front of the Strep - tag II in pTUM104_RFC25 MCS===
*Afterwards a control digestion of P45 and P46 was done.
*Afterwards a control digestion of P45 and P46 was done.
Line 2,222: Line 2,299:
== '''Saturday, July 7th''' ==
== '''Saturday, July 7th''' ==
<div class="vector_design">
<div class="vector_design">
-
===  Quick Change mutagenesis to insert Ala in front of the Strep-tag II in pYES2_RFC25 MCS  ===
+
===  Quick Change mutagenesis to insert Ala in front of the Strep-tag II in pTUM104_RFC25 MCS  ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector.
*As the sequencing of the first attempt to introduce Ala in front of the Strep-tag II did not show a successfull insertion of Ala, the quickchange mutagense was performed once again with a modified setup. Presumably a formation of primer dimers was responsable for the experiment's results. Therefore the second PCR was operated in two steps as shown below.
*As the sequencing of the first attempt to introduce Ala in front of the Strep-tag II did not show a successfull insertion of Ala, the quickchange mutagense was performed once again with a modified setup. Presumably a formation of primer dimers was responsable for the experiment's results. Therefore the second PCR was operated in two steps as shown below.
'''PCR'''<br>
'''PCR'''<br>
Line 2,276: Line 2,353:
|Pfu Turbo DNA polymerase (2.5 U / µl)
|Pfu Turbo DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 2,342: Line 2,418:
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin- and kanamycin plates.
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin- and kanamycin plates.
</div>
</div>
 +
</div>
 +
 +
=Week 5=
 +
<!--
 +
<p class="limonene">'''Limonene (4 Experiments):'''</p>
 +
* Ligation of Schwab and BioBricks PCR products in pYES and pSB1C3
 +
 +
<p class="coumaryl">'''Xanthohumol (10 Experiments):'''</p>
 +
* Repetition of PCR with PAL
 +
* Transformation with PCR products of OMT, 4Cl and CHS
 +
 +
<p class="thaumatin">'''Thaumatin (1 Experiment):'''</p>
 +
* Preparation of YPD medium
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (10 Experiments):'''</p>
 +
* Phycocyanobilin (PCB) extraction from dried Spirulina platensis powder
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (14 Experiments):'''</p>
 +
*
 +
<html><a class="WDetails" href="#Week_5" id="Week_5">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_5">
== '''Monday, July 9th''' ==
== '''Monday, July 9th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Picking of colonies of TEF2-P, ADH1-P, ADH1-T (Igem)===
+
=== Picking of colonies of TEF2-P, ADH1-P, ADH1-T (iGEM)===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 2,363: Line 2,462:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Repetition of picking of colonies of TEF2-P, ADH1-P, ADH1-T (Igem)===
+
=== Repetition of picking of colonies of TEF2-P, ADH1-P, ADH1-T (iGEM)===
'''Investigator:''' Georg
'''Investigator:''' Georg
*Only ADH1 promoter showed cell proliferation. The rest showed no proliferation.The reason was a 10x too high amount of antibiotics.
*Only ADH1 promoter showed cell proliferation. The rest showed no proliferation.The reason was a 10x too high amount of antibiotics.
Line 2,548: Line 2,647:
* Incubation over night at 37°C in the 180rpm cell-culture shaker.
* Incubation over night at 37°C in the 180rpm cell-culture shaker.
</div>
</div>
-
 
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
Line 2,617: Line 2,715:
|bidest. sterile Water
|bidest. sterile Water
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 2,664: Line 2,761:
<div class="coumaryl">
<div class="coumaryl">
-
=== Preparative Digest of pYES_iGEM===
+
=== Preparative Digest of pYES2_iGEM===
'''Investigator: Katrin, Daniela'''
'''Investigator: Katrin, Daniela'''
-
 
'''Digestion of P50 with Xbal and NgOMIV'''
'''Digestion of P50 with Xbal and NgOMIV'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 2,698: Line 2,793:
'''Digestion of P50 with Xbal and PstI'''
'''Digestion of P50 with Xbal and PstI'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 2,727: Line 2,821:
*band 2: P50 digested with XbaI and NgOMIV
*band 2: P50 digested with XbaI and NgOMIV
*70 V, 90 min
*70 V, 90 min
-
 
'''Gelextration'''
'''Gelextration'''
Line 2,876: Line 2,969:
*water bath 16 °C  
*water bath 16 °C  
-
 
</div>
</div>
Line 2,882: Line 2,974:
== '''Thursday, July 12th''' ==
== '''Thursday, July 12th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Genextraction and analytical digestion of CYC1-terminator, TEF1-promoter, and PGK1-Promoter from '''pSB1C3 and pSB1A2===
+
=== Gelextraction and analytical digestion of CYC1-terminator, TEF1-promoter, and PGK1-Promoter from pSB1C3 and pSB1A2===
'''Investigator: Georg'''
'''Investigator: Georg'''
Line 2,911: Line 3,003:
|'''TOTAL'''
|'''TOTAL'''
|}
|}
-
 
-
 
-
 
*Analytical gel was run (1% Agarose).
*Analytical gel was run (1% Agarose).
Line 2,919: Line 3,008:
[[File:20120712-PGK1-P,-Cyc-T,-TEf.png]]
[[File:20120712-PGK1-P,-Cyc-T,-TEf.png]]
</div>
</div>
-
 
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
Line 2,942: Line 3,030:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Picking of transformated (pGADT7 and pGBKT7) E.&nbsp;coli cells on antibiotic selection plates  ===
+
=== Picking of transformated (pGADT7 and pGBKT7) ''E.coli cells'' on antibiotic selection plates  ===
'''Investigator: Jeff'''
'''Investigator: Jeff'''
Line 2,954: Line 3,042:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of transformated E.&nbsp;coli from overnight culture (8 plasmids containing biobricks)  ===
+
 
 +
=== Miniprep of transformated ''E.coli'' from overnight culture (8 plasmids containing biobricks)  ===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
Line 3,065: Line 3,154:
<div class="coumaryl">
<div class="coumaryl">
-
=== Transformation of Ligationproducts of pYES2 + OMT, 4Cl and CHS in E.coli===
+
=== Transformation of Ligationproducts of pTUM104 + OMT, 4Cl and CHS in ''E.coli''===
'''Investigator: Mary'''
'''Investigator: Mary'''
-
* adding 5µl ligation product in 100µl competent XL blue E.coli cells
+
* adding 5µl ligation product in 100µl competent XL blue ''E.coli'' cells
* incubation 30 min on ice
* incubation 30 min on ice
* 5 min at 37°C
* 5 min at 37°C
Line 3,084: Line 3,173:
only with PAL+, 3 different temperatures (see cycling parameters) and one batch at 52.5 °C with DMSO
only with PAL+, 3 different temperatures (see cycling parameters) and one batch at 52.5 °C with DMSO
-
 
'''Reaction batch'''
'''Reaction batch'''
Line 3,112: Line 3,200:
|ddH2O
|ddH2O
|}
|}
-
 
'''Reaction batch with DMSO'''
'''Reaction batch with DMSO'''
Line 3,143: Line 3,230:
|ddH2O
|ddH2O
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 3,178: Line 3,264:
|-
|-
|}
|}
-
 
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 3,214: Line 3,298:
|-
|-
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 3,417: Line 3,500:
<div class="limonene">
<div class="limonene">
-
=== Preperative gel electrophoresis ===
+
=== Preparative gel electrophoresis of digested plasmids PCR1-PCR7 and PCR9 ===
'''Investigator: Andrea'''  
'''Investigator: Andrea'''  
Line 3,829: Line 3,912:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Preperative digestion and gelelectrophoresis of P79 and O56??? ===
+
=== Preperative digestion and gelelectrophoresis of P79 and O56 ===
'''Investigator:''' Jeff, Saskia, Georg
'''Investigator:''' Jeff, Saskia, Georg
Line 3,849: Line 3,932:
'''Digestion of P19 with ApaI'''
'''Digestion of P19 with ApaI'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 3,875: Line 3,957:
*band 2: P50 digested with XbaI and NgOMIV
*band 2: P50 digested with XbaI and NgOMIV
*70 V, 90 min
*70 V, 90 min
-
 
'''Gelextration'''
'''Gelextration'''
Line 3,918: Line 3,999:
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 3,965: Line 4,045:
[[File:TUM12 gradient PCR PAL 13.07.2012.jpg|500px|Gel picture of gradient PCR of P19]]
[[File:TUM12 gradient PCR PAL 13.07.2012.jpg|500px|Gel picture of gradient PCR of P19]]
*A bond at the expected length of 2160 bp appears at 47 °C. Therefore a PCR using this primer annealing temperature will done on sunday.
*A bond at the expected length of 2160 bp appears at 47 °C. Therefore a PCR using this primer annealing temperature will done on sunday.
-
 
</div>
</div>
Line 3,972: Line 4,051:
===Transformation of P94 - P97 (ligationproducts of pSB1C3 with CHS and OMT respectively) in ''E.coli''===
===Transformation of P94 - P97 (ligationproducts of pSB1C3 with CHS and OMT respectively) in ''E.coli''===
Investigator: Daniela
Investigator: Daniela
-
* adding 5µl ligation product (P94-P97) in 100µl competent XL blue E.coli cells
+
* adding 5µl ligation product (P94-P97) in 100µl competent XL blue ''E.coli'' cells
* incubation 30 min on ice
* incubation 30 min on ice
* 5 min at 37°C
* 5 min at 37°C
Line 3,988: Line 4,067:
'''Transformation'''
'''Transformation'''
-
* adding 5µl ligation product (PCR1-PCR7) in 100µl competent XL blue E.coli cells
+
* adding 5µl ligation product (PCR1-PCR7) in 100µl competent XL blue ''E.coli'' cells
* incubation 30 min on ice
* incubation 30 min on ice
* 5 min at 37°C
* 5 min at 37°C
Line 4,000: Line 4,079:
'''Investigator: A lot of Alois, Martin'''
'''Investigator: A lot of Alois, Martin'''
-
 
'''Manual for YPD production'''
'''Manual for YPD production'''
Line 4,012: Line 4,090:
*20 g peptone
*20 g peptone
*20 g dextrose (see note below if making plates)
*20 g dextrose (see note below if making plates)
-
 
2. Autoclave for 20 minutes on liquid cycle.
2. Autoclave for 20 minutes on liquid cycle.
-
 
3. Store medium at room temperature. The shelf life is approximately one to two months.
3. Store medium at room temperature. The shelf life is approximately one to two months.
Line 4,074: Line 4,150:
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 4,120: Line 4,195:
</div>
</div>
 +
</div>
 +
 +
=Week 6=
 +
<!--
 +
<p class="vector_design">'''Vector Design (2 Experiments):'''</p>
 +
*
 +
 +
<p class="limonene">'''Limonene (6 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (17 Experiments):'''</p>
 +
*
 +
 +
<p class="thaumatin">'''Thaumatin (3 Experiments):'''</p>
 +
* Inoculation of YPD medium with S. cerevisiae and brewing yeast strain 34/70
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (6 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (16 Experiments):'''</p>
 +
*
 +
<html><a class="WDetails" href="#Week_6" id="Week_6">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_6">
== '''Monday, July 16th ''' ==
== '''Monday, July 16th ''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
Line 4,131: Line 4,230:
* Cells were to grow at room-temperature over the weekend
* Cells were to grow at room-temperature over the weekend
</div>
</div>
-
 
<div class="constitutive_promoter">
<div class="constitutive_promoter">
Line 4,137: Line 4,235:
'''Investigator:'''Georg
'''Investigator:'''Georg
'''Aim of the experiment:''' Digestion of CYC1-Terminator, ADH1-Promoter for ligation '''
'''Aim of the experiment:''' Digestion of CYC1-Terminator, ADH1-Promoter for ligation '''
-
 
* Preparative digestion after manufacturer's advice (NEB) with 20 u PstI and 20 u XbaI in 1x Tango buffer with 25 µl DNA and 4 µl NEB4 10x buffer and 0,4 µl 100x BSA. Water was added to a volume of 40 µl. Restriction time was 3 hours at 37 °C; 3 hours.
* Preparative digestion after manufacturer's advice (NEB) with 20 u PstI and 20 u XbaI in 1x Tango buffer with 25 µl DNA and 4 µl NEB4 10x buffer and 0,4 µl 100x BSA. Water was added to a volume of 40 µl. Restriction time was 3 hours at 37 °C; 3 hours.
Line 4,223: Line 4,320:
'''Aim of the experiment:''' Analytical restriction digest of plasmids p116, p117, p118, p119, p120, p121, p122.
'''Aim of the experiment:''' Analytical restriction digest of plasmids p116, p117, p118, p119, p120, p121, p122.
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 4,253: Line 4,349:
<div class="limonene">
<div class="limonene">
-
=== Analytical gel electrophoresis ===
+
=== Analytical gel electrophoresis of p116-p122 ===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 4,284: Line 4,380:
'''Aim of the experiment:''' Get a lot of pSB1C3 for further experiments
'''Aim of the experiment:''' Get a lot of pSB1C3 for further experiments
-
Midipreparation of the pellet from over night cultures (E.coli, Transformed with pSB1C3 - RFC25; name in registry: K365005)
+
Midipreparation of the pellet from over night cultures (''E.coli'', Transformed with pSB1C3 - RFC25; name in registry: K365005)
was done with the Midiprep Kit from Qiagen
was done with the Midiprep Kit from Qiagen
Line 4,292: Line 4,388:
</div>
</div>
-
<div=coumaryl>
+
<div=Xanthohumol>
<div class="coumaryl">
<div class="coumaryl">
Line 4,364: Line 4,460:
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 4,441: Line 4,536:
===Preparative digest of P123 (pSB1C3 RFC25)===
===Preparative digest of P123 (pSB1C3 RFC25)===
'''Investigator: Mary, Daniela'''
'''Investigator: Mary, Daniela'''
-
 
'''Digestion of P123 with Xbal/PstI and XbaI/AgeI
'''Digestion of P123 with Xbal/PstI and XbaI/AgeI
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 4,493: Line 4,586:
Incubation: 37 °C, 3 h
Incubation: 37 °C, 3 h
-
 
'''DNA preparative gel electrophoresis'''
'''DNA preparative gel electrophoresis'''
Line 4,500: Line 4,592:
*band 2: P123 digested with XbaI and AgeI
*band 2: P123 digested with XbaI and AgeI
*70 V, 90 min
*70 V, 90 min
-
 
'''Gelextration'''
'''Gelextration'''
Line 4,520: Line 4,611:
'''investigator: ''' Daniela, Mary
'''investigator: ''' Daniela, Mary
-
'''Aim of the experiment:''' digestion of PCR-Products to gain the correct cutting sites for ligation in pYES2 and pSB1C3 afterwards
+
'''Aim of the experiment:''' digestion of PCR-Products to gain the correct cutting sites for ligation in pTUM104 and pSB1C3 afterwards
Purification of PCR-Products with PCR-Purification Kit
Purification of PCR-Products with PCR-Purification Kit
Line 4,560: Line 4,651:
<div class="coumaryl">
<div class="coumaryl">
-
=== Repetition of ligation of PCR 15-20 (4CL, CHS and OMT) with pYES (P71 and P72 respectively)===
+
=== Repetition of ligation of PCR 15-20 (4CL, CHS and OMT) with pTUM104 (P71 and P72 respectively)===
'''Investigator: Mary, Daniela'''
'''Investigator: Mary, Daniela'''
Line 4,698: Line 4,789:
*water bath 16 °C  
*water bath 16 °C  
-
 
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of ligationproducts of 4CL, OMT and CHS respectively in pYES in ''E.coli''===
+
===Transformation of ligationproducts of 4CL, OMT and CHS respectively in pTUM104 in ''E.coli''===
Investigator: Mary,Daniela
Investigator: Mary,Daniela
Line 4,713: Line 4,803:
results:
results:
-
*CHS+ in pYES (P72) 100 µl: 7 clones
+
*CHS+ in pTUM104 (P72) 100 µl: 7 clones
-
*CHS- in pYES (P72) 100 µl: 9 clones
+
*CHS- in pTUM104 (P72) 100 µl: 9 clones
-
*CHS+ in pYES (P72) Pellet: 111 clones
+
*CHS+ in pTUM104 (P72) Pellet: 111 clones
-
*CHS- in pYES (P72) Pellet: 77 clones
+
*CHS- in pTUM104 (P72) Pellet: 77 clones
-
*4CL+ in pYES (P71) 100 µl: 9 clones
+
*4CL+ in pTUM104 (P71) 100 µl: 9 clones
-
*4CL- in pYES (P71) 100 µl: 3 clones
+
*4CL- in pTUM104 (P71) 100 µl: 3 clones
-
*4CL+ in pYES (P71) Pellet: 47 clones
+
*4CL+ in pTUM104 (P71) Pellet: 47 clones
-
*4CL- in pYES (P71) Pellet: 45 clones
+
*4CL- in pTUM104 (P71) Pellet: 45 clones
-
*OMT+ in pYES (P72) 100 µl: 7 clones
+
*OMT+ in pTUM104 (P72) 100 µl: 7 clones
-
*OMT- in pYES (P72) 100 µl: 5 clones
+
*OMT- in pTUM104 (P72) 100 µl: 5 clones
-
*OMT+ in pYES (P72) Pellet: 30 clones
+
*OMT+ in pTUM104 (P72) Pellet: 30 clones
-
*OMT- in pYES (P72) Pellet: 53 clones
+
*OMT- in pTUM104 (P72) Pellet: 53 clones
*negative control P71 100 µl: 14
*negative control P71 100 µl: 14
Line 4,753: Line 4,843:
== '''Wednesday, July 18th''' ==
== '''Wednesday, July 18th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Extraction of Plasmid-DNA===
+
=== Minipreparation of ADH1-T Plasmids===
'''Investigator:''' Georg
'''Investigator:''' Georg
-
* ADH1-T Plasmids were extracted according to protocoll of Quiaprep genextraction protocoll
+
* ADH1-T Plasmids were extracted according to protocoll of Quiaprep gelextraction protocoll
</div>
</div>
<div class="constitutive_promoter">
<div class="constitutive_promoter">
 +
=== Analytical digestion of ADH1-T and gelelectrophoresis===
=== Analytical digestion of ADH1-T and gelelectrophoresis===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 4,795: Line 4,886:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Ligation of plasmid pSB1C3 containing 20aaLinker with LexA and plasmid containing Gal4AD with Pif3 for fusion protein construction ===
+
=== Ligation of plasmid pSB1C3 containing 20aaLinker with LexA and plasmid containing Gal4AD with Pif3 for fusion protein construction<br> ===
</div>
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of overnight culture from picked transformed E. coli containing biobrick BBa_K165055 ===
+
 
 +
=== Miniprep of overnight culture from picked transformed ''E. coli'' containing biobrick BBa_K165055 ===
</div>
</div>
<div class="thaumatin">
<div class="thaumatin">
 +
=== Inoculation of YPD medium with ''S. cerevisiae'' and brewing yeast strain 34/70 (part 2/3) ===
=== Inoculation of YPD medium with ''S. cerevisiae'' and brewing yeast strain 34/70 (part 2/3) ===
Line 4,808: Line 4,901:
'''Aim of the experiment:''' Discrimination of growing ability in wort medium.
'''Aim of the experiment:''' Discrimination of growing ability in wort medium.
-
 
After 12h of cultivating the optical density (OD) at 550nm was determined:
After 12h of cultivating the optical density (OD) at 550nm was determined:
-
 
{|cellspacing="0" border="2"
{|cellspacing="0" border="2"
Line 4,886: Line 4,977:
| + 0.1
| + 0.1
|}
|}
-
 
-
 
After 12h of cultivating the ''S. cerevisiae'' is growing quite well. There is a tendency that the brewing yeast strain 34/70 is not capable to grow sufficiently in autoclaved (e.g. proteinfree) medium. Since the 34/70 was stored at 4°C over 5 days, directly used to inoculate the medium (no preparatory culture) and we only used 1ml to inoculate with (compared to 5ml of the preparatory culture of ''S. cerevisiae'' - because of obvious differences in opacity of the inoculation media) there is not yet a conclusion to be drawn. We decided to incubate for another 24h at least.
After 12h of cultivating the ''S. cerevisiae'' is growing quite well. There is a tendency that the brewing yeast strain 34/70 is not capable to grow sufficiently in autoclaved (e.g. proteinfree) medium. Since the 34/70 was stored at 4°C over 5 days, directly used to inoculate the medium (no preparatory culture) and we only used 1ml to inoculate with (compared to 5ml of the preparatory culture of ''S. cerevisiae'' - because of obvious differences in opacity of the inoculation media) there is not yet a conclusion to be drawn. We decided to incubate for another 24h at least.
Line 4,893: Line 4,982:
<div class="vector_design">
<div class="vector_design">
-
=== new Miniprep of P50 pYES2 ===
+
=== New Miniprep of P50 pTUM104 ===
'''Investigators: Andrea'''
'''Investigators: Andrea'''
Line 4,901: Line 4,990:
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of P50 (pYes) in ''E.coli''===
+
 
 +
===Transformation of P50 (pTUM104) in ''E.coli''===
Investigator: Katrin
Investigator: Katrin
-
'''Aim of the experiment:''' Get more P50(pYes) for further experiments
+
'''Aim of the experiment:''' Get more P50(pTUM104) for further experiments
* adding 2-3 µl of plasmid P50 in 100µl competent XL blue E.coli cells
* adding 2-3 µl of plasmid P50 in 100µl competent XL blue E.coli cells
* incubation 30 min on ice
* incubation 30 min on ice
Line 4,913: Line 5,003:
<div class="coumaryl">
<div class="coumaryl">
-
===Ligation of 4CL and PAL in pSB1C3-RFC25 and ligation of PAL in pYES===
+
===Ligation of 4CL and PAL in pSB1C3-RFC25 and ligation of PAL in pTUM104===
Investigator: Katrin, Daniela
Investigator: Katrin, Daniela
Line 5,010: Line 5,100:
|}
|}
-
PAL+ (PCR 32) with P72 (pYES)
+
PAL+ (PCR 32) with P72 (pTUM104)
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
|'''volume'''
|'''volume'''
Line 5,031: Line 5,121:
|}
|}
-
PAL- (PCR 33) with P72 (pYES)
+
PAL- (PCR 33) with P72 (pTUM104)
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
|'''volume'''
|'''volume'''
Line 5,127: Line 5,217:
<div class="coumaryl">
<div class="coumaryl">
-
=== Picking clones of 4CL, CHS and OMT in pYES ===
+
=== Picking clones of 4CL, CHS and OMT in pTUM104 ===
'''investigator: ''' Katrin, Daniela
'''investigator: ''' Katrin, Daniela
Line 5,150: Line 5,240:
*P126+PCR31 ->Amp
*P126+PCR31 ->Amp
*negative control: NK2 ->Amp
*negative control: NK2 ->Amp
-
 
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells
Line 5,201: Line 5,290:
'''Aim of the experiment:''' Discrimination of growing ability in wort medium.
'''Aim of the experiment:''' Discrimination of growing ability in wort medium.
-
 
After 40h of cultivating the optical density (OD) at 550nm was determined:
After 40h of cultivating the optical density (OD) at 550nm was determined:
-
 
{|cellspacing="0" border="2"
{|cellspacing="0" border="2"
Line 5,288: Line 5,375:
| + 0.2
| + 0.2
|}
|}
-
 
-
 
After 40h of cultivating the ''S. cerevisiae'' is growing comparably to the brewing yeast strain, though we seem to have entered a phase of substrate limitation.
After 40h of cultivating the ''S. cerevisiae'' is growing comparably to the brewing yeast strain, though we seem to have entered a phase of substrate limitation.
Line 5,382: Line 5,467:
<div class="limonene">
<div class="limonene">
-
===Preparative gel===
+
===Preparative gel of pSB1C3 and pTUM104===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
*40 µl pSB1C3 + 4 µl loading dye
*40 µl pSB1C3 + 4 µl loading dye
-
*40 µl pYES2 + 4 µl loading dye
+
*40 µl pTUM104 + 4 µl loading dye
*20 µl PCR1 + 2 µl loading dye
*20 µl PCR1 + 2 µl loading dye
*Limonensynthase: 1600 bp
*Limonensynthase: 1600 bp
-
*pYES2: 5800 bp
+
*pTUM104: 5800 bp
*pSB1C3: 2000bp
*pSB1C3: 2000bp
Line 5,433: Line 5,518:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep of 4CL, CHS and OMT in pYES (P71 and P72)===
+
===Miniprep of 4CL, CHS and OMT in pTUM104 (P71 and P72)===
Investigator: Daniela
Investigator: Daniela
-
'''Aim of the experiment''': Extract plasmids (pYES) that contain 4CL, CHS and OMT
+
'''Aim of the experiment''': Extract plasmids (pTUM104) that contain 4CL, CHS and OMT
The day before 2 clones were picked for each enzyme.
The day before 2 clones were picked for each enzyme.
Line 5,445: Line 5,530:
Concentration:
Concentration:
-
*4CL+ in pYES clone 1: c = 172.5 ng/µl
+
*4CL+ in pTUM104 clone 1: c = 172.5 ng/µl
-
*4CL- in pYES clone 1: c = 192.1 ng/µl
+
*4CL- in pTUM104 clone 1: c = 192.1 ng/µl
-
*CHS+ in pYES clone 1: c = 136.6 ng/µl
+
*CHS+ in pTUM104 clone 1: c = 136.6 ng/µl
-
*CHS- in pYES clone 1: c = 85.7 ng/µl
+
*CHS- in pTUM104 clone 1: c = 85.7 ng/µl
-
*OMT+ in pYES clone 1: c = 116.0 ng/µl
+
*OMT+ in pTUM104 clone 1: c = 116.0 ng/µl
-
*OMT- in pYES clone 1: c = 129.7 ng/µl
+
*OMT- in pTUM104 clone 1: c = 129.7 ng/µl
-
 
+
-
*4CL+ in pYES clone 2: c = 160.0 ng/µl
+
-
*4CL- in pYES clone 2: c = 144.5 ng/µl
+
-
*CHS+ in pYES clone 2: c = 128.5 ng/µl
+
-
*CHS- in pYES clone 2: c = 116.2 ng/µl
+
-
*OMT+ in pYES clone 2: c = 142.8 ng/µl
+
-
*OMT- in pYES clone 2: c = 134.5 ng/µl
+
 +
*4CL+ in pTUM104 clone 2: c = 160.0 ng/µl
 +
*4CL- in pTUM104 clone 2: c = 144.5 ng/µl
 +
*CHS+ in pTUM104 clone 2: c = 128.5 ng/µl
 +
*CHS- in pTUM104 clone 2: c = 116.2 ng/µl
 +
*OMT+ in pTUM104 clone 2: c = 142.8 ng/µl
 +
*OMT- in pTUM104 clone 2: c = 134.5 ng/µl
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
===Control digest of 4CL, CHS and OMT in pYES===
+
===Control digest of 4CL, CHS and OMT in pTUM104===
Investigator: Daniela
Investigator: Daniela
-
'''Aim of the experiment:''' Test whether the ligation of 4CL, CHS and OMT in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of 4CL, CHS and OMT in pTUM104 was successful
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 5,474: Line 5,558:
|-
|-
|2.5 µl
|2.5 µl
-
|4CL+ in pYES clone 1 / 4CL- in pYES clone 1
+
|4CL+ in pTUM104 clone 1 / 4CL- in pTUM104 clone 1
|-
|-
|0.25 µl
|0.25 µl
Line 5,497: Line 5,581:
|-
|-
|3 µl
|3 µl
-
|4CL+ in pYES clone 2
+
|4CL+ in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,520: Line 5,604:
|-
|-
|3.5 µl
|3.5 µl
-
|4CL- in pYES clone 2
+
|4CL- in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,543: Line 5,627:
|-
|-
|3.5 µl
|3.5 µl
-
|CHS+ in pYES clone 1 / OMT+ in pYES clone 1 / OMT- in pYES clone 1 / CHS+ in pYES clone 2 / OMT+ in pYES clone 2 / OMT- in pYES clone 2
+
|CHS+ in pTUM104 clone 1 / OMT+ in pTUM104 clone 1 / OMT- in pTUM104 clone 1 / CHS+ in pTUM104 clone 2 / OMT+ in pTUM104 clone 2 / OMT- in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,566: Line 5,650:
|-
|-
|4 µl
|4 µl
-
|CHS- in pYES clone 2
+
|CHS- in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,589: Line 5,673:
|-
|-
|5 µl
|5 µl
-
|CHS- in pYES clone 1
+
|CHS- in pTUM104 clone 1
|-
|-
|0.25 µl
|0.25 µl
Line 5,608: Line 5,692:
expected bands:
expected bands:
-
*pYES: about 5800bp
+
*pTUM104: about 5800bp
*4CL: 1685bp
*4CL: 1685bp
*CHS: 1173bp
*CHS: 1173bp
Line 5,619: Line 5,703:
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of ligationsproducts of 4CL and PAL in pSB1C3-RFC25 and of PAL in pYES in ''E.coli'' (see July, 18th)===
+
===Transformation of ligationsproducts of 4CL and PAL in pSB1C3-RFC25 and of PAL in pTUM104 in ''E.coli'' (see July, 18th)===
Investigator: Daniela
Investigator: Daniela
Line 5,626: Line 5,710:
*PAL+ (PCR32) in pSB1C3-RFC25 (P133) ->Chlp
*PAL+ (PCR32) in pSB1C3-RFC25 (P133) ->Chlp
*PAL- (PCR33) in pSB1C3-RFC25 (P133) ->Chlp
*PAL- (PCR33) in pSB1C3-RFC25 (P133) ->Chlp
-
*PAL+ (PCR32) in pYES(P72) ->Amp
+
*PAL+ (PCR32) in pTUM104(P72) ->Amp
-
*PAL- (PCR33) in pYES(P72) ->Amp
+
*PAL- (PCR33) in pTUM104(P72) ->Amp
*negative control: P72 ->Amp
*negative control: P72 ->Amp
*negative control: P132 ->Chlp
*negative control: P132 ->Chlp
*negative control: P133 ->Chlp
*negative control: P133 ->Chlp
-
 
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells
Line 5,692: Line 5,775:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of transformed ''E.&nbsp;coli'' XL1-Blue with pYES2 new from P50 tube (4x), BBa_K365005 (4x), BBa_K207000 (1x)and BBa_K207001 (1x)  ===
+
=== Miniprep of transformed ''E.&nbsp;coli'' XL1-Blue with pTUM104 new from P50 tube (4x), BBa_K365005 (4x), BBa_K207000 (1x)and BBa_K207001 (1x)  ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
Line 5,805: Line 5,888:
<div class="vector_design">
<div class="vector_design">
-
===Control digest of pYES (P153 and P154)===
+
===Control digest of pTUM104 (P153 and P154)===
Investigator: Mary, Ingmar, Daniela
Investigator: Mary, Ingmar, Daniela
-
'''Aim of the experiment:''' Test whether the vector pYES is right.
+
'''Aim of the experiment:''' Test whether the vector pTUM104 is right.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 6,061: Line 6,144:
|ddH2O
|ddH2O
|}
|}
-
 
*P153
*P153
[[File:TUM12_20120720analyt.verdau_P153.jpg]]
[[File:TUM12_20120720analyt.verdau_P153.jpg]]
-
 
*P154
*P154
Line 6,160: Line 6,241:
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
=== Preparative digest of pYes2 RFC 25 and ligation with PCR products PCR 15 - 20 and 32+33 ===
+
=== Preparative digest of pTUM104 RFC25 and ligation with PCR products PCR 15 - 20 and 32+33 ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
'''Aim of the experiment:''' Intsert the genes of PAL, 4CL, CHS and OMT in pYEs2 RFC 25 in order to test their expression in yeast.
+
'''Aim of the experiment:''' Intsert the genes of PAL, 4CL, CHS and OMT in pTUM104 RFC 25 in order to test their expression in yeast.
-
 
+
'''Preparative digest of P 154 with XbaI and NgoMIV and of P 153 with XbaI and PstI'''
'''Preparative digest of P 154 with XbaI and NgoMIV and of P 153 with XbaI and PstI'''
Line 6,213: Line 6,293:
Incubation: 37 °C, 3 h
Incubation: 37 °C, 3 h
-
 
'''DNA preparative gel electrophoresis'''
'''DNA preparative gel electrophoresis'''
Line 6,222: Line 6,301:
[[File:xxx.jpg|500px|Gel picture of control digest with PstI]]
[[File:xxx.jpg|500px|Gel picture of control digest with PstI]]
*All digest products show the expected bonds at 5849 bp (digest with XbaI and NgoMIV) and 5785 bp (digest with XbaI and PstI) respectively.
*All digest products show the expected bonds at 5849 bp (digest with XbaI and NgoMIV) and 5785 bp (digest with XbaI and PstI) respectively.
-
 
'''Gelextration'''
'''Gelextration'''
Line 6,320: Line 6,398:
|}
|}
</div>
</div>
 +
</div>
 +
 +
=Week 7=
 +
<!--
 +
<p class="limonene">'''Limonene (7 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (18 Experiments):'''</p>
 +
*
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (2 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (15 Experiments):'''</p>
 +
*
 +
<html><a class="WDetails" href="#Week_7" id="Week_7">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_7">
== '''Monday, July 23rd''' ==
== '''Monday, July 23rd''' ==
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep of PAL, 4CL in pSB1C3 and PAL in pYES===
+
===Miniprep of PAL, 4CL in pSB1C3 and PAL in pTUM104===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment''': Extract plasmids (pYES and pSB1C3-RFC25) that contain 4CL and PAL´
+
'''Aim of the experiment''': Extract plasmids (pTUM104 and pSB1C3-RFC25) that contain 4CL and PAL´
The day before one clone were picked for each enzyme from plates from 19th July 2012.
The day before one clone were picked for each enzyme from plates from 19th July 2012.
Line 6,341: Line 6,437:
*PAL- (PCR33) in pSB1C3-RF25 (P133): c = 255 ng/µl -> new name of Ligationproduct after Miniprep: P188
*PAL- (PCR33) in pSB1C3-RF25 (P133): c = 255 ng/µl -> new name of Ligationproduct after Miniprep: P188
-
*PAL+ (PCR32) in pYES (P72): c = 190 ng/µl
+
*PAL+ (PCR32) in pTUM104 (P72): c = 190 ng/µl
-
*PAL- (PCR33) in pYES (P72): c = 238 ng/µl
+
*PAL- (PCR33) in pTUM104 (P72): c = 238 ng/µl
-
 
+
-
 
+
</div>
</div>
Line 6,350: Line 6,444:
<div class="coumaryl">
<div class="coumaryl">
-
===Control digest of 4CL, PAL in pSB1C3-RFC25 and PAL in pYES===
+
===Control digest of 4CL, PAL in pSB1C3-RFC25 and PAL in pTUM104===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL in pSB1C3-RFC25 and PAL in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL in pSB1C3-RFC25 and PAL in pTUM104 was successful
Plasmids are taken from miniprep from 23.07.2012
Plasmids are taken from miniprep from 23.07.2012
Line 6,426: Line 6,520:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands:
expected bands:
-
*pYES: about 5800bp
+
*pTUM104: about 5800bp
*pSB1C3-RFC25: 2070bp
*pSB1C3-RFC25: 2070bp
*4CL: 1685bp
*4CL: 1685bp
Line 6,436: Line 6,529:
[[File:TUM12_120723_kontrollverdau_wdh.jpg|500px]]
[[File:TUM12_120723_kontrollverdau_wdh.jpg|500px]]
-
Ligation of PAL+/- in pYES was not succesful
+
Ligation of PAL+/- in pTUM104 was not succesful
Ligation of PAL+/- and 4CL+/- in pSB1C3-RFC25 were succesful! (pSB1C3 is overlapping with PAL)
Ligation of PAL+/- and 4CL+/- in pSB1C3-RFC25 were succesful! (pSB1C3 is overlapping with PAL)
Line 6,447: Line 6,540:
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' solubilisation of the synthetic gene of APT and transformation of sent plasmid (including APT) in E.coli to copy it if necessary
+
'''Aim of the experiment:''' solubilisation of the synthetic gene of APT and transformation of sent plasmid (including APT) in ''E.coli'' to copy it if necessary
short zentrifugation of sent product and adding 50µl bidest. H2O to it (5µg in 50µl = concentration of 0.1 µg/µl)
short zentrifugation of sent product and adding 50µl bidest. H2O to it (5µg in 50µl = concentration of 0.1 µg/µl)
Line 6,454: Line 6,547:
2µl of solved product used for transformation in Ecoli (Kit of Quiagen) and Amp-resistance (said GeneArt)
2µl of solved product used for transformation in Ecoli (Kit of Quiagen) and Amp-resistance (said GeneArt)
Plating cells on Agar with Amp, 37°C over night
Plating cells on Agar with Amp, 37°C over night
-
 
</div>
</div>
Line 6,490: Line 6,582:
   
   
Incubation: 37°C, 2.5h
Incubation: 37°C, 2.5h
-
 
Bond at 1244bp as expected:
Bond at 1244bp as expected:
-
 
[[File:TUM12_120723_prepGel_von_APT.jpg|500px]]
[[File:TUM12_120723_prepGel_von_APT.jpg|500px]]
Line 6,503: Line 6,593:
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of  ligationsproducts of 4CL, CHS, OMT  and PAL in pYES in E.Coli (Ligation see 22th of July)===
+
===Transformation of  ligationsproducts of 4CL, CHS, OMT  and PAL in pTUM104 in ''E.Coli'' (Ligation see 22th of July)===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' ligation of enzymes in pYES to transform it into yeast if this was successful.
+
'''Aim of the experiment:''' ligation of enzymes in pTUM104 to transform it into yeast if this was successful.
* 4CL+ (PCR15) in pYES (P176) -> new name: P177
* 4CL+ (PCR15) in pYES (P176) -> new name: P177
* 4CL- (PCR16) in pYES (P176) -> new name: P178
* 4CL- (PCR16) in pYES (P176) -> new name: P178
Line 6,517: Line 6,607:
* PAL- (PCR33) in pYES (P175) -> new name: P184
* PAL- (PCR33) in pYES (P175) -> new name: P184
-
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells  
+
* adding 5µl ligation product in 100 µl competent XL blue ''E.coli'' cells  
* incubation 30 min on ice  
* incubation 30 min on ice  
* 5 min at 37°C  
* 5 min at 37°C  
Line 6,539: Line 6,629:
== '''Tuesday, July 24nd''' ==
== '''Tuesday, July 24nd''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== GElextraction of preparative digested ADH1-P, CYC1-T, TEF2-P, TEF1-P,PGK1-P===
+
=== Gelextraction of preparative digested ADH1-P, CYC1-T, TEF2-P, TEF1-P,PGK1-P===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 6,546: Line 6,636:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop===
+
===Nanodrop: measuring concentration of P128-P131, P168-P169===
''' Investigator:''' Georg
''' Investigator:''' Georg
Line 6,822: Line 6,912:
* Negative control P133
* Negative control P133
-
 
+
* adding 5µl ligation product in 100 µl competent XL blue ''E.coli'' cells  
-
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells  
+
* incubation 30 min on ice  
* incubation 30 min on ice  
* 5 min at 37°C  
* 5 min at 37°C  
Line 6,831: Line 6,920:
<div class="coumaryl">
<div class="coumaryl">
-
=== Picking Clones of 4CL, CHS, OMT and PAL in pYES and APT in original plasmid===
+
=== Picking Clones of 4CL, CHS, OMT and PAL in pTUM104 and APT in original plasmid===
'''investigator: ''' Daniela
'''investigator: ''' Daniela
Line 7,010: Line 7,099:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep of 4CL, CHS, OMT, PAL in pYes and APT in original plasmid from GeneArt===
+
===Miniprep of 4CL, CHS, OMT, PAL in pTUM104 and APT in original plasmid from GeneArt===
Investigator: Katrin
Investigator: Katrin
-
'''Aim of the experiment''': extraction of plasmids (pYes2) that contain 4CL, CHS, OMT, PAL; extraction of original plasmid from GeneArt with APT
+
'''Aim of the experiment''': extraction of plasmids (pTUM104) that contain 4CL, CHS, OMT, PAL; extraction of original plasmid from GeneArt with APT
QIAprepS Spin Miniprep Kit
QIAprepS Spin Miniprep Kit
Line 7,045: Line 7,134:
* cells were prefilled with 1 ml of LB-medium and incubated in a cell-culture shaker at 37 °C for 40 min
* cells were prefilled with 1 ml of LB-medium and incubated in a cell-culture shaker at 37 °C for 40 min
-
* 100 µl of these cell suspension were plated on antibiotic selection plates (ligations in pYES: Ampicillin; ligations in pSB1C3: Chloramphenicol)
+
* 100 µl of these cell suspension were plated on antibiotic selection plates (ligations in pTUM104: Ampicillin; ligations in pSB1C3: Chloramphenicol)
* cell suspension was centrifuged at 13000 rpm for 90 s for resuspending the pellet with 100 µl LB and plating also
* cell suspension was centrifuged at 13000 rpm for 90 s for resuspending the pellet with 100 µl LB and plating also
Line 7,085: Line 7,174:
'''Control digest'''
'''Control digest'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 7,109: Line 7,197:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands:
expected bands:
Line 7,119: Line 7,206:
<div class="coumaryl">
<div class="coumaryl">
-
===Control digest of 4CL, PAL, CHS, OMT, APT in pYES===
+
===Control digest of 4CL, PAL, CHS, OMT, APT in pTUM104===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL, CHS, OMT, APT in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL, CHS, OMT, APT in pTUM104 was successful
Plasmids are taken from miniprep from 25.07.2012
Plasmids are taken from miniprep from 25.07.2012
Line 7,149: Line 7,236:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands:
expected bands:
Line 7,163: Line 7,249:
<div class="coumaryl">
<div class="coumaryl">
-
=== pour on yeast agarplates ===
+
=== Pour on yeast agarplates for selection of yeast cells ===
Investigator: Mary
Investigator: Mary
Line 7,175: Line 7,261:
<div class="limonene">
<div class="limonene">
 +
===Picking of clones of transformation from 25.07.===
===Picking of clones of transformation from 25.07.===
Line 7,180: Line 7,267:
'''Aim:''' Amplification of clones for extraction of plasmids and subsequent proof of functional ligation.
'''Aim:''' Amplification of clones for extraction of plasmids and subsequent proof of functional ligation.
-
 
6 clones were picked for each ligation (PCR1 in pYESnew, PCR2 (p144) in pYESnew and PCR in pSB1C3. Clones containing pYESnew were put into 4 ml LB with 4 µl of ampillicin stock solution, clones containing pSB1C3 were put into chloramphenicol-containing media. Incubation at 37 °C over night.
6 clones were picked for each ligation (PCR1 in pYESnew, PCR2 (p144) in pYESnew and PCR in pSB1C3. Clones containing pYESnew were put into 4 ml LB with 4 µl of ampillicin stock solution, clones containing pSB1C3 were put into chloramphenicol-containing media. Incubation at 37 °C over night.
Line 7,186: Line 7,272:
<div class="limonene">
<div class="limonene">
-
===Transformation of plasmids P40&P42 into E.coli XL1 blue===
+
===Transformation of plasmids P40&P42 into ''E.coli'' XL1 blue===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 7,192: Line 7,278:
'''Aim:'''  
'''Aim:'''  
-
Transformation of plasmids P40 and P42 into E.coli XL1 blue to get plasmids of higher quality. P40&P42 are directly extracted from the expression strain BL21(DE). The quality of the plasmids might not be sufficient for Quickchange site-directed mutagenesis. Therefore transformation into E.coli XL1 blue and subsequent plasmid preparation to get plasmids with sufficient quality for SDM.
+
Transformation of plasmids P40 and P42 into ''E.coli'' XL1 blue to get plasmids of higher quality. P40&P42 are directly extracted from the expression strain BL21(DE). The quality of the plasmids might not be sufficient for Quickchange site-directed mutagenesis. Therefore transformation into ''E.coli'' XL1 blue and subsequent plasmid preparation to get plasmids with sufficient quality for SDM.
'''Procedure:'''  
'''Procedure:'''  
Line 7,217: Line 7,303:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Transferring ''E.&nbsp;coli''XL1-Blue colonies, transformed with BBa_I15008 (heme oxygenase) and BBa_K105005 (LexA), from old antibiotic plates on new plates ===
+
=== Transferring ''E.&nbsp;coli'' XL1-Blue colonies, transformed with BBa_I15008 (heme oxygenase) and BBa_K105005 (LexA), from old antibiotic plates on new plates ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
Line 7,238: Line 7,324:
Investigator: Ingmar
Investigator: Ingmar
-
'''Aim of the experiment:''' Test whether the ligation of PAL in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of PAL in pTUM104 was successful
'''Miniprep'''
'''Miniprep'''
Line 7,267: Line 7,353:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands:
expected bands:
Line 7,273: Line 7,358:
*PAL: 2151bp
*PAL: 2151bp
-
[[File:TUM12_Coumaryl_P219_und_P220__27.07.2012.jpg|500px]]
+
[[File:TUM12_Xanthohumol_P219_und_P220__27.07.2012.jpg|500px]]
As the picture only shows one band at the expected length of the vecotr backbone the ligation was not successfull and will be repeated with a reduced quotient of insert to vector of 3.
As the picture only shows one band at the expected length of the vecotr backbone the ligation was not successfull and will be repeated with a reduced quotient of insert to vector of 3.
Line 7,331: Line 7,416:
<div class="limonene">
<div class="limonene">
-
=== Plasmid extraction of plasmids PCR1/pYes, P144/pYES, PCR1/pSB1C3 ===
+
=== Plasmid extraction of plasmids PCR1/pTUM104, P144/pTUM104, PCR1/pSB1C3 ===
'''Investigator: Lara'''
'''Investigator: Lara'''
-
'''Aim of the experiment:''' Extract plasmids from ligation of PCR1 in pYES, P144 in pYES and PCR1 in pSB1C3 for further analytical restriction digest. (6 clones were picked for each ligation and plasmids subsequently extracted.)
+
'''Aim of the experiment:''' Extract plasmids from ligation of PCR1 in pYES, P144 in pTUM104 and PCR1 in pSB1C3 for further analytical restriction digest. (6 clones were picked for each ligation and plasmids subsequently extracted.)
'''Prodedure:''' Plasmids were extraced by using Qiagen plasmid miniprep kit.
'''Prodedure:''' Plasmids were extraced by using Qiagen plasmid miniprep kit.
Line 7,369: Line 7,454:
<div class="limonene">
<div class="limonene">
-
=== Restriction digest of plasmids from 6 clones each of PCR1/pYESnew, P144(PCR2)/pYESnew, PCR1/pSB1C3 ===
+
=== Restriction digest of plasmids from 6 clones each of PCR1/pTUM104new, P144(PCR2)/pTUM104new, PCR1/pSB1C3 ===
'''Investigator:''' Lara
'''Investigator:''' Lara
'''Aim of the experiment:''' Analytical restriction digest of plasmids to check for insert.
'''Aim of the experiment:''' Analytical restriction digest of plasmids to check for insert.
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 7,402: Line 7,486:
A mastermix for 19 samples was made.
A mastermix for 19 samples was made.
-
 
-
 
</div>
</div>
Line 7,409: Line 7,491:
<div class="limonene">
<div class="limonene">
-
=== Analytical gel electrophoresis ===
+
=== Analytical gel electrophoresis of PCR1/pTUM104new, P144(PCR2)/pTUM104new, PCR1/pSB1C3 ===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 7,422: Line 7,504:
<div class="coumaryl">
<div class="coumaryl">
-
===Small-Scale Yeast Transformation of 4CL, CHS, OMT and PAL- in pYES===
+
===Small-Scale Yeast Transformation of 4CL, CHS, OMT and PAL- in pTUM104===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
Line 7,480: Line 7,562:
*Two clones were picked an transferred to 6 ml LB medium containing 1:1000 Ampicillin.  
*Two clones were picked an transferred to 6 ml LB medium containing 1:1000 Ampicillin.  
*Incubation overnight at 37°C, 180 rpm.
*Incubation overnight at 37°C, 180 rpm.
 +
</div>
</div>
</div>
 +
=Week 8=
 +
<!--
 +
<p class="limonene">'''Limonene (14 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (5 Experiments):'''</p>
 +
*
 +
 +
<p class="thaumatin">'''Thaumatin (2 Experiments):'''</p>
 +
* Media and plates for yeast transformation
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (14 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (16 Experiments):'''</p>
 +
*
 +
 +
<html><a class="WDetails" href="#Week_8" id="Week_8">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_8">
== '''Monday, July 30th''' ==
== '''Monday, July 30th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Extraction of Yeast genomic DNA===
+
===Extraction of Yeast genomic DNA for amplify TEF2-P, TEF1-T,ADH1-T===
'''Investigator''': Georg
'''Investigator''': Georg
Line 7,510: Line 7,613:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop of yeast genomic DNA===
+
===Nanodrop of yeast genomic DNA to measuring the concentration===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 7,636: Line 7,739:
<div class="coumaryl">
<div class="coumaryl">
-
=== Transformation of ligation products of PAL+ (PCR32) and APT(P189) in pYES2 RFC 25 (P175)into ''E.coli'' Xl1-Blue===
+
=== Transformation of ligation products of PAL+ (PCR32) and APT(P189) in pTUM104 RFC25 (P175)into ''E.coli'' Xl1-Blue===
'''Investigator:''' Ingmar
'''Investigator:''' Ingmar
-
'''Aim of the experiment:'''Transformation of the ligation products of PAL+ (PCR32), APT (P189) and the  negative control in pYes in XL1 Blue.
+
'''Aim of the experiment:'''Transformation of the ligation products of PAL+ (PCR32), APT (P189) and the  negative control in pTUM104 in XL1 Blue.
'''Operation Sequence'''
'''Operation Sequence'''
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
Line 7,652: Line 7,755:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep and control digest of PAL+ in pYES picked on sunday 29th July===
+
===Miniprep and control digest of PAL+ in pTUM104 picked on sunday 29th July===
Investigator: Ingmar
Investigator: Ingmar
-
'''Aim of the experiment:''' Test whether the ligation of PAL in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of PAL in pTUM104 was successful
'''Miniprep'''
'''Miniprep'''
-
Using a Quiagen Miniprep kit a plasmid isolation of two picked clones of the PAL+ in pYes2 RFC25 ligation was done. The miniprep product of the first clone was named P235, the one of the second clone P236. Both were used for the following control digest.
+
Using a Quiagen Miniprep kit a plasmid isolation of two picked clones of the PAL+ in pTUM104 RFC25 ligation was done. The miniprep product of the first clone was named P235, the one of the second clone P236. Both were used for the following control digest.
'''control digest'''
'''control digest'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 7,684: Line 7,786:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands:
expected bands:
Line 7,697: Line 7,798:
<div class="limonene">
<div class="limonene">
-
===Miniprep of Schwab plasmids P40 & P42 from E.coli XL1 blue===
+
===Miniprep of Schwab plasmids P40 & P42 from ''E.coli'' XL1 blue===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 7,781: Line 7,882:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim of experiment:''' Check whether ligations PCR1/pYESnew, P144(PCR2)/pYESnew and PCR1/pSB1C3 have worked. This time, a standard protocol with 2,5 µl of DNA was used. Furthermore, Pst-1 HF was used instead of Spe1 (as on Friday, July 27th).
+
'''Aim of experiment:''' Check whether ligations PCR1/pTUM104new, P144(PCR2)/pTUM104new and PCR1/pSB1C3 have worked. This time, a standard protocol with 2,5 µl of DNA was used. Furthermore, Pst-1 HF was used instead of Spe1 (as on Friday, July 27th).
-
 
+
-
 
+
-
*Digest of plasmids PCR1/pYESnew clone 1,3,5 and 6; P144(PCR2)/pYESnew clone 1,3,5 and 6; PCR1/pSB1C3 clone 1,5 and 6.
+
 +
*Digest of plasmids PCR1/pTUM104new clone 1,3,5 and 6; P144(PCR2)/pTUM104 new clone 1,3,5 and 6; PCR1/pSB1C3 clone 1,5 and 6.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 7,809: Line 7,908:
|ddH2O
|ddH2O
|}
|}
-
 
Incubation for 1,5 h at 37 °C.
Incubation for 1,5 h at 37 °C.
Line 7,819: Line 7,917:
== '''Tuesday, July 31st''' ==
== '''Tuesday, July 31st''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop===
+
===Nanodrop for measuring Plasmidconcentrations of P54,P55,P57,P87,P86,P88,P90,P91,P89===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 7,837: Line 7,935:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
 +
===Prep. digestion of P90, P87, P55 and prep. gelelectrophoresis===
===Prep. digestion of P90, P87, P55 and prep. gelelectrophoresis===
Line 7,873: Line 7,972:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Analytical digestion of pYESII with PvuII and SwaI===
+
=== Analytical digestion of pTUM104 with PvuII and SwaI===
''' Investigator:''' Georg
''' Investigator:''' Georg
Line 7,922: Line 8,021:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim of experiment:''' Remove Age1 restriction site in gene coding for lavendula limonene synthase.
'''Aim of experiment:''' Remove Age1 restriction site in gene coding for lavendula limonene synthase.
Line 7,998: Line 8,096:
'''Investigator: Andrea'''
'''Investigator: Andrea'''
-
'''Digestion of PCR1, PCR2 and P155 (pYES) with XbaI and AgeI'''
+
'''Digestion of PCR1, PCR2 and P155 (pTUM104) with XbaI and AgeI'''
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 8,075: Line 8,173:
</div>
</div>
<div class="limonene">
<div class="limonene">
-
===preparative gel electrophoresis===
+
===Preparative gel electrophoresis of PCR1/PCR2, P155===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
Line 8,086: Line 8,184:
<div class="limonene">
<div class="limonene">
-
=== Ligation of digested PCR1 with P133 (pSB1C3) and P175 (pYES) (XbaI and AgeI)===
+
=== Ligation of digested PCR1 with P133 (pSB1C3) and P175 (pTUM104) (XbaI and AgeI)===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
Line 8,235: Line 8,333:
* YPD-Medium, YPD-plates, 10X TE, 10X LiAc, 1x LiAc/0.5x TE
* YPD-Medium, YPD-plates, 10X TE, 10X LiAc, 1x LiAc/0.5x TE
-
</div>
 
</div>
</div>
-
=August 2012=
 
-
<div class="month" id="MAugust_2012">
 
== '''Wednesday, August 1st''' ==
== '''Wednesday, August 1st''' ==
Line 8,452: Line 8,547:
'''Procedure:'''
'''Procedure:'''
-
 
* '''PCR reaction mixture'''
* '''PCR reaction mixture'''
Line 8,522: Line 8,616:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Preparative digestion of pYesII with SwaI and PvuII ===
+
=== Preparative digestion of pTUM104 with SwaI and PvuII ===
*Preparative digestion of pYesII
*Preparative digestion of pYesII
Line 8,555: Line 8,649:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Preparative Gel of pYESII digestion===
+
===Preparative Gel of pTUM104 digestion===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 8,597: Line 8,691:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep and control digest of APT in pYES ===
+
===Miniprep and control digest of APT in pTUM104 ===
Investigator: Katrin
Investigator: Katrin
Line 8,611: Line 8,705:
clone 2 (P262): 153,5 ng/µl
clone 2 (P262): 153,5 ng/µl
clone 3 (P263): 158,4 ng/µl
clone 3 (P263): 158,4 ng/µl
-
 
'''control digest'''
'''control digest'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 8,638: Line 8,730:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands (pYes has 2 AgeI restriction site):
expected bands (pYes has 2 AgeI restriction site):
Line 8,644: Line 8,735:
*pYes fragment 2: 451
*pYes fragment 2: 451
*APT: 1244 bp  
*APT: 1244 bp  
-
 
-
 
[[File:IM000269 APT pyes kontrolle.jpg|500px]]
[[File:IM000269 APT pyes kontrolle.jpg|500px]]
Line 8,685: Line 8,774:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Gelextraction of pYesII -f1,-Gal4 ===
+
=== Gelextraction of pTUM104 -f1,-Gal4 ===
-
pYes II extraction was performed according to manufacturers protocoll
+
pTUM104 extraction was performed according to manufacturers protocoll
Concentration was measured with nanodrop
Concentration was measured with nanodrop
Line 8,697: Line 8,786:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Circularization of linearized plasmid backbone pYesII===
+
=== Circularization of linearized plasmid backbone pTUM104===
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 8,729: Line 8,818:
===Repetition of Quickchange mutagenesis of lavendula limonene synthase===
===Repetition of Quickchange mutagenesis of lavendula limonene synthase===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' No colonies were observable after second transformation of quickchange PCR products. Therefore the quickchange pcr reaction was repeated with a modified protocol:
'''Aim:''' No colonies were observable after second transformation of quickchange PCR products. Therefore the quickchange pcr reaction was repeated with a modified protocol:
-
 
'''PCR'''<br>
'''PCR'''<br>
Line 8,783: Line 8,870:
|Pfu Turbo DNA polymerase (2.5 U / µl)
|Pfu Turbo DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 8,817: Line 8,903:
'''! Unfortunately someone turned off the heat block, so that the reaction tube was below 37 °C (approx. 25 °C) for about 45 min. After recognition (after one hour of incubation), the heat block was turned on again and the reaction tube was incubated for another 30 min.'''
'''! Unfortunately someone turned off the heat block, so that the reaction tube was below 37 °C (approx. 25 °C) for about 45 min. After recognition (after one hour of incubation), the heat block was turned on again and the reaction tube was incubated for another 30 min.'''
-
 
''' Transformation into ''E.coli'' Xl1-Blue'''
''' Transformation into ''E.coli'' Xl1-Blue'''
Line 8,837: Line 8,922:
'''Aim:''' To get more PCR product in case another preparative digest is needed.
'''Aim:''' To get more PCR product in case another preparative digest is needed.
-
 
'''Primer with consensus sequence'''
'''Primer with consensus sequence'''
Line 8,869: Line 8,953:
|'''TOTAL'''
|'''TOTAL'''
|}
|}
-
 
'''Primer without consensus sequence'''
'''Primer without consensus sequence'''
Line 8,928: Line 9,011:
|1 h
|1 h
|}
|}
-
 
'''Analytical gel electrophoresis'''
'''Analytical gel electrophoresis'''
Line 8,938: Line 9,020:
<div class="coumaryl">
<div class="coumaryl">
-
===Preparation of YPD Medium and Picking of S. cerevisiae clones===
+
===Preparation of YPD Medium and Picking of ''S. cerevisiae'' clones===
'''Investigator:''' Lara, Katrin
'''Investigator:''' Lara, Katrin
-
 
YPD Yeast Extract Peptone Dextrose Medium (1 liter)
YPD Yeast Extract Peptone Dextrose Medium (1 liter)
Line 8,948: Line 9,029:
* 2% peptone
* 2% peptone
* 2% dextrose (D-glucose)
* 2% dextrose (D-glucose)
-
 
Picking of two clones of S. cerevisiae DD (17.17.2012): The clones were put into YPD medium and incubated at 30 °C over night. Additional 0,8 g Glucose were added to one of the cell culture tubes.
Picking of two clones of S. cerevisiae DD (17.17.2012): The clones were put into YPD medium and incubated at 30 °C over night. Additional 0,8 g Glucose were added to one of the cell culture tubes.
Line 8,956: Line 9,036:
== '''Friday, August 3rd''' ==
== '''Friday, August 3rd''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of E.coli Xl1-blue with Vector pGADT7-AD===
+
=== Transformation of ''E.coli'' Xl1-blue with Vector pGADT7-AD===
'''Investigator:'''Georg
'''Investigator:'''Georg
Line 8,980: Line 9,060:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of E.coli Xl1-blue with pYES-TUM overnight ligation===
+
=== Transformation of ''E.coli'' Xl1-blue with pTUM104 overnight ligation===
'''Investigator:'''Georg
'''Investigator:'''Georg
Line 9,152: Line 9,232:
* Final extension: 68 C
* Final extension: 68 C
* Hold: 4 C
* Hold: 4 C
 +
* PCR was successful
</div>
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
===Transformation of E.coli XL1 blue with ligation product P207/PCR39===
+
 
 +
===Transformation of ''E.coli'' XL1 blue with ligation product P207/PCR39===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
+
'''Aim:''' Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation of ''E.coli'' XL1 blue with ligation products P207/PCR39 and P207/NK.
-
'''Aim:''' Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation of E.coli XL1 blue with ligation products P207/PCR39 and P207/NK.
+
-
 
+
''' Transformation into ''E.coli'' Xl1-Blue'''
''' Transformation into ''E.coli'' Xl1-Blue'''
Line 9,178: Line 9,258:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Check whether site directed mutagenesis to eliminate Age1 restriction site has worked.
'''Aim:''' Check whether site directed mutagenesis to eliminate Age1 restriction site has worked.
-
 
'''Quickchange PCR product purification''':
'''Quickchange PCR product purification''':
Line 9,188: Line 9,266:
* P241 SDM: 7 ng/µl
* P241 SDM: 7 ng/µl
* P242 SDM: 63 ng/µl
* P242 SDM: 63 ng/µl
-
 
'''Restriction digest of p241 SDM (31.7.), p242 SDM (2.8.) and p242 (as positive control)'''
'''Restriction digest of p241 SDM (31.7.), p242 SDM (2.8.) and p242 (as positive control)'''
Line 9,211: Line 9,288:
|ddH2O
|ddH2O
|}
|}
-
 
'''Analytical Gel'''
'''Analytical Gel'''
Line 9,230: Line 9,306:
8. PCR 43
8. PCR 43
-
 
[[File:TUM12_LS_Quickchange_Analytgel.png]]
[[File:TUM12_LS_Quickchange_Analytgel.png]]
Line 9,237: Line 9,312:
<div class="limonene">
<div class="limonene">
-
===Transformation of E.coli XL1 blue with P242 SDM===
+
===Transformation of ''E.coli'' XL1 blue with P242 SDM===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation with P242 SDM.
'''Aim:''' Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation with P242 SDM.
-
 
''' Transformation into ''E.coli'' Xl1-Blue'''
''' Transformation into ''E.coli'' Xl1-Blue'''
Line 9,258: Line 9,331:
<div class="coumaryl">
<div class="coumaryl">
-
===Repetition of small-Scale Yeast Transformation of 4CL, CHS, OMT, PAL and APT in pYES===
+
===Repetition of small-Scale Yeast Transformation of 4CL, CHS, OMT, PAL and APT in pTUM104===
'''Investigator:''' Mary
'''Investigator:''' Mary
Line 9,264: Line 9,337:
The protocol on page 13 of the pYES2 manual was used.
The protocol on page 13 of the pYES2 manual was used.
-
 
Only modifications are noted:
Only modifications are noted:
Line 9,271: Line 9,343:
step 2: OD600 = 9 -> to determine a OD600 of 0.4 in 50 ml, 2.2 ml yeast suspension and 42.5 ml YPD medium were used, 5ml 20% Glucose was added (wrong information about the YPD-medium: we suggested that Glucose caramelizes when autoclaved together with medium - but it is not the case! Only agar and glucose will caramelize).  
step 2: OD600 = 9 -> to determine a OD600 of 0.4 in 50 ml, 2.2 ml yeast suspension and 42.5 ml YPD medium were used, 5ml 20% Glucose was added (wrong information about the YPD-medium: we suggested that Glucose caramelizes when autoclaved together with medium - but it is not the case! Only agar and glucose will caramelize).  
-
 
steps 3 and 4: centrifugation for 5 min, 4 °C
steps 3 and 4: centrifugation for 5 min, 4 °C
-
 
step 6:  
step 6:  
Line 9,292: Line 9,362:
100 µg denatured sheared salmon sperm: the one from Simon was used -> 10 µl
100 µg denatured sheared salmon sperm: the one from Simon was used -> 10 µl
-
 
step 7:  
step 7:  
Line 9,298: Line 9,367:
7 ml 50% PEG3350 was synthesized (3.5 g in 7 ml bidest.water)
7 ml 50% PEG3350 was synthesized (3.5 g in 7 ml bidest.water)
6.4 ml 50% PEG3350 + 800 µl 10x LiAc + 800 µl 10x TE were mixed
6.4 ml 50% PEG3350 + 800 µl 10x LiAc + 800 µl 10x TE were mixed
-
 
The cells were plated out on SC-U plates with Glucose and incubated the weekend at 30°C
The cells were plated out on SC-U plates with Glucose and incubated the weekend at 30°C
Line 9,305: Line 9,373:
<div class="limonene">
<div class="limonene">
-
===Transformation of E.coli XL1 blue with ligation products===
+
===Transformation of ''E.coli'' XL1 blue with ligation products===
Investigator: Katrin
Investigator: Katrin
Line 9,311: Line 9,379:
Aim: Transformation of ligation products PCR2/P133, PCR1/P133, MK/P133, PCR2/P175, MK/P175
Aim: Transformation of ligation products PCR2/P133, PCR1/P133, MK/P133, PCR2/P175, MK/P175
-
Transformation into E.coli Xl1-Blue
+
Transformation into ''E.coli'' Xl1-Blue
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
Line 9,520: Line 9,588:
* 3 or 4 clones were picked for each ligation. Clones containing pYES2-new were put into 4 ml LB with 4 µl of ampillicin stock solution, clones containing pSB1C3 were put into chloramphenicol containing media. Incubation at 37&nbsp;°C overnight.
* 3 or 4 clones were picked for each ligation. Clones containing pYES2-new were put into 4 ml LB with 4 µl of ampillicin stock solution, clones containing pSB1C3 were put into chloramphenicol containing media. Incubation at 37&nbsp;°C overnight.
</div>
</div>
 +
</div>
 +
 +
=Week 9=
 +
<!--
 +
<p class="limonene">'''Limonene (11 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (10 Experiments):'''</p>
 +
*
 +
 +
<p class="caffeine">'''Caffeine (5 Experiments):'''</p>
 +
*
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (10 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (24 Experiments):'''</p>
 +
*
 +
<html><a class="WDetails" href="#Week_9" id="Week_9">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_9">
== '''Monday, August 6th''' ==
== '''Monday, August 6th''' ==
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR39  ===
+
=== Miniprep of overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P207+PCR39  ===
'''Investigator:''' Jeff, Dennis
'''Investigator:''' Jeff, Dennis
Line 9,878: Line 9,967:
'''Investigator:''' Georg
'''Investigator:''' Georg
-
'''Aim of the experiment:''' Miniprep of overnight cultures of transformed E. coli XL1-Blue
+
'''Aim of the experiment:''' Miniprep of overnight cultures of transformed ''E. coli'' XL1-Blue
'''Procedure:'''
'''Procedure:'''
Line 9,889: Line 9,978:
'''Investigator:''' Georg
'''Investigator:''' Georg
-
'''Aim of the experiment:''' Amplification of TEF1-Terminator, TEF2-Promoter from genomic DNA of Saccharomyces cerevisiae and ADH1-Terminator from yeast Vector PGADT7 AD'''
+
'''Aim of the experiment:''' Amplification of TEF1-Terminator, TEF2-Promoter from genomic DNA of ''Saccharomyces cerevisiae'' and ADH1-Terminator from yeast Vector PGADT7 AD'''
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 9,919: Line 10,008:
|'''TOTAL'''
|'''TOTAL'''
|}
|}
-
 
* The PCR program was performed after following scheme:
* The PCR program was performed after following scheme:
Line 9,947: Line 10,035:
|1 h
|1 h
|}
|}
-
 
*Afterwards, the PCR-product was purified by Quiaquick PCR purification KIt
*Afterwards, the PCR-product was purified by Quiaquick PCR purification KIt
Line 10,014: Line 10,101:
<div class="limonene">
<div class="limonene">
-
===Ligation of lavendula LS and citrus LS with pSB1C3 and pYES===
+
===Ligation of lavendula LS and citrus LS with pSB1C3 and pTUM104===
Investigator: Andrea
Investigator: Andrea
Line 10,150: Line 10,237:
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
===Preparation of SC-U medium with 2% glucose (300ml) or galactose (700 ml) for expression in Saccharomyces cerevisiae===
+
===Preparation of SC-U medium with 2% glucose (300ml) or galactose (700 ml) for expression in ''Saccharomyces cerevisiae''===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
Line 10,171: Line 10,258:
<div class="coumaryl">
<div class="coumaryl">
-
===Inoculation of Saccharomyces cerevisiae colonies of transformation products from August, 3rd===
+
===Inoculation of ''Saccharomyces cerevisiae'' colonies of transformation products from August, 3rd===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
-
'''Aim of the experiment:''' First step of the expression protocol in Saccharomyces cerevisiae
+
'''Aim of the experiment:''' First step of the expression protocol in ''Saccharomyces cerevisiae''
-
Inoculation of a single colony of Saccaromyces cerevisiae transformed with enzymes PAL+/-, 4CL+/-, CHS+/-, OMT+/-, APT and the positive control GFP in pYES, respectively in 15 ml of SC-U medium with 2% glucose.
+
Inoculation of a single colony of ''Saccaromyces cerevisiae'' transformed with enzymes PAL+/-, 4CL+/-, CHS+/-, OMT+/-, APT and the positive control GFP in pTUM104, respectively in 15 ml of SC-U medium with 2% glucose.
Incubation at 30°C over night.
Incubation at 30°C over night.
Line 10,379: Line 10,466:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Prepare digested PCR fragments for further ligation into pYES and pSB1C3.
+
'''Aim:''' Prepare digested PCR fragments for further ligation into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 10,438: Line 10,524:
[[File:TUM12_LS_0808_prepgel2.png]]
[[File:TUM12_LS_0808_prepgel2.png]]
[[File:TUM12_LS_0808_prepgel1.png]]
[[File:TUM12_LS_0808_prepgel1.png]]
-
 
'''Digested PCR products (PCR 42 RL, PCR 43 RL, PCR 56 RL, PCR 57 RL, PCR 58 RL) are stored in the iGEM PCR product box at -20°C. '''
'''Digested PCR products (PCR 42 RL, PCR 43 RL, PCR 56 RL, PCR 57 RL, PCR 58 RL) are stored in the iGEM PCR product box at -20°C. '''
Line 10,463: Line 10,548:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Check ligation of PCR 1 and PCR 2 into pYES and pSB1C3.
+
'''Aim:''' Check ligation of PCR 1 and PCR 2 into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 10,490: Line 10,574:
* Incubation at 37°C for 2 h.
* Incubation at 37°C for 2 h.
-
 
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 10,501: Line 10,584:
<div class="limonene">
<div class="limonene">
-
===Ligation of lavendula LS and citrus LS with pSB1C3 and pYES===
+
===Ligation of lavendula LS and citrus LS with pSB1C3 and pTUM104===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pYES.
+
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pTUM104.
'''Procedure'''
'''Procedure'''
Line 10,794: Line 10,877:
'''Eppis with Ligation products are stored in two 50 ml Falcon tubes at -20°C (lowest drawer)! '''
'''Eppis with Ligation products are stored in two 50 ml Falcon tubes at -20°C (lowest drawer)! '''
-
 
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
===Induction of PAL,4CL,CHS,OMT,APT and GFP in pYES in ''S. cerevisiae'' in SC-U medium with 2% galactose===
+
===Induction of PAL,4CL,CHS,OMT,APT and GFP in pTUM104 in ''S. cerevisiae'' in SC-U medium with 2% galactose===
'''Investigator:''' Mary, Daniela
'''Investigator:''' Mary, Daniela
-
'''Aim of the experiment:''' Expression of all enzymes in Saccharomyces cerevisiae.
+
'''Aim of the experiment:''' Expression of all enzymes in ''Saccharomyces cerevisiae''.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 11,077: Line 11,159:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Get transformed plasmids for further analytical restriction digest to check whether ligation worked.
'''Aim:''' Get transformed plasmids for further analytical restriction digest to check whether ligation worked.
-
 
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
Line 11,093: Line 11,173:
* PCR2/p133 clone 3: 140 ng/µl
* PCR2/p133 clone 3: 140 ng/µl
* PCR2/p133 clone 4: 510 ng/µl
* PCR2/p133 clone 4: 510 ng/µl
-
 
'''Eppis containing miniprep products were stored in 50 ml Falcon tubes at the lowest drawer of -20°C.'''
'''Eppis containing miniprep products were stored in 50 ml Falcon tubes at the lowest drawer of -20°C.'''
Line 11,104: Line 11,183:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Analytical restriction digest to check whether ligation of Tuesday, July 31st has worked.
'''Aim:''' Analytical restriction digest to check whether ligation of Tuesday, July 31st has worked.
Line 11,165: Line 11,243:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Transform E.coli XL 1 blue with ligation products to produce colonies containing plasmid DNA.
+
'''Aim:''' Transform ''E.coli'' XL 1 blue with ligation products to produce colonies containing plasmid DNA.
-
'''Transformation into E.coli Xl1-Blue'''
+
'''Transformation into ''E.coli'' Xl1-Blue'''
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
Line 11,183: Line 11,261:
'''Aim of the experiment:'''Receive (hopefully) expressed enzymes.
'''Aim of the experiment:'''Receive (hopefully) expressed enzymes.
-
 
The protocol 'Expression Hefe' (Dropbox) was used. If you want to repeat the experiment please read comments before you start.
The protocol 'Expression Hefe' (Dropbox) was used. If you want to repeat the experiment please read comments before you start.
You should make a glycerol stock of clones picked. You should as well take a sample of the uninduced yeast and do a cell lysis to be able to compare the induced and uninduced status.
You should make a glycerol stock of clones picked. You should as well take a sample of the uninduced yeast and do a cell lysis to be able to compare the induced and uninduced status.
-
 
Preparation of sodium phosphate buffer (50 mM):
Preparation of sodium phosphate buffer (50 mM):
Line 11,194: Line 11,270:
*1 M NaH2PO4x2H2O (M = 156.01 g/mol):  0.468 g dissolved in 3 ml ELGA water
*1 M NaH2PO4x2H2O (M = 156.01 g/mol):  0.468 g dissolved in 3 ml ELGA water
*8.095 ml Na2HPO4 and 1.905 ml NaH2PO4 and 190 ml ELGA water were mixed -> pH should be 7.5 but in our case it wasn't. Therefore we used all of the Na2HPO4, but could only achieve an pH of 7.47.
*8.095 ml Na2HPO4 and 1.905 ml NaH2PO4 and 190 ml ELGA water were mixed -> pH should be 7.5 but in our case it wasn't. Therefore we used all of the Na2HPO4, but could only achieve an pH of 7.47.
-
 
Preparation of PMSF (100 mM)->solution is in the fridge:
Preparation of PMSF (100 mM)->solution is in the fridge:
*0.0174 g were dissolved in 1 ml isopropanol (techn.)
*0.0174 g were dissolved in 1 ml isopropanol (techn.)
-
 
Preparation of breaking buffer:
Preparation of breaking buffer:
Line 11,204: Line 11,278:
*750 µl Glycerol (80%)
*750 µl Glycerol (80%)
*24 µl EDTA
*24 µl EDTA
-
 
Preparation of breaking buffer with PMSF:
Preparation of breaking buffer with PMSF:
* 6 ml of breaking buffer
* 6 ml of breaking buffer
* 60 µl of PMSF (100 mM)
* 60 µl of PMSF (100 mM)
-
 
'''Preparations for SDS gel the next day:'''
'''Preparations for SDS gel the next day:'''
Line 11,271: Line 11,343:
|-
|-
|}
|}
-
 
</div>
</div>
Line 11,302: Line 11,373:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop measurement===
+
===Nanodrop measurement of PCR 50-55 and P297-302===
'''Investigator''': Georg
'''Investigator''': Georg
-
* PCR products 50-55 (ADH1-T, TEf1-T, TEF2-P) and P297-302 (TEF1-P, ADH1-P) were measured with Nanodrop
+
* PCR products 50-55 (ADH1-T, TEf1-T, TEF2-P) and P297-302 (TEF1-P, ADH1-P) were measured with Nanodrop in ng/µl
* ADH1-T: 22,4
* ADH1-T: 22,4
* TEF2-P: 7,4
* TEF2-P: 7,4
Line 11,317: Line 11,388:
'''Investigator''': Georg
'''Investigator''': Georg
-
===Ligation of TEF1-P, TEF2-P ADH1-T, TEF1-T and ADH1-T and pYESII-Tum===  
+
===Ligation of TEF1-P, TEF2-P ADH1-T, TEF1-T and ADH1-T and pTUM104===  
'''Procedure:'''
'''Procedure:'''
* Reaction batch for Ligation:
* Reaction batch for Ligation:
Line 11,505: Line 11,576:
Negative control was prepared the same way, with 1 µl ddH2O instead of plasmid template.
Negative control was prepared the same way, with 1 µl ddH2O instead of plasmid template.
-
 
PCR temperature program:
PCR temperature program:
Line 11,573: Line 11,643:
* Then the gel extraction kit from Qiagen was used for extracting the linearized insert from the agarose gel.
* Then the gel extraction kit from Qiagen was used for extracting the linearized insert from the agarose gel.
-
[[File:TUM12_20120809 dennis präp verdau baa36500.jpg]]
+
[[File:TUM12_20120809 dennis präp verdau baa36500.jpg|300px]]
</div>
</div>
Line 11,595: Line 11,665:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Get cells for miniprep for further analytical restriction digest to check whether ligation has worked.
'''Aim:''' Get cells for miniprep for further analytical restriction digest to check whether ligation has worked.
-
 
'''Procedure:''' Picking of 3 clones each of PCR42/p175, PCR43/p175, PCR56/p175, PCR57/p175, PCR58/p175 into 4 ml LB with Amp and PCR42/p133, PCR43/p133, PCR56/p133, PCR57/p133, PCR58/p133 into 4 ml with Chlp. Inbucation at 37°C (shaker) over night.
'''Procedure:''' Picking of 3 clones each of PCR42/p175, PCR43/p175, PCR56/p175, PCR57/p175, PCR58/p175 into 4 ml LB with Amp and PCR42/p133, PCR43/p133, PCR56/p133, PCR57/p133, PCR58/p133 into 4 ml with Chlp. Inbucation at 37°C (shaker) over night.
Line 11,617: Line 11,685:
[[File: TUM12_120809_SDS-PAGE.jpg]]
[[File: TUM12_120809_SDS-PAGE.jpg]]
-
 
Mass of enzymes:
Mass of enzymes:
Line 11,634: Line 11,701:
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast===
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
-
 
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
-
 
'''SDS-PAGE:'''
'''SDS-PAGE:'''
Line 11,686: Line 11,751:
*12 % gel
*12 % gel
*120 V, 1.5 h
*120 V, 1.5 h
-
 
'''Blotting:'''
'''Blotting:'''
Line 11,692: Line 11,756:
*blotting of proteins on a nitrocellulose membrane (Whatman)
*blotting of proteins on a nitrocellulose membrane (Whatman)
*50mA, 1 h
*50mA, 1 h
-
 
'''Blocking:'''
'''Blocking:'''
Line 11,709: Line 11,772:
'''Operational sequence:'''  
'''Operational sequence:'''  
-
The used vectors for the transformations were pSB1C3 RFC25 (p123), and pSB1C3 containing CHS- from the coumaroyl group (p136). Vector lengths are 2070 bps and xxx bps, respectively).
+
The used vectors for the transformations were pSB1C3 RFC25 (p123), and pSB1C3 containing CHS- from the coumaroyl group (p136).  
'''Transformations:'''
'''Transformations:'''
-
* Transformation of (old) chemo competent ''e.coli'' cells, used up to now, and the newly prepared with p123  
+
* Transformation of (old) chemo competent ''E.coli'' cells, used up to now, and the newly prepared with p123  
-
* Transformation of the new chemo competent ''e.coli'' cells with p136 with two slightly different methods:
+
* Transformation of the new chemo competent ''E.coli'' cells with p136 with two slightly different methods:
** as described in previous protocolls, with an heat shock at 37°C for 5 minutes
** as described in previous protocolls, with an heat shock at 37°C for 5 minutes
** with an heat shock at 42°C for 30 seconds, followed by an incubation on ice for 30 minutes (before the cells being incubated with LB- medium)
** with an heat shock at 42°C for 30 seconds, followed by an incubation on ice for 30 minutes (before the cells being incubated with LB- medium)
Line 11,721: Line 11,784:
=='''Friday, August 10th'''==
=='''Friday, August 10th'''==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of overnight ligation with TEF1-P, TEF2-P, TEF1-T, ADH1-P, ADH1-T and pYE2II-TUM===
+
=== Transformation of overnight ligation with TEF1-P, TEF2-P, TEF1-T, ADH1-P, ADH1-T and pTUM104===
'''Investigator''': Georg
'''Investigator''': Georg
Line 11,747: Line 11,810:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===PCR of TEF1-T and TEF2-P from Saccharomyces cerv. genome===
+
===PCR of TEF1-T and TEF2-P from ''Saccharomyces cerevisiae'' genome===
'''Investigator''': Georg
'''Investigator''': Georg
Line 11,824: Line 11,887:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===PCR-Purification===
+
===PCR-Purification of TEF1-T and TEF2-P ===
'''Investigator''': Georg
'''Investigator''': Georg
Line 11,832: Line 11,895:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Analytical gel of purified PCR-Products===
+
===Analytical gel of purified PCR-Products (TEF1-T and TEF2-P) ===
[[File:20120810 Anal.Gel PCR TEF2p,TEF1t.png]]
[[File:20120810 Anal.Gel PCR TEF2p,TEF1t.png]]
* PCR was succesfull
* PCR was succesfull
Line 11,919: Line 11,982:
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast - continued===
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast - continued===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
-
 
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
-
 
'''Detection:'''
'''Detection:'''
Line 11,933: Line 11,994:
[[File: TUM12_120810WesternBlot.jpg]]
[[File: TUM12_120810WesternBlot.jpg]]
-
 
Expected bands:
Expected bands:
Line 11,952: Line 12,012:
<div class="limonene">
<div class="limonene">
-
===Miniprep===
+
===Miniprep of transformation august 8th===
'''Investigator:''' Dennis
'''Investigator:''' Dennis
-
Minipreps are stored in a disposal bag on the lowest drawer of -20°C.
+
'''Aim:''' Miniprep of transformation August 8th
 +
 
 +
The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 40 µl ddH2O at room temperature, with the columns having been incubated 2 minutes at room temperature before the final centrifugation.
 +
'''Miniprep products are stored in a 50 ml Falcon tube in the lowest drawer at -20°C '''
 +
 
</div>
</div>
Line 12,001: Line 12,065:
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast===
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast===
'''Investigator:''' Ingmar
'''Investigator:''' Ingmar
-
 
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag using Strep MAB classic
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag using Strep MAB classic
-
 
'''SDS-PAGE:'''
'''SDS-PAGE:'''
Line 12,013: Line 12,075:
*12.5 µl sample
*12.5 µl sample
*90 V as long as the samples cross the collecting gel, afterwards 110 V until the dye is close to the lower end of the gel.
*90 V as long as the samples cross the collecting gel, afterwards 110 V until the dye is close to the lower end of the gel.
-
 
'''Blotting:'''
'''Blotting:'''
Line 12,019: Line 12,080:
*blotting of proteins on a nitrocellulose membrane (Whatman) according to the protocol of Nadine Kallweit
*blotting of proteins on a nitrocellulose membrane (Whatman) according to the protocol of Nadine Kallweit
*50mA per gel, 1 h
*50mA per gel, 1 h
-
 
'''Blocking:'''
'''Blocking:'''
Line 12,031: Line 12,091:
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast - continued===
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast - continued===
'''Investigator:''' Ingmar
'''Investigator:''' Ingmar
-
 
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
-
 
'''Detection:'''
'''Detection:'''
Line 12,082: Line 12,140:
*Test different blocking techniques for the Western Blot to reduce the background signal.
*Test different blocking techniques for the Western Blot to reduce the background signal.
</div>
</div>
 +
</div>
 +
 +
=Week 10=
 +
<!--
 +
<p class="limonene">'''Limonene (16 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (6 Experiments):'''</p>
 +
*
 +
 +
<p class="thaumatin">'''Thaumatin (5 Experiments):'''</p>
 +
*
 +
 +
<p class="caffeine">'''Caffeine (14 Experiments):'''</p>
 +
*
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (13 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (41 Experiments):'''</p>
 +
*
 +
<html><a class="WDetails" href="#Week_10" id="Week_10">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_10">
== '''Monday, August 13th''' ==
== '''Monday, August 13th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
Line 12,114: Line 12,196:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Picking of colonies of psb1c3 with TEF1-t, TEF2-P, ADH1-P und ADH1-t, pyes2-Tum===
+
===Picking of colonies of psb1c3 with TEF1-t, TEF2-P, ADH1-P und ADH1-t, pTUM104===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 12,122: Line 12,204:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Preparative digestion of pYES2===
+
===Preparative digestion of pTUM104===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 12,776: Line 12,858:
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 12,840: Line 12,921:
<div class="coumaryl">
<div class="coumaryl">
-
===small-Scale Yeast Transformation of pYES without insert===
+
===Small-Scale Yeast Transformation of pTUM104 without insert===
'''Investigator:''' Katrin, Ingmar
'''Investigator:''' Katrin, Ingmar
-
'''Aim of the experiment:'''Transformation of P152 (pYes without insert) in Yeast  
+
'''Aim of the experiment:'''Transformation of P152 (pTUM104 without insert) in Yeast  
The protocol on page 13 of the pYES2 manual was used. To ensure a positive result, two transformations were made.
The protocol on page 13 of the pYES2 manual was used. To ensure a positive result, two transformations were made.
-
 
Only modifications are noted:
Only modifications are noted:
Line 12,853: Line 12,933:
step 2: OD600 = 5,6 -> to determine a OD600 of 0.4 in 50 ml, 3 ml yeast suspension and 50 ml YPD medium were used.  
step 2: OD600 = 5,6 -> to determine a OD600 of 0.4 in 50 ml, 3 ml yeast suspension and 50 ml YPD medium were used.  
-
 
steps 3 and 4: centrifugation for 5 min, 4 °C
steps 3 and 4: centrifugation for 5 min, 4 °C
-
 
step 6:  
step 6:  
Line 12,890: Line 12,968:
<div class="caffeine">
<div class="caffeine">
-
=== Restriction digest of p123 and p136 and preparative gel electrophoresisb===
+
=== Restriction digest of p123 and p136 and preparative gel electrophoresis===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 12,946: Line 13,024:
'''Aim:'''  
'''Aim:'''  
-
Dilution of dried pUCIDT- Amp vector, which contains the gene synthesis products. Afterwards, transformation of pUCIDT_CaXMT1, pUCIDT_CaMXMT1 and pUCIDT_CaDXMT1 in chemo competent XL-1 blue ''e.coli-'' cells, to make the genes available for cloning in pSB1C3 and pYES2.
+
Dilution of dried pUCIDT- Amp vector, which contains the gene synthesis products. Afterwards, transformation of pUCIDT_CaXMT1, pUCIDT_CaMXMT1 and pUCIDT_CaDXMT1 in chemo competent XL-1 blue ''e.coli-'' cells, to make the genes available for cloning in pSB1C3 and pTUM104
'''Operational sequence'''
'''Operational sequence'''
Line 12,979: Line 13,057:
<div class="thaumatin">
<div class="thaumatin">
-
=== Preparative restriction digest and gel electrophoresis of the preprothaumatin plasmid and pYes2 ===
+
=== Preparative restriction digest and gel electrophoresis of the preprothaumatin plasmid and pTUM104 ===
'''Investigator:''' Maddin, Aloisius
'''Investigator:''' Maddin, Aloisius
-
'''Aim:''' Cloning of preprothaumatin on pYes2
+
'''Aim:''' Cloning of preprothaumatin on pTUM104
'''Operational sequence'''
'''Operational sequence'''
Line 12,997: Line 13,075:
* Gel extraction according to QIAqick®  Gel  Extraction Kit. Not successful, EtOH was forgotten.
* Gel extraction according to QIAqick®  Gel  Extraction Kit. Not successful, EtOH was forgotten.
* Transformation of ''E. coli'' XL1-Blue with the preprothaumatin plasmid (selection with amp).
* Transformation of ''E. coli'' XL1-Blue with the preprothaumatin plasmid (selection with amp).
-
 
</div>
</div>
Line 13,009: Line 13,086:
'''Aim of experiment:''' Find positive clones from transformation with ligation products ADH1-P+psb1c3, ADH1-T+psb1c3,TEF1-t+psb1c3 and TEF1-P+psb1c3
'''Aim of experiment:''' Find positive clones from transformation with ligation products ADH1-P+psb1c3, ADH1-T+psb1c3,TEF1-t+psb1c3 and TEF1-P+psb1c3
-
 
* Reaction batch for digestion:
* Reaction batch for digestion:
Line 13,050: Line 13,126:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue ===
+
=== Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in ''E. coli'' XL1-Blue ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment''': Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue.
+
'''Aim of the experiment''': Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in ''E. coli'' XL1-Blue.
'''Procedure:'''
'''Procedure:'''
Line 13,064: Line 13,140:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Reapeat of transformation of E. coli XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th ===
+
=== Reapeat of transformation of ''E. coli'' XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment''': Reapeat of transformation of E. coli XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th. The reason is that the freshly prepared competent cells are contaminated with a foreign plasmid.
+
'''Aim of the experiment''': Reapeat of transformation of ''E. coli'' XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th. The reason is that the freshly prepared competent cells are contaminated with a foreign plasmid.
'''Procedure:'''
'''Procedure:'''
Line 13,091: Line 13,167:
<div class="caffeine">
<div class="caffeine">
-
=== Analysis of plated XL1-blue chemo competent ''e.coli'' (untransformed) ===
+
=== Analysis of plated XL1-blue chemo competent ''E.coli'' (untransformed) ===
'''Investigator:''' Volker
'''Investigator:''' Volker
Line 13,110: Line 13,186:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pYES and pSB1C3.
+
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 13,139: Line 13,214:
* 2,5 µl DNA added to 17,5 µl Master-Mix
* 2,5 µl DNA added to 17,5 µl Master-Mix
* Incubation at 37°C for 1,5 h.
* Incubation at 37°C for 1,5 h.
-
 
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 13,160: Line 13,234:
*The following media were made:
*The following media were made:
-
 
SC-U medium (synthetic complete medium, without uracil)
SC-U medium (synthetic complete medium, without uracil)
Line 13,188: Line 13,261:
== '''Wednesday, August 15th''' ==
== '''Wednesday, August 15th''' ==
-
<div class="constitutive_promoter">
 
-
=== Sequencing of TEF1-T, TEF1-P, ADH1-P, ADH1-T (noch machen)===
 
-
'''Investigator''': Georg
 
-
</div>
 
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
+
 
 +
=== Miniprep of overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment:''' Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
+
'''Aim of the experiment:''' Miniprep of overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
'''Procedure:'''
'''Procedure:'''
Line 13,401: Line 13,471:
<div class="limonene">
<div class="limonene">
-
===Transformation of E.coli XL1 blue with ligation products===
+
===Transformation of ''E.coli'' XL1 blue with ligation products===
Investigator: Andrea
Investigator: Andrea
Line 13,419: Line 13,489:
<div class="limonene">
<div class="limonene">
-
===repetition of analytical restriction digest of ligation products of 10.08. after miniprep===
+
===Repetition of analytical restriction digest of ligation products of 10.08. after miniprep===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pYES and pSB1C3.
+
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 13,452: Line 13,521:
* 2,5 µl DNA added to 17,5 µl Master-Mix
* 2,5 µl DNA added to 17,5 µl Master-Mix
* Incubation at 37°C for 2 h.
* Incubation at 37°C for 2 h.
-
 
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 13,466: Line 13,534:
<div class="limonene">
<div class="limonene">
 +
===Picking of colonies of transformation (August 3rd and August 8th)===
===Picking of colonies of transformation (August 3rd and August 8th)===
'''Investigator:''' Katrin
'''Investigator:''' Katrin
-
 
'''Aim:''' Get cells for miniprep for further analytical restriction digest to check whether ligation has worked.
'''Aim:''' Get cells for miniprep for further analytical restriction digest to check whether ligation has worked.
-
 
'''Procedure:'''  
'''Procedure:'''  
Line 13,488: Line 13,555:
'''Investigator:''' Katrin
'''Investigator:''' Katrin
-
'''Aim of the experiment:'''Picking transformed Saccharomyces cerevisae cells for protein expression in yeast (expression will be done on Thursday, August 16th)
+
'''Aim of the experiment:'''Picking transformed ''Saccharomyces cerevisiae'' cells for protein expression in yeast (expression will be done on Thursday, August 16th)
* Inocultion of overnight cultures: one clone from each plates with PAL+/-, CHS+/-, 4CL+/-, OMT1+/-, APT, GFP was picked,resuspended in 15 ml SCU medium with glucose and incubated at 30 °C overnight
* Inocultion of overnight cultures: one clone from each plates with PAL+/-, CHS+/-, 4CL+/-, OMT1+/-, APT, GFP was picked,resuspended in 15 ml SCU medium with glucose and incubated at 30 °C overnight
Line 13,526: Line 13,593:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Gelextraction of linear pYESII-Tum===
+
===Gelextraction of linear pTUM104===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 13,534: Line 13,601:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop===
+
===Nanodrop for measuring the concentration of P265,264===
-
 
+
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 13,546: Line 13,612:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Ligation of pYESII-TUM===
+
 
 +
===Ligation of pTUM104===
'''Investigator''': Georg
'''Investigator''': Georg
Line 13,610: Line 13,677:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===ligation of TEF2-P (PCR59) and Cyc1-T P131 with P132===
+
===Ligation of TEF2-P (PCR59) and Cyc1-T P131 with P132===
'''Investigator''': Georg
'''Investigator''': Georg
Line 13,668: Line 13,735:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Analytic digestion and gelelectrophoresis of P362, P364 and P366 ===
=== Analytic digestion and gelelectrophoresis of P362, P364 and P366 ===
Line 13,848: Line 13,916:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Preperative digestion of P231 ===
=== Preperative digestion of P231 ===
Line 14,036: Line 14,105:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of the 10&nbsp;h culture of transformated E. coli XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
+
=== Miniprep of the 10&nbsp;h culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment:''' Miniprep of the 10&nbsp;h culture of transformated E. coli XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
+
'''Aim of the experiment:''' Miniprep of the 10&nbsp;h culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
'''Procedure:'''
'''Procedure:'''
Line 14,122: Line 14,191:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Picking from the transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue from Tuesday, the 14th ===
+
=== Picking from the transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in ''E. coli'' XL1-Blue from Tuesday, the 14th ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
Line 14,171: Line 14,240:
<div class="caffeine">
<div class="caffeine">
-
=== Restriction digest of p373 (pYES2 new MCS RFC25) ===
+
=== Restriction digest of p373 (pTUM104 new MCS RFC25) ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 14,177: Line 14,246:
'''Aim:'''  
'''Aim:'''  
-
Restriction digest of pYES2 new with Xba1 and Pst1-HF to be able to clone the caffeine genes into.  
+
Restriction digest of pTUM104 with Xba1 and Pst1-HF to be able to clone the caffeine genes into.  
'''Operational Sequence'''
'''Operational Sequence'''
Line 14,216: Line 14,285:
{| cellspacing="0" border="1"
{| cellspacing="0" border="1"
|DNA- Ladder
|DNA- Ladder
-
|pYES2newMCS_Xba1Pst1
+
|pTUM104_Xba1Pst1
|}
|}
Line 14,223: Line 14,292:
<div class="caffeine">
<div class="caffeine">
-
=== Picking of transformed ''e.coli-'' XL1-blue cells and preparation of liquid cultures ===
+
=== Picking of transformed ''E.coli-'' XL1-blue cells and preparation of liquid cultures ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 14,244: Line 14,313:
<div class="caffeine">
<div class="caffeine">
-
=== Gel extraction of p373 (=pYES2 new MCS RFC25) ===
+
=== Gel extraction of p373 (=pTUM104) ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 14,250: Line 14,319:
'''Aim:'''  
'''Aim:'''  
-
Extraction of Xba1 and Pst1 digested pYES2 new out of agarose gel, to make it ready for ligation
+
Extraction of Xba1 and Pst1 digested pTUM104 out of agarose gel, to make it ready for ligation
'''Operational sequence:'''
'''Operational sequence:'''
Line 14,264: Line 14,333:
<div class="limonene">
<div class="limonene">
 +
=== PCR of C-LS3 (BBa_I742111, Trafo 19.6) ===
=== PCR of C-LS3 (BBa_I742111, Trafo 19.6) ===
Line 14,269: Line 14,339:
'''Aim:''' To get more PCR product in case another preparative digest is needed.
'''Aim:''' To get more PCR product in case another preparative digest is needed.
-
 
'''Primer with consensus sequence'''
'''Primer with consensus sequence'''
Line 14,301: Line 14,370:
|'''TOTAL'''
|'''TOTAL'''
|}
|}
-
 
'''Primer without consensus sequence'''
'''Primer without consensus sequence'''
Line 14,449: Line 14,517:
<div class="limonene">
<div class="limonene">
-
===Miniprep of pYES clones picked on August 15th===
+
===Miniprep of pTUM104 clones picked on August 15th===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
 
'''Aim:''' Get transformed plasmids for further ligations.
'''Aim:''' Get transformed plasmids for further ligations.
-
 
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
Line 14,467: Line 14,533:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
 
'''Aim:''' Get transformed plasmids for further analytical restriction digest to check whether ligation worked.
'''Aim:''' Get transformed plasmids for further analytical restriction digest to check whether ligation worked.
-
 
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
Line 14,510: Line 14,574:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Prepare digested PCR fragments for further ligation into pYES and pSB1C3.
+
'''Aim:''' Prepare digested PCR fragments for further ligation into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 14,545: Line 14,608:
Before Gelelectrophoresis Dephosphorylation of several fragments was done (see next part) !
Before Gelelectrophoresis Dephosphorylation of several fragments was done (see next part) !
-
 
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 14,553: Line 14,615:
[[File:16.08.12 prepgel1 bearbeitet.png|400px]]
[[File:16.08.12 prepgel1 bearbeitet.png|400px]]
[[File:16.08.12 prepgel4 bearbeitet.png|400px]]
[[File:16.08.12 prepgel4 bearbeitet.png|400px]]
-
 
'''Digested PCR products (still in gel) are stored in an disposal bag at the upper drawer of -20°C. '''
'''Digested PCR products (still in gel) are stored in an disposal bag at the upper drawer of -20°C. '''
Line 14,563: Line 14,624:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
 
'''Aim:''' Dephosphorylation of digested PCR products to avoid religation of the insert and enhance ligation rate.
'''Aim:''' Dephosphorylation of digested PCR products to avoid religation of the insert and enhance ligation rate.
Line 14,575: Line 14,635:
* incubate at 37°C for 30 min
* incubate at 37°C for 30 min
* inactivation at 65°C for 15 min
* inactivation at 65°C for 15 min
-
 
</div>
</div>
Line 14,581: Line 14,640:
<div class="thaumatin">
<div class="thaumatin">
-
===Preparative restriction digest of P343, P344, P345, P152 (pYES) and P286 (pSB1C3)===
+
===Preparative restriction digest of P343, P344, P345, P152 (pTUM104) and P286 (pSB1C3)===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Prepare digested Preprothaumatin plasmids for further ligation into pYES and pSB1C3.
+
'''Aim:''' Prepare digested Preprothaumatin plasmids for further ligation into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 14,619: Line 14,677:
P187 was used as positive control for restriction digest (XbaI and AgeI).
P187 was used as positive control for restriction digest (XbaI and AgeI).
-
Before Gelelectrophoresis Dephosphorylation of vectors (pYES and pSB1C3) was done (see next part) !
+
Before Gelelectrophoresis Dephosphorylation of vectors (pTUM104 and pSB1C3) was done (see next part) !
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 14,632: Line 14,690:
<div class="thaumatin">
<div class="thaumatin">
-
===Dephosphorylation of digested pSB1C3 and pYES (with XbaI and SpeI)===
+
===Dephosphorylation of digested pSB1C3 and pTUM104 (with XbaI and SpeI)===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
 
'''Aim:''' Dephosphorylation of digested vectors to avoid religation and enhance ligation rate.
'''Aim:''' Dephosphorylation of digested vectors to avoid religation and enhance ligation rate.
Line 14,873: Line 14,930:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of E.coli Xl1-Blue with ligation of TEF2-p, CYC1-t with psb1c3 and pYES2 selfligation ===
+
=== Transformation of ''E.coli'' Xl1-Blue with ligation of TEF2-p, CYC1-t with psb1c3 and pTUM104 selfligation ===
''' Investigator''': Georg
''' Investigator''': Georg
Line 14,958: Line 15,015:
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 15,007: Line 15,063:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Extract digested PCR products for further ligation.
'''Aim:''' Extract digested PCR products for further ligation.
-
 
Due to previous phosphatase treatment (and presumably application of only 20 µl on the preparative gel), concentrations of products were very low:
Due to previous phosphatase treatment (and presumably application of only 20 µl on the preparative gel), concentrations of products were very low:
Line 15,026: Line 15,080:
<div class="limonene">
<div class="limonene">
-
===Ligation of PCR 42, 43, 56, 57 and 58 with pYES (p175) and pSB1C3 (p133)===
+
===Ligation of PCR 42, 43, 56, 57 and 58 with pTUM104 (p175) and pSB1C3 (p133)===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pYES.
+
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pTUM104.
'''Procedure'''
'''Procedure'''
Line 15,297: Line 15,351:
|=25&nbsp;µl
|=25&nbsp;µl
|}
|}
-
 
-
 
*ligation for 2 h at room temperature.
*ligation for 2 h at room temperature.
* 5 µl of ligation product was transformed. The remaining products were incubated at 16 °C (waterbath) for the weekend.
* 5 µl of ligation product was transformed. The remaining products were incubated at 16 °C (waterbath) for the weekend.
-
 
</div>
</div>
Line 15,310: Line 15,361:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Extract digested prepro-thaumatin for further ligation.
'''Aim:''' Extract digested prepro-thaumatin for further ligation.
-
 
Due to previous phosphatase treatment (and presumably application of only 20 µl on the preparative gel), concentrations of products were very low:
Due to previous phosphatase treatment (and presumably application of only 20 µl on the preparative gel), concentrations of products were very low:
Line 15,332: Line 15,381:
'''Investigators:''' Katrin (digest), Lara (gelelectrophoresis)
'''Investigators:''' Katrin (digest), Lara (gelelectrophoresis)
-
 
'''Aim:''' Check whether ligations have worked (transformation products of 3.8. (ligation 31.7.) & 8.8. (ligation 7.8.))
'''Aim:''' Check whether ligations have worked (transformation products of 3.8. (ligation 31.7.) & 8.8. (ligation 7.8.))
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 15,365: Line 15,412:
[[File:TUM12_LS_analytgel2_1708.png]]
[[File:TUM12_LS_analytgel2_1708.png]]
[[File:TUM12_LS_analytgel3_1708.png]]
[[File:TUM12_LS_analytgel3_1708.png]]
-
 
-
 
</div>
</div>
Line 15,376: Line 15,421:
'''Investigator:''' Lara
'''Investigator:''' Lara
 +
'''Aim:''' Transform ''E.coli'' XL 1 blue with ligation products (PCR42/p133, PCR42/p175, PCR43/p133, PCR43/p175, PCR56/p133, PCR56/p175, PCR57/p133, PCR57/p175, PCR58/p133, PCR58/p175)  to produce colonies containing plasmid DNA.
-
'''Aim:''' Transform E.coli XL 1 blue with ligation products (PCR42/p133, PCR42/p175, PCR43/p133, PCR43/p175, PCR56/p133, PCR56/p175, PCR57/p133, PCR57/p175, PCR58/p133, PCR58/p175)  to produce colonies containing plasmid DNA.
+
'''Transformation into ''E.coli'' Xl1-Blue'''
-
 
+
-
 
+
-
'''Transformation into E.coli Xl1-Blue'''
+
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
Line 15,424: Line 15,467:
'''Aim:''' Digest of plasmids with Xba1 and Pst1 to gain the caffeine- synthesis genes and pSB1C3 backbone, respectively.
'''Aim:''' Digest of plasmids with Xba1 and Pst1 to gain the caffeine- synthesis genes and pSB1C3 backbone, respectively.
-
 
'''Operational Sequence:'''
'''Operational Sequence:'''
Line 15,513: Line 15,555:
<div class="caffeine">
<div class="caffeine">
-
=== Ligation of genes envolved in caffeine synthesis into pYES2new and pSB1C3 ===
+
=== Ligation of genes envolved in caffeine synthesis into pTUM104 ===
'''Investigator:''' Roman
'''Investigator:''' Roman
-
'''Aim:''' Ligation of the genes, which are responsible for caffeine synthesis, into pYES2new (for further expression studies) and pSB1C3 (to create BioBricks).
+
'''Aim:''' Ligation of the genes, which are responsible for caffeine synthesis, into pTUM104 (for further expression studies) and pSB1C3 (to create BioBricks).
'''Operational Sequence:'''
'''Operational Sequence:'''
Line 15,529: Line 15,571:
|'''volume'''
|'''volume'''
|-
|-
-
|pYES2new
+
|pTUM104
|1,5 µl (ca. 120 ng)
|1,5 µl (ca. 120 ng)
|-
|-
Line 15,579: Line 15,621:
* make sure you have PCR tubes and cell culture tubes labeled sufficiently. you need to have one pcr tube and one cell culture tube for each colony.
* make sure you have PCR tubes and cell culture tubes labeled sufficiently. you need to have one pcr tube and one cell culture tube for each colony.
* pick a colony with a sterile toothpick or pipet tip, smear some of the cells onto the wall of the pcr tube (a bit of pressure and smearing) and subsequently put the toothpick into a  cell culture tube with LB-medium and antibiotic.
* pick a colony with a sterile toothpick or pipet tip, smear some of the cells onto the wall of the pcr tube (a bit of pressure and smearing) and subsequently put the toothpick into a  cell culture tube with LB-medium and antibiotic.
-
 
'''19 Clones of PCR58/p133 (transformation of August 17th) were picked + 1 clone of 4CL+(PCR15)/p132 as positive control'''
'''19 Clones of PCR58/p133 (transformation of August 17th) were picked + 1 clone of 4CL+(PCR15)/p132 as positive control'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 15,651: Line 15,691:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Repetition of analytical digestion of products of miniprep on August 16th (clone 6,11,24) and August 10th (PCR56/p175 clone 1; PCR56/p175 clone 3; PCR57/p175 clone 2, PCR58/p175 clone 1)
'''Aim:''' Repetition of analytical digestion of products of miniprep on August 16th (clone 6,11,24) and August 10th (PCR56/p175 clone 1; PCR56/p175 clone 3; PCR57/p175 clone 2, PCR58/p175 clone 1)
Line 15,687: Line 15,726:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of the overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR69 and P207+PCR70 ===
+
=== Miniprep of the overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P207+PCR69 and P207+PCR70 ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment:''' Miniprep of the overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR69 and P207+PCR70.
+
'''Aim of the experiment:''' Miniprep of the overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P207+PCR69 and P207+PCR70.
'''Procedure:'''
'''Procedure:'''
Line 15,699: Line 15,738:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Analytical digestion and gelelectrophoresis of the minipreps of transformated ''E.&nbsp;coli'' XL1-Blue with ligation products of P207+PCR69 and P207+PCR70 ===
=== Analytical digestion and gelelectrophoresis of the minipreps of transformated ''E.&nbsp;coli'' XL1-Blue with ligation products of P207+PCR69 and P207+PCR70 ===
Line 15,798: Line 15,838:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Picking Clones for Ingma and Roman ===
+
=== Picking Clones for Ingmar and Roman ===
'''Investigator:''' Volker
'''Investigator:''' Volker
Line 15,810: Line 15,850:
* on all positive plates there was a sufficient number of clons (30-200)<br>
* on all positive plates there was a sufficient number of clons (30-200)<br>
</div>
</div>
 +
</div>
 +
 +
=Week 11=
 +
<!--
 +
<p class="limonene">'''Limonene (21 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (7 Experiments):'''</p>
 +
*
 +
 +
<p class="thaumatin">'''Thaumatin (8 Experiments):'''</p>
 +
*
 +
 +
<p class="caffeine">'''Caffeine (12 Experiments):'''</p>
 +
*
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (28 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (24 Experiments):'''</p>
 +
*
 +
<html><a class="WDetails" href="#Week_11" id="Week_11">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_11">
== '''Monday, August 20th''' ==
== '''Monday, August 20th''' ==
Line 16,090: Line 16,154:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Ligation of pYES2 without f1-origin and Gal-promoter ===
+
=== Ligation of pTUM100 without f1-origin and Gal-promoter ===
*Reaction batch for pYes2 circulation:
*Reaction batch for pYes2 circulation:
Line 16,120: Line 16,184:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of E.coli Xl1-blue ===
+
 
 +
=== Transformation of ''E.coli'' Xl1-blue ===
To 100 µl competent cells of E. coli Xl1-blue 10 µl of the pYes II Ligation reaction were added.  
To 100 µl competent cells of E. coli Xl1-blue 10 µl of the pYes II Ligation reaction were added.  
Line 16,139: Line 16,204:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Picking colonies of E.coli Xl1-blue, transforemed with Tef2-p + psb1c3 and  Cyc-t + psb1c3 ===
+
=== Picking colonies of ''E.coli'' Xl1-blue, transforemed with Tef2-p + psb1c3 and  Cyc-t + psb1c3 ===
15 colonies from Tef2-p and 6 from Cyc-t were picked and transferred into LB-medium with 1x Chloramphenicole.
15 colonies from Tef2-p and 6 from Cyc-t were picked and transferred into LB-medium with 1x Chloramphenicole.
Line 16,147: Line 16,212:
<div class="limonene">
<div class="limonene">
-
=== Colony PCR===
+
=== Colony PCR of PCR43/p175 and PCR58/p133===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Establish colony PCR to increase speed of clone screening.
'''Aim:''' Establish colony PCR to increase speed of clone screening.
Line 16,156: Line 16,220:
* make sure you have PCR tubes and cell culture tubes labeled sufficiently. you need to have one pcr tube and one cell culture tube for each colony.
* make sure you have PCR tubes and cell culture tubes labeled sufficiently. you need to have one pcr tube and one cell culture tube for each colony.
* pick a colony with a sterile toothpick or pipet tip, smear some of the cells onto the wall of the pcr tube (a bit of pressure and smearing) and subsequently put the toothpick into a  cell culture tube with LB-medium and antibiotic.
* pick a colony with a sterile toothpick or pipet tip, smear some of the cells onto the wall of the pcr tube (a bit of pressure and smearing) and subsequently put the toothpick into a  cell culture tube with LB-medium and antibiotic.
-
 
*'''Citrus''': 8 clones of PCR43/p175 were picked.
*'''Citrus''': 8 clones of PCR43/p175 were picked.
* '''Lavendula''': 8 clones of PCR58/p133 (5 clones of transformation of August 17th, 3 clones of August 8th) and PCR58/p175 (8 of transformation of August 17th) were picked
* '''Lavendula''': 8 clones of PCR58/p133 (5 clones of transformation of August 17th, 3 clones of August 8th) and PCR58/p175 (8 of transformation of August 17th) were picked
* plasmid DNA of PCR2/p133 clone 4 as positive control
* plasmid DNA of PCR2/p133 clone 4 as positive control
-
 
'''Citrus'''
'''Citrus'''
Line 16,255: Line 16,317:
23-25: PCR58/p133, transformation of August 8th
23-25: PCR58/p133, transformation of August 8th
-
 
[[File:TUM12_LS_analytcolonyPCR3.png]]
[[File:TUM12_LS_analytcolonyPCR3.png]]
Line 16,265: Line 16,326:
<div class="limonene">
<div class="limonene">
-
=== Miniprep ===
+
=== Miniprep of PCR58/p133 ===
'''Investigator:''' Dennis
'''Investigator:''' Dennis
Line 16,280: Line 16,341:
<div class="limonene">
<div class="limonene">
-
=== Miniprep ===
+
=== Miniprep of PCR58/p133 ===
'''Investigator:''' Saskia
'''Investigator:''' Saskia
Line 16,321: Line 16,382:
<div class="thaumatin">
<div class="thaumatin">
-
===Ligation of insert and pYes===
+
===Ligation of insert and pTUM104===
Investigator: Martin y Aloís
Investigator: Martin y Aloís
-
 
Aim: Ligate the extracted plasmids of the experiment before
Aim: Ligate the extracted plasmids of the experiment before
Line 16,339: Line 16,399:
<div class="caffeine">
<div class="caffeine">
-
=== Transformation of over-weekend ligation of caffeine synthesis genes in pSB1C3 and pYES2new ===
+
=== Transformation of over-weekend ligation of caffeine synthesis genes in pSB1C3 and pTUM104 ===
'''Investigator:''' Saskia
'''Investigator:''' Saskia
Line 16,347: Line 16,407:
'''Operational Sequence'''
'''Operational Sequence'''
-
The transformation procedure was carried out as previously described, whereas the entire ligation batch was used for transformation in XL1 blue chemo competent ''e.coli-''cells. The 30 minutes on ice incubation was followed by the heat shock at 37°C for 5 minutes and an incubation at 180 rpm at 37°C for about 45 minutes. Afterwords, the suspension was plated on appropriate plates (pSB1C3 transformants with chloramphenicol, pYES2new transformants with ampicillin) and incubated at 37°C over night. Besides, the pellet was also plated out (resuspension in about ca. 100 µl LB medium).
+
The transformation procedure was carried out as previously described, whereas the entire ligation batch was used for transformation in XL1 blue chemo competent ''e.coli-''cells. The 30 minutes on ice incubation was followed by the heat shock at 37°C for 5 minutes and an incubation at 180 rpm at 37°C for about 45 minutes. Afterwords, the suspension was plated on appropriate plates (pSB1C3 transformants with chloramphenicol, pTUM104 transformants with ampicillin) and incubated at 37°C over night. Besides, the pellet was also plated out (resuspension in about ca. 100 µl LB medium).
'''Note:''' This transformation was performed without knowing, that a transformation with 5 µl of every ligation batch was already done on saturday. Furthermore, clone picking and preparing of over night liquid cultures was made, too (on sunday).
'''Note:''' This transformation was performed without knowing, that a transformation with 5 µl of every ligation batch was already done on saturday. Furthermore, clone picking and preparing of over night liquid cultures was made, too (on sunday).
Line 16,355: Line 16,415:
<div class ="caffeine">
<div class ="caffeine">
-
=== Miniprep of picked clones of possible positive pSB1C3_Caffeine_involved_gene and pYES2new_caffeine_involved_gene transformants ===
+
=== Miniprep of picked clones of possible positive pSB1C3_Caffeine_involved_gene and pTUM104_caffeine_involved_gene transformants ===
'''Investigator:''' Roman, Saskia
'''Investigator:''' Roman, Saskia
Line 16,361: Line 16,421:
'''Aim:'''  
'''Aim:'''  
-
Isolation of plasmids pSB1C3 and pYES2, to check for uptaken inserts by an analytical restriction digest.
+
Isolation of plasmids pSB1C3 and pTUM104, to check for uptaken inserts by an analytical restriction digest.
'''Operational sequence:'''
'''Operational sequence:'''
Line 16,413: Line 16,473:
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
-
|'''pYES2new_caffeine_involved_gene'''
+
|'''pTUM104_caffeine_involved_gene'''
|'''Concentration in ng/µl'''
|'''Concentration in ng/µl'''
|-
|-
Line 16,457: Line 16,517:
<div class ="caffeine">
<div class ="caffeine">
-
=== Analytical digest of pSB1C3_Caffeine_involved_gene and pYES2new_caffeine_involved_gene plasmids ===
+
=== Analytical digest of pSB1C3_Caffeine_involved_gene and pTUM104_caffeine_involved_gene plasmids ===
'''Investigator:''' Saskia
'''Investigator:''' Saskia
Line 16,463: Line 16,523:
'''Aim:'''  
'''Aim:'''  
-
Analytical digest of B1A-D, B2A-D, B3A-D, Y1A-D, Y2A-D, Y3A-D with PstI ans XbaI to controll the ligation of the inserts in pSB1C3 and pYES2new.
+
Analytical digest of B1A-D, B2A-D, B3A-D, Y1A-D, Y2A-D, Y3A-D with PstI ans XbaI to controll the ligation of the inserts in pSB1C3 and pTUM104.
'''Procedure:'''
'''Procedure:'''
Line 16,585: Line 16,645:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of overnight ligation with P265B (pYes-TUM)===
+
=== Transformation of overnight ligation with P265B (pTUM100)===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 16,610: Line 16,670:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
 +
=== Preparative digestion of P451 (TEF2-P in psb1c3) with SpeI-HF and PstI-HF===
=== Preparative digestion of P451 (TEF2-P in psb1c3) with SpeI-HF and PstI-HF===
-
'''Investigator''':Georg
+
'''Investigator''':Georg, Dennis
'''Aim of the experiment''': Prepare TEF2-P for cloning  
'''Aim of the experiment''': Prepare TEF2-P for cloning  
Line 16,707: Line 16,768:
<div class="limonene">
<div class="limonene">
-
===Colony PCR===
+
===Colony PCR of PCR42/p133 and PCR56/p133===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 16,714: Line 16,775:
* extension time of PCR reaction was adjusted to the longer PCR product (insert+primers+backbone from primer binding site)
* extension time of PCR reaction was adjusted to the longer PCR product (insert+primers+backbone from primer binding site)
* annealing temperature was adjusted to lowest primer melting temperature
* annealing temperature was adjusted to lowest primer melting temperature
-
 
*'''Citrus''': 5 clones of PCR42/p133 (transformation of 8.8.) and PCR42/p175 (trafo 17.8.) were picked.
*'''Citrus''': 5 clones of PCR42/p133 (transformation of 8.8.) and PCR42/p175 (trafo 17.8.) were picked.
* '''Lavendula''': 5 clones of PCR56/p133 (trafo 17.8.) and PCR56/p175 (transformation of August 17th) were picked.
* '''Lavendula''': 5 clones of PCR56/p133 (trafo 17.8.) and PCR56/p175 (transformation of August 17th) were picked.
* positive control: plasmid DNA of PCR2/p133 clone 4 as positive control
* positive control: plasmid DNA of PCR2/p133 clone 4 as positive control
-
* negative controls: 1. clone containing pSB1C3 with proteinlinker (Jeff); 2. ddH2O; 3. clone containing pYES (P50, no insert)
+
* negative controls: 1. clone containing pSB1C3 with proteinlinker (Jeff); 2. ddH2O; 3. clone containing pTUM104 (P50, no insert)
-
 
+
'''Citrus in pSB1C3''' (PCR42/p133)
'''Citrus in pSB1C3''' (PCR42/p133)
Line 16,867: Line 16,926:
19: p50 clone
19: p50 clone
20-24: PCR56/p175
20-24: PCR56/p175
-
 
[[File:TUM12_LS_analytcolonyPCR6.png]]
[[File:TUM12_LS_analytcolonyPCR6.png]]
[[File:TUM12_LS_analytcolonyPCR7.png]]
[[File:TUM12_LS_analytcolonyPCR7.png]]
[[File:TUM12_LS_analytcolonyPCR8.png]]
[[File:TUM12_LS_analytcolonyPCR8.png]]
-
 
</div>
</div>
Line 17,060: Line 17,117:
'''Investigators:''' Andrea
'''Investigators:''' Andrea
-
 
'''Aim:''' Check whether ligations have worked (ligation of 17th August)
'''Aim:''' Check whether ligations have worked (ligation of 17th August)
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 17,115: Line 17,170:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep of 4CL in psB1C3 and pYES after Quick Change from August 17th===
+
===Miniprep of 4CL in psB1C3 and pTUM104 after Quick Change from August 17th===
'''Investigator: Saskia, Daniela'''
'''Investigator: Saskia, Daniela'''
-
 
Overnight culutres were grown too long. To obtain bacteria with plasmids we exchanged the media and let them grow for another 6 hours. A Miniprep was done afterwards.
Overnight culutres were grown too long. To obtain bacteria with plasmids we exchanged the media and let them grow for another 6 hours. A Miniprep was done afterwards.
-
Using a Quiagen Miniprep kit, a plasmid isolation of three picked clones of a APT in pYes2 RFC25 ligation was done.  
+
Using a Quiagen Miniprep kit, a plasmid isolation of three picked clones of a APT in pTUM104 RFC25 ligation was done.  
The resulting plamid-concentrations (measured with nanodrop) were:
The resulting plamid-concentrations (measured with nanodrop) were:
Line 17,133: Line 17,187:
4CL- pYES clone 4: 136.2 ng/µl
4CL- pYES clone 4: 136.2 ng/µl
-
 
4CL+ pYES clone 1: 88.4 ng/µl
4CL+ pYES clone 1: 88.4 ng/µl
Line 17,142: Line 17,195:
4CL+ pYES clone 4: 104.9 ng/µl
4CL+ pYES clone 4: 104.9 ng/µl
-
 
4CL- pSB1C3 clone 1: 170.4 ng/µl
4CL- pSB1C3 clone 1: 170.4 ng/µl
Line 17,151: Line 17,203:
4CL- pSB1C3 clone 4: 254.2 ng/µl
4CL- pSB1C3 clone 4: 254.2 ng/µl
-
 
4CL+ pSB1C3 clone 1: 272.8 ng/µl
4CL+ pSB1C3 clone 1: 272.8 ng/µl
Line 17,160: Line 17,211:
4CL+ pSB1C3 clone 4: 170.1 ng/µl
4CL+ pSB1C3 clone 4: 170.1 ng/µl
-
 
</div>
</div>
<div class ="caffeine">
<div class ="caffeine">
-
=== Analytical DNA-gelelectrophoresis of pSB1C3_Caffeine_involved_gene and pYES2new_caffeine_involved_gene plasmids after digestion with PstI and XbaI===
+
=== Analytical DNA-gelelectrophoresis of pSB1C3_Caffeine_involved_gene and pTUM104_caffeine_involved_gene plasmids after digestion with PstI and XbaI===
'''Investigator:''' Roman, Saskia
'''Investigator:''' Roman, Saskia
Line 17,171: Line 17,221:
'''Aim:'''  
'''Aim:'''  
-
Analytical DNA-gelelectrophoresis of B1A-D, B2A-D, B3A-D, Y1A-D, Y2A-D, Y3A-D with PstI ans XbaI to controll the ligation of the inserts in pSB1C3 and pYES2new.
+
Analytical DNA-gelelectrophoresis of B1A-D, B2A-D, B3A-D, Y1A-D, Y2A-D, Y3A-D with PstI ans XbaI to controll the ligation of the inserts in pSB1C3 and pTUM104.
'''Procedure:'''
'''Procedure:'''
Line 17,202: Line 17,252:
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
|1 kp ladder DNA ladder
|1 kp ladder DNA ladder
-
|'''B1D'''
+
|'''B3D'''
|'''Y1A'''
|'''Y1A'''
|'''Y1B'''
|'''Y1B'''
Line 17,226: Line 17,276:
|-
|-
|}
|}
 +
 +
'''Result:''' All ligations were positive!
</div>
</div>
Line 17,231: Line 17,283:
<div class ="caffeine">
<div class ="caffeine">
-
=== Preparation for transformation of pYESnew with caffeine genes in yeast===
+
=== Preparation for transformation of pTUM104 with caffeine genes in yeast===
'''Investigator:''' Saskia
'''Investigator:''' Saskia
Line 17,237: Line 17,289:
'''Aim:'''  
'''Aim:'''  
-
Transformation of ''S. cerevisiae'' INVSc1 with pYESnew with CaXMT1, CaMXMT1 and CaDXMT1.
+
Transformation of ''S. cerevisiae'' INVSc1 with pTUM104 with CaXMT1, CaMXMT1 and CaDXMT1.
'''Procedure:'''
'''Procedure:'''
-
production of YPD medium as described in the pYES manual
+
production of YPD medium as described in the pYES2 manual
Incubation of ''S. cerevisiae'' INVSc1 in 4 ml YPD as described in the pYES manual
Incubation of ''S. cerevisiae'' INVSc1 in 4 ml YPD as described in the pYES manual
Line 17,249: Line 17,301:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Minipreparation of pYes2_Preprothaumatin_RFC10 and pSB1C3_Preprothaumatin_RFC10===
+
=== Minipreparation of pTUM104_Preprothaumatin_RFC10 and pSB1C3_Preprothaumatin_RFC10===
'''Investigator:''' Martianus Capella, Albertus Magnus
'''Investigator:''' Martianus Capella, Albertus Magnus
Line 17,350: Line 17,402:
  ACGAAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGTT
  ACGAAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGTT
Sequence of interest matches the expectation
Sequence of interest matches the expectation
-
 
* P398:
* P398:
Line 17,483: Line 17,534:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop measurement===
+
===Nanodrop measurement of ADH1-P===
''' Investigator''': Georg
''' Investigator''': Georg
Line 17,494: Line 17,545:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Preparative gel of TEF1-P (P309), TEF2-P (P451) in psb1c3 and pYESII without GAL-P and f1===
+
 
 +
===Preparative gel of TEF1-P (P309), TEF2-P (P451) in psb1c3 and pTUM104 without GAL-P and f1 (pTUM100)===
* Preparative digests were loaded onto 1% preparative agarose gels
* Preparative digests were loaded onto 1% preparative agarose gels
Line 17,533: Line 17,585:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Preparative Digestion of P375 (pYesII)===
+
===Preparative Digestion of P375 (pTUM104)===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 17,565: Line 17,617:
|}
|}
-
* pYes was first digested with SwaI and BSA at room temperature. Afterwards PvuII was added and digested for another 3 hours at 37°C
+
* pTUM104 was first digested with SwaI and BSA at room temperature. Afterwards PvuII was added and digested for another 3 hours at 37°C
</div>
</div>
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Control digest of pYes2_Preprothaumatin and pSB1C3_Preprothaumatin===
+
=== Control digest of pTUM104_Preprothaumatin and pSB1C3_Preprothaumatin===
'''Investigator:''' Cicero, Platon
'''Investigator:''' Cicero, Platon
Line 17,595: Line 17,647:
<div class="caffeine">
<div class="caffeine">
-
=== Small scale yeast transformation with pYES2new_CaXMT1, pYES2new_CaMXMT1 and pYES2new_CaDXMT1 ===
+
=== Small scale yeast transformation with pTUM104_CaXMT1, pTUM104_CaMXMT1 and pTUM104_CaDXMT1 ===
'''Investigator:''' Saskia, Roman
'''Investigator:''' Saskia, Roman
-
'''Aim:''' To transform our yeast strain ''saccharomyces cerevisiae'' INVSC1 -URA with the created pYES2new plasmids, to be able to start expression of our genes.
+
'''Aim:''' To transform our yeast strain ''saccharomyces cerevisiae'' INVSC1 -URA with the created pTUM104 plasmids, to be able to start expression of our genes.
'''Operational sequence:'''
'''Operational sequence:'''
Line 17,605: Line 17,657:
* The transformation of the yeast cells was performed as described in the pYES2 Manual of Invitrogen (small scale  yeast transformation).  
* The transformation of the yeast cells was performed as described in the pYES2 Manual of Invitrogen (small scale  yeast transformation).  
-
* As positive control, we used a pYES2_eGFP plasmid (provided by Simon) and as negative control, no plasmid (water) was "transformed".
+
* Used plasmids pTUM104_Insert were previously isolated out of clones: Y1B, Y2D, Y3A
 +
 
 +
* As positive control, we used a pTUM104_eGFP plasmid (provided by Simon) and as negative control, no plasmid (water) was "transformed".
* 1xTE and 1xLiAc/40%PEG-3350/1xTE solution were created immediately before use and sterilized by steril- filtration. The other solutions had already been available (and had also been sterilized by steril- filtration).
* 1xTE and 1xLiAc/40%PEG-3350/1xTE solution were created immediately before use and sterilized by steril- filtration. The other solutions had already been available (and had also been sterilized by steril- filtration).
-
* The resuspended pellets were plated on adequate selective SC -URA plates (minimal, defined medium for yeast, without uracil, due to selection for pYES2new vector).
+
* The resuspended pellets were plated on adequate selective SC -URA plates (minimal, defined medium for yeast, without uracil, due to selection for pTUM104 vector).
* Plates were incubated at 30°C over night
* Plates were incubated at 30°C over night
Line 17,632: Line 17,686:
===Western Blot of APT at different times of expression in yeast===
===Western Blot of APT at different times of expression in yeast===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
-
 
'''Aim of the experiment:''' Find out optimum time for expression.
'''Aim of the experiment:''' Find out optimum time for expression.
Line 17,652: Line 17,705:
*12 % gel
*12 % gel
*120 V, 1.5 h
*120 V, 1.5 h
-
 
'''Blotting:'''
'''Blotting:'''
Line 17,658: Line 17,710:
*blotting of proteins on a nitrocellulose membrane (Whatman)
*blotting of proteins on a nitrocellulose membrane (Whatman)
*50mA, 1 h
*50mA, 1 h
-
 
'''Blocking:'''
'''Blocking:'''
Line 17,667: Line 17,718:
<div class="coumaryl">
<div class="coumaryl">
-
===Control digest of 4CL in pYES and pSB1C3-RFC25 after Quick Change from August 17th===
+
===Control digest of 4CL in pTUM104 and pSB1C3-RFC25 after Quick Change from August 17th===
Investigator: Daniela
Investigator: Daniela
Line 17,692: Line 17,743:
|ddH2O
|ddH2O
|}
|}
-
 
'''Gel 1: 4CL in pYES'''
'''Gel 1: 4CL in pYES'''
-
 
lane 1: 4CL- in pYES clone 1
lane 1: 4CL- in pYES clone 1
Line 17,704: Line 17,753:
lane 4: 4CL- in pYES clone 4
lane 4: 4CL- in pYES clone 4
-
 
lane 5: 4CL+ in pYES clone 1
lane 5: 4CL+ in pYES clone 1
Line 17,713: Line 17,761:
lane 8: 4CL+ in pYES clone 4
lane 8: 4CL+ in pYES clone 4
-
 
[[File: TUM12_4CL_+_pYES_after_Quick_Change_from_August_17th.jpg]]
[[File: TUM12_4CL_+_pYES_after_Quick_Change_from_August_17th.jpg]]
-
 
'''Gel 2: 4CL in pSB1C3-RFC25'''
'''Gel 2: 4CL in pSB1C3-RFC25'''
-
 
lane 1: 4CL- in pSB1C3 clone 1
lane 1: 4CL- in pSB1C3 clone 1
Line 17,728: Line 17,773:
lane 4: 4CL- in pSB1C3 clone 4
lane 4: 4CL- in pSB1C3 clone 4
-
 
lane 5: 4CL+ in pSB1C3 clone 1
lane 5: 4CL+ in pSB1C3 clone 1
Line 17,737: Line 17,781:
lane 8: 4CL+ in pSB1C3 clone 4
lane 8: 4CL+ in pSB1C3 clone 4
-
 
[[File: TUM12_4CL_+_pSB1C3_after_Quick_Change_from_August_17th.jpg]]
[[File: TUM12_4CL_+_pSB1C3_after_Quick_Change_from_August_17th.jpg]]
-
 
The results are not unambiguous. Nevertheless the last Quick Change will be done on Friday 24th.
The results are not unambiguous. Nevertheless the last Quick Change will be done on Friday 24th.
Line 17,751: Line 17,793:
'''Investigators:''' Andrea
'''Investigators:''' Andrea
-
 
'''Aim:''' Check whether ligations have worked (ligation of 17th August)
'''Aim:''' Check whether ligations have worked (ligation of 17th August)
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 17,778: Line 17,818:
|ddH2O
|ddH2O
|}
|}
-
 
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 17,800: Line 17,839:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
 
'''Aim:''' Transform E.coli XL 1 blue with ligation products (PCR58/p133 (Klon20) (Miniprep: 21rst August), PCR2/p133 (Klon 4) (Miniprep: 8th August))  to produce colonies containing plasmid DNA.
'''Aim:''' Transform E.coli XL 1 blue with ligation products (PCR58/p133 (Klon20) (Miniprep: 21rst August), PCR2/p133 (Klon 4) (Miniprep: 8th August))  to produce colonies containing plasmid DNA.
-
 
'''Transformation into E.coli Xl1-Blue'''
'''Transformation into E.coli Xl1-Blue'''
Line 17,830: Line 17,867:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Preparative digest of pSB1C3_Preprothaumatin (p456) and ligation with p400 (pYes2 digested with XbaI and PstI)===
+
=== Preparative digest of pSB1C3_Preprothaumatin (p456) and ligation with p400 (pTUM104 digested with XbaI and PstI)===
'''Investigator:''' Martin, Dennis, Alois
'''Investigator:''' Martin, Dennis, Alois
Line 17,851: Line 17,888:
* 1.7 µl p400 (digested with XbaI and PstI), 5 µl p456 (digested with XbaI and PstI), 1 µl 10x T4-DNA ligase, 1 µl T4-DNA ligase buffer, 10.3 µl ddH2O. Additional: negative control without insert.
* 1.7 µl p400 (digested with XbaI and PstI), 5 µl p456 (digested with XbaI and PstI), 1 µl 10x T4-DNA ligase, 1 µl T4-DNA ligase buffer, 10.3 µl ddH2O. Additional: negative control without insert.
* 16°C over night.
* 16°C over night.
-
 
</div>
</div>
Line 17,878: Line 17,914:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Gelextraction ===
+
=== Gelextraction of preparative digested TEF1-P, TEF2-P in psb1c3, and digested pTUM104===
'''Investigator''': Georg
'''Investigator''': Georg
Line 17,889: Line 17,925:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Nanodrop Measurement===
+
=== Nanodrop Measurement of TEF1-P and TEF2-P===
'''Investigator''': Georg
'''Investigator''': Georg
Line 17,899: Line 17,935:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Self-ligation (self-circularization) of pYESII-TUM ===
+
 
 +
=== Self-ligation (self-circularization) of pTUM100 ===
''' Aim of the experiment:''' Ligation of pYESII-TUM for transformation in E.coli XL1-blue
''' Aim of the experiment:''' Ligation of pYESII-TUM for transformation in E.coli XL1-blue
Line 17,959: Line 17,996:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
 +
===Preparative digestion of ADH1-P (720 bp)in psb1c3 with SpeI and PSTI===
===Preparative digestion of ADH1-P (720 bp)in psb1c3 with SpeI and PSTI===
Line 18,000: Line 18,038:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Transformation EYFP (Dist. Kit) ECFP (Distr. Kit), Lig. pYesII 1h, 50ng and 100 ng of E.coli Xl-1 blue===
+
===Transformation EYFP (Dist. Kit) ECFP (Distr. Kit), Lig. pTUM100 1h, 50ng and 100 ng of E.coli Xl-1 blue===
'''Investigator''': Georg
'''Investigator''': Georg
Line 18,026: Line 18,064:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
===Transformation of E.coli Xl1-blue competent cells with ligation batches at room temperature===
===Transformation of E.coli Xl1-blue competent cells with ligation batches at room temperature===
Line 18,304: Line 18,343:
<div class="limonene">
<div class="limonene">
-
===Preparative restriction digest of PCR58 / P133 Klon20 (lavendula LS in pSB1C3, Miniprep 21rst August) and PCR2 / P133 Klon4 (citrus LS in pSB1C3, Miniprep 8th August) and P373 (pYES2)===
+
===Preparative restriction digest of PCR58 / P133 Klon20 (lavendula LS in pSB1C3, Miniprep 21rst August) and PCR2 / P133 Klon4 (citrus LS in pSB1C3, Miniprep 8th August) and P373 (pTUM104)===
'''Investigator:''' Lara (digest), Andrea (gel electrophoresis)
'''Investigator:''' Lara (digest), Andrea (gel electrophoresis)
'''Aim:''' Prepare digested PCR fragments for further ligation into pYES.
'''Aim:''' Prepare digested PCR fragments for further ligation into pYES.
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 18,403: Line 18,441:
<div class="limonene">
<div class="limonene">
-
===ligation of PCR2/P133 (Miniprep 08.08.) and PCR58/133 (Miniprep 21.08.) in pYES2 (P375)===
+
===Ligation of PCR2/P133 (Miniprep 08.08.) and PCR58/133 (Miniprep 21.08.) in pTUM104 (P375)===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
Line 18,478: Line 18,516:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
 
'''Aim:''' Get cells for miniprep for amplifying ligation products.
'''Aim:''' Get cells for miniprep for amplifying ligation products.
-
 
'''Procedure:'''  
'''Procedure:'''  
Line 18,535: Line 18,571:
|ddH2O
|ddH2O
|}
|}
-
 
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 18,554: Line 18,589:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Transformation of pYes2_Preprothaumatin and inoculation===
+
=== Transformation of pTUM104_Preprothaumatin and inoculation===
'''Investigator:''' Martin, Alois
'''Investigator:''' Martin, Alois
Line 18,576: Line 18,611:
<div class="limonene">
<div class="limonene">
-
===Colony PCR===
+
===Colony PCR of PCR43/p175 and PCR57/p133===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 18,583: Line 18,618:
* extension time of PCR reaction was adjusted to the longer PCR product (insert+primers+backbone from primer binding site)
* extension time of PCR reaction was adjusted to the longer PCR product (insert+primers+backbone from primer binding site)
* annealing temperature was adjusted to lowest primer melting temperature
* annealing temperature was adjusted to lowest primer melting temperature
-
 
*'''Citrus''': 8 clones of PCR43/p175 (transformation of 17.8.) were picked.
*'''Citrus''': 8 clones of PCR43/p175 (transformation of 17.8.) were picked.
Line 18,589: Line 18,623:
* positive control: plasmid DNA of PCR1/p175 (clone 20) as positive control
* positive control: plasmid DNA of PCR1/p175 (clone 20) as positive control
* negative controls: ddH2O
* negative controls: ddH2O
-
 
'''Citrus in pYES''' (PCR43/p175)
'''Citrus in pYES''' (PCR43/p175)
Line 18,712: Line 18,745:
33: Negative control: ddH2O
33: Negative control: ddH2O
-
 
[[File:TUM12_LS_analytcolonyPCR9.png]]
[[File:TUM12_LS_analytcolonyPCR9.png]]
Line 18,758: Line 18,790:
===Western Blot of APT at different times of expression in yeast - continued===
===Western Blot of APT at different times of expression in yeast - continued===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
-
 
'''Aim of the experiment:''' Find out optimum time for expression.
'''Aim of the experiment:''' Find out optimum time for expression.
-
 
'''Detection:'''
'''Detection:'''
Line 18,771: Line 18,801:
*incubation: about 30 min
*incubation: about 30 min
 +
Expected bands:
 +
APT:  length: 411, mass =  45.481 kDa
 +
GFP: mass: 26.9 kDa ->positive control
-
Expected bands:
+
[[File: TUM12_120823Western_Blot.jpg]]
 +
</div>
-
APT:  length: 411, mass = 45.481 kDa
+
<div class ="caffeine">
-
GFP: mass: 26.9 kDa ->positive control
+
=== Sequencing of plasmids pSB1C3_Insert and pTUM104_Insert ===
 +
'''Investigator:''' Roman, Saskia
-
[[File: TUM12_120823Western_Blot.jpg]]
+
'''Aim:''' Proof of inserted sequence
 +
 
 +
Sequenced plasmids:
 +
* pSB1C3_CaXMT1 (clone B1B): sequence ok
 +
* pSB1C3_CaMXMT1 (clone B2A): sequence ok
 +
* pSB1C3_CaDXMT1 (clone B3D): sequence ok
 +
 
 +
* pTUM104CaXMT1 (clone Y1B): sequencing failed
 +
* pTUM104_CaMXMT1 (clone Y2D): sequencing failed
 +
* pTUM104_CaDXMT1 (clone Y3A): sequencing failed
 +
 
 +
Note: Sequencing of pTUM104 plasmids will be repeated next week with newly picked clones. Sequencing results of all three pSB1C3 plasmids (containing inserts) were positive.
</div>
</div>
Line 18,838: Line 18,884:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Nanodrop===
+
=== Nanodrop for concentration measuring of ADH1-P, P434, P299, P432===
'''Investigator''':Georg
'''Investigator''':Georg
Line 18,849: Line 18,895:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Picking of colonies of pYESII-Tum, GFP and ADH1-P (720 bp)===
+
 
 +
===Picking of colonies of pTUM104, GFP and ADH1-P (720 bp)===
'''Investigator''': Georg
'''Investigator''': Georg
Line 19,084: Line 19,131:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Minipreparation of pSB1C3_Preprothaumatin and pYes2_Preprothaumatin ===
+
=== Minipreparation of pSB1C3_Preprothaumatin and pTUM104_Preprothaumatin ===
'''Investigator:''' Martin, Alois
'''Investigator:''' Martin, Alois
Line 19,091: Line 19,138:
* pSB1C3_Preprothaumatin: p485-490.
* pSB1C3_Preprothaumatin: p485-490.
-
 
</div>
</div>
Line 19,097: Line 19,143:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Control digest of pYes2_Preprothaumatin ===
+
=== Control digest of pTUM104_Preprothaumatin ===
'''Investigator:''' Martin, Alois
'''Investigator:''' Martin, Alois
Line 19,119: Line 19,165:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Small scale yeast transformation of ''S. cerevisiae'' with pYes2_Preprothaumatin ===
+
=== Small scale yeast transformation of ''S. cerevisiae'' with pTUM104_Preprothaumatin ===
'''Investigator:''' Martin, Alois
'''Investigator:''' Martin, Alois
-
Procedure according to pYes2_manuel_kommentiert:
+
Procedure according to pYes2_manual_kommentiert:
* 2. Determine the OD600 of your overnight culture. Dilute culture to an OD600 of 0.4 in 50 ml of YPD medium, add 5ml 20% glucose and grow an additional 2–4 hours. 3. Pellet (5 min, 4°C) the cells at 2500 rpm and resuspend the pellet in 40 ml 1X TE. 4. Pellet (5 min, 4°C) the cells at 2500 rpm and resuspend the pellet in 2 ml of 1X LiAc/0.5X TE. 5. Incubate the cells at room temperature for 10 minutes. 6. For each transformation, mix together 1 μg plasmid DNA and 100 μg (10 μl) denatured sheared salmon sperm DNA with 100 μl of the yeast suspension from Step 5. 7. Add 700 μl of 1X LiAc/40% PEG-3350/1X TE (7 ml 50% PEG3350 was synthesized (3.5 g in 7 ml bidest.water); 6.4 ml 50% PEG3350 + 800 μl 10x LiAc + 800 μl 10x TE were mixed) and mix well. 8. Incubate solution at 30°C for 30 minutes. 9. Add 88 μl DMSO, mix well, and heat shock at 42°C for 7 minutes. 10. Centrifuge in a microcentrifuge for 10 seconds and remove supernatant. 11. Resuspend the cell pellet in 1 ml 1X TE and re-pellet. 12. Resuspend the cell pellet in 50–100 μl 1X TE and plate on a selective plate (SCU-plates + Glucose). Incubate the SCU-plates at 30°C over the weekend.
* 2. Determine the OD600 of your overnight culture. Dilute culture to an OD600 of 0.4 in 50 ml of YPD medium, add 5ml 20% glucose and grow an additional 2–4 hours. 3. Pellet (5 min, 4°C) the cells at 2500 rpm and resuspend the pellet in 40 ml 1X TE. 4. Pellet (5 min, 4°C) the cells at 2500 rpm and resuspend the pellet in 2 ml of 1X LiAc/0.5X TE. 5. Incubate the cells at room temperature for 10 minutes. 6. For each transformation, mix together 1 μg plasmid DNA and 100 μg (10 μl) denatured sheared salmon sperm DNA with 100 μl of the yeast suspension from Step 5. 7. Add 700 μl of 1X LiAc/40% PEG-3350/1X TE (7 ml 50% PEG3350 was synthesized (3.5 g in 7 ml bidest.water); 6.4 ml 50% PEG3350 + 800 μl 10x LiAc + 800 μl 10x TE were mixed) and mix well. 8. Incubate solution at 30°C for 30 minutes. 9. Add 88 μl DMSO, mix well, and heat shock at 42°C for 7 minutes. 10. Centrifuge in a microcentrifuge for 10 seconds and remove supernatant. 11. Resuspend the cell pellet in 1 ml 1X TE and re-pellet. 12. Resuspend the cell pellet in 50–100 μl 1X TE and plate on a selective plate (SCU-plates + Glucose). Incubate the SCU-plates at 30°C over the weekend.
Line 19,181: Line 19,227:
|ddH2O
|ddH2O
|}
|}
-
 
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 19,215: Line 19,260:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Transform E.coli XL 1 blue with plasmids that were identified as being positive for insert. Furthermore transformation with ligation products of ligation 23.8.
'''Aim:''' Transform E.coli XL 1 blue with plasmids that were identified as being positive for insert. Furthermore transformation with ligation products of ligation 23.8.
Line 19,230: Line 19,274:
5. Ligation product negative control (ligation 23.8.)
5. Ligation product negative control (ligation 23.8.)
-
 
'''Transformation into E.coli Xl1-Blue'''
'''Transformation into E.coli Xl1-Blue'''
Line 19,306: Line 19,349:
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 19,396: Line 19,438:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Miniprep ===
+
=== Miniprep pTUM100, GFP and ADH1-P (720 bp) ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment:''' Miniprep of ???
+
'''Aim of the experiment:''' Miniprep of pTUM100, GFP and ADH1-P (720 bp)
'''Procedure:'''
'''Procedure:'''
Line 19,422: Line 19,464:
*4CL- in pSB1C3 clone 1
*4CL- in pSB1C3 clone 1
*4CL+ in pSB1C3 clone 2
*4CL+ in pSB1C3 clone 2
-
 
*Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4-5 ml of LB-medium and antibiotics (Amp -> pYES, Chlp -> pSB1C3. These tubes were put overnight in a 180rpm cell culture shaker at 37°C.  
*Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4-5 ml of LB-medium and antibiotics (Amp -> pYES, Chlp -> pSB1C3. These tubes were put overnight in a 180rpm cell culture shaker at 37°C.  
Line 19,509: Line 19,550:
'''Aim:'''  
'''Aim:'''  
-
Preparation of pYESnew Y1B, Y2D and Y3A for sequencing.
+
Preparation of pTUM104 Y1B, Y2D and Y3A for sequencing.
-
 
+
'''Plasmidconcentration:''' Nanodroplet
'''Plasmidconcentration:''' Nanodroplet
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
-
|'''pYES2new_caffeine_involved_gene'''
+
|'''pTUM104_caffeine_involved_gene'''
|'''Concentration in ng/µl'''
|'''Concentration in ng/µl'''
|-
|-
Line 19,532: Line 19,572:
<div class="limonene">
<div class="limonene">
-
===Picking of colonies ===
+
===Picking of colonies of PCR2 pTUM104 and PCR58 pTUM104 and of PCR1 pTUM104 and PCR56 pSBC3 ===
'''Investigator:''' Saskia
'''Investigator:''' Saskia
'''Procedure:'''  
'''Procedure:'''  
-
* Picking of 5 clones each of PCR2 pYES and PCR58 pYES and picking of 2 clone each of PCR1 pYES and PCR56 pSBC3
+
* Picking of 5 clones each of PCR2 pTUM104 and PCR58 pTUM104 and picking of 2 clone each of PCR1 pTUM104 and PCR56 pSBC3
* Inbucation at 37°C (shaker) over night.
* Inbucation at 37°C (shaker) over night.
Line 19,543: Line 19,583:
<div class="coumaryl">
<div class="coumaryl">
 +
===Analytical restriction digest and analytical gel electrophoresis===
===Analytical restriction digest and analytical gel electrophoresis===
'''Investigator:''' Saskia and Katrin
'''Investigator:''' Saskia and Katrin
Line 19,626: Line 19,667:
[[File: TUM12_AnalVerdau_4CL_2.jpg]]
[[File: TUM12_AnalVerdau_4CL_2.jpg]]
 +
</div>
</div>
</div>
 +
=Week 12=
 +
<div class="week" id="WWeek_12">
== '''Monday, August 27th''' ==
== '''Monday, August 27th''' ==
Line 19,789: Line 19,833:
1. Inoculate 4 ml of YPD medium with a colony of S. cerevisiae and shake well overnight at '''30 °C'''.
1. Inoculate 4 ml of YPD medium with a colony of S. cerevisiae and shake well overnight at '''30 °C'''.
-
Results: 30 °C and not 37 °C. Redo!
+
'''Results:''' 30 °C and not 37 °C. Redo!
</div>
</div>
Line 19,806: Line 19,850:
* PCR58/pYES (tube 4): 136 ng/µl
* PCR58/pYES (tube 4): 136 ng/µl
* PCR58/pYES (tube 5): 110 ng/µl
* PCR58/pYES (tube 5): 110 ng/µl
-
 
* PCR2/pYES (tube 1): 212 ng/µl
* PCR2/pYES (tube 1): 212 ng/µl
Line 19,813: Line 19,856:
* PCR2/pYES (tube 4): 162 ng/µl
* PCR2/pYES (tube 4): 162 ng/µl
* PCR2/pYES (tube 5): 132 ng/µl
* PCR2/pYES (tube 5): 132 ng/µl
-
 
* PCR1/pYES (tube 1): 112 ng/µl
* PCR1/pYES (tube 1): 112 ng/µl
* PCR1/pYES (tube 2): 104 ng/µl
* PCR1/pYES (tube 2): 104 ng/µl
-
 
* PCR56/p133 (tube 1): 207 ng/µl
* PCR56/p133 (tube 1): 207 ng/µl
* PCR56/p133 (tube 2): 80 ng/µl
* PCR56/p133 (tube 2): 80 ng/µl
-
 
*ColPCR Clone2: 121 ng/µl
*ColPCR Clone2: 121 ng/µl
Line 19,829: Line 19,869:
*ColPCR Clone28: 280 ng/µl
*ColPCR Clone28: 280 ng/µl
*ColPCR Clone32: 146 ng/µl
*ColPCR Clone32: 146 ng/µl
-
 
'''Eppis are stored in a disposal bag (label: Positive Klone, Lara, 27.8.) in the lowest drawer of -20°C.'''
'''Eppis are stored in a disposal bag (label: Positive Klone, Lara, 27.8.) in the lowest drawer of -20°C.'''
Line 19,865: Line 19,904:
|ddH2O
|ddH2O
|}
|}
-
 
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 19,912: Line 19,950:
'''Investigator:''' Saskia
'''Investigator:''' Saskia
-
'''Aim:''' yeast transformation for expression of caffeine-genes (the last one wasn't successful)
+
'''Aim:''' yeast transformation for expression of caffeine-genes  
'''Procedure:'''  
'''Procedure:'''  
Line 19,921: Line 19,959:
== '''Tuesday, August 28th''' ==
== '''Tuesday, August 28th''' ==
 +
<div class="constitutive_promoter">
 +
===Analytical gelelectrophoresis of pTUM100 undigested===
 +
 +
'''Investigator:''' Georg
 +
 +
* Plasmid-DNA of undigested pYES-TUM colonies was applicated on analytical 0,5% Agarosegels
 +
* pYES2 served as control plasmid
 +
* colonies 1-4 and 6-10 showed positive pYES-TUM2 variants
 +
[[File:20120828 pYES2-TUM Kol ungeschnitten (Gel1).png]]
 +
[[File:20120828 pYes2-Tum Kol.png]]
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Analytical digestion of pTUM100===
 +
 +
'''Investigator:''' Georg
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2,75 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|22 µl
 +
|NEB-4 buffer
 +
|-
 +
|167,75 µl
 +
|dd H20
 +
|-
 +
|=192,5µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* to 2,5 ml of DNA 17,5 µl reaction batch were added
 +
* Digestion took place at 37°C for 1 h
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Analytical gelelectrophoresis of pTUM100===
 +
 +
'''Investigator:'''
 +
 +
* Digested pYES2-Tum clones were analyzed on 0,5% Agarose gels
 +
* Clones 1-4 and 6-10 were positive
 +
[[File:20120829 Anal.png]]
 +
[[File:20120829 Gel 2 pYES2-tum.png]]
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Nanodrop for concentration measuring of ADH-P,pTUM100,GFP===
 +
 +
'''Investigator:''' Georg
 +
 +
* ADH-P Kol1: 112,5 ng/µl
 +
* ADH-P Kol2: 105,4 ng/µl
 +
* pYES2-TUM Kol1: 155,7 ng/µl
 +
* pYES2-TUM Kol2: 67,3 ng/µl
 +
* pYES2-TUM Kol3: 124,5 ng/µl
 +
* pYES2-TUM Kol4: 91,5 ng/µl
 +
* pYES2-TUM Kol5: 91,7 ng/µl
 +
* pYES2-TUM Kol6: 122,8 ng/µl
 +
* pYES2-TUM Kol7: 105,9 ng/µl
 +
* pYES2-TUM Kol8: 123,9 ng/µl
 +
* pYES2-TUM Kol9: 129,8 ng/µl
 +
* pYES2-TUM Kol10:136,9 ng/µl
 +
* GFP Kol1: 152,1 ng/µl
 +
* GFP Kol2: 107,5 ng/µl
 +
* GFP Kol3: 53,9 ng/µl
 +
* GFP Kol4: 146,9 ng/µl
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Cycled ligation of P399+P552 ===
=== Cycled ligation of P399+P552 ===
Line 19,974: Line 20,088:
<div class="limonene">
<div class="limonene">
-
===Ligation of PCR57 in pYES and pSB1C3, of PCR 42 in pSB1C3, of PCR 56 in pYES===
+
===Ligation of PCR57 in pTUM104 and pSB1C3, of PCR 42 in pSB1C3, of PCR 56 in pTUM104===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
Line 20,073: Line 20,187:
<div class="limonene">
<div class="limonene">
-
===Transformation (ligation 28.8.)===
+
===Transformation into ''E.coli'' (ligation 28.8.)===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
 
'''Aim:''' Transform E.coli XL 1 blue with ligation products of ligation 28.8.
'''Aim:''' Transform E.coli XL 1 blue with ligation products of ligation 28.8.
Line 20,089: Line 20,202:
4. PCR 56 (digested 7th August) in pYES (P375, digested 23th August)
4. PCR 56 (digested 7th August) in pYES (P375, digested 23th August)
-
 
'''Transformation into E.coli Xl1-Blue'''
'''Transformation into E.coli Xl1-Blue'''
Line 20,103: Line 20,215:
<div class="limonene">
<div class="limonene">
 +
===Colony PCR===
===Colony PCR===
Line 20,110: Line 20,223:
* extension time of PCR reaction was adjusted to the longer PCR product (insert+primers+backbone from primer binding site)
* extension time of PCR reaction was adjusted to the longer PCR product (insert+primers+backbone from primer binding site)
* annealing temperature was adjusted to lowest primer melting temperature
* annealing temperature was adjusted to lowest primer melting temperature
-
 
*'''Citrus''': 8 clones of PCR42/p133 (4 clones transformation of 8.8., 4 clones of 27.7.) were picked.
*'''Citrus''': 8 clones of PCR42/p133 (4 clones transformation of 8.8., 4 clones of 27.7.) were picked.
Line 20,116: Line 20,228:
* positive control: clones PCR2/p133, PCR58/p133, PCR58/pYES
* positive control: clones PCR2/p133, PCR58/p133, PCR58/pYES
* negative controls: ddH2O
* negative controls: ddH2O
-
 
'''Citrus in pYES''' (PCR43/p133)
'''Citrus in pYES''' (PCR43/p133)
Line 20,240: Line 20,351:
35: PCR58/p133
35: PCR58/p133
36: PCR58/pYES
36: PCR58/pYES
-
 
[[File:TUM12_LS_analytcolonyPCR12.png]]
[[File:TUM12_LS_analytcolonyPCR12.png]]
[[File:TUM12_LS_analytcolonyPCR13.png]]
[[File:TUM12_LS_analytcolonyPCR13.png]]
-
 
'''Gelelectrophoresis still needs to be done'''
'''Gelelectrophoresis still needs to be done'''
Line 20,261: Line 20,370:
* 10 ml of resuspended S. cerevisiae were added to 40 ml SCU medium with glucose for reaching OD600 = 0.4
* 10 ml of resuspended S. cerevisiae were added to 40 ml SCU medium with glucose for reaching OD600 = 0.4
* Incubation at 30 °C overnight
* Incubation at 30 °C overnight
 +
</div>
 +
 +
<div class="caffeine">
 +
 +
=== Plasmid isolation of pTUM104_Insert containing over night cultures ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim of the experiment:'''
 +
Isolation of plasmids pTUM104_CaXMT1, pTUM104_CaMXMT1 and pTUM104_CaDXMT1 to be able to repeat yeast transformation
 +
 +
'''Operational sequence:'''
 +
Plasmid isolation was performed with the Quiagen Miniprep Kit as described in the manufacturers protocoll. Three over night cultures of each plasmid had been prepared on the day before. They had been established of three colonies of each plate, named Y1E-G, Y2E-G and Y3E-G.
 +
Elution was made with 40µl elution buffer, heated up to 37°C and 1 minute incubation before the final centrifugation step.
 +
 +
'''Concentrations:'''
 +
Concentration was measured with NanoDrop:
 +
* Y1E: 230,7 ng/µl
 +
* Y1F: 164,5 ng/µl
 +
* Y1G: 290,6 ng/µl
 +
 +
* Y2E: 181,2 ng/µl
 +
* Y2F: 91,8 ng/µl
 +
* Y2G: 191,0 ng/µl
 +
 +
* Y3E: 98,9 ng/µl
 +
* Y3F: 181,5 ng/µl
 +
* Y3G: 157,1 ng/µl
</div>
</div>
 +
<div class="caffeine">
 +
 +
=== Control digest of isolated pTUM104_Insert plasmids with Xba1 and Pst1-HF ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim of the experiment:'''
 +
Test of isolated plasmids, wether they are containing the right inserts (CaXMT1, CaMXMT1 and CaDXMT1).
 +
 +
'''Operational sequence:'''
 +
 +
Reaction batch:
 +
 +
{|cellspacing="0" border="1"
 +
|'''reagent'''
 +
|'''volume'''
 +
|-
 +
|Plasmid template
 +
|5µl
 +
|-
 +
|Buffer NEB 4
 +
|2µl
 +
|-
 +
|BSA 100x
 +
|0,2µl
 +
|-
 +
|RE Xba1
 +
|0,25µl
 +
|-
 +
|RE Pst1-HF
 +
|0,25µl
 +
|-
 +
|ddH2O
 +
|12,3
 +
|-
 +
|'''TOTAL'''
 +
|20µl
 +
|}
 +
 +
The reaction batch was incubated at 37°C for about 1,5 h, beeing followed by an analytical gel electrophoresis.
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Analytical gelelectrophoresis of digested plasmids ===
 +
 +
'''Investigator: Roman'''
 +
 +
'''Aim of the experiment:'''
 +
Proof of the expected inserts
 +
 +
'''Operational sequence:'''
 +
The whole amount of the reaction batch (restriction digest, 20µl, see above) was load on gel after having mixed the samples with 2 µl of 10x loading dye.
 +
 +
Expected lengths of the inserts: ca. 1200bp (all three genes have almost the same length).
 +
 +
[[File:TUM12_20120828KontrollverdauY1-3,E-G.jpg|500px]]
 +
 +
'''From left to right:'''
 +
 +
{|cellspacing="0" border="1"
 +
|DNA Ladder
 +
|Y1E Xba1/Pst1
 +
|Y1F Xba1/Pst1
 +
|Y1G Xba1/Pst1
 +
|Y2E Xba1/Pst1
 +
|Y2F Xba1/Pst1
 +
|Y2G Xba1/Pst1
 +
|Y3E Xba1/Pst1
 +
|Y3F Xba1/Pst1
 +
|Y3G Xba1/Pst1
 +
|DNA Ladder
 +
|}
 +
 +
'''Result:'''
 +
All the newly picked colonies show the right, expected insert. Clones Y1G, Y2G and Y3G will be used for the repetition of the yeast transformation.
 +
 +
</div>
 +
 +
<div class="caffeine">
 +
 +
=== Repetition of yeast transformation ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim of the experiment:'''
 +
Transformation of yeast cells (INVSCN1) with the plasmids pTUM104_CaXMT1, pTUM104_CaMXMT1 and pTUM104_CaDXMT1, as well as pTUM104_eGFP (positive controll).
 +
 +
'''Operational sequence:'''
 +
 +
The yeast transformation was performed as described in the pYES2 manual of Invitrogen (see small scale yeast transformation), using an over night culture of INVSC1- yeast cells. The solutions 1xTE and 1xLiAc/40% PEG 3350/1xTE were made immediately before use.
 +
 +
* 1xTE:
 +
5µl of 10x TE were mixed with 45µl ddH2O and sterile filtrated.
 +
 +
* 1xLiAc/40% PEG 3350/1xTE
 +
At first, 3,5g PEG 3350 were dissolved in 7ml of bidestillated water, resulting in a 50% PEG solution. 6,4ml of this 50% PEG solution were mixed with 800µl 10xTE and 800µl 10x LiAc and sterile filtrated.
 +
 +
Used amount of vector DNA:
 +
* Y1G (p554): 4µl (ca. 1,1µg)
 +
* Y2G (p555): 6µl (ca. 1,1µg)
 +
* Y3G (p556): 6,5µl (ca. 1µg)
 +
* eGFP: 5 µl (ca. 1µg)
 +
 +
Negative controll: water used
 +
 +
At last, the cells were plated on appropriate agar- plates with SC -Ura medium and incubated at 30°C for the next three days. Colonies should be visible on friday.
 +
 +
</div>
 +
 +
<div class ="limonene">
 +
 +
=== Yeast transformation with p542 and p549 ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim of the experiment:'''
 +
Transformation of yeast cells (INVSC1) with the plasmids p542 and p549
 +
 +
'''Operational sequence:'''
 +
 +
The yeast transformation was performed as described in the pYES2 manual of Invitrogen (see small scale yeast transformation), using an over night culture of INVSC1- yeast cells. The solutions 1xTE and 1xLiAc/40% PEG 3350/1xTE were made immediately before use.
 +
 +
* 1xTE:
 +
5µl of 10x TE were mixed with 45µl ddH2O and sterile filtrated.
 +
 +
* 1xLiAc/40% PEG 3350/1xTE
 +
At first, 3,5g PEG 3350 were dissolved in 7ml of bidestillated water, resulting in a 50% PEG solution. 6,4ml of this 50% PEG solution were mixed with 800µl 10xTE and 800µl 10x LiAc and sterile filtrated.
 +
 +
Used amount of vector DNA:
 +
* p542: 5µl
 +
* p549: 13µl
 +
 +
Positive controll: eGFP (see caffeine group)
 +
Negative controll: water used
 +
 +
At last, the cells were plated on appropriate agar- plates with SC -Ura medium and incubated at 30°C for the next three days. Colonies should be visible on friday.
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Preparation of over night cultures for yeast expression ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim of the experiment:'''
 +
Expression of enzymes CaXMT1, CaMXMT1 and Protein eGFP in yeast.
 +
 +
'''Operational sequence:'''
 +
 +
To express the gene products, a single yeast colonie (transformation was performed on last wednesday) of each plate was used for inoculation of 15ml  SC -URA 2% glucose medium. However, there was no colony of a pTUM104_CaDXMT1 transformant (repetition of transformation is already in progress). Incubation was performed at 30°C over night and 180 rpm.
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Preparation of over night cultures of positive sequenced clones B1B, B2A and B3D for plasmid isolation and stock generation ===
 +
 +
'''Investigator:''' Dennis
 +
 +
'''Aim of the experiment:'''
 +
The sequencing of the named clones was positive. Thus, a small amount (has been stored in the fridge for a few days, i.e. a rest of the last over night culture) of each clone was used for inoculation of 8ml LB medium containing chloramphenicol (8µl). Incubation was performed at 37°C over night at 180 rpm.
 +
 +
</div>
== '''Wednesday, August 29th''' ==
== '''Wednesday, August 29th''' ==
 +
<div class="constitutive_promoter">
 +
=== Preparative digestion of GFP (P567), Limonesynthase (P509), ADH-P (720 bp) (P565)===
 +
'''Investigator''': Georg
-
<div class="limonene">
+
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|3 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|3 µl 
 +
|XbaI (NEB)
 +
|-
 +
|6 µl
 +
|NEB-4 buffer
 +
|-
 +
|0,6 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|47,4 µl
 +
|dd H20
 +
|-
 +
|=60 µl
 +
|'''TOTAL'''
 +
|}
 +
* To 20 µl reaction batch 20 µl of plasmid with insert were added
 +
* Digestion was performed at 37C for 3 hours
 +
[[File:20120829 Präp. Verdau ADH1-P (720bp), Limonensyn.png]]
 +
</div>
 +
<div class="constitutive_promoter">
 +
 +
=== Ligation of TEF2-P in psb1c3 with Thaumatin P467 ===
 +
 +
'''Investigator:''' Georg
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|0,54 µl (=100 ng)
 +
|P492
 +
|-
 +
|4,46 µl
 +
|P467
 +
|-
 +
|1
 +
|10x T4-ligase buffer
 +
|-
 +
|3,5 µl
 +
|dd H20
 +
|-
 +
|=10µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Ligation was performed for 1h at room temperature
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Ligation of TEF1-P in psb1c3 with Thaumatin P467 ===
 +
 +
'''Investigator:''' Georg
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|0,87 µl (=100 ng)
 +
|P493
 +
|-
 +
|4,93 µl
 +
|P467
 +
|-
 +
|1
 +
|10x T4-ligase buffer
 +
|-
 +
|2,7 µl
 +
|dd H20
 +
|-
 +
|=10µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Ligation was performed for 1h at room temperature
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Ligation of ADH1-P in psb1c3 with Thaumatin P467 ===
 +
 +
'''Investigator:''' Georg
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|2,25 µl (=100 ng)
 +
|P494
 +
|-
 +
|4,45 µl
 +
|P467
 +
|-
 +
|1
 +
|10x T4-ligase buffer
 +
|-
 +
|1,8 µl
 +
|dd H20
 +
|-
 +
|=10µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Ligation was performed for 1h at room temperature
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Ligation of psb1c3 P132 with Thaumatin P467 ===
 +
 +
'''Investigator:''' Georg
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|1,49 µl
 +
|P132
 +
|-
 +
|6,51 µl
 +
|P467
 +
|-
 +
|1
 +
|10x T4-ligase buffer
 +
|-
 +
|1,8 µl
 +
|dd H20
 +
|-
 +
|=10µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Ligation was performed for 1h at room temperature
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Ligation of Cyc1-T (P130) in psb1c3 (P132)===
 +
 +
'''Investigator:''' Georg
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|6,51 µl
 +
|P130
 +
|-
 +
|1,49 µl
 +
|P132
 +
|-
 +
|1
 +
|10x T4-ligase buffer
 +
|-
 +
|0,5 µl
 +
|dd H20
 +
|-
 +
|=10µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Ligation was performed for 1h at room temperature
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Ligation of TEF1-T in psb1c3 P132 ===
 +
 +
'''Investigator:''' Georg
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|1,49 µl
 +
|P132
 +
|-
 +
|4,51 µl
 +
|PCR62
 +
|-
 +
|1
 +
|10x T4-ligase buffer
 +
|-
 +
|2,5 µl
 +
|dd H20
 +
|-
 +
|=10µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Ligation was performed for 1h at room temperature
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Gelextraction of digested (Xba+PST-HF) ADH-P, GFP, Limonens. and psb1c3 (P577)===
 +
 +
'''Investigator:''' Georg
 +
'''Procedure:'''
 +
* Gelextraction was performed according to Quiaquick extraction protocoll
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Transformation of ''E.coli'' Xl1-blue with ligation batch (1h) psb1c3 with Thaumatin, Cyc1-T, TEF1-T and Thaumatin with P492,P493 and P494 ===
 +
 +
'''Investigator:''' Georg
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 10 µl of ligation product (P265B) was added to 100 µl of competent cells and gently mixed.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on Chloramphenicole plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin plates.
 +
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
=== Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation product P399+P552 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation products P399+P552 for the construction of N'-SV40NLS-PhyB(908NT)-20aaLinker-Gal4DBD-C'.
 +
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 5&nbsp;µl of the ligation products (P399+P552) and it's negative control (P399 NK) were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice.
 +
 +
* 30&nbsp;min incubation on ice.
 +
 +
* 5&nbsp;min heat shock at 37&nbsp;°C
 +
 +
* Adding of 1&nbsp;ml LB-medium to each tube.
 +
 +
* Incubation for 45&nbsp;min at 37&nbsp;°C in the 180&nbsp;rpm cell-culture shaker.
 +
 +
* 100&nbsp;µl of those cell suspension were plated on chloramphenicol plates.
 +
 +
* The rest were centrifuged for 1&nbsp;min at 13000&nbsp;rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100&nbsp;µl of LB-medium and these concentrated cell suspensions was plated again on new chloramphenicol plates.
 +
 +
* Incubation at 37&nbsp;°C overnight.
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
=== Preperative digestion and gelelectrophoresis of P473 and p556 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Preperative digestion and gelelectrophoresis of P473 and p556
 +
 +
'''Procedure:'''
 +
 +
* Reaction batch for preperative digestion of P473 with XbaI+PstI-HF
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|P473
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer 4 (10x)
 +
|-
 +
|0.4&nbsp;µl
 +
|BSA (100x)
 +
|-
 +
|1&nbsp;µl
 +
|XbaI (20&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|13.6&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for preperative digestion of P556 with XbaI+PstI-HF
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|P556
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer 4 (10x)
 +
|-
 +
|0.4&nbsp;µl
 +
|BSA (100x)
 +
|-
 +
|1&nbsp;µl
 +
|XbaI (20&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|13.6&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Preperative digestion was performed for 2.5&nbsp;h at 37&nbsp;°C.
 +
 +
* 4.44&nbsp;µl of DNA loading buffer (10x) was added to the digestion mix after incubation time.
 +
 +
* Preperative gelelectrophoresis was perforemd at 70&nbsp;V for 1.5&nbsp;h.
 +
 +
{|cellspacing="0" border="1"
 +
|100&nbsp;bp DNA ladder
 +
|P473 (XbaI+PstI-HF)
 +
|P556 (XbaI+PstI-HF)
 +
|1&nbsp;kbp DNA ladder
 +
|-
 +
|
 +
|Digested Backbone (lower band!) was cut out
 +
|Digested Backbone pYESnew without promoter was cut out
 +
|
 +
|}
 +
 +
[[File:TUM12_20120829_prep_gel_P473_P556.jpg|500px]]
 +
 +
* The gel oucuts were undergone a gel extraction with the gel extraction kit from Qiagen.
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
=== Cycled ligation of P571+PCR72 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Cycled ligation was performed for P571+PCR72 and it's negative control P571 NK.
 +
 +
'''Procedure:'''
 +
 +
* Ligation batch for P571+PCR72
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2.54&nbsp;µl
 +
|P571 (39.3&nbsp;ng/µl, 2048&nbsp;bp)
 +
|-
 +
|5.19&nbsp;µl
 +
|PCR72 (23.2&nbsp;ng/µl, 825&nbsp;bp)
 +
|-
 +
|2&nbsp;µl
 +
|T4 ligase buffer (10x)
 +
|-
 +
|1&nbsp;µl
 +
|T4 ligase (1&nbsp;U/µl)
 +
|-
 +
|9.27&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=20&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Cycled ligation has been performed after following protocol in a thermocycler:
 +
{|cellspacing="0" border="1"
 +
|100 cycles
 +
|12&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|
 +
|22&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|Hold
 +
|16&nbsp;°C
 +
|infinite
 +
|}
 +
 +
Lid temperature&nbsp;=&nbsp;37&nbsp;°C
 +
</div>
 +
 +
<div class="limonene">
===Transformation of ''E. Coli'' with ligation products ===
===Transformation of ''E. Coli'' with ligation products ===
Line 20,281: Line 21,011:
3. PCR 42 (digested 7th August) in pSB1C3 (P133)
3. PCR 42 (digested 7th August) in pSB1C3 (P133)
-
 
-
 
Transformation into E.coli Xl1-Blue
Transformation into E.coli Xl1-Blue
Line 20,295: Line 21,023:
</div>
</div>
 +
<div class="thaumatin">
 +
=== Small Scale Yeast Transformation - Preparatory culture ===
 +
'''Investigator:''' Martin, Alois
 +
'''Aim:''' Preculture of ''S. cerevisiae'' according to pYes2_manuel_kommentiert.
 +
1. Inoculate 4 ml of YPD medium with a colony of S. cerevisiae and shake well overnight at '''30 °C'''.
 +
 +
'''Results:'''
</div>
</div>
 +
 +
<div class="limonene">
 +
===Preparation of cells for protein expression in yeast ===
 +
'''Investigator:''' Andrea
 +
 +
'''Aim of the experiment:'''Transfer of a certain amount of transformed Saccharomyces cerevisiae cells from yesterday to new medium with galactose for protein expression in yeast
 +
 +
* Measurement: OD600 = 1.9 (used OD600 = 0.4)
 +
* 10.5 ml of resuspended S. cerevisiae were added to 39.5 ml SCU medium with galactose for reaching OD600 = 0.4
 +
* Incubation at 30 °C overnight
 +
</div>
 +
 +
<div class="limonene">
 +
===Picking of colonies ===
 +
 +
'''Investigator:''' Andrea
 +
 +
'''Procedure:'''
 +
* Picking of 6 clones each of PCR56 pYES and PCR57 pYES (transformation 28th August)
 +
* Inbucation at 37°C (shaker) over night.
 +
 +
</div>
 +
 +
<div class="integration">
 +
 +
===Picking of Integrationvector_mOrange===
 +
 +
'''Investigator:''' Martin
 +
 +
'''Aim:'''To gain a stock of plasmids in order to integrate biobricks into yeast genome
 +
 +
'''Procedure:''' Pick a clone from the plate, put it into 7 ml LB-medium (7 µl Ampicillin added) and incubate over night.
 +
 +
</div>
 +
 +
<div class="limonene">
 +
===Sequencing===
 +
 +
'''Investigator:''' Lara
 +
 +
'''Aim:''' Repetition of sequencing to check whether insert is wrong. This time, p546 (PCR56/p133)and p512 (PCR58/p133) were sequenced. Furthermore, p550 (PCR58/pYES) was sequenced.
 +
 +
*p133: Primer VF2
 +
*pYES: Primer T7
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Yeast expression Part 1 ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim:'''
 +
Induction of protein expression of CaXMT1, CaMXMT1 and eGFP
 +
 +
'''Operational sequence:'''
 +
 +
At first, the OD600 of the over night cultures were measured:
 +
 +
* CaXMT1: 4,4/ml
 +
* CaMXMT1: 3,9/ml
 +
* eGFP: 4,5/ml
 +
(1/10 dilutions have been prepared for measurment)
 +
 +
To obtain an OD of 0,4/ml in 50ml of SC -URA 2% gal medium, 4,5ml, 3,9ml and 4,5ml of the over night cultures were centrifuged at 1500xg for minutes at 4°C. Afterwards, the pellet was resuspended in 2ml SC -URA 2% gal. The suspension was then given to 48ml SC -URA 2% gal medium, followed by incubation at 180rpm and 30°C.
 +
 +
Afterwards, 5ml samples were taken of each culture after incubation times of 20min, 140 min and 320 min. The samples were first stored in the fridge and then centrifuged at 1500xg and 4°C for 5 minutes. After washing with 500µl sterile water, the pellet was stored at -80°C until further usage (cell lysis). Furthermore, the OD600 was measured:
 +
 +
After 20 min:
 +
* CaXMT1: 0,41
 +
* CaMXMT1: 0,40
 +
* eGFP: 0,42
 +
 +
After 140 min:
 +
* CaXMT1: 0,43
 +
* CaMXMT1: 0,42
 +
* eGFP: 0,45
 +
 +
After 320 min:
 +
* CaXMT1: 0,5
 +
* CaMXMT1: 0,45
 +
* eGFP: 0,5
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Preparation of glycerol stocks of positive sequenced pSB1C3_Insert clones ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Operational sequence:'''
 +
750µl of each of the three over night cultures with pSB1C3_CaXMT1 (clone B1B), pSB1C3_CaMXMT1 (clone B2A) and pSB1C3 (clone B3D) were mixed with 250µl glycerol and stored at -80°C (in the box of the competent XL1-blue cells).
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Sequencing of newly prepared pTUM104_RFC25_Insert plasmids (clones: Y1G, Y2G, Y3G) ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim:''' Proof of inserted sequence (former sequencing failed)
 +
 +
'''Results:'''
 +
 +
* pTUM104_CaXMT1 with T7 primer
 +
GCCGCTTCTAGAGTACACAATGTCTTTACAAGAAGTCTTGAGAATGAACGGTGGTGAAGGTGATACTTCTTACGCTAAAA
 +
ACTCCGCCTACAATCAATTGGTTTTGGCTAAAGTTAAGCCAGTCTTGGAACAATGCGTCAGAGAATTATTGAGAGCTAAC
 +
TTGCCAAACATCAACAAGTGCATTAAGGTTGCTGATTTGGGTTGTGCTTCTGGTCCAAATACTTTGTTGACTGTTAGAGA
 +
CATCGTCCAATCCATTGATAAGGTTGGTCAAGAAAAGAAGAACGAATTGGAAAGACCAACCATCCAAATTTTCTTGAACG
 +
ACTTGTTCCCAAACGACTTCAACTCTGTTTTTAAGTTGTTGCCATCCTTCTACAGAAAGTTGGAAAAAGAAAACGGTAGA
 +
AAGATCGGTTCCTGTTTGATTGGTGCTATGCCAGGTTCTTTCTACTCCAGATTATTTCCTGAAGAATCCATGCATTTCTT
 +
GCACTCTTGTTATTGCTTGCAATGGTTGTCTCAAGTTCCATCTGGTTTGGTTACTGAATTGGGTATTTCTACCAACAAGG
 +
GTTCCATCTACTCTTCTAAAGCTTCAAGATTGCCAGTTCAAAAGGCCTACTTGGATCAATTCACTAAGGATTTCACCACC
 +
TTTTTGAGAATCCACTCCGAAGAATTATTCTCCCACGGTAGAATGTTGTTGACCTGTATATGTAAGGGTGTTGAATTGGA
 +
TGCTAGAAACGCCATTGATTTGTTGGAAATGGCTATCAACGATTTGGTTGTTGAAGGTCACTTAGAAGAAGAAAAGTTGG
 +
ACTCTTTCAACTTGCCAGTTTACATTCCATCTGCCGAAGAAGTTAAGTGCATCGTTGAAGAAGAAGGTTCCTTCGAAATC
 +
TTGTACTTGGAAACTTTCAAGGTCTTGTACGATGCCGGTTTCTCTATTGATGATGAACATATTAAGGCCGAATACGTTGC
 +
CTCTTCTGTTAGAGCTGTTTACGAACCTATTTTGGCTTCTCATTTCGGTGAAGCC
 +
 +
* pTUM104_CaXMT1 with reversed primer
 +
GCGTGATGTAGCGTGACATAACTAATTACATGATGCGGCCCTCTAGTCTGCAGCGGCCGCTACTAGTATCATCACTTTTC
 +
GAATTGTGGATGTGACCAAGCAGAAACATCAGACTTTTCTGGCTTTTTGGCCAAGGAGATGATCAAGTTGTTGTAAAAAC
 +
CTTTACCCAATGGCAAAACCTTAGCAGCGTGCTTAGCAAATCTATGAAAGATATCTGGGATAATGGCTTCACCGAAATGA
 +
GAAGCCAAAATAGGTTCGTAAACAGCTCTAACAGAAGAGGCAACGTATTCGGCCTTAATATGTTCATCATCAATAGAGAA
 +
ACCGGCATCGTACAAGACCTTGAAAGTTTCCAAGTACAAGATTTCGAAGGAACCTTCTTCTTCAACGATGCACTTAACTT
 +
CTTCGGCAGATGGAATGTAAACTGGCAAGTTGAAAGAGTCCAACTTTTCTTCTTCTAAGTGACCTTCAACAACCAAATCG
 +
TTGATAGCCATTTCCAACAAATCAATGGCGTTTCTAGCATCCAATTCAACACCCTTACATATACAGGTCAACAACATTCT
 +
ACCGTGGGAGAATAATTCTTCGGAGTGGATTCTCAAAAAGGTGGTGAAATCCTTAGTGAATTGATCCAAGTAGGCCTTTT
 +
GAACTGGCAATCTTGAAGCTTTAGAAGAGTAGATGGAACCCTTGTTGGTAGAAATACCCAATTCAGTAACCAAACCAGAT
 +
GGAACTTGAGACAACCATTGCAAGCAATAACAAGAGTGCAAGAAATGCATGGATTCTTCAGGAAATAATCTGGAGTAGAA
 +
AGAACCTGGCATAGCACCAATCAAACAGGAACCGATCTTTCTACCGTTTTCTTTTTCCAACTTTCTGTAGAAGAT
 +
 +
* pTUM104_CaMXMT1 with T7 primer
 +
GCGCTTCTAGAGTACACAATGTCTTTACAAGAAGTCTTGCACATGAACGAAGGTGAAGGTGATACTTCTTACGCTAAGAA
 +
TGCTTCTTACAACTTGGCTTTGGCTAAGGTTAAGCCATTCTTGGAACAATGCATCAGAGAATTATTGAGAGCCAACTTGC
 +
CAAACATCAACAAGTGTATTAAGGTTGCTGATTTGGGTTGTGCTTCTGGTCCAAATACTTTGTTGACTGTTAGAGACATC
 +
GTCCAATCCATTGATAAGGTTGGTCAAGAAGAAAAGAACGAATTGGAAAGACCAACCATCCAAATTTTCTTGAACGACTT
 +
GTTCCAAAACGACTTCAACTCCGTTTTTAAGTTGTTGCCATCCTTCTACAGAAAGTTGGAAAAAGAAAACGGTAGAAAGA
 +
TCGGTTCCTGCTTGATTTCTGCTATGCCAGGTTCTTTTTACGGTAGATTATTCCCTGAAGAATCCATGCATTTCTTGCAC
 +
TCTTGTTACTCTGTTCACTGGTTGTCTCAAGTTCCATCTGGTTTGGTTATTGAATTGGGTATTGGTGCTAACAAGGGTTC
 +
CATCTATTCTTCTAAAGGTTGTAGACCACCAGTTCAAAAGGCTTACTTGGATCAATTCACTAAGGACTTCACCACTTTCT
 +
TGAGAATCCACTCCAAAGAATTATTCTCCAGAGGTAGAATGTTGTTGACCTGTATCTGTAAGGTTGACGAATTTGATGAA
 +
CCTAACCCATTGGATTTGTTGGATATGGCCATTAACGATTTGATCGTCGAAGGTTTGTTGGAAGAAGAAAAGTTGGACTC
 +
CTTCAACATTCCATTCTTTACTCCATCTGCCGAAGAAGTTAAGTGCATCGTTGAAGAAGACGTTCTTGCGAAATCTTGTA
 +
CTTGGAAACTTTCAAGGCTCATTACGATGCTGCCTTCTCTATTGATGATGATTACCCAGTTAGATCCCACGAACAAATCA
 +
AGCTGAT
 +
 +
* pTUM104_CaMXMT1 with reversed primer
 +
CGTGATGTAGCGTGACATAACTAATTACATGATGCGGCCCTCTAGTCTGCAGCGGCCGCTACTAGTATCATCACTTTTCG
 +
AATTGTGGATGTGACCAAGCAGAAACATCAGACTTTTCTGGCTTTTTGGCCAAGGAGATAATCAAGTTGTTGTAACAACC
 +
CTTACCCATGTGTAAAACCTTAGCAGCATGTTTAGCCAATCTGTGAAACAAATCTGGCATAATAGCTTCACCGAAATGAG
 +
AGGCCAAAATAGGTTCGTAAACAGATCTGATCAAGGAGGCAACGTATTCAGCTTTGATTTGTTCGTGGGATCTAACTGGG
 +
TAATCATCATCAATAGAGAAGGCAGCATCGTAATGAGCCTTGAAAGTTTCCAAGTACAAGATTTCGCAAGAACCTTCTTC
 +
TTCAACGATGCACTTAACTTCTTCGGCAGATGGAGTAAAGAATGGAATGTTGAAGGAGTCCAACTTTTCTTCTTCCAACA
 +
AACCTTCGACGATCAAATCGTTAATGGCCATATCCAACAAATCCAATGGGTTAGGTTCATCAAATTCGTCAACCTTACAG
 +
ATACAGGTCAACAACATTCTACCTCTGGAGAATAATTCTTTGGAGTGGATTCTCAAGAAAGTGGTGAAGTCCTTAGTGAA
 +
TTGATCCAAGTAAGCCTTTTGAACTGGTGGTCTACAACCTTTAGAAGAATAGATGGAACCCTTGTTAGCACCAATACCCA
 +
ATTCAATAACCAAACCAGATGGAACTTGAGACAACCAGTGAACAGAGTAACAAGAGTGCAAGAAATGCATGGATTCTTCA
 +
GGGAATAATCTACCGTAAAAAGAACCTGGCATAGCAGAATCAAGCAGGAACCGATCTTTCTACCGTTTTCTTTTTCCAAC
 +
TTTCTGTAGAAGGATGGCAACAACTTAAAAACGGAGTTGAAGTCGTTTTGGACAAGTCGTTCAGAAAATTTGGATGGTTG
 +
GTCTTTCCATTCGTTCTTTCTTCTTGACCAACCTTA
 +
 +
* pTUM104_CaDXMT1 with T7 primer
 +
CGGCCGCTTCTAGAGTACACAATGTCTTTACAAGAAGTCTTGCATATGAACGGTGGTGAAGGTGATACTTCTTACGCTAA
 +
GAACTCTTTCTACAACTTGTTCTTGATCAGAGTCAAGCCAATCTTGGAACAATGCATCCAAGAATTATTGAGAGCCAACT
 +
TGCCAAACATCAACAAGTGTATTAAGGTTGCTGATTTGGGTTGTGCTTCTGGTCCAAATACTTTGTTGACTGTTAGAGAC
 +
ATCGTCCAATCCATTGATAAGGTTGGTCAAGAAAAGAAGAACGAATTGGAAAGACCAACCATCCAAATTTTCTTGAACGA
 +
CTTGTTCCAAAACGACTTCAACTCCGTTTTTAAGTCCTTGCCATCCTTCTACAGAAAGTTGGAAAAAGAAAACGGTAGAA
 +
AGATCGGTTCCTGTTTGATTGGTGCTATGCCAGGTTCTTTTTACGGTAGATTATTCCCTGAAGAATCCATGCATTTCTTG
 +
CATTCTTGTTACTGCTTGCACTGGTTGTCTCAAGTTCCATCTGGTTTGGTTACTGAATTGGGTATTTCTGCTAACAAGGG
 +
TTGCATCTACTCTTCTAAAGCTTCAAGACCACCAATTCAAAAGGCCTACTTGGATCAATTCACTAAGGATTTCACCACTT
 +
TCTTGAGAATCCACTCCGAAGAATTGATCAGTAGAGGTAGAATGTTGTTGACCTGGATCTGCAAAGAAGATGAATTTGAA
 +
AACCCAAACTCCATCGATTTGTTGGAAATGTCCATCAACGATTTGGTTATCGAAGGTCACTTAGAAGAAGAAAAGTTGGA
 +
CTCTTTCAACGTTCCAATCTATGCTCCATCTACCGAAGAAGTTAAGTGCATCGTTGAAGAAGAAGGTTCCTTCGAAATCT
 +
TGTACTTGGAAACCTTTAAAGTTCCATACGATGCCGGTTTCTCTATCGATGATGATTATCAAGGTAGATCCCACTCTCCA
 +
GTTTCTTGTGATGAACATGCTAGAGCTGCTCATGTTGCTTCAGTTGTAGAT
 +
 +
* pTUM104_CaDXMT1 with reversed primer
 +
CGTGATGTAGCGTGACATAACTAATTACATGATGCGGCCCTCTAGTCTGCAGCGGCCGCTACTAGTATCATCACTTTTCG
 +
AATTGTGGATGTGACCAAGCAGAAACATCGGACTTTTCTGGCTTTTTGGCCAAGGAAATAATCAAGGAGTCGTAAAAACC
 +
CTTACCAGATCTCAAAACCTTGGCAGCATTCTTAGCAATTCTATGGGACAAATCTGGCATAATAGCTTCACCGAAATGAG
 +
AGGCAACGATAGGTTCGAAAATAGATCTAACAACTGAAGCAACATGAGCAGCTCTAGCATGTTCATCACAAGAAACTGGA
 +
GAGTGGGATCTACCTTGATAATCATCATCGATAGAGAAACCGGCATCGTATGGAACCTTAAAGGTTTCCAAGTACAAGAT
 +
TTCGAAGGAACCTTCTTCTTCAACGATGCACTTAACTTCTTCGGTAGATGGAGCATAGATTGGAACGTTGAAAGAGTCCA
 +
ACTTTTCTTCTTCTAAGTGACCTTCGATAACCAAATCGTTGATGGACATTTCCAACAAATCGATGGAGTTTGGGTTTTCA
 +
AATTCATCTTCTTTGCAGATCCAGGTCAACAACATTCTACCTCTACTGATCAATTCTTCGGAGTGGATTCTCAAGAAAGT
 +
GGTGAAATCCTTAGTGAATTGATCCAAGTAGGCCTTTTGAATTGGTGGTCTTGAAGCTTTAGAAGAGTAGATGCAACCCT
 +
TGTTAGCAGAAATACCCAATTCAGTAACCAAACCAGATGGAACTTGAGACAACCAGTGCAAGCAGTAACAAGAATGCAAG
 +
AAATGCATGGATTCTTCAGGGAATAATCTACCGTAAAAAGAACCTGGCATAGCACCAATCAAACAGGAACCGATCTTTCT
 +
ACCGTTTTCTTTTTCCAACTTTCTGTAGAAGGATGGCAAGGACTTAAAAACGGAGTTGAAGTCGTTTTGGAACAGTCGTT
 +
CAGAAAATTTGGATGGTTGGTCTTTCCAATTCGTTCTTCTTTCTTGACCACCTTATCAATGGATTGGACGATGTCTCTAA
 +
C
 +
 +
'''Conclusion:'''
 +
 +
The sequencing has worked and the sequences are right. These clones will be used for the further experiments (yeast transformation, expression, etc.)
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Miniprep of B2A,B1B,B3D===
 +
 +
'''Investigator:''' Dennis
 +
 +
'''Aim:''' Miniprep of over night cultures with number B2A, B1B, B3D (clones were isolated of overnightculture, 5ml LB-medium with CHLP).
 +
 +
The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 40 µl of elution buffer (Kit) at room temperature, with the columns having been incubated 5 minutes at room temperature before the final centrifugation.
 +
'''Miniprep products are stored in a 50 ml Falcon tube in the lowest drawer at -20°C '''
 +
 +
</div>
 +
 +
<div class="Caffeine">
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Preperative digestion of B2A, B1B, B3D ===
 +
 +
'''Investigator:''' Dennis
 +
 +
'''Aim of the experiment:''' digestion of pSB1C3_CaXMT1 (clone B1B), pSB1C3_CaMXMT1 (clone B2A) and pSB1C3 (clone B3D)
 +
'''Procedure:'''
 +
 +
* Reaction batch:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|40&nbsp;µl
 +
|B1B, B2A, B3D
 +
|-
 +
|5&nbsp;µl
 +
|NEBuffer&nbsp;4 (10x)
 +
|-
 +
|0.5&nbsp;µl
 +
|BSA (100x)
 +
|-
 +
|1&nbsp;µl
 +
|XbaI (20&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|2,5&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=50&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
===Preperative Gelelectrophoresis of pSB1C3_CaMXMT1===
 +
 +
'''Investigator:''' Dennis
 +
 +
* 4.44&nbsp;µl of DNA loading buffer (10x) was added to the digestion mix after incubation time.
 +
 +
* Preperative gelelectrophoresis was perforemd at 90&nbsp;V for 1&nbsp;h.
 +
 +
{|cellspacing="0" border="1"
 +
|1&nbsp;kbp DNA ladder
 +
|pSB1C3_CaMXMT1 (clone B2A)
 +
|pSB1C3_CaMXMT1 (clone B1B)
 +
 +
|}
 +
[[File:20120829 präpGelB2A B1B Dennis.JPG|500px]]
 +
 +
* Digested Inserts B1B, B2A was cut out (lower band!- ca1200bp)
 +
 +
{|cellspacing="0" border="1"
 +
|1&nbsp;kbp DNA ladder
 +
|pSB1C3_CaMXMT1 (clone B3D)
 +
|}
 +
[[File:20120829 präpGelC Dennis.jpg|500px]]
 +
 +
* Digested Insert B2D was cut out (lower band!- ca1200bp)
 +
 +
</div>
 +
 +
<div class="caffein">
 +
 +
<div class="caffeine">
 +
 +
===Gelextraction ===
 +
 +
'''Investigator''':Dennis
 +
 +
* Gelextraction of B2A, B1B, B3D was performed according to Quiaquick gel extraction protocol
 +
* following concentrations were detected by Nanodrop:
 +
* B2A ==> 13,6 ng/µl
 +
* B1B ==> 12,8 ng/µl
 +
* B2D ==> 8,4 ng/µl
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Cycled ligation of P492+B2A, P4492+B1B, P493+B3D ===
 +
 +
'''Investigator:''' Dennis
 +
 +
'''Aim of the experiment:''' Cycled ligation was performed for P492 (Konz: 91 ng/µl), P493 (Konz: 57 ng/µl)
 +
 +
'''Procedure:'''
 +
 +
* Ligation batch for P492+B2A
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2 &nbsp;µl
 +
|P492 (91&nbsp;ng/µl, 2048&nbsp;bp)
 +
|-
 +
|16,5 &nbsp;µl
 +
|B2A (13,5 &nbsp;ng/µl, 825&nbsp;bp)
 +
|-
 +
|2&nbsp;µl
 +
|T4 ligase buffer (10x)
 +
|-
 +
|1&nbsp;µl
 +
|T4 ligase (1&nbsp;U/µl)
 +
|-
 +
|-
 +
|=21&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Ligation batch for P492+B1B
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2 &nbsp;µl
 +
|P492 (91&nbsp;ng/µl, 2048&nbsp;bp)
 +
|-
 +
|16,5 &nbsp;µl
 +
|B1B (12,4 &nbsp;ng/µl, 825&nbsp;bp)
 +
|-
 +
|2&nbsp;µl
 +
|T4 ligase buffer (10x)
 +
|-
 +
|1&nbsp;µl
 +
|T4 ligase (1&nbsp;U/µl)
 +
|-
 +
|-
 +
|=21&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Ligation batch for P493+B3D
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1,25 &nbsp;µl
 +
|P493 (91&nbsp;ng/µl, 2048&nbsp;bp)
 +
|-
 +
|17,5 &nbsp;µl
 +
|B3D (8,4 &nbsp;ng/µl, 825&nbsp;bp)
 +
|-
 +
|2&nbsp;µl
 +
|T4 ligase buffer (10x)
 +
|-
 +
|1&nbsp;µl
 +
|T4 ligase (1&nbsp;U/µl)
 +
|-
 +
|-
 +
|=20&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Cycled ligation has been performed after following protocol in a thermocycler:
 +
{|cellspacing="0" border="1"
 +
|100 cycles
 +
|12&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|
 +
|22&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|Hold
 +
|16&nbsp;°C
 +
|infinite
 +
|}
 +
 +
Lid temperature&nbsp;=&nbsp;37&nbsp;°C
 +
 +
</div>
 +
 +
<div class="limonene">
 +
 +
===Gelelectrophoresis of colony pcr products===
 +
 +
'''Investigator:''' Lara
 +
 +
'''Aim:''' Check products of colony pcr whether there are positive clones.
 +
 +
'''Results:''' See pictures that were uploaded into lab journal entry of colony pcr (august 28th).
 +
 +
--> Positive clones were transferred into 4 ml of LB medium with antibiotic (Chlp -> pSB1C3)
 +
 +
--> please prep plasmid DNA and do an analytical restriction digest
 +
 +
</div>
 +
 +
== '''Thursday, August 30th''' ==
 +
<div class="constitutive_promoter">
 +
=== Miniprep of picked colonies from ''E.coli'' transformed with TEF2-P in psb1c3 from P451===
 +
 +
''' Investigator:''' Georg
 +
* Miniprep was performed according Quiaprep plasmid extraction kit
 +
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Preparative digestion of TEF2-psb1c3 clones P588 and P591===
 +
 +
'''Investigator:''' Georg
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|2 µl 
 +
|XbaI (NEB)
 +
|-
 +
|8 µl
 +
|NEB-4 buffer
 +
|-
 +
|0,8 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|29,2 µl
 +
|dd H20
 +
|-
 +
|=40µl
 +
|'''TOTAL'''
 +
|}
 +
* To 20 µl reaction batch 20 µl plasmid-DNA was added
 +
* Digestion was performed for 3 h at 37C
 +
[[File:20120830 TEF2-P ausgeschn mit xbaI und PstI.png]]
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Gelextraction of digested TEF2-P===
 +
 +
'''Investigator:'''Georg
 +
* Gelextraction was performed according to Quiaquick gel extraction protocoll
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Nanodrop measurement of digested limonensynthases, GFP, ADH1-P, TEF2-P===
 +
'''Investigator:''' Georg
 +
*P578 Limonens.: 36,7 ng/µl
 +
*P576 GFP: 15,7 ng/µl
 +
*P575 ADH-P: 11,2 ng/µl
 +
*P588 TEF2-P: 289,7 ng/µl
 +
*P589 TEF2-P: 225,1 ng/µl
 +
*P590 TEF2-P: 260,5 ng/µl
 +
*P591 TEF2-P: 433,2 ng/µl
 +
*P592 TEF2-P (Preparative digestion (XBAI+PSTI-HF)): 50 ng/µl
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Ligation of P494 and P567===
 +
'''Investigator:''' Georg
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|4,52 µl (=100 ng)
 +
|P494
 +
|-
 +
|4,88 µl (=100 ng)
 +
|P567
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|7,6 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
* Ligation was performed 1h at room temperature
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Ligation of P492 and P567===
 +
'''Investigator:''' Georg
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|1,08 µl (=100 ng)
 +
|P492
 +
|-
 +
|4,92 µl (=100 ng)
 +
|P567
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|11 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
* Ligation was performed 1h at room temperature
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Ligation of P493 and P567===
 +
'''Investigator:''' Georg
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|1,73 µl (=100 ng)
 +
|P493
 +
|-
 +
|5,37 µl (=100 ng)
 +
|P567
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|9,9 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
* Ligation was performed 1h at room temperature
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Gelextraction of digested TEF2-P (XbaI+PstI)===
 +
 +
'''Investigator:'''Georg
 +
 +
* Gelextraction was performed according to Quiaquick gelextraction-kit
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Preparation of new Chloramphenicole plates===
 +
''' Investigator:''' Georg
 +
 +
* To 2 L of LB-Medium 15 g Agar was added
 +
* The mixture was then autoclaved
 +
* 2 ml 1000x Chloramphenicole was given when temperature has cooled down properly
 +
* Agar was distributed to plates and then stored in the cooler
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
=== Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation product P571+PCR72 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation products P571+PCR72 for bricking the fusion protein of N'-SV40NLS-Gal4AD-Linker-Pif3-C'.
 +
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 5&nbsp;µl of the ligation products (P571+PCR72) and it's negative control (P571) were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice.
 +
 +
* 30&nbsp;min incubation on ice.
 +
 +
* 5&nbsp;min heat shock at 37&nbsp;°C
 +
 +
* Adding of 1&nbsp;ml LB-medium to each tube.
 +
 +
* Incubation for 45&nbsp;min at 37&nbsp;°C in the 180&nbsp;rpm cell-culture shaker.
 +
 +
* 100&nbsp;µl of those cell suspension were plated on chloramphenicol plates.
 +
 +
* The rest were centrifuged for 1&nbsp;min at 13000&nbsp;rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100&nbsp;µl of LB-medium and these concentrated cell suspensions was plated again on new chloramphenicol plates.
 +
 +
* Incubation at 37&nbsp;°C overnight.
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
=== Picking of ''E.&nbsp;coli'' XL-Blue cells, transformated with ligation products of P399+P552 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Picking of ''E.&nbsp;coli'' XL-Blue cells, transformated with ligation products of P399+P552.
 +
 +
'''Procedure:'''
 +
 +
* 6 colonies of the transformation with P399+491 (CamR) and 10 colonies of the transformation with P399+P552 (CamR) were taken.
 +
 +
* Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4&nbsp;ml of LB-medium and chloramphenicol. These tubes were put overnight in a 180&nbsp;rpm cell culture shaker at 37&nbsp;°C.
 +
</div>
 +
 +
<div class="vector_design">
 +
 +
=== Picking of ''E.&nbsp;coli'' XL-Blue cells, transformated with P20 (BBa_J04450 in pSB1C3) ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Picking of ''E.&nbsp;coli'' XL-Blue cells, transformated with P20 (BBa_J04450 in pSB1C3), in order to introduce RFC25 pre- and suffix by PCR to the RFP generator device as a helper construct for cloning with RFC25/RFC10 parts.
 +
 +
'''Procedure:'''
 +
 +
* 4 colonies of the transformation with P20 (CamR) and were taken.
 +
 +
* Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4&nbsp;ml of LB-medium and 4&nbsp;µl of chloramphenicol (1000x). These tubes were put overnight in a 180&nbsp;rpm cell culture shaker at 37&nbsp;°C.
 +
</div>
 +
<div class="vector_design">
 +
 +
=== Design of an minimal multiple cloning site to insert protein coding part between promoter and terminator for pTUM104new-without-promoter and pSB1C3 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
* '''Ask me if you want to use constitutive promoter and terminator for express your target enzyme or protein or you want to integrate your coding device into the genome!!''' (Jeff)
 +
 +
[[File:TUM12 mMCS design.jpg|500px]]
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Cycled ligation of P572 with P299, P575, P592, PCR59 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Ligation of TEF1-P, TEF2-P, ADH1-P in pYES2-TUM
 +
 +
'''Procedure:'''
 +
 +
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|3,12 µl (=100 ng)
 +
|P572
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|2,08 µl
 +
|P299
 +
|-
 +
|12,3 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|3,16 µl 
 +
|P572
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|3,84µl
 +
|P575
 +
|-
 +
|10 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|3,13 µl 
 +
|P572
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|3,27µl
 +
|PCR59
 +
|-
 +
|10,5 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|3,18 µl 
 +
|P572
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|0,82 µl
 +
|P592
 +
|-
 +
|13 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Cycled ligation has been performed after following protocol in a thermocycler:
 +
{|cellspacing="0" border="1"
 +
|100 cycles
 +
|12&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|
 +
|22&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|Hold
 +
|16&nbsp;°C
 +
|infinite
 +
|}
 +
 +
Lid temperature&nbsp;=&nbsp;37&nbsp;°C
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Yeast expression Part 2 ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim of the experiment:''' Expression of gen products CaXMT1, CaMXMT1 and eGFP
 +
 +
Analogous to yesterday, one more sample of each yeast culture growing in SC -URA 2%gal medium was taken (5ml), 20h and 24h after induction. Furthermore, the OD600 was determined:
 +
 +
20h:
 +
* CaXMT1: 4,9
 +
* CaMXMT1: 4,6
 +
* eGFP: 5,8
 +
 +
24h:
 +
* CaXMT1: 5,6
 +
* CaMXMT1: 5,4
 +
* eGFP: 6,8
 +
 +
The samples were handled as described yesterday and stored at -80°C
 +
 +
'''Note:''' At the eGFP pellet is green ==> expression of positive control works
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Transformation of ''E.&nbsp;coli'' with P492+B1B, P492+B2A, P493+B3D ''' ===
 +
 +
'''Investigator:''' Dennis
 +
 +
'''Aim of the experiment:''' Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation products of P492+B1B, P492+B2A, P493+B3D.
 +
 +
'''Procedure:'''
 +
 +
* 20&nbsp;µl of each ligation products were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice.
 +
 +
* 30&nbsp;min incubation on ice.
 +
 +
* 5&nbsp;min heat shock at 37&nbsp;°C
 +
 +
* Adding of 1&nbsp;ml LB-medium to each tube.
 +
 +
* Incubation for 45&nbsp;min at 37&nbsp;°C in the 180&nbsp;rpm cell-culture shaker.
 +
 +
* 100&nbsp;µl of those cell suspension were plated on chloramphenicol plates.
 +
 +
* The rest were centrifuged for 1&nbsp;min at 13000&nbsp;rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100&nbsp;µl of LB-medium and this concentrated cell suspension was plated again on chloramphenicol plates.
 +
 +
* Incubation at 37&nbsp;°C overnight.
 +
 +
</div>
 +
 +
<div class="thaumatin">
 +
 +
=== Small scale yeast transformation of ''S. cerevisiae'' with pTUM104_Preprothaumatin, Integration-Vector_mOrange and pTUM104_GFP ===
 +
 +
'''Investigator:''' Martin, Alois
 +
 +
Procedure according to pYes2_manual_kommentiert:
 +
 +
* 2. Determine the OD600 of your overnight culture. Dilute culture to an OD600 of 0.4 in 50 ml of YPD medium, add 5ml 20% glucose and grow an additional 2–4 hours.
 +
3. Pellet (5 min, 4°C) the cells at 2500 rpm and resuspend the pellet in 40 ml 1X TE.
 +
4. Pellet (5 min, 4°C) the cells at 2500 rpm and resuspend the pellet in 2 ml of 1X LiAc/0.5X TE.
 +
5. Incubate the cells at room temperature for 10 minutes.
 +
6. For each transformation, mix together 1 μg plasmid DNA and 100 μg (10 μl) denatured sheared salmon sperm DNA with 100 μl of the yeast suspension from Step 5.
 +
7. Add 700 μl of 1X LiAc/40% PEG-3350/1X TE (7 ml 50% PEG3350 was synthesized (3.5 g in 7 ml bidest.water); 6.4 ml 50% PEG3350 + 800 μl 10x LiAc + 800 μl 10x TE were mixed) and mix well.
 +
8. Incubate solution at 30°C for 30 minutes.
 +
9. Add 88 μl DMSO, mix well, and heat shock at 42°C for 7 minutes.
 +
10. Centrifuge in a microcentrifuge for 10 minutes and remove supernatant.
 +
11. Resuspend the cell pellet in 1 ml 1X TE and re-pellet.
 +
12. Resuspend the cell pellet in 50–100 μl 1X TE and plate on a selective plate (SCU-plates + Glucose, respectively Kanamycin-YPD plates for the Integration-Vector_mOrange). Incubate the plates at 30°C over the weekend.
 +
 +
'''Name:''' pYes2_Thaumatin/Integ-Vek/GFP, S. cerevisiae, Schappert, Bräuer.
 +
 +
</div>
 +
<div class="integration">
 +
 +
=== Miniprep of Integvek_mOrange ===
 +
 +
'''Investigator''': Martin, Alois
 +
 +
'''Aim:''' To gain enough plasmid to digest with restriction enzymes (and ligate with other inserts than the mOrange) and to transform yeast.
 +
 +
'''Procedure:''' Miniprepkit - Qiagen, Procedure according to the manual
 +
 +
</div>
 +
<div class="integration">
 +
 +
=== Gelextraction of Thaumatin, Limonene-Synthase and Integration-Vector-Backbone ===
 +
 +
'''Investigator''': Martin, Alois
 +
 +
'''Aim:''' P583 (Thaumatin), 584 (Limonene-Synthase), 585 (Integration-vector-backbone)
 +
 +
'''Procedure:''' Gelextraction with a 1%-LMP-Agarose-Gel - Qiagen Gelextraction Kit
 +
 +
Picture of Integration-Vector (Backbone at 3650 bp)
 +
 +
[[File:20120830_integvek_gelex_TUM12.jpg|250 px]]
 +
 +
Picture of Thaumatin (721 bp, upper) and Limonene (1650bp, lower)
 +
 +
[[File:20120830_limonen_thaumatin_gelex_TUM12.jpg|250px]]
 +
 +
</div>
 +
<div class="integration">
 +
 +
=== Ligation of Thaumatin/Limonene and Integration-Vector ===
 +
 +
'''Investigator''': Martin, Alois
 +
 +
'''Aim:''' Ligate the Thaumatin/Limonene as inserts into the Integration-Vector.
 +
 +
'''Procedure:'''
 +
 +
* Ligation batch for P583+P585 and P584+P585
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5.5 µl
 +
|P585 (18,4 ng/µl, 3600 bp)
 +
|-
 +
|4.6 µl
 +
|P583 (13.1 ng/µl, 721 bp)
 +
|P584 (28.5 ng/µl, 1650 bp)
 +
|-
 +
|0,5 µl
 +
|BSA
 +
|-
 +
|2 µl
 +
|T4 ligase buffer (10x)
 +
|-
 +
|1 µl
 +
|T4 ligase (1&nbsp;U/µl)
 +
|-
 +
|5.9 µl
 +
|ddH2O
 +
|-
 +
|=21&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
 +
</div>
 +
 +
<div class="integration">
 +
 +
=== Transformation of ''E. Coli'' XL1blu with Integ-Vec_Thaumatin and Integ-Vec_Limonene-Synthase ===
 +
 +
'''Investigator''': Martin, Alois
 +
 +
'''Aim:''' To establish a ''E. Coli''-Strain carrying the Integration-Vector backbone with a Thaumatin, respectively Limonene-Synthase, insert.
 +
 +
'''Procedure:''' The products of the Ligation before were used to transform ''E. Coli'' XL1blu. For the procedure have a close look at the quadrizillion transformations before. I'm outta here.
 +
 +
</div>
 +
 +
<div class="limonene">
 +
===Miniprep of ligation products and colony PCR products===
 +
 +
'''Investigator:''' Andrea
 +
 +
'''Aim:''' Check ligation products (PCR56/P375 (pYES), PCR57/P375 (pYES)). Check colony PCR clones (3, 5, 6, 7, 8) .
 +
 +
* PCR56/pYES (tube 1): 242 ng/µl
 +
* PCR56/pYES (tube 2): 71 ng/µl
 +
* PCR56/pYES (tube 3): 63 ng/µl
 +
* PCR56/pYES (tube 4): 36 ng/µl
 +
* PCR56/pYES (tube 5): 137 ng/µl
 +
* PCR56/pYES (tube 6): 63 ng/µl
 +
 +
* PCR57/pYES (tube 1): 74 ng/µl
 +
* PCR57/pYES (tube 2): 98 ng/µl
 +
* PCR57/pYES (tube 3): 124 ng/µl
 +
* PCR57/pYES (tube 4): 100 ng/µl
 +
* PCR57/pYES (tube 5): 152 ng/µl
 +
* PCR57/pYES (tube 6): 85 ng/µl
 +
 +
* Colony PCR (clone 3): 63.5 ng/µl
 +
* Colony PCR (clone 5): 101 ng/µl
 +
* Colony PCR (clone 6): 161.5 ng/µl
 +
* Colony PCR (clone 7): 61 ng/µl
 +
* Colony PCR (clone 8): 59 ng/µl
 +
 +
'''Eppis are stored in a disposal bag (label: Miniprep, Andrea, 30.8.) in the middle drawer of -20°C.'''
 +
 +
</div>
 +
 +
<div class="limonene">
 +
===Analytical restriction digest of transformed ligation products and colony PCR products===
 +
 +
'''Investigator:''' Andrea
 +
 +
'''Aim:''' Check that transformed clones are positive.
 +
 +
*PCR56/pSB1C3 (transformation 28th August)
 +
*PCR57/pSB1C3 (transformation 28th August)
 +
*Colony PCR (clone 3, 5, 6, 7, 8)
 +
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|3 µl
 +
|plasmid DNA
 +
|-
 +
|0.25 µl
 +
|Xba 1
 +
|-
 +
|0.25 µl
 +
|Spe-HF 1
 +
|-
 +
|2 µl
 +
|NEB
 +
|-
 +
|0,2 µl
 +
|BSA
 +
|-
 +
|14.3 µl
 +
|ddH2O
 +
|}
 +
 +
'''Gelelectrophoresis:'''
 +
 +
*expected:
 +
Limonene synthase 1600 bp
 +
 +
pSB1C3 (P133)    2000 bp
 +
 +
[[File:30.ß8.12 analytgel1 bearbeitet.png|400px]]
 +
 +
[[File:30.08.12 analytgel2 bearbeitet.png|400px]]
 +
 +
ligations negative
 +
colony PCR products negative
 +
</div>
 +
 +
<div class="limonene">
 +
===Preparation of cells of protein expressed yeasts===
 +
'''Investigator:''' Andrea
 +
 +
'''Aim of the experiment:''' Get yeast cell pellets for further cell disruption
 +
 +
* measure OD600 at different time points (after 15 hours, 20 hours, 24 hours)
 +
* centrifugation of each 5 ml (4°C, 5 min, 5000x g)
 +
* resuspend pellet in 1ml ddH2O
 +
* centrifugation of each resuspended pellet (4°C, 5 min, 5000x g)
 +
* stored pellet at -20°C
 +
</div>
 +
 +
<div class="limonene">
 +
===Preparation of PMSF solution===
 +
'''Investigator:''' Andrea
 +
 +
'''Aim of the experiment:''' Get PMSF solution for breaking buffer for yeast expression procedure
 +
 +
* 0.0174 g in 1ml Isopropanol (techn.)
 +
* stored Eppi at 4°C (great iGEM fridge)
 +
* added 60 µl to breaking buffer --> breaking buffer + PMSF ready for yeast cell disruption
 +
 +
</div>
 +
 +
== '''Friday, August 31st''' ==
 +
<div class="constitutive_promoter">
 +
=== Transformation of ''E.coli'' with ligation product pTUM100 with PCR59 (TEF1-T), TEF2-P, TEF1-P and ADH1-P===
 +
'''Investigator: Georg'''
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 10 µl of ligation product (P265B) was added to 100 µl of competent cells and gently mixed.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on ampicillin plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin plates.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Picking of colonies with ligation products CYC-T+psb1c3, TEF1-T-psb1c3, Thaumatin+ ADH1-TEF2-TEF1-P===
 +
 +
'''Investigator:Georg'''
 +
 +
 +
* 42 colonies were picked and transferred to 5 ml medium with 5 µl 1000x CAM in case of ligation and CYC-T and TEF1-T
 +
 +
* Ampicillin in case of ligation products of Thaumatin
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
=== Miniprep of ''E.&nbsp;coli'' XL-Blue cells, transformated with ligation product of P399+P552 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Miniprep of ''E.&nbsp;coli'' XL-Blue cells, transformated with ligation products of P399+P552 (P573).
 +
 +
'''Procedure:'''
 +
 +
* Miniprep was done after manufacturer's protocol. (QIAGEN - QIAprep Spin Miniprep Kit)
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
=== Analytical digestion and gelelectrophoresis of the minipreps P601-P606 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Analytical digestion and gelelectrophoresis of the minipreps P601-P606 with XbaI+PstI-HF.
 +
 +
'''Procedure:'''
 +
 +
* Mastermix for analytical digestion for P601-P606 with XbaI+PstI-HF:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|14&nbsp;µl
 +
|NEBuffer 4 (10x)
 +
|-
 +
|1.4&nbsp;µl
 +
|BSA (100x)
 +
|-
 +
|1.75&nbsp;µl
 +
|XbaI (20&nbsp;U/µl)
 +
|-
 +
|1.75&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|103.6&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=122.5&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* 17.5&nbsp;µl of the mastermix was added to 2.5&nbsp;µl of plasmid DNA (P601-P606).
 +
 +
* The reaction mixes were incubated at 37&nbsp;°C for 90&nbsp;min.
 +
 +
* 9&nbsp;µl of the digested DNA was mixed with 1&nbsp;µl of DNA loading buffer (10x).
 +
 +
* Analytical gelelectrophoresis was performed at 90&nbsp;V for about 60&nbsp;min.
 +
 +
P601-P606:
 +
{|cellspacing="0" border="1"
 +
|100&nbsp;bp DNA ladder
 +
|P601
 +
|P602
 +
|P603
 +
|P604
 +
|P605
 +
|P606
 +
|1&nbsp;kbp DNA ladder
 +
|-
 +
|
 +
|Ligation seems to  be successful. Sequencing has to be done!
 +
|Ligation seems to  be successful. Sequencing has to be done!
 +
|Ligation seems to  be successful. Sequencing has to be done!
 +
|Ligation seems to  be successful. Sequencing has to be done!
 +
|Ligation seems to  be successful. Sequencing has to be done!
 +
|Ligation seems to  be successful. Sequencing has to be done!
 +
|
 +
|}
 +
[[File:TUM12_20120831_anal_gel_p601-p606.jpg|500px]]
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
=== Picking of ''E.&nbsp;coli'' XL-Blue cells, transformated with ligation products of P571+PCR72 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Picking of ''E.&nbsp;coli'' XL-Blue cells, transformated with ligation products of P571+PCR72.
 +
 +
'''Procedure:'''
 +
 +
* 6 colonies of the transformation with P571+PCR72 (CamR) were taken.
 +
 +
* Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4&nbsp;ml of LB-medium and chloramphenicol. These tubes were put overnight in a 180&nbsp;rpm cell culture shaker at 37&nbsp;°C.
 +
</div>
 +
 +
<div class="limonene">
 +
 +
=== Picking of clones: PSB1C3_P57 and PSB1C3_P42 ===
 +
 +
'''Investigator:''' Martin, Alois '''(???)'''
 +
 +
'''Aim:''' Picking of ''E. coli'' XL-Blue cells, transformated with ligation products of P113 and P57/P42.
 +
 +
'''Procedure:'''
 +
 +
* 2 colonies of the transformation (29th August) from each plate were taken, 4 in total.
 +
 +
* Colonies were picked with pipette tips and transferred into a new cell-culture tube with 7 ml of LB-medium and chloramphenicol. These tubes were put in a 180 rpm cell culture shaker at 37 °C overnicht.
 +
 +
</div>
 +
 +
<div class="limonene">
 +
 +
===Harvest proteins expressed in yeasts===
 +
 +
'''Aim:''' Cell disruption for harvesting proteins expressed in yeasts
 +
 +
'''Procedure:'''
 +
 +
*resuspending stored cell pellets in defined volume of braking buffer + PMSF
 +
*adding glass beads to eppis
 +
*vortex for 30 min and incubate on ice for 30 min (repetition for 25 times)
 +
*centrifuge at 4 °C, full speed, 10 min
 +
*take supernatant and centrifuge at 4 °C, full speed, 10 min again
 +
*store supernatant at -80°C (second box)
 +
 +
*concentrations
 +
 +
LS (15 hours after galactose induction): 4.053 mg/ml
 +
 +
LS (20 hours after galactose induction): 1.932 mg/ml
 +
 +
LS (24 hours after galactose induction): 4.828 mg/ml
 +
 +
Caffein CaXMT1 (20 hours after galactose induction): 10.142 mg/ml
 +
 +
Caffein CaXMT1 (24 hours after galactose induction): 2.433 mg/ml
 +
 +
Caffein CaMXMT1 (20 hours after galactose induction): 8.508 mg/ml
 +
 +
Caffein CaMXMT1 (24 hours after galactose induction): 4.712 mg/ml
 +
 +
Caffein eGFP (20 hours after galactose induction): 6.661 mg/ml
 +
 +
Caffein eGFP (24 hours after galactose induction): 4.244 mg/ml
 +
 +
</div>
 +
 +
<div class="limonene">
 +
 +
===Repitition of analytical restriction digest of transformed ligation products and colony PCR products===
 +
 +
'''Investigator:''' Andrea
 +
 +
'''Aim:''' Check that transformed clones are positive.
 +
 +
*PCR56/pSB1C3 (transformation 28th August)
 +
*PCR57/pSB1C3 (transformation 28th August)
 +
*Colony PCR (clone 3, 5, 6, 7, 8)
 +
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|3 µl
 +
|plasmid DNA
 +
|-
 +
|0.5 µl
 +
|Xba 1
 +
|-
 +
|0.5 µl
 +
|Spe-HF 1
 +
|-
 +
|2 µl
 +
|NEB
 +
|-
 +
|0,2 µl
 +
|BSA
 +
|-
 +
|12.8 µl
 +
|ddH2O
 +
|}
 +
 +
*incubation: 2 hours, 37°C
 +
 +
'''Gelelectrophoresis:'''
 +
 +
needs to be done
 +
</div>
 +
 +
<div class="limonene">
 +
===Analytical restriction digest of schwab vectors===
 +
 +
'''Investigator:''' Andrea
 +
 +
'''Aim:''' Check that schwab plasmids and insert are right.
 +
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''