Team:TU Munich/Notebook/Labjournal

From 2012.igem.org

(Difference between revisions)
(Analytical digestion and gelelectrophoresis of the minipreps of transformated E. coli XL1-Blue with ligated P206+P310 products (P327-P331))
(Undo revision 300635 by AndiB (talk))
 
(2022 intermediate revisions not shown)
Line 1: Line 1:
{{Team:TU_Munich/Header}}
{{Team:TU_Munich/Header}}
{{Team:TU_Munich/LabHeader}}
{{Team:TU_Munich/LabHeader}}
 +
{{Team:TU_Munich/ExCol}}
 +
__NOTOC__
<html>
<html>
<body>
<body>
         <form id="labselect"><fieldset class="ui-widget ui-widget-content ui-corner-left">
         <form id="labselect"><fieldset class="ui-widget ui-widget-content ui-corner-left">
-
         <b>Display subprojects:</b><br>
+
         <b>Display:</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="vector_design" id="ui-test1" /><b style="color: rgb(166, 126, 166)">Vector Design</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="vector_design" id="ui-test1" /><b style="color: rgb(166, 126, 166)">Vector Design</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="limonene" id="ui-test2" /><b style="color: rgb(116, 183, 112)">Limonene</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="limonene" id="ui-test2" /><b style="color: rgb(116, 183, 112)">Limonene</b><br>
-
<input class="labcheckbox" type="checkbox" name="category" value="coumaryl" id="ui-test3" /><b style="color: rgb(255, 122, 97)">Coumaryl</b><br>
+
<input class="labcheckbox" type="checkbox" name="category" value="coumaryl" id="ui-test3" /><b style="color: rgb(255, 122, 97)">Xanthohumol</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="thaumatin" id="ui-test4" /><b style="color: rgb(202, 85, 85)">Thaumatin</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="thaumatin" id="ui-test4" /><b style="color: rgb(202, 85, 85)">Thaumatin</b><br>
-
<input class="labcheckbox" type="checkbox" name="category" value="caffeine" id="ui-test5" /><b style="color: rgb(211, 254, 113)">Caffeine</b><br>
+
<input class="labcheckbox" type="checkbox" name="category" value="caffeine" id="ui-test5" /><b style="color:rgb(192, 167, 4)">Caffeine</b><br>
-
<input class="labcheckbox" type="checkbox" name="category" value="constitutive_promoter" id="ui-test6" /><b style="color: rgb(115, 208, 255)">Constituve promoter</b><br>
+
<input class="labcheckbox" type="checkbox" name="category" value="constitutive_promoter" id="ui-test6" /><b style="color: rgb(115, 208, 255)">Constitutive promoter</b><br>
-
<input class="labcheckbox" type="checkbox" name="category" value="light_switchable_promoter" id="ui-test7" /><b style="color: rgb(0, 32, 96)">Light-switchable promoter</b><br>
+
<input class="labcheckbox" type="checkbox" name="category" value="light_switchable_promoter" id="ui-test7"  
-
<br><i>You can also click on individual experiments to show/hide them</i><br>
+
/><b style="color: rgb(0, 32, 96)">Light-switchable promoter</b><br>
 +
        <input class="labcheckbox" type="checkbox" name="category" value="ethanol_inducible_promoter" id="ui-test8"
 +
/><b style="color: rgb(0, 102, 0)">Ethanol-inducible promoter</b><br>
 +
        <input class="labcheckbox" type="checkbox" name="category" value="integration" id="ui-test9" /><b style="color: rgb(222, 77, 185)">Genome integration</b><br>
 +
        <br><a href="#" id="ExAll">Expand All ...</a><br>
 +
        <a href="#" id="ColAll">Collapse All ...</a><br>
 +
 
 +
        <br><i>You can also click on individual experiments to show/hide them</i><br>
         <b>Jump to:</b><br>
         <b>Jump to:</b><br>
-
         <a href="#Wednesday.2C_June_13th" class="openjune">Week 1: 13.6-17.6</a><br>
+
         <a href="#Week_1">Week 1</a> 13.6-17.6<br>
-
         <a href="#Monday.2C_June_18th" class="openjune">Week 2: 18.6-24.6</a><br>
+
         <a href="#Week_2">Week 2</a> 18.6-24.6<br>
-
         <a href="#Monday.2C_June_25th" class="openjune openjuly">Week 3: 25.6-1.7</a><br>
+
         <a href="#Week_3">Week 3</a> 25.6-1.7<br>
-
         <a href="#Monday.2C_July_2nd" class="openjuly">Week 4: 2.7-8.7</a><br>
+
         <a href="#Week_4">Week 4</a> 2.7-8.7<br>
-
         <a href="#Monday.2C_July_9th" class="openjuly">Week 5: 9.7-15.7</a><br>
+
         <a href="#Week_5">Week 5</a> 9.7-15.7<br>
-
         <a href="#Monday.2C_July_16th" class="openjuly">Week 6: 16.7-22.7</a><br>
+
         <a href="#Week_6">Week 6</a> 16.7-22.7<br>
-
         <a href="#Monday.2C_July_23rd" class="openjuly">Week 7: 23.7-29.7</a><br>
+
         <a href="#Week_7">Week 7</a> 23.7-29.7<br>
-
         <a href="#Monday.2C_July_30th" class="openjuly openaugust">Week 8: 30.7-5.8</a><br>
+
         <a href="#Week_8">Week 8</a> 30.7-5.8<br>
-
         <a href="#Monday.2C_August_6th" class="openaugust">Week 9: 6.8-12.8</a><br>
+
        <a href="#Week_9">Week 9</a> 6.8-12.8<br>
-
         <a href="#Monday.2C_August_13th" class="openaugust">Week 10: 13.8-19.8</a><br>
+
         <a href="#Week_10">Week 10</a> 13.8-19.8<br>
 +
        <a href="#Week_11">Week 11</a> 20.8-26.8<br>
 +
        <a href="#Week_12">Week 12</a> 27.8-2.9<br>
 +
         <a href="#Week_13">Week 13</a> 3.9-9.9<br>
 +
        <a href="#Week_14">Week 14</a> 10.9-16.9<br>
 +
        <a href="#Week_15">Week 15</a> 17.9-23.9<br>
 +
        <a href="#Week_16">Week 16</a> 24.9-27.9
         </fieldset>
         </fieldset>
         </form>
         </form>
Line 39: Line 54:
= Labjournal =
= Labjournal =
<hr/>
<hr/>
 +
 +
P1-923 and PCR1-73 are the tube numbers for plasmids/PCR products from our [[Team:TU_Munich/Notebook/Inventory|inventory list (most of the descriptions are in german)]]
 +
 +
For a shorter summary of what happened each week, see our [[Team:TU_Munich/Notebook/Meetings|meeting protocols]].
<div class="labbook">
<div class="labbook">
-
=June 2012=
+
 
-
<div class="month" id="MJune_2012">
+
=Week 1=
 +
<!--
 +
<p class="vector_design">'''Vector Design (4 Experiments):''' </p>
 +
* Exchange of Multiple Cloning Site of pTUM104
 +
 
 +
<p class="limonene">'''Limonene (2 Experiments):''' </p>
 +
* Transformation with limonene plasmids from Prof. Schwab
 +
 
 +
<html><a class="WDetails" href="#Week_1" id="Week_1">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_1">
=='''Wednesday, June 13th'''==
=='''Wednesday, June 13th'''==
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2 ===
+
===Exchange of the Multiple Cloning Site of pTUM104 ===
-
'''Investigator: Saskia, Daniela'''
+
'''Investigator:''' Saskia, Daniela
-
Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Hybridisation of the primers O1 with O2 and O3 with O4'''
'''Hybridisation of the primers O1 with O2 and O3 with O4'''
Line 108: Line 137:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2 ===
+
===Exchange of the Multiple Cloning Site of pTUM104 ===
-
'''Investigator: Saskia, Daniela'''
+
'''Investigator:''' Saskia, Daniela
-
 
+
-
Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2
+
-
'''Digestion of pYES2 with HindIII and XbaI'''
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
 +
'''Digestion of pTUM104 with HindIII and XbaI'''
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 141: Line 169:
Incubation: 37 °C, 1.75 h
Incubation: 37 °C, 1.75 h
-
 
'''DNA preparative gel electrophoresis'''
'''DNA preparative gel electrophoresis'''
Line 149: Line 176:
*70 V, 90 min
*70 V, 90 min
-
[[File:TUM12_pYES2_verdaut.jpg]]
+
[[File:TUM12_pYES2digested.jpg]]
'''Gelextration'''
'''Gelextration'''
Line 168: Line 195:
===Transformation of plasmids from Prof. Schwab in ''E.coli'' XL-1 Blue===
===Transformation of plasmids from Prof. Schwab in ''E.coli'' XL-1 Blue===
-
'''Investigator: Lara, Andrea'''
+
'''Investigator:''' Lara, Andrea
-
Aim of the experiment: Preparation of the plasmids for transformation
+
'''Aim of the experiment:''' Preparation of the plasmids for transformation
'''Overnight cultures of cells with limonenesynthase-plasmid from Prof. Schwab'''
'''Overnight cultures of cells with limonenesynthase-plasmid from Prof. Schwab'''
Line 183: Line 210:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
-
'''Investigator: Saskia, Daniela'''
+
'''Investigator:''' Saskia, Daniela
-
Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Analytical DNA gel electrophoresis'''
'''Analytical DNA gel electrophoresis'''
Line 197: Line 224:
*band 4: 3 µl O6 + 7 µl TAE-buffer + 1 µl loading dye
*band 4: 3 µl O6 + 7 µl TAE-buffer + 1 µl loading dye
*band 5: 10 µl DNA ladder (100 bp)
*band 5: 10 µl DNA ladder (100 bp)
-
[[File:TUM12_pYES_und_Primer.jpg]]
+
[[File:TUM12_pYES2_and_primer.jpg]]
'''Ligation of Plasmid P5 (pYES2 digested) with the hybridized primers O5 and O6'''
'''Ligation of Plasmid P5 (pYES2 digested) with the hybridized primers O5 and O6'''
Line 260: Line 287:
===Transformation of plasmids from Prof. Schwab into ''E.coli'' XL-1 Blue===
===Transformation of plasmids from Prof. Schwab into ''E.coli'' XL-1 Blue===
-
'''Investigator: Andrea'''
+
'''Investigator:''' Andrea
-
Aim of the experiment: Preparation of the plasmids for transformation
+
'''Aim of the experiment:''' Preparation of the plasmids for transformation
'''Determination of the concentration with Nano Drop'''
'''Determination of the concentration with Nano Drop'''
Line 286: Line 313:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
-
'''Investigator: Saskia, Daniela'''
+
'''Investigator:''' Saskia, Daniela
-
Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Picking clones for Miniprep'''
'''Picking clones for Miniprep'''
Line 297: Line 324:
</div>
</div>
 +
</div>
 +
 +
=Week 2=
 +
<!--
 +
<p class="vector_design">'''Vector Design (4 Experiments):'''</p>
 +
* Exchange of Multiple Cloning Site of pTUM104
 +
* Quick Change mutagenisis of pTUM104 for RFC25 compatibility
 +
 +
<p class="limonene">'''Limonene (3 Experiments):'''</p>
 +
* Transformation with limonene BioBricks
 +
 +
<p class="coumaryl">'''Xanthohumol (2 Experiments):'''</p>
 +
* Amplification of plasmids containing the genes for the enzymes PAL, 4Cl and CHS
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (1 Experiment):'''</p>
 +
* Transformation with heme oxygenase and LexA BioBricks to them RFC25 compatible later on
 +
 +
<html><a class="WDetails" href="#Week_2" id="Week_2">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_2">
== '''Monday, June 18th''' ==
== '''Monday, June 18th''' ==
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
-
'''Investigator: Saskia, Daniela'''
+
'''Investigator:''' Saskia, Daniela
-
Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Miniprep of transformed E.coli with P6'''
'''Miniprep of transformed E.coli with P6'''
Line 310: Line 357:
*step 3: invert 2-3 times (don't shake to avoid destruction of genomic DNA)
*step 3: invert 2-3 times (don't shake to avoid destruction of genomic DNA)
*the 10 Minipreps were named: P7 - P16
*the 10 Minipreps were named: P7 - P16
-
 
'''Determination of the concentration with Nano Drop'''
'''Determination of the concentration with Nano Drop'''
Line 406: Line 452:
gel 1:  
gel 1:  
*band 1: 10 µl DNA ladder (1 kb)
*band 1: 10 µl DNA ladder (1 kb)
-
*band 2: 3 µl pYES2 SH 1.7.3 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
+
*band 2: 3 µl pTUM104 SH 1.7.3 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
-
[[File:TUM12_pYES_mit_neuer_MCS_verd_mit_Xbal_und_HindIII.jpg]]
+
[[File:TUM12_pYES_new_mcs_digested_with_Xbal_and_HindIII.jpg]]
gel 2:
gel 2:
*band 1: 10 µl DNA ladder (1 kb)
*band 1: 10 µl DNA ladder (1 kb)
-
*band 2: 3 µl pYES2 SH 1.7.3 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
+
*band 2: 3 µl pTUM104 SH 1.7.3 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
-
[[File:TUM12_pYES_mit_neuer_MCS_verd_mit_NgoMIV.jpg]]
+
[[File:TUM12_pYES_new_mcs_digested_with_NgoMIV.jpg]]
</div>
</div>
Line 422: Line 468:
===Transformation of BBa_I742111 (Limonenesynthase) into ''E.coli'' XL-1 Blue===
===Transformation of BBa_I742111 (Limonenesynthase) into ''E.coli'' XL-1 Blue===
-
'''Investigator: Andrea'''
+
'''Investigator:''' Andrea
-
Aim of the experiment: Transformation
+
'''Aim of the experiment:''' Transformation
* for each Biobrick 100 µl cells were used and pooled together with 2 µl of plasmid DNA
* for each Biobrick 100 µl cells were used and pooled together with 2 µl of plasmid DNA
Line 445: Line 491:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
-
'''Investigator: Saskia, Daniela'''
+
'''Investigator:''' Saskia, Daniela
-
Aim of the experiment: Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
-
'''Sequencing of P13 and P14: pYES2 with new MCS'''
+
'''Sequencing of P13 and P14: pTUM104 with new MCS'''
sequencing primer:
sequencing primer:
*1.6 µM forward primer O9
*1.6 µM forward primer O9
Line 463: Line 509:
===Transformation of BBa_I742111 (Limonenesynthase) into ''E.coli'' XL-1 Blue===
===Transformation of BBa_I742111 (Limonenesynthase) into ''E.coli'' XL-1 Blue===
-
'''Investigator: Daniela'''
+
'''Investigator:''' Daniela
-
Aim of the experiment: Transformation
+
'''Aim of the experiment:''' Transformation
'''Picking of Clones'''
'''Picking of Clones'''
Line 478: Line 524:
===Transformation of BBa_I742111 and plasmids from Prof. Schwab into ''E.coli'' XL-1 Blue===
===Transformation of BBa_I742111 and plasmids from Prof. Schwab into ''E.coli'' XL-1 Blue===
-
'''Investigator: Lara, Andrea'''
+
'''Investigator: Lara, Andrea
-
 
+
-
Aim of the experiment: Controll of Transformation
+
 +
'''Aim of the experiment:''' Controll of Transformation
'''Controll digestion'''
'''Controll digestion'''
Line 563: Line 608:
== '''Friday, June 22nd''' ==
== '''Friday, June 22nd''' ==
-
 
<div class="coumaryl">
<div class="coumaryl">
=== Transformation of ''E.coli'' XL1-Blue with pKS2µHyg-PAL-4Cl-CHS===
=== Transformation of ''E.coli'' XL1-Blue with pKS2µHyg-PAL-4Cl-CHS===
-
'''Investigator: Ingmar, Volker'''
+
'''Investigator:''' Ingmar, Volker
-
Aim of the experiment: Plasmid amplification
+
'''Aim of the experiment:''' Plasmid amplification
Operation Sequence:
Operation Sequence:
Line 585: Line 629:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove NgoMIV from pYES2 ===
+
=== Quick Change mutagenis to remove NgoMIV from pTUM104 ===
-
'''Investigator: Ingmar, Volker'''
+
'''Investigator:''' Ingmar, Volker
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.
+
'''Aim of the experiment:''' Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 665: Line 709:
=== Miniprep of ''E.coli'' XL1-Blue with pKS2µHyg-PAL-4Cl-CHS ===
=== Miniprep of ''E.coli'' XL1-Blue with pKS2µHyg-PAL-4Cl-CHS ===
-
'''Investigator: Ingmar, Volker'''
+
'''Investigator:''' Ingmar, Volker
-
Aim of the experiment: Plasmid purification
+
'''Aim of the experiment:''' Plasmid purification
Operation Sequence:
Operation Sequence:
Line 677: Line 721:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove NgoMIV from pYES2 ===
+
=== Quick Change mutagenis to remove NgoMIV from pTUM104 ===
-
'''Investigator: Ingmar, Volker'''
+
'''Investigator:''' Ingmar, Volker
-
Aim of the experiment: Removal of a NgoMIV restriction site in the backbone of pYes2.
+
'''Aim of the experiment:''' Removal of a NgoMIV restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 688: Line 732:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Transformation of 2 Biobricks into ''E. coli'' XL1-Blue ===
=== Transformation of 2 Biobricks into ''E. coli'' XL1-Blue ===
-
'''Investigator: Jeffery Truong'''
+
'''Investigator:''' Jeffery Truong
-
Aim of the experiment: Transformation of Biobricks into ''E. coli'' for plasmid propagation for PCR with new RFC pre- and suffix primer in order to do protein fusions.
+
'''Aim of the experiment:''' Transformation of Biobricks into ''E. coli'' for plasmid propagation for PCR with new RFC pre- and suffix primer in order to do protein fusions.
* 2 Biobricks from the distribution kit were used: First, LexA (BBa_K105005, Plate 3 Well 9E) in the pSB1A2 plasmid with ampicillin resistance and second, the heme oxygenase (BBa_I15008, Plate 2 Well 13J) in the pSB2K3 plasmid with kanamycin resistance.
* 2 Biobricks from the distribution kit were used: First, LexA (BBa_K105005, Plate 3 Well 9E) in the pSB1A2 plasmid with ampicillin resistance and second, the heme oxygenase (BBa_I15008, Plate 2 Well 13J) in the pSB2K3 plasmid with kanamycin resistance.
Line 718: Line 763:
* These 4 plates were put at 37&nbsp;°C overnight
* These 4 plates were put at 37&nbsp;°C overnight
 +
</div>
</div>
</div>
 +
=Week 3=
 +
<!--
 +
<p class="vector_design">'''Vector Design (9 Experiments):'''</p>
 +
* Quick Change mutagenisis of pTUM104 for RFC25 compatibility and
 +
 +
<p class="limonene">'''Limonene (1 Experiment):'''</p>
 +
* Repetition of analytical gelectrophoresis
 +
 +
<p class="coumaryl">'''Xanthohumol (3 Experiments):'''</p>
 +
* PCR of PAL, 4CL, CHS, OMT
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (2 Experiments):'''</p>
 +
* Verification of transformations (positive)
 +
 +
<html><a class="WDetails" href="#Week_3" id="Week_3">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_3">
== '''Monday, June 25th''' ==
== '''Monday, June 25th''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Miniprep of ''E. coli'' XL1-Blue with pYes2_RFC25 MCS 1.2 ===
+
=== Miniprep of ''E. coli'' XL1-Blue with pTUM104_RFC25 MCS 1.2 ===
-
'''Investigator: Alois, Martin'''
+
'''Investigator:''' Alois, Martin
-
Aim of the experiment: proof of successful removal of NgoMIV in the backbone of pYes2
+
'''Aim of the experiment:''' proof of successful removal of NgoMIV in the backbone of pTUM104
Operation Sequence:
Operation Sequence:
-
* Mini prep of pYes2 1.2. The resulting purified DNA is P33.
+
* Mini prep of pTUM104 1.2. The resulting purified DNA is P33.
-
* Control digest of pYes2_RFC25 MCS 1.2 and p13 (+ analytical gel electrophoresis: 90 V, 1 h:
+
* Control digest of pTUM104_RFC25 MCS 1.2 and p13 (+ analytical gel electrophoresis: 90 V, 1 h:
  *  15 µl ddH20
  *  15 µl ddH20
  *  2 µl NEBuffer4
  *  2 µl NEBuffer4
  * 0,5 µl NgoMIV
  * 0,5 µl NgoMIV
-
  * 2,5 µl pYes2 1.2/p13
+
  * 2,5 µl pTUM104 1.2/p13
  * 37°C, 1 h.
  * 37°C, 1 h.
</div>
</div>
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove SpeI from pYES2_RFC25 MCS 1.2 ===
+
=== Quick Change mutagenis to remove SpeI from pTUM104_RFC25 MCS 1.2 ===
-
'''Investigator: Ingmar, Volker'''
+
'''Investigator:''' Ingmar, Volker
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.
+
'''Aim of the experiment:''' Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 803: Line 866:
|}
|}
*The procedure was furthermore applied to P13 and P14.
*The procedure was furthermore applied to P13 and P14.
-
*The vector resulting from the '''PCR-product was named pYes2_RFC25 MCS 1.3'''.
+
*The vector resulting from the '''PCR-product was named pTUM104_RFC25 MCS 1.3'''.
*Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.
*Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.
Line 822: Line 885:
=== Picking of E.&nbsp;coli cells on antibiotic selection plates: pSB1A2 plasmid with BBa_K105005 (LexA) and pSB2K3 plasmid BBa_I15008 (heme oxygenase) ===
=== Picking of E.&nbsp;coli cells on antibiotic selection plates: pSB1A2 plasmid with BBa_K105005 (LexA) and pSB2K3 plasmid BBa_I15008 (heme oxygenase) ===
-
'''Investigator: Jeffery Truong'''
+
'''Investigator:''' Jeffery Truong
-
Aim of the experiment: Picking colonies from transformed E.&nbsp;coli XL1-Blue, 4x picked for each Biobrick.
+
'''Aim of the experiment:''' Picking colonies from transformed E.&nbsp;coli XL1-Blue, 4x picked for each Biobrick.
* pSB1A2 plasmid with BBa_K105005 (LexA): Colonies were on both ampicillin selection plates, the one with diluted cell suspension and the one with concentrated E.&nbsp;coli cell suspension. Typical E.&nbsp;coli colony morphology. Picking was performed on the plate with diluted cell suspension.
* pSB1A2 plasmid with BBa_K105005 (LexA): Colonies were on both ampicillin selection plates, the one with diluted cell suspension and the one with concentrated E.&nbsp;coli cell suspension. Typical E.&nbsp;coli colony morphology. Picking was performed on the plate with diluted cell suspension.
Line 841: Line 904:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove SpeI from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove SpeI from  pTUM104_RFC25 MCS ===
-
'''Investigator: Ingmar'''
+
'''Investigator:''' Ingmar
-
Aim of the experiment: Removal of a SpeI restriction site in the backbone of pYes2.
+
'''Aim of the experiment:''' Removal of a SpeI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 915: Line 978:
=== Verification of the PCR products P30, P31 and P33===
=== Verification of the PCR products P30, P31 and P33===
-
'''Investigator: Saskia, Jara'''
+
'''Investigator:''' Saskia, Jara
-
Aim of the experiment: Verification of the PCR produts P30, P31 and P33
+
'''Aim of the experiment:''' Verification of the PCR produts P30, P31 and P33
'''Nano Drop'''
'''Nano Drop'''
Line 963: Line 1,026:
<div class="coumaryl">
<div class="coumaryl">
-
=== PCR of PAL, 4CL, CHS, OMT (Coumaryl-CoA) ===
+
=== PCR of PAL, 4CL, CHS, OMT (Xanthohumol-CoA) ===
'''Investigator: Daniela, Mary'''
'''Investigator: Daniela, Mary'''
Line 992: Line 1,055:
| 4CL + || 4CL || +|| O21 and O20
| 4CL + || 4CL || +|| O21 and O20
|}
|}
-
 
'''Reaction batch'''
'''Reaction batch'''
Line 1,054: Line 1,116:
|-
|-
|}
|}
-
 
PCR purification
PCR purification
*Purification was done using QIAquick PCR Purification Kit (250)
*Purification was done using QIAquick PCR Purification Kit (250)
-
 
Analytical Gel Electrophoresis:
Analytical Gel Electrophoresis:
Line 1,122: Line 1,182:
=== Repetition of analytic gel of 21st June===
=== Repetition of analytic gel of 21st June===
-
'''Investigator: Andrea'''
+
'''Investigator: Andrea, Lara'''
 +
 
 +
Buffer systems were adjusted. -> only use of one buffer per reaction.
[[File:27.06.12.png|400px]]
[[File:27.06.12.png|400px]]
Line 1,199: Line 1,261:
[[File:29.06. prepgelCHS.jpg|500px|preparative gel of CHS]]
[[File:29.06. prepgelCHS.jpg|500px|preparative gel of CHS]]
-
 
DNA-purification with Kit from Quiagen  
DNA-purification with Kit from Quiagen  
Line 1,206: Line 1,267:
<div class="vector_design">
<div class="vector_design">
-
===  Quick Change mutagenesis to remove PstI in URA3 from pYES2_RFC25 MCS 1.2 ===
+
===  Quick Change mutagenesis to remove PstI in URA3 from pTUM104_RFC25 MCS 1.2 ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 1,285: Line 1,346:
== '''Saturday, June 30th''' ==
== '''Saturday, June 30th''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
* For each transformation of the PCR-products of P29 and P30 a single clone was picked an transferred to 6 ml LB Amp. Incubation overnight at 37°C 180 rpm. The transfomation with the PCR product of P31, P32 and P33 was not successfull. Therfore no clone could be picked from these plates and four instead of one clone was picked from the plates containing the  transformations of P29.
* For each transformation of the PCR-products of P29 and P30 a single clone was picked an transferred to 6 ml LB Amp. Incubation overnight at 37°C 180 rpm. The transfomation with the PCR product of P31, P32 and P33 was not successfull. Therfore no clone could be picked from these plates and four instead of one clone was picked from the plates containing the  transformations of P29.
-
</div>
 
</div>
</div>
-
=July 2012=
 
-
<div class="month" id="MJuly_2012">
 
== '''Sunday, July 1st''' ==
== '''Sunday, July 1st''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 1,376: Line 1,434:
<div class="vector_design">
<div class="vector_design">
-
===  Quick Change mutagenesis to remove PstI in the 2µ ori from pYES2_RFC25 MCS  ===
+
===  Quick Change mutagenesis to remove PstI in the 2µ ori from pTUM104_RFC25 MCS  ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 1,430: Line 1,488:
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 1,474: Line 1,531:
</div>
</div>
 +
</div>
 +
 +
=Week 4=
 +
<!--
 +
<p class="vector_design">'''Vector Design (6 Experiments):'''</p>
 +
* Further Quickchanges for RFC25 compatibility and insertion of Ala before the strep tag
 +
 +
<p class="limonene">'''Limonene (8 Experiments):'''</p>
 +
* Transformation with Schwab plasmids
 +
* PCR of both Schwab and BioBrick to make them RFC25 compatible
 +
 +
<p class="coumaryl">'''Xanthohumol (4 Experiments):'''</p>
 +
* Repetition of PCR with PAL and troubleshooting
 +
 +
<p class="thaumatin">'''Thaumatin (2 Experiments):'''</p>
 +
* Miniprepping reporter BioBricks gfp/egfp/yfp
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (1 Experiment):'''</p>
 +
* Transformation with BioBricks
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (2 Experiments):'''</p>
 +
* PCR of LexA BioBricks to introduce RFC25
 +
 +
<html><a class="WDetails" href="#Week_4" id="Week_4">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_4">
== '''Monday, July 2nd''' ==
== '''Monday, July 2nd''' ==
<div class="coumaryl">
<div class="coumaryl">
Line 1,507: Line 1,590:
|bidest. sterile Water
|bidest. sterile Water
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 1,640: Line 1,722:
===LS: Plating of Schwab expression stains #106 & #108 which contain lavendula limonene synthase===
===LS: Plating of Schwab expression stains #106 & #108 which contain lavendula limonene synthase===
-
'''Investigator: Lara Kuntz'''
+
'''Investigator: Lara'''
Aim of the experiment: To get colonies of BL21 strains containing lavendula LS for amplification and subsequent plasmid extraction.
Aim of the experiment: To get colonies of BL21 strains containing lavendula LS for amplification and subsequent plasmid extraction.
Line 1,648: Line 1,730:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pYes2_RFC25 MCS ===
+
 
 +
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 1,659: Line 1,742:
<div class="limonene">
<div class="limonene">
-
=== PCR of BBa_I742111 (Limonenesynthase) Clone 3 (Trafo 19.06.12) ===
+
=== PCR of BBa_I742111 (Limonenesynthase) Clone 3 (Transformation of 19.06.12) ===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
Line 1,761: Line 1,844:
== '''Wednesday, July 4th''' ==
== '''Wednesday, July 4th''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 1,812: Line 1,895:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to  insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS  ===
+
=== Quick Change mutagenis to  insert Ala in front of the Strep - tag II in pTUM104_RFC25 MCS  ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector; operating purfication possibility via Strep-tag II.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector; operating purfication possibility via Strep-tag II.
'''PCR'''<br>
'''PCR'''<br>
Line 1,892: Line 1,975:
===Analytical Gelelektrophoresis of PCR-Products of PAL===
===Analytical Gelelektrophoresis of PCR-Products of PAL===
-
 
'''Investigator: Mary'''
'''Investigator: Mary'''
Line 1,907: Line 1,989:
-> next steps: new Design of Primer and repetition of PCR with new primers  
-> next steps: new Design of Primer and repetition of PCR with new primers  
-
 
-
 
</div>
</div>
Line 2,003: Line 2,083:
Plasmids were digested, 2 µl loading dye (10x) was added to each sample. Gel was loaded in the following order:
Plasmids were digested, 2 µl loading dye (10x) was added to each sample. Gel was loaded in the following order:
-
1. 6 µl gene ruler 1 kb, 2.-6. 11 µl of: P39, P40, P41, P42, Coumaryl-Plasmid (Katrin)
+
1. 6 µl gene ruler 1 kb, 2.-6. 11 µl of: P39, P40, P41, P42, Xanthohumol-Plasmid (Katrin)
[[File:TUM12_VerdauSchwabPlasmide0507.png]]
[[File:TUM12_VerdauSchwabPlasmide0507.png]]
Line 2,041: Line 2,121:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS ===
+
=== Quick Change mutagenis to insert Ala in front of the Strep - tag II in pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector; operating purfication possibility via Strep-tag II.  
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector; operating purfication possibility via Strep-tag II.  
Operational sequence:
Operational sequence:
Line 2,074: Line 2,154:
== '''Friday, July 6th''' ==
== '''Friday, July 6th''' ==
<div class="vector_design">
<div class="vector_design">
-
===Quick Change mutagenis to insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS===
+
===Quick Change mutagenis to insert Ala in front of the Strep - tag II in pTUM104_RFC25 MCS===
*Afterwards a control digestion of P45 and P46 was done.
*Afterwards a control digestion of P45 and P46 was done.
Line 2,219: Line 2,299:
== '''Saturday, July 7th''' ==
== '''Saturday, July 7th''' ==
<div class="vector_design">
<div class="vector_design">
-
===  Quick Change mutagenesis to insert Ala in front of the Strep-tag II in pYES2_RFC25 MCS  ===
+
===  Quick Change mutagenesis to insert Ala in front of the Strep-tag II in pTUM104_RFC25 MCS  ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector.
*As the sequencing of the first attempt to introduce Ala in front of the Strep-tag II did not show a successfull insertion of Ala, the quickchange mutagense was performed once again with a modified setup. Presumably a formation of primer dimers was responsable for the experiment's results. Therefore the second PCR was operated in two steps as shown below.
*As the sequencing of the first attempt to introduce Ala in front of the Strep-tag II did not show a successfull insertion of Ala, the quickchange mutagense was performed once again with a modified setup. Presumably a formation of primer dimers was responsable for the experiment's results. Therefore the second PCR was operated in two steps as shown below.
'''PCR'''<br>
'''PCR'''<br>
Line 2,273: Line 2,353:
|Pfu Turbo DNA polymerase (2.5 U / µl)
|Pfu Turbo DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 2,318: Line 2,397:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===  Transformation of ''E.coli'' XL1 blue with ADH1 promoter, ADH1 terminator and TEF2 promoter ===
+
===  Transformation of ''E.coli'' XL1 blue with ADH1 promoter (BBa_J63005), ADH1 terminator(BBa_J63002) and TEF2 promoter from Igem Distribution kit===
 +
 
'''Investigator: Georg'''
'''Investigator: Georg'''
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 2 µl of DNA was added to 100 µl of competent cells and gently mixed.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on ampicillin plates for ADH1-P, and ADH1-T and Kanamycin plates for TEF2-Promoter.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin- and kanamycin plates.
 +
</div>
</div>
</div>
 +
=Week 5=
 +
<!--
 +
<p class="limonene">'''Limonene (4 Experiments):'''</p>
 +
* Ligation of Schwab and BioBricks PCR products in pYES and pSB1C3
 +
 +
<p class="coumaryl">'''Xanthohumol (10 Experiments):'''</p>
 +
* Repetition of PCR with PAL
 +
* Transformation with PCR products of OMT, 4Cl and CHS
 +
 +
<p class="thaumatin">'''Thaumatin (1 Experiment):'''</p>
 +
* Preparation of YPD medium
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (10 Experiments):'''</p>
 +
* Phycocyanobilin (PCB) extraction from dried Spirulina platensis powder
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (14 Experiments):'''</p>
 +
*
 +
 +
<html><a class="WDetails" href="#Week_5" id="Week_5">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_5">
== '''Monday, July 9th''' ==
== '''Monday, July 9th''' ==
 +
<div class="constitutive_promoter">
 +
=== Picking of colonies of TEF2-P, ADH1-P, ADH1-T (iGEM)===
 +
'''Investigator:''' Georg
 +
 +
* To 5 µl LB-Medium,5 µl of 1000x stock of ampicillin (ADH-P, ADH1-T) and kanamycin (TEF2-P) were added
 +
* 4 colonies from the plate with TEF2-P and 5 colonies of ADH1-P and ADH1-T were picked
 +
* Each colony was transferred into 5 ml LB-Medium with 1x ampicillin or kanamycin
 +
* Incubation over night at 37°C in the 180rpm cell-culture shaker.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Repetition of picking of colonies of ADH1-P, ADH1-T, TEF2-P from iGEM distribution kit===
 +
 +
'''Investigator''': Georg
 +
 +
* Analytical Gel was loaded with 9 µl digestion and 1 µl 10x buffer
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Repetition of picking of colonies of TEF2-P, ADH1-P, ADH1-T (iGEM)===
 +
'''Investigator:''' Georg
 +
*Only ADH1 promoter showed cell proliferation. The rest showed no proliferation.The reason was a 10x too high amount of antibiotics.
 +
 
 +
*Colonies from  transformation from ADH1-promoter and terminator  were picked again and incubated in LB medium with 
 +
ampicillin at a dilution of 1:1000 and for TEF2 –Promoter with Kanamycin at a dilution of 1:1000
 +
*From the grown colonies from the transformation with ADH1-Promoter then were the plasmids extracted, using the
 +
Quiaprep Spin Miniprep kit from Quiagen
 +
*The extracted ADH1-P DNA was then analytically digested  with XbaI and PstI from Fermentas
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|PSTI (Fermentas)
 +
|-
 +
|1 µl 
 +
|XbaI (Fermentas)
 +
|-
 +
|8 µl
 +
|Tango buffer
 +
|-
 +
|60µl
 +
|dd H20
 +
|-
 +
|=70µl
 +
|'''TOTAL'''
 +
|}
 +
* To 17,5 µl mastermix was 2,5 µl of plasmid DNA added
 +
 +
* to 2,5 ml of DNA 17,5 µl reaction batch were added
 +
* Digestion took place at 37°C for 1 h
 +
</div>
 +
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
=== Phycocyanobilin (PCB) extraction from dried ''Spirulina platensis'' powder (part 1/4) ===
=== Phycocyanobilin (PCB) extraction from dried ''Spirulina platensis'' powder (part 1/4) ===
Line 2,370: Line 2,545:
== '''Tuesday, July 10th''' ==
== '''Tuesday, July 10th''' ==
 +
<div class="constitutive_promoter">
 +
===Analytical digestion of ADH1-P and gelelectrophoresis===
 +
''' Investigator:''' Georg
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|1 µl 
 +
|XbaI (NEB)
 +
|-
 +
|8 µl
 +
|NEB-4 buffer
 +
|-
 +
|0,8 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|59,2 µl
 +
|dd H20
 +
|-
 +
|=70µl
 +
|'''TOTAL'''
 +
|}
 +
 +
[[File:10.07.2012 ADH1 Prom (fertig).PNG]]
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Extraction of ADH1-P, TEF2-T with plasmid===
 +
 +
'''Investigator:''' Georg
 +
 +
* Plasmid-DNA was extracted according to Quiaprep Plasmid extraction kit
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Inoculation of TEF1-P, PGK-P, Cyc-T===
 +
 +
'''Investigator:''' Georg
 +
 +
* Transfomed E. coli cells from iGEM were inoculated onto Amp-LB-Plates in case of PGK1-P and Cyc1-T
 +
* E. coli with TEF1-T were inoculated onto psb1c3
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
Line 2,403: Line 2,626:
== '''Wednesday, July 11th''' ==
== '''Wednesday, July 11th''' ==
 +
<div class="constitutive_promoter">
 +
===Analytical digestion and gelelectrophoresis of ADH1-Terminator and TEF2-P===
 +
 +
'''Investigator:''' Georg
 +
 +
* Transformants of ADH1-T showed no Plasmid
 +
* TEF2 Promoter-colonies were all positive
 +
 +
[[File:20120711 tef2promotor adh1terminator.PNG]]
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Picking of inoculated CYC1-T, TEF1-P, PGK1-P for overnight cultures===
 +
 +
'''Investigator:''' Georg
 +
 +
* To 5 µl LB-Medium,5 µl of 1000x Chloramphenicol were added
 +
* 4 colonies from the plate with TEF1-P, 4 colonies of Cyc-T were picked and 4 colonies of PGK1-P were picked
 +
* Each colony was transferred into 5 ml LB-Medium with 1x Chloramphenicol (TEF1-P)or Amp (PGK1-P, Cyc1-T)
 +
* Incubation over night at 37°C in the 180rpm cell-culture shaker.
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
Line 2,471: Line 2,715:
|bidest. sterile Water
|bidest. sterile Water
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 2,518: Line 2,761:
<div class="coumaryl">
<div class="coumaryl">
-
=== Preparative Digest of pYES_iGEM===
+
=== Preparative Digest of pYES2_iGEM===
'''Investigator: Katrin, Daniela'''
'''Investigator: Katrin, Daniela'''
-
 
'''Digestion of P50 with Xbal and NgOMIV'''
'''Digestion of P50 with Xbal and NgOMIV'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 2,552: Line 2,793:
'''Digestion of P50 with Xbal and PstI'''
'''Digestion of P50 with Xbal and PstI'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 2,581: Line 2,821:
*band 2: P50 digested with XbaI and NgOMIV
*band 2: P50 digested with XbaI and NgOMIV
*70 V, 90 min
*70 V, 90 min
-
 
'''Gelextration'''
'''Gelextration'''
Line 2,730: Line 2,969:
*water bath 16 °C  
*water bath 16 °C  
-
 
</div>
</div>
Line 2,736: Line 2,974:
== '''Thursday, July 12th''' ==
== '''Thursday, July 12th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Genextraction and analytical digestion of CYC1-terminator, TEF1-promoter, and PGK1-Promoter from '''pSB1C3 and pSB1A2===
+
=== Gelextraction and analytical digestion of CYC1-terminator, TEF1-promoter, and PGK1-Promoter from pSB1C3 and pSB1A2===
 +
 
'''Investigator: Georg'''
'''Investigator: Georg'''
 +
*Genes from overnight cultures were extracted, using the Quiaprep gene extraction Kit. Extracted Plasmids then were analytically digested with XbaI and PstI (Fermentas).
*Genes from overnight cultures were extracted, using the Quiaprep gene extraction Kit. Extracted Plasmids then were analytically digested with XbaI and PstI (Fermentas).
Line 2,758: Line 2,998:
|-
|-
|ddH2O
|ddH2O
-
|11,5 µl
+
|165,5 µl
 +
|-
 +
|=175µl
 +
|'''TOTAL'''
|}
|}
-
 
*Analytical gel was run (1% Agarose).
*Analytical gel was run (1% Agarose).
   
   
-
[[File:20120712-PGK1-P,-Cyc-T,-TEf]]
+
[[File:20120712-PGK1-P,-Cyc-T,-TEf.png]]
</div>
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Phycocyanobilin (PCB) extraction from dried ''Spirulina platensis'' powder (part 4/4) ===
=== Phycocyanobilin (PCB) extraction from dried ''Spirulina platensis'' powder (part 4/4) ===
'''Investigator: Martin, Jeff, Alois'''
'''Investigator: Martin, Jeff, Alois'''
Line 2,787: Line 3,030:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Picking of transformated (pGADT7 and pGBKT7) E.&nbsp;coli cells on antibiotic selection plates  ===
+
=== Picking of transformated (pGADT7 and pGBKT7) ''E.coli cells'' on antibiotic selection plates  ===
'''Investigator: Jeff'''
'''Investigator: Jeff'''
Line 2,799: Line 3,042:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of transformated E.&nbsp;coli from overnight culture (8 plasmids containing biobricks)  ===
+
 
 +
=== Miniprep of transformated ''E.coli'' from overnight culture (8 plasmids containing biobricks)  ===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
Line 2,910: Line 3,154:
<div class="coumaryl">
<div class="coumaryl">
-
=== Transformation of Ligationproducts of pYES2 + OMT, 4Cl and CHS in E.coli===
+
=== Transformation of Ligationproducts of pTUM104 + OMT, 4Cl and CHS in ''E.coli''===
'''Investigator: Mary'''
'''Investigator: Mary'''
-
* adding 5µl ligation product in 100µl competent XL blue E.coli cells
+
* adding 5µl ligation product in 100µl competent XL blue ''E.coli'' cells
* incubation 30 min on ice
* incubation 30 min on ice
* 5 min at 37°C
* 5 min at 37°C
Line 2,929: Line 3,173:
only with PAL+, 3 different temperatures (see cycling parameters) and one batch at 52.5 °C with DMSO
only with PAL+, 3 different temperatures (see cycling parameters) and one batch at 52.5 °C with DMSO
-
 
'''Reaction batch'''
'''Reaction batch'''
Line 2,957: Line 3,200:
|ddH2O
|ddH2O
|}
|}
-
 
'''Reaction batch with DMSO'''
'''Reaction batch with DMSO'''
Line 2,988: Line 3,230:
|ddH2O
|ddH2O
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 3,023: Line 3,264:
|-
|-
|}
|}
-
 
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 3,059: Line 3,298:
|-
|-
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 3,262: Line 3,500:
<div class="limonene">
<div class="limonene">
-
=== Preperative gel electrophoresis ===
+
=== Preparative gel electrophoresis of digested plasmids PCR1-PCR7 and PCR9 ===
'''Investigator: Andrea'''  
'''Investigator: Andrea'''  
'''Aim of the experiment:''' Analytical gel electrophoresis of products from restriction digest of plasmids PCR1 - PCR7 and PCR9
'''Aim of the experiment:''' Analytical gel electrophoresis of products from restriction digest of plasmids PCR1 - PCR7 and PCR9
 +
 +
Limonensynthase: 1600 bp
[[File:12.07.12 prep digest1.png|400px]]
[[File:12.07.12 prep digest1.png|400px]]
Line 3,559: Line 3,799:
== '''Friday, July 13th''' ==
== '''Friday, July 13th''' ==
 +
<div class="constitutive_promoter">
 +
=== Transformation of ADH1-T ===
 +
 +
'''Procedure:'''
 +
 +
'''Investigator''': Georg
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 2 µl of ADH-T plasmid was added to 100 µl of competent cells and gently mixed.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on ampicillin plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin plates.
 +
</div>
 +
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
=== PCR of P73, P80 and P81 to add RFC25 pre- and suffix ===
=== PCR of P73, P80 and P81 to add RFC25 pre- and suffix ===
Line 3,646: Line 3,912:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Preperative digestion and gelelectrophoresis of P79 and O56??? ===
+
=== Preperative digestion and gelelectrophoresis of P79 and O56 ===
'''Investigator:''' Jeff, Saskia, Georg
'''Investigator:''' Jeff, Saskia, Georg
Line 3,666: Line 3,932:
'''Digestion of P19 with ApaI'''
'''Digestion of P19 with ApaI'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 3,692: Line 3,957:
*band 2: P50 digested with XbaI and NgOMIV
*band 2: P50 digested with XbaI and NgOMIV
*70 V, 90 min
*70 V, 90 min
-
 
'''Gelextration'''
'''Gelextration'''
Line 3,735: Line 3,999:
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 3,782: Line 4,045:
[[File:TUM12 gradient PCR PAL 13.07.2012.jpg|500px|Gel picture of gradient PCR of P19]]
[[File:TUM12 gradient PCR PAL 13.07.2012.jpg|500px|Gel picture of gradient PCR of P19]]
*A bond at the expected length of 2160 bp appears at 47 °C. Therefore a PCR using this primer annealing temperature will done on sunday.
*A bond at the expected length of 2160 bp appears at 47 °C. Therefore a PCR using this primer annealing temperature will done on sunday.
-
 
</div>
</div>
Line 3,789: Line 4,051:
===Transformation of P94 - P97 (ligationproducts of pSB1C3 with CHS and OMT respectively) in ''E.coli''===
===Transformation of P94 - P97 (ligationproducts of pSB1C3 with CHS and OMT respectively) in ''E.coli''===
Investigator: Daniela
Investigator: Daniela
-
* adding 5µl ligation product (P94-P97) in 100µl competent XL blue E.coli cells
+
* adding 5µl ligation product (P94-P97) in 100µl competent XL blue ''E.coli'' cells
* incubation 30 min on ice
* incubation 30 min on ice
* 5 min at 37°C
* 5 min at 37°C
Line 3,805: Line 4,067:
'''Transformation'''
'''Transformation'''
-
* adding 5µl ligation product (PCR1-PCR7) in 100µl competent XL blue E.coli cells
+
* adding 5µl ligation product (PCR1-PCR7) in 100µl competent XL blue ''E.coli'' cells
* incubation 30 min on ice
* incubation 30 min on ice
* 5 min at 37°C
* 5 min at 37°C
Line 3,817: Line 4,079:
'''Investigator: A lot of Alois, Martin'''
'''Investigator: A lot of Alois, Martin'''
-
 
'''Manual for YPD production'''
'''Manual for YPD production'''
Line 3,829: Line 4,090:
*20 g peptone
*20 g peptone
*20 g dextrose (see note below if making plates)
*20 g dextrose (see note below if making plates)
-
 
2. Autoclave for 20 minutes on liquid cycle.
2. Autoclave for 20 minutes on liquid cycle.
-
 
3. Store medium at room temperature. The shelf life is approximately one to two months.
3. Store medium at room temperature. The shelf life is approximately one to two months.
Line 3,891: Line 4,150:
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 3,936: Line 4,194:
[[File:TUM12_120716_PCR_PALconsless.jpg|800px|Analytical gelelectrophoresis of PCR product of PAL]]
[[File:TUM12_120716_PCR_PALconsless.jpg|800px|Analytical gelelectrophoresis of PCR product of PAL]]
 +
</div>
</div>
</div>
 +
=Week 6=
 +
<!--
 +
<p class="vector_design">'''Vector Design (2 Experiments):'''</p>
 +
*
 +
 +
<p class="limonene">'''Limonene (6 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (17 Experiments):'''</p>
 +
*
 +
 +
<p class="thaumatin">'''Thaumatin (3 Experiments):'''</p>
 +
* Inoculation of YPD medium with S. cerevisiae and brewing yeast strain 34/70
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (6 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (16 Experiments):'''</p>
 +
*
 +
 +
<html><a class="WDetails" href="#Week_6" id="Week_6">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_6">
== '''Monday, July 16th ''' ==
== '''Monday, July 16th ''' ==
 +
<div class="constitutive_promoter">
 +
===Inoculation of ADH1-T (iGEM)===
 +
 +
'''Investigator:''' Georg
 +
 +
* Transformantion with ADH1-T didn't go well
 +
* By iGEM transformed cells with ADH1-T were inoculated onto Amp-LB-Plates
 +
* Cells were to grow at room-temperature over the weekend
 +
</div>
 +
<div class="constitutive_promoter">
<div class="constitutive_promoter">
=== Preparative digestion and gelelectrophoresis of P86 and P55 ===
=== Preparative digestion and gelelectrophoresis of P86 and P55 ===
'''Investigator:'''Georg
'''Investigator:'''Georg
'''Aim of the experiment:''' Digestion of CYC1-Terminator, ADH1-Promoter for ligation '''
'''Aim of the experiment:''' Digestion of CYC1-Terminator, ADH1-Promoter for ligation '''
-
 
* Preparative digestion after manufacturer's advice (NEB) with 20 u PstI and 20 u XbaI in 1x Tango buffer with 25 µl DNA and 4 µl NEB4 10x buffer and 0,4 µl 100x BSA. Water was added to a volume of 40 µl. Restriction time was 3 hours at 37 °C; 3 hours.
* Preparative digestion after manufacturer's advice (NEB) with 20 u PstI and 20 u XbaI in 1x Tango buffer with 25 µl DNA and 4 µl NEB4 10x buffer and 0,4 µl 100x BSA. Water was added to a volume of 40 µl. Restriction time was 3 hours at 37 °C; 3 hours.
Line 3,949: Line 4,240:
* Preparative gelelectrophoresis after laboratory's standart protocol. (70&nbsp;V, 90&nbsp;min)
* Preparative gelelectrophoresis after laboratory's standart protocol. (70&nbsp;V, 90&nbsp;min)
-
[[File:Preparative digestion ADH1-p, CYC1-t.jpg]]
+
[[File:Preparative digestion ADH1-p, CYC1-t.png]]
* Gel was stored at -20 °C.
* Gel was stored at -20 °C.
-
 
</div>
</div>
Line 4,030: Line 4,320:
'''Aim of the experiment:''' Analytical restriction digest of plasmids p116, p117, p118, p119, p120, p121, p122.
'''Aim of the experiment:''' Analytical restriction digest of plasmids p116, p117, p118, p119, p120, p121, p122.
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 4,060: Line 4,349:
<div class="limonene">
<div class="limonene">
-
=== Analytical gel electrophoresis ===
+
=== Analytical gel electrophoresis of p116-p122 ===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 4,091: Line 4,380:
'''Aim of the experiment:''' Get a lot of pSB1C3 for further experiments
'''Aim of the experiment:''' Get a lot of pSB1C3 for further experiments
-
Midipreparation of the pellet from over night cultures (E.coli, Transformed with pSB1C3 - RFC25; name in registry: K365005)
+
Midipreparation of the pellet from over night cultures (''E.coli'', Transformed with pSB1C3 - RFC25; name in registry: K365005)
was done with the Midiprep Kit from Qiagen
was done with the Midiprep Kit from Qiagen
Line 4,099: Line 4,388:
</div>
</div>
-
<div=coumaryl>
+
<div=Xanthohumol>
<div class="coumaryl">
<div class="coumaryl">
Line 4,171: Line 4,460:
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|Pfu Ultra II DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 4,230: Line 4,518:
== '''Tuesday, July 17th ''' ==
== '''Tuesday, July 17th ''' ==
 +
<div class="constitutive_promoter">
 +
===Picking of ADH1-T colonies===
 +
 +
'''Investigator:''' Georg
 +
 +
* To 5 µl LB-Medium,5 µl of 1000x Amp were added
 +
* 5 colonies from the plate with ADH1-P were picked
 +
* Each colony was transferred into 5 ml LB-Medium with Chloramphenicol
 +
* Incubation over night at 37°C in the 180rpm cell-culture shaker.
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
Line 4,238: Line 4,536:
===Preparative digest of P123 (pSB1C3 RFC25)===
===Preparative digest of P123 (pSB1C3 RFC25)===
'''Investigator: Mary, Daniela'''
'''Investigator: Mary, Daniela'''
-
 
'''Digestion of P123 with Xbal/PstI and XbaI/AgeI
'''Digestion of P123 with Xbal/PstI and XbaI/AgeI
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 4,290: Line 4,586:
Incubation: 37 °C, 3 h
Incubation: 37 °C, 3 h
-
 
'''DNA preparative gel electrophoresis'''
'''DNA preparative gel electrophoresis'''
Line 4,297: Line 4,592:
*band 2: P123 digested with XbaI and AgeI
*band 2: P123 digested with XbaI and AgeI
*70 V, 90 min
*70 V, 90 min
-
 
'''Gelextration'''
'''Gelextration'''
Line 4,317: Line 4,611:
'''investigator: ''' Daniela, Mary
'''investigator: ''' Daniela, Mary
-
'''Aim of the experiment:''' digestion of PCR-Products to gain the correct cutting sites for ligation in pYES2 and pSB1C3 afterwards
+
'''Aim of the experiment:''' digestion of PCR-Products to gain the correct cutting sites for ligation in pTUM104 and pSB1C3 afterwards
Purification of PCR-Products with PCR-Purification Kit
Purification of PCR-Products with PCR-Purification Kit
Line 4,357: Line 4,651:
<div class="coumaryl">
<div class="coumaryl">
-
=== Repetition of ligation of PCR 15-20 (4CL, CHS and OMT) with pYES (P71 and P72 respectively)===
+
=== Repetition of ligation of PCR 15-20 (4CL, CHS and OMT) with pTUM104 (P71 and P72 respectively)===
'''Investigator: Mary, Daniela'''
'''Investigator: Mary, Daniela'''
Line 4,495: Line 4,789:
*water bath 16 °C  
*water bath 16 °C  
-
 
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of ligationproducts of 4CL, OMT and CHS respectively in pYES in ''E.coli''===
+
===Transformation of ligationproducts of 4CL, OMT and CHS respectively in pTUM104 in ''E.coli''===
Investigator: Mary,Daniela
Investigator: Mary,Daniela
Line 4,510: Line 4,803:
results:
results:
-
*CHS+ in pYES (P72) 100 µl: 7 clones
+
*CHS+ in pTUM104 (P72) 100 µl: 7 clones
-
*CHS- in pYES (P72) 100 µl: 9 clones
+
*CHS- in pTUM104 (P72) 100 µl: 9 clones
-
*CHS+ in pYES (P72) Pellet: 111 clones
+
*CHS+ in pTUM104 (P72) Pellet: 111 clones
-
*CHS- in pYES (P72) Pellet: 77 clones
+
*CHS- in pTUM104 (P72) Pellet: 77 clones
-
*4CL+ in pYES (P71) 100 µl: 9 clones
+
*4CL+ in pTUM104 (P71) 100 µl: 9 clones
-
*4CL- in pYES (P71) 100 µl: 3 clones
+
*4CL- in pTUM104 (P71) 100 µl: 3 clones
-
*4CL+ in pYES (P71) Pellet: 47 clones
+
*4CL+ in pTUM104 (P71) Pellet: 47 clones
-
*4CL- in pYES (P71) Pellet: 45 clones
+
*4CL- in pTUM104 (P71) Pellet: 45 clones
-
*OMT+ in pYES (P72) 100 µl: 7 clones
+
*OMT+ in pTUM104 (P72) 100 µl: 7 clones
-
*OMT- in pYES (P72) 100 µl: 5 clones
+
*OMT- in pTUM104 (P72) 100 µl: 5 clones
-
*OMT+ in pYES (P72) Pellet: 30 clones
+
*OMT+ in pTUM104 (P72) Pellet: 30 clones
-
*OMT- in pYES (P72) Pellet: 53 clones
+
*OMT- in pTUM104 (P72) Pellet: 53 clones
*negative control P71 100 µl: 14
*negative control P71 100 µl: 14
Line 4,549: Line 4,842:
== '''Wednesday, July 18th''' ==
== '''Wednesday, July 18th''' ==
 +
<div class="constitutive_promoter">
 +
=== Minipreparation of ADH1-T Plasmids===
 +
 +
'''Investigator:''' Georg
 +
* ADH1-T Plasmids were extracted according to protocoll of Quiaprep gelextraction protocoll
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Analytical digestion of ADH1-T and gelelectrophoresis===
 +
'''Investigator:''' Georg
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1,25 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|1,25 µl 
 +
|XbaI (NEB)
 +
|-
 +
|5 µl
 +
|NEB-4 buffer
 +
|-
 +
|0,5 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|79,5 µl
 +
|dd H20
 +
|-
 +
|= 87,5µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* 17,5 µl Mastermix were added to 2,5 µl plasid DNA
 +
 +
[[File:20120718  BBa_j63002.PNG]]
 +
 +
* They have sent the wrong insert
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Ligation of plasmid pSB1C3 containing 20aaLinker with LexA and plasmid containing Gal4AD with Pif3 for fusion protein construction ===
+
 
 +
=== Ligation of plasmid pSB1C3 containing 20aaLinker with LexA and plasmid containing Gal4AD with Pif3 for fusion protein construction<br> ===
</div>
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of overnight culture from picked transformed E. coli containing biobrick BBa_K165055 ===
+
 
 +
=== Miniprep of overnight culture from picked transformed ''E. coli'' containing biobrick BBa_K165055 ===
</div>
</div>
<div class="thaumatin">
<div class="thaumatin">
 +
=== Inoculation of YPD medium with ''S. cerevisiae'' and brewing yeast strain 34/70 (part 2/3) ===
=== Inoculation of YPD medium with ''S. cerevisiae'' and brewing yeast strain 34/70 (part 2/3) ===
Line 4,564: Line 4,901:
'''Aim of the experiment:''' Discrimination of growing ability in wort medium.
'''Aim of the experiment:''' Discrimination of growing ability in wort medium.
-
 
After 12h of cultivating the optical density (OD) at 550nm was determined:
After 12h of cultivating the optical density (OD) at 550nm was determined:
-
 
{|cellspacing="0" border="2"
{|cellspacing="0" border="2"
Line 4,642: Line 4,977:
| + 0.1
| + 0.1
|}
|}
-
 
-
 
After 12h of cultivating the ''S. cerevisiae'' is growing quite well. There is a tendency that the brewing yeast strain 34/70 is not capable to grow sufficiently in autoclaved (e.g. proteinfree) medium. Since the 34/70 was stored at 4°C over 5 days, directly used to inoculate the medium (no preparatory culture) and we only used 1ml to inoculate with (compared to 5ml of the preparatory culture of ''S. cerevisiae'' - because of obvious differences in opacity of the inoculation media) there is not yet a conclusion to be drawn. We decided to incubate for another 24h at least.
After 12h of cultivating the ''S. cerevisiae'' is growing quite well. There is a tendency that the brewing yeast strain 34/70 is not capable to grow sufficiently in autoclaved (e.g. proteinfree) medium. Since the 34/70 was stored at 4°C over 5 days, directly used to inoculate the medium (no preparatory culture) and we only used 1ml to inoculate with (compared to 5ml of the preparatory culture of ''S. cerevisiae'' - because of obvious differences in opacity of the inoculation media) there is not yet a conclusion to be drawn. We decided to incubate for another 24h at least.
Line 4,649: Line 4,982:
<div class="vector_design">
<div class="vector_design">
-
=== new Miniprep of P50 pYES2 ===
+
=== New Miniprep of P50 pTUM104 ===
'''Investigators: Andrea'''
'''Investigators: Andrea'''
Line 4,657: Line 4,990:
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of P50 (pYes) in ''E.coli''===
+
 
 +
===Transformation of P50 (pTUM104) in ''E.coli''===
Investigator: Katrin
Investigator: Katrin
-
'''Aim of the experiment:''' Get more P50(pYes) for further experiments
+
'''Aim of the experiment:''' Get more P50(pTUM104) for further experiments
* adding 2-3 µl of plasmid P50 in 100µl competent XL blue E.coli cells
* adding 2-3 µl of plasmid P50 in 100µl competent XL blue E.coli cells
* incubation 30 min on ice
* incubation 30 min on ice
Line 4,669: Line 5,003:
<div class="coumaryl">
<div class="coumaryl">
-
===Ligation of 4CL and PAL in pSB1C3-RFC25 and ligation of PAL in pYES===
+
===Ligation of 4CL and PAL in pSB1C3-RFC25 and ligation of PAL in pTUM104===
Investigator: Katrin, Daniela
Investigator: Katrin, Daniela
Line 4,766: Line 5,100:
|}
|}
-
PAL+ (PCR 32) with P72 (pYES)
+
PAL+ (PCR 32) with P72 (pTUM104)
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
|'''volume'''
|'''volume'''
Line 4,787: Line 5,121:
|}
|}
-
PAL- (PCR 33) with P72 (pYES)
+
PAL- (PCR 33) with P72 (pTUM104)
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
|'''volume'''
|'''volume'''
Line 4,883: Line 5,217:
<div class="coumaryl">
<div class="coumaryl">
-
=== Picking clones of 4CL, CHS and OMT in pYES ===
+
=== Picking clones of 4CL, CHS and OMT in pTUM104 ===
'''investigator: ''' Katrin, Daniela
'''investigator: ''' Katrin, Daniela
Line 4,906: Line 5,240:
*P126+PCR31 ->Amp
*P126+PCR31 ->Amp
*negative control: NK2 ->Amp
*negative control: NK2 ->Amp
-
 
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells
Line 4,957: Line 5,290:
'''Aim of the experiment:''' Discrimination of growing ability in wort medium.
'''Aim of the experiment:''' Discrimination of growing ability in wort medium.
-
 
After 40h of cultivating the optical density (OD) at 550nm was determined:
After 40h of cultivating the optical density (OD) at 550nm was determined:
-
 
{|cellspacing="0" border="2"
{|cellspacing="0" border="2"
Line 5,044: Line 5,375:
| + 0.2
| + 0.2
|}
|}
-
 
-
 
After 40h of cultivating the ''S. cerevisiae'' is growing comparably to the brewing yeast strain, though we seem to have entered a phase of substrate limitation.
After 40h of cultivating the ''S. cerevisiae'' is growing comparably to the brewing yeast strain, though we seem to have entered a phase of substrate limitation.
Line 5,138: Line 5,467:
<div class="limonene">
<div class="limonene">
-
===Preparative gel===
+
===Preparative gel of pSB1C3 and pTUM104===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
*40 µl pSB1C3 + 4 µl loading dye
*40 µl pSB1C3 + 4 µl loading dye
-
*40 µl pYES2 + 4 µl loading dye
+
*40 µl pTUM104 + 4 µl loading dye
*20 µl PCR1 + 2 µl loading dye
*20 µl PCR1 + 2 µl loading dye
 +
 +
*Limonensynthase: 1600 bp
 +
*pTUM104: 5800 bp
 +
*pSB1C3: 2000bp
[[File:19.07.12-prep-gel.png|400px]]
[[File:19.07.12-prep-gel.png|400px]]
Line 5,157: Line 5,490:
Concentration (Nano Drop: <br />
Concentration (Nano Drop: <br />
LIMS Citrus (PCR 1) = 18.6 ng/µl<br />
LIMS Citrus (PCR 1) = 18.6 ng/µl<br />
-
<br />
 
P50 (digested with XbaI and NgoMIV) = 24.9 ng/µl<br />
P50 (digested with XbaI and NgoMIV) = 24.9 ng/µl<br />
-
<br />
 
P123 (digested with XbaI and AgeI) = 44.5 ng/µl<br />
P123 (digested with XbaI and AgeI) = 44.5 ng/µl<br />
Line 5,187: Line 5,518:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep of 4CL, CHS and OMT in pYES (P71 and P72)===
+
===Miniprep of 4CL, CHS and OMT in pTUM104 (P71 and P72)===
Investigator: Daniela
Investigator: Daniela
-
'''Aim of the experiment''': Extract plasmids (pYES) that contain 4CL, CHS and OMT
+
'''Aim of the experiment''': Extract plasmids (pTUM104) that contain 4CL, CHS and OMT
The day before 2 clones were picked for each enzyme.
The day before 2 clones were picked for each enzyme.
Line 5,199: Line 5,530:
Concentration:
Concentration:
-
*4CL+ in pYES clone 1: c = 172.5 ng/µl
+
*4CL+ in pTUM104 clone 1: c = 172.5 ng/µl
-
*4CL- in pYES clone 1: c = 192.1 ng/µl
+
*4CL- in pTUM104 clone 1: c = 192.1 ng/µl
-
*CHS+ in pYES clone 1: c = 136.6 ng/µl
+
*CHS+ in pTUM104 clone 1: c = 136.6 ng/µl
-
*CHS- in pYES clone 1: c = 85.7 ng/µl
+
*CHS- in pTUM104 clone 1: c = 85.7 ng/µl
-
*OMT+ in pYES clone 1: c = 116.0 ng/µl
+
*OMT+ in pTUM104 clone 1: c = 116.0 ng/µl
-
*OMT- in pYES clone 1: c = 129.7 ng/µl
+
*OMT- in pTUM104 clone 1: c = 129.7 ng/µl
-
 
+
-
*4CL+ in pYES clone 2: c = 160.0 ng/µl
+
-
*4CL- in pYES clone 2: c = 144.5 ng/µl
+
-
*CHS+ in pYES clone 2: c = 128.5 ng/µl
+
-
*CHS- in pYES clone 2: c = 116.2 ng/µl
+
-
*OMT+ in pYES clone 2: c = 142.8 ng/µl
+
-
*OMT- in pYES clone 2: c = 134.5 ng/µl
+
 +
*4CL+ in pTUM104 clone 2: c = 160.0 ng/µl
 +
*4CL- in pTUM104 clone 2: c = 144.5 ng/µl
 +
*CHS+ in pTUM104 clone 2: c = 128.5 ng/µl
 +
*CHS- in pTUM104 clone 2: c = 116.2 ng/µl
 +
*OMT+ in pTUM104 clone 2: c = 142.8 ng/µl
 +
*OMT- in pTUM104 clone 2: c = 134.5 ng/µl
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
===Control digest of 4CL, CHS and OMT in pYES===
+
===Control digest of 4CL, CHS and OMT in pTUM104===
Investigator: Daniela
Investigator: Daniela
-
'''Aim of the experiment:''' Test whether the ligation of 4CL, CHS and OMT in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of 4CL, CHS and OMT in pTUM104 was successful
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 5,228: Line 5,558:
|-
|-
|2.5 µl
|2.5 µl
-
|4CL+ in pYES clone 1 / 4CL- in pYES clone 1
+
|4CL+ in pTUM104 clone 1 / 4CL- in pTUM104 clone 1
|-
|-
|0.25 µl
|0.25 µl
Line 5,251: Line 5,581:
|-
|-
|3 µl
|3 µl
-
|4CL+ in pYES clone 2
+
|4CL+ in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,274: Line 5,604:
|-
|-
|3.5 µl
|3.5 µl
-
|4CL- in pYES clone 2
+
|4CL- in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,297: Line 5,627:
|-
|-
|3.5 µl
|3.5 µl
-
|CHS+ in pYES clone 1 / OMT+ in pYES clone 1 / OMT- in pYES clone 1 / CHS+ in pYES clone 2 / OMT+ in pYES clone 2 / OMT- in pYES clone 2
+
|CHS+ in pTUM104 clone 1 / OMT+ in pTUM104 clone 1 / OMT- in pTUM104 clone 1 / CHS+ in pTUM104 clone 2 / OMT+ in pTUM104 clone 2 / OMT- in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,320: Line 5,650:
|-
|-
|4 µl
|4 µl
-
|CHS- in pYES clone 2
+
|CHS- in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,343: Line 5,673:
|-
|-
|5 µl
|5 µl
-
|CHS- in pYES clone 1
+
|CHS- in pTUM104 clone 1
|-
|-
|0.25 µl
|0.25 µl
Line 5,362: Line 5,692:
expected bands:
expected bands:
-
*pYES: about 5800bp
+
*pTUM104: about 5800bp
*4CL: 1685bp
*4CL: 1685bp
*CHS: 1173bp
*CHS: 1173bp
Line 5,373: Line 5,703:
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of ligationsproducts of 4CL and PAL in pSB1C3-RFC25 and of PAL in pYES in ''E.coli'' (see July, 18th)===
+
===Transformation of ligationsproducts of 4CL and PAL in pSB1C3-RFC25 and of PAL in pTUM104 in ''E.coli'' (see July, 18th)===
Investigator: Daniela
Investigator: Daniela
Line 5,380: Line 5,710:
*PAL+ (PCR32) in pSB1C3-RFC25 (P133) ->Chlp
*PAL+ (PCR32) in pSB1C3-RFC25 (P133) ->Chlp
*PAL- (PCR33) in pSB1C3-RFC25 (P133) ->Chlp
*PAL- (PCR33) in pSB1C3-RFC25 (P133) ->Chlp
-
*PAL+ (PCR32) in pYES(P72) ->Amp
+
*PAL+ (PCR32) in pTUM104(P72) ->Amp
-
*PAL- (PCR33) in pYES(P72) ->Amp
+
*PAL- (PCR33) in pTUM104(P72) ->Amp
*negative control: P72 ->Amp
*negative control: P72 ->Amp
*negative control: P132 ->Chlp
*negative control: P132 ->Chlp
*negative control: P133 ->Chlp
*negative control: P133 ->Chlp
-
 
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells
Line 5,396: Line 5,725:
== '''Friday, July 20th''' ==
== '''Friday, July 20th''' ==
 +
<div class="constitutive_promoter">
 +
===Preparative Digestion of PGK1-P, TEF2-T, TEF1-P and gelelectrophoresis===
 +
 +
'''Investigator:''' Georg
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|3,3 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|3,3 µl 
 +
|XbaI (NEB)
 +
|-
 +
|13,2µl
 +
|NEB-4 buffer
 +
|-
 +
|1,32 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|44,88 µl
 +
|dd H20
 +
|-
 +
|=72µl
 +
|'''TOTAL'''
 +
|}
 +
* 20 µl preparative mastermix were mixed with 20 µl of plasmid-DNA
 +
* Preparative gelelectrophoresis was processed for 90 min at 70 V
 +
 +
[[File:20120720 tef2 pgk1.PNG]]
 +
[[File:20120720 TEF1-Promoter.PNG]]
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Gel purification of Xba1/ Age1 digested P79  ===
=== Gel purification of Xba1/ Age1 digested P79  ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 5,411: Line 5,775:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of transformed ''E.&nbsp;coli'' XL1-Blue with pYES2 new from P50 tube (4x), BBa_K365005 (4x), BBa_K207000 (1x)and BBa_K207001 (1x)  ===
+
=== Miniprep of transformed ''E.&nbsp;coli'' XL1-Blue with pTUM104 new from P50 tube (4x), BBa_K365005 (4x), BBa_K207000 (1x)and BBa_K207001 (1x)  ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
Line 5,524: Line 5,888:
<div class="vector_design">
<div class="vector_design">
-
===Control digest of pYES (P153 and P154)===
+
===Control digest of pTUM104 (P153 and P154)===
Investigator: Mary, Ingmar, Daniela
Investigator: Mary, Ingmar, Daniela
-
'''Aim of the experiment:''' Test whether the vector pYES is right.
+
'''Aim of the experiment:''' Test whether the vector pTUM104 is right.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 5,780: Line 6,144:
|ddH2O
|ddH2O
|}
|}
-
 
*P153
*P153
[[File:TUM12_20120720analyt.verdau_P153.jpg]]
[[File:TUM12_20120720analyt.verdau_P153.jpg]]
-
 
*P154
*P154
Line 5,791: Line 6,153:
The vector seems to be correct. However NgoMIV did not digest the plasmid properly.
The vector seems to be correct. However NgoMIV did not digest the plasmid properly.
</div>
</div>
 +
== '''Saturday, July 21st''' ==
== '''Saturday, July 21st''' ==
Line 5,878: Line 6,241:
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
=== Preparative digest of pYes2 RFC 25 and ligation with PCR products PCR 15 - 20 and 32+33 ===
+
=== Preparative digest of pTUM104 RFC25 and ligation with PCR products PCR 15 - 20 and 32+33 ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
'''Aim of the experiment:''' Intsert the genes of PAL, 4CL, CHS and OMT in pYEs2 RFC 25 in order to test their expression in yeast.
+
'''Aim of the experiment:''' Intsert the genes of PAL, 4CL, CHS and OMT in pTUM104 RFC 25 in order to test their expression in yeast.
-
 
+
'''Preparative digest of P 154 with XbaI and NgoMIV and of P 153 with XbaI and PstI'''
'''Preparative digest of P 154 with XbaI and NgoMIV and of P 153 with XbaI and PstI'''
Line 5,931: Line 6,293:
Incubation: 37 °C, 3 h
Incubation: 37 °C, 3 h
-
 
'''DNA preparative gel electrophoresis'''
'''DNA preparative gel electrophoresis'''
Line 5,940: Line 6,301:
[[File:xxx.jpg|500px|Gel picture of control digest with PstI]]
[[File:xxx.jpg|500px|Gel picture of control digest with PstI]]
*All digest products show the expected bonds at 5849 bp (digest with XbaI and NgoMIV) and 5785 bp (digest with XbaI and PstI) respectively.
*All digest products show the expected bonds at 5849 bp (digest with XbaI and NgoMIV) and 5785 bp (digest with XbaI and PstI) respectively.
-
 
'''Gelextration'''
'''Gelextration'''
Line 6,038: Line 6,398:
|}
|}
</div>
</div>
 +
</div>
 +
 +
=Week 7=
 +
<!--
 +
<p class="limonene">'''Limonene (7 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (18 Experiments):'''</p>
 +
*
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (2 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (15 Experiments):'''</p>
 +
*
 +
<html><a class="WDetails" href="#Week_7" id="Week_7">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_7">
== '''Monday, July 23rd''' ==
== '''Monday, July 23rd''' ==
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep of PAL, 4CL in pSB1C3 and PAL in pYES===
+
===Miniprep of PAL, 4CL in pSB1C3 and PAL in pTUM104===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment''': Extract plasmids (pYES and pSB1C3-RFC25) that contain 4CL and PAL´
+
'''Aim of the experiment''': Extract plasmids (pTUM104 and pSB1C3-RFC25) that contain 4CL and PAL´
The day before one clone were picked for each enzyme from plates from 19th July 2012.
The day before one clone were picked for each enzyme from plates from 19th July 2012.
Line 6,059: Line 6,437:
*PAL- (PCR33) in pSB1C3-RF25 (P133): c = 255 ng/µl -> new name of Ligationproduct after Miniprep: P188
*PAL- (PCR33) in pSB1C3-RF25 (P133): c = 255 ng/µl -> new name of Ligationproduct after Miniprep: P188
-
*PAL+ (PCR32) in pYES (P72): c = 190 ng/µl
+
*PAL+ (PCR32) in pTUM104 (P72): c = 190 ng/µl
-
*PAL- (PCR33) in pYES (P72): c = 238 ng/µl
+
*PAL- (PCR33) in pTUM104 (P72): c = 238 ng/µl
-
 
+
-
 
+
</div>
</div>
Line 6,068: Line 6,444:
<div class="coumaryl">
<div class="coumaryl">
-
===Control digest of 4CL, PAL in pSB1C3-RFC25 and PAL in pYES===
+
===Control digest of 4CL, PAL in pSB1C3-RFC25 and PAL in pTUM104===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL in pSB1C3-RFC25 and PAL in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL in pSB1C3-RFC25 and PAL in pTUM104 was successful
Plasmids are taken from miniprep from 23.07.2012
Plasmids are taken from miniprep from 23.07.2012
Line 6,144: Line 6,520:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands:
expected bands:
-
*pYES: about 5800bp
+
*pTUM104: about 5800bp
*pSB1C3-RFC25: 2070bp
*pSB1C3-RFC25: 2070bp
*4CL: 1685bp
*4CL: 1685bp
Line 6,154: Line 6,529:
[[File:TUM12_120723_kontrollverdau_wdh.jpg|500px]]
[[File:TUM12_120723_kontrollverdau_wdh.jpg|500px]]
-
Ligation of PAL+/- in pYES was not succesful
+
Ligation of PAL+/- in pTUM104 was not succesful
Ligation of PAL+/- and 4CL+/- in pSB1C3-RFC25 were succesful! (pSB1C3 is overlapping with PAL)
Ligation of PAL+/- and 4CL+/- in pSB1C3-RFC25 were succesful! (pSB1C3 is overlapping with PAL)
Line 6,165: Line 6,540:
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' solubilisation of the synthetic gene of APT and transformation of sent plasmid (including APT) in E.coli to copy it if necessary
+
'''Aim of the experiment:''' solubilisation of the synthetic gene of APT and transformation of sent plasmid (including APT) in ''E.coli'' to copy it if necessary
short zentrifugation of sent product and adding 50µl bidest. H2O to it (5µg in 50µl = concentration of 0.1 µg/µl)
short zentrifugation of sent product and adding 50µl bidest. H2O to it (5µg in 50µl = concentration of 0.1 µg/µl)
Line 6,172: Line 6,547:
2µl of solved product used for transformation in Ecoli (Kit of Quiagen) and Amp-resistance (said GeneArt)
2µl of solved product used for transformation in Ecoli (Kit of Quiagen) and Amp-resistance (said GeneArt)
Plating cells on Agar with Amp, 37°C over night
Plating cells on Agar with Amp, 37°C over night
-
 
</div>
</div>
Line 6,208: Line 6,582:
   
   
Incubation: 37°C, 2.5h
Incubation: 37°C, 2.5h
-
 
Bond at 1244bp as expected:
Bond at 1244bp as expected:
-
 
[[File:TUM12_120723_prepGel_von_APT.jpg|500px]]
[[File:TUM12_120723_prepGel_von_APT.jpg|500px]]
Line 6,221: Line 6,593:
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of  ligationsproducts of 4CL, CHS, OMT  and PAL in pYES in E.Coli (Ligation see 22th of July)===
+
===Transformation of  ligationsproducts of 4CL, CHS, OMT  and PAL in pTUM104 in ''E.Coli'' (Ligation see 22th of July)===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' ligation of enzymes in pYES to transform it into yeast if this was successful.
+
'''Aim of the experiment:''' ligation of enzymes in pTUM104 to transform it into yeast if this was successful.
* 4CL+ (PCR15) in pYES (P176) -> new name: P177
* 4CL+ (PCR15) in pYES (P176) -> new name: P177
* 4CL- (PCR16) in pYES (P176) -> new name: P178
* 4CL- (PCR16) in pYES (P176) -> new name: P178
Line 6,235: Line 6,607:
* PAL- (PCR33) in pYES (P175) -> new name: P184
* PAL- (PCR33) in pYES (P175) -> new name: P184
-
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells  
+
* adding 5µl ligation product in 100 µl competent XL blue ''E.coli'' cells  
* incubation 30 min on ice  
* incubation 30 min on ice  
* 5 min at 37°C  
* 5 min at 37°C  
Line 6,256: Line 6,628:
== '''Tuesday, July 24nd''' ==
== '''Tuesday, July 24nd''' ==
 +
<div class="constitutive_promoter">
 +
=== Gelextraction of preparative digested ADH1-P, CYC1-T, TEF2-P, TEF1-P,PGK1-P===
 +
'''Investigator:''' Georg
 +
*Plasmid-DNA was extracted according to Quiaquick gel extraction kit
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Nanodrop: measuring concentration of P128-P131, P168-P169===
 +
''' Investigator:''' Georg
 +
*P128: 28,3 ng/µl
 +
*P129: 21  ng/µl
 +
*P130: 4,2 ng/µl
 +
*P131: 4,7 ng/µl
 +
*P168: 3,5 ng/µl
 +
*P169: 4,2 ng/µl
 +
</div>
<div class="coumaryl">
<div class="coumaryl">
Line 6,524: Line 6,912:
* Negative control P133
* Negative control P133
-
 
+
* adding 5µl ligation product in 100 µl competent XL blue ''E.coli'' cells  
-
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells  
+
* incubation 30 min on ice  
* incubation 30 min on ice  
* 5 min at 37°C  
* 5 min at 37°C  
Line 6,533: Line 6,920:
<div class="coumaryl">
<div class="coumaryl">
-
=== Picking Clones of 4CL, CHS, OMT and PAL in pYES and APT in original plasmid===
+
=== Picking Clones of 4CL, CHS, OMT and PAL in pTUM104 and APT in original plasmid===
'''investigator: ''' Daniela
'''investigator: ''' Daniela
Line 6,712: Line 7,099:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep of 4CL, CHS, OMT, PAL in pYes and APT in original plasmid from GeneArt===
+
===Miniprep of 4CL, CHS, OMT, PAL in pTUM104 and APT in original plasmid from GeneArt===
Investigator: Katrin
Investigator: Katrin
-
'''Aim of the experiment''': extraction of plasmids (pYes2) that contain 4CL, CHS, OMT, PAL; extraction of original plasmid from GeneArt with APT
+
'''Aim of the experiment''': extraction of plasmids (pTUM104) that contain 4CL, CHS, OMT, PAL; extraction of original plasmid from GeneArt with APT
QIAprepS Spin Miniprep Kit
QIAprepS Spin Miniprep Kit
Line 6,747: Line 7,134:
* cells were prefilled with 1 ml of LB-medium and incubated in a cell-culture shaker at 37 °C for 40 min
* cells were prefilled with 1 ml of LB-medium and incubated in a cell-culture shaker at 37 °C for 40 min
-
* 100 µl of these cell suspension were plated on antibiotic selection plates (ligations in pYES: Ampicillin; ligations in pSB1C3: Chloramphenicol)
+
* 100 µl of these cell suspension were plated on antibiotic selection plates (ligations in pTUM104: Ampicillin; ligations in pSB1C3: Chloramphenicol)
* cell suspension was centrifuged at 13000 rpm for 90 s for resuspending the pellet with 100 µl LB and plating also
* cell suspension was centrifuged at 13000 rpm for 90 s for resuspending the pellet with 100 µl LB and plating also
Line 6,787: Line 7,174:
'''Control digest'''
'''Control digest'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 6,811: Line 7,197:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands:
expected bands:
Line 6,821: Line 7,206:
<div class="coumaryl">
<div class="coumaryl">
-
===Control digest of 4CL, PAL, CHS, OMT, APT in pYES===
+
===Control digest of 4CL, PAL, CHS, OMT, APT in pTUM104===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL, CHS, OMT, APT in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL, CHS, OMT, APT in pTUM104 was successful
Plasmids are taken from miniprep from 25.07.2012
Plasmids are taken from miniprep from 25.07.2012
Line 6,851: Line 7,236:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands:
expected bands:
Line 6,865: Line 7,249:
<div class="coumaryl">
<div class="coumaryl">
-
=== pour on yeast agarplates ===
+
=== Pour on yeast agarplates for selection of yeast cells ===
Investigator: Mary
Investigator: Mary
Line 6,877: Line 7,261:
<div class="limonene">
<div class="limonene">
 +
===Picking of clones of transformation from 25.07.===
===Picking of clones of transformation from 25.07.===
Line 6,882: Line 7,267:
'''Aim:''' Amplification of clones for extraction of plasmids and subsequent proof of functional ligation.
'''Aim:''' Amplification of clones for extraction of plasmids and subsequent proof of functional ligation.
-
 
6 clones were picked for each ligation (PCR1 in pYESnew, PCR2 (p144) in pYESnew and PCR in pSB1C3. Clones containing pYESnew were put into 4 ml LB with 4 µl of ampillicin stock solution, clones containing pSB1C3 were put into chloramphenicol-containing media. Incubation at 37 °C over night.
6 clones were picked for each ligation (PCR1 in pYESnew, PCR2 (p144) in pYESnew and PCR in pSB1C3. Clones containing pYESnew were put into 4 ml LB with 4 µl of ampillicin stock solution, clones containing pSB1C3 were put into chloramphenicol-containing media. Incubation at 37 °C over night.
Line 6,888: Line 7,272:
<div class="limonene">
<div class="limonene">
-
===Transformation of plasmids P40&P42 into E.coli XL1 blue===
+
===Transformation of plasmids P40&P42 into ''E.coli'' XL1 blue===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 6,894: Line 7,278:
'''Aim:'''  
'''Aim:'''  
-
Transformation of plasmids P40 and P42 into E.coli XL1 blue to get plasmids of higher quality. P40&P42 are directly extracted from the expression strain BL21(DE). The quality of the plasmids might not be sufficient for Quickchange site-directed mutagenesis. Therefore transformation into E.coli XL1 blue and subsequent plasmid preparation to get plasmids with sufficient quality for SDM.
+
Transformation of plasmids P40 and P42 into ''E.coli'' XL1 blue to get plasmids of higher quality. P40&P42 are directly extracted from the expression strain BL21(DE). The quality of the plasmids might not be sufficient for Quickchange site-directed mutagenesis. Therefore transformation into ''E.coli'' XL1 blue and subsequent plasmid preparation to get plasmids with sufficient quality for SDM.
'''Procedure:'''  
'''Procedure:'''  
Line 6,919: Line 7,303:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Transferring ''E.&nbsp;coli''XL1-Blue colonies, transformed with BBa_I15008 (heme oxygenase) and BBa_K105005 (LexA), from old antibiotic plates on new plates ===
+
=== Transferring ''E.&nbsp;coli'' XL1-Blue colonies, transformed with BBa_I15008 (heme oxygenase) and BBa_K105005 (LexA), from old antibiotic plates on new plates ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
Line 6,940: Line 7,324:
Investigator: Ingmar
Investigator: Ingmar
-
'''Aim of the experiment:''' Test whether the ligation of PAL in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of PAL in pTUM104 was successful
'''Miniprep'''
'''Miniprep'''
Line 6,969: Line 7,353:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands:
expected bands:
Line 6,975: Line 7,358:
*PAL: 2151bp
*PAL: 2151bp
-
[[File:TUM12_Coumaryl_P219_und_P220__27.07.2012.jpg|500px]]
+
[[File:TUM12_Xanthohumol_P219_und_P220__27.07.2012.jpg|500px]]
As the picture only shows one band at the expected length of the vecotr backbone the ligation was not successfull and will be repeated with a reduced quotient of insert to vector of 3.
As the picture only shows one band at the expected length of the vecotr backbone the ligation was not successfull and will be repeated with a reduced quotient of insert to vector of 3.
Line 7,033: Line 7,416:
<div class="limonene">
<div class="limonene">
-
=== Plasmid extraction of plasmids PCR1/pYes, P144/pYES, PCR1/pSB1C3 ===
+
=== Plasmid extraction of plasmids PCR1/pTUM104, P144/pTUM104, PCR1/pSB1C3 ===
'''Investigator: Lara'''
'''Investigator: Lara'''
-
'''Aim of the experiment:''' Extract plasmids from ligation of PCR1 in pYES, P144 in pYES and PCR1 in pSB1C3 for further analytical restriction digest. (6 clones were picked for each ligation and plasmids subsequently extracted.)
+
'''Aim of the experiment:''' Extract plasmids from ligation of PCR1 in pYES, P144 in pTUM104 and PCR1 in pSB1C3 for further analytical restriction digest. (6 clones were picked for each ligation and plasmids subsequently extracted.)
'''Prodedure:''' Plasmids were extraced by using Qiagen plasmid miniprep kit.
'''Prodedure:''' Plasmids were extraced by using Qiagen plasmid miniprep kit.
Line 7,071: Line 7,454:
<div class="limonene">
<div class="limonene">
-
=== Restriction digest of plasmids from 6 clones each of PCR1/pYESnew, P144(PCR2)/pYESnew, PCR1/pSB1C3 ===
+
=== Restriction digest of plasmids from 6 clones each of PCR1/pTUM104new, P144(PCR2)/pTUM104new, PCR1/pSB1C3 ===
'''Investigator:''' Lara
'''Investigator:''' Lara
'''Aim of the experiment:''' Analytical restriction digest of plasmids to check for insert.
'''Aim of the experiment:''' Analytical restriction digest of plasmids to check for insert.
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 7,104: Line 7,486:
A mastermix for 19 samples was made.
A mastermix for 19 samples was made.
-
 
-
 
</div>
</div>
Line 7,111: Line 7,491:
<div class="limonene">
<div class="limonene">
-
=== Analytical gel electrophoresis ===
+
=== Analytical gel electrophoresis of PCR1/pTUM104new, P144(PCR2)/pTUM104new, PCR1/pSB1C3 ===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 7,124: Line 7,504:
<div class="coumaryl">
<div class="coumaryl">
-
===Small-Scale Yeast Transformation of 4CL, CHS, OMT and PAL- in pYES===
+
===Small-Scale Yeast Transformation of 4CL, CHS, OMT and PAL- in pTUM104===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
Line 7,182: Line 7,562:
*Two clones were picked an transferred to 6 ml LB medium containing 1:1000 Ampicillin.  
*Two clones were picked an transferred to 6 ml LB medium containing 1:1000 Ampicillin.  
*Incubation overnight at 37°C, 180 rpm.
*Incubation overnight at 37°C, 180 rpm.
 +
</div>
</div>
</div>
 +
=Week 8=
 +
<!--
 +
<p class="limonene">'''Limonene (14 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (5 Experiments):'''</p>
 +
*
 +
 +
<p class="thaumatin">'''Thaumatin (2 Experiments):'''</p>
 +
* Media and plates for yeast transformation
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (14 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (16 Experiments):'''</p>
 +
*
 +
 +
<html><a class="WDetails" href="#Week_8" id="Week_8">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_8">
== '''Monday, July 30th''' ==
== '''Monday, July 30th''' ==
 +
<div class="constitutive_promoter">
 +
===Extraction of Yeast genomic DNA for amplify TEF2-P, TEF1-T,ADH1-T===
 +
'''Investigator''': Georg
 +
 +
'''Aim of Experiment:''' To get genomic DNA of yeast for amplify TEF2-P, TEF1-T,ADH1-T by PCR
 +
* 100 µl of overnight culture of S. cerevisiae is centrifuged 5 min (13400 rpm)
 +
* Remove supernatant and resuspend pellet in 100 µl 200 mM LiAC 1% SDS
 +
* Incubate for 5 min at 70 C
 +
* Precipitate DNA by adding 300µl 96% Ethanol and vortexing
 +
* Sedimentation for 3 min (13400 rpm)
 +
* Removal of supernatant and washing with 500 µl 70& EtOH + centrifuge
 +
* remove supernatant and solubilisate pellet in 100 ml 1x TE-buffer
 +
* Remove cell-parts by 1 min of centrifugation and move supernatant in new Eppi
 +
* Add 50 ml 7 M NH4AC-solution, let incubate at room-temperature for 5 min
 +
* Centrifuge for 10 min
 +
* Move supernatant to a new eppi
 +
* ADD 70 µl 7,5 M NH4OAc and 280 µl Isopropanol
 +
* Incubate 10 min at room-temperature and centrifuge 10 min
 +
* remove supernatant
 +
* wash pellet with 100µl 80% Ethanol, centrifuge for 10 min
 +
* remove supernatant
 +
* dry pelleted DNA, and resolubilsate in 1x TE-buffer
 +
( Extraction had to be done twice)
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Nanodrop of yeast genomic DNA to measuring the concentration===
 +
 +
'''Investigator:''' Georg
 +
 +
*S.C1: 51,2 ng/µl
 +
*S.C2: 24,6 ng/µl
 +
*S.C3: 41,3 ng/µl
 +
*S.C4: 45,9 ng/µl
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
=== Analytical digestion and gelelectrophoresis of the plasmids P221-P232 ===
=== Analytical digestion and gelelectrophoresis of the plasmids P221-P232 ===
Line 7,303: Line 7,739:
<div class="coumaryl">
<div class="coumaryl">
-
=== Transformation of ligation products of PAL+ (PCR32) and APT(P189) in pYES2 RFC 25 (P175)into ''E.coli'' Xl1-Blue===
+
=== Transformation of ligation products of PAL+ (PCR32) and APT(P189) in pTUM104 RFC25 (P175)into ''E.coli'' Xl1-Blue===
'''Investigator:''' Ingmar
'''Investigator:''' Ingmar
-
'''Aim of the experiment:'''Transformation of the ligation products of PAL+ (PCR32), APT (P189) and the  negative control in pYes in XL1 Blue.
+
'''Aim of the experiment:'''Transformation of the ligation products of PAL+ (PCR32), APT (P189) and the  negative control in pTUM104 in XL1 Blue.
'''Operation Sequence'''
'''Operation Sequence'''
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
Line 7,319: Line 7,755:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep and control digest of PAL+ in pYES picked on sunday 29th July===
+
===Miniprep and control digest of PAL+ in pTUM104 picked on sunday 29th July===
Investigator: Ingmar
Investigator: Ingmar
-
'''Aim of the experiment:''' Test whether the ligation of PAL in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of PAL in pTUM104 was successful
'''Miniprep'''
'''Miniprep'''
-
Using a Quiagen Miniprep kit a plasmid isolation of two picked clones of the PAL+ in pYes2 RFC25 ligation was done. The miniprep product of the first clone was named P235, the one of the second clone P236. Both were used for the following control digest.
+
Using a Quiagen Miniprep kit a plasmid isolation of two picked clones of the PAL+ in pTUM104 RFC25 ligation was done. The miniprep product of the first clone was named P235, the one of the second clone P236. Both were used for the following control digest.
'''control digest'''
'''control digest'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 7,351: Line 7,786:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands:
expected bands:
Line 7,364: Line 7,798:
<div class="limonene">
<div class="limonene">
-
===Miniprep of Schwab plasmids P40 & P42 from E.coli XL1 blue===
+
===Miniprep of Schwab plasmids P40 & P42 from ''E.coli'' XL1 blue===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 7,448: Line 7,882:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim of experiment:''' Check whether ligations PCR1/pYESnew, P144(PCR2)/pYESnew and PCR1/pSB1C3 have worked. This time, a standard protocol with 2,5 µl of DNA was used. Furthermore, Pst-1 HF was used instead of Spe1 (as on Friday, July 27th).
+
'''Aim of experiment:''' Check whether ligations PCR1/pTUM104new, P144(PCR2)/pTUM104new and PCR1/pSB1C3 have worked. This time, a standard protocol with 2,5 µl of DNA was used. Furthermore, Pst-1 HF was used instead of Spe1 (as on Friday, July 27th).
-
 
+
-
 
+
-
*Digest of plasmids PCR1/pYESnew clone 1,3,5 and 6; P144(PCR2)/pYESnew clone 1,3,5 and 6; PCR1/pSB1C3 clone 1,5 and 6.
+
 +
*Digest of plasmids PCR1/pTUM104new clone 1,3,5 and 6; P144(PCR2)/pTUM104 new clone 1,3,5 and 6; PCR1/pSB1C3 clone 1,5 and 6.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 7,476: Line 7,908:
|ddH2O
|ddH2O
|}
|}
-
 
Incubation for 1,5 h at 37 °C.
Incubation for 1,5 h at 37 °C.
Line 7,485: Line 7,916:
== '''Tuesday, July 31st''' ==
== '''Tuesday, July 31st''' ==
 +
<div class="constitutive_promoter">
 +
===Nanodrop for measuring Plasmidconcentrations of P54,P55,P57,P87,P86,P88,P90,P91,P89===
 +
 +
'''Investigator:''' Georg
 +
 +
* P54: 235 ng/µl
 +
* P55: 645 ng/µl
 +
* P57: 491,1 ng/µl
 +
 +
* P87: 259 ng/µl
 +
* P86: 99 ng/µl
 +
* P88: 86 ng/µl
 +
 +
* P90: 1161 ng/µl
 +
* P91: 261 ng/µl
 +
* P89: 630 ng/µl
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Prep. digestion of P90, P87, P55 and prep. gelelectrophoresis===
 +
 +
'''Investigator''': Georg
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|3 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|3 µl 
 +
|XbaI (NEB)
 +
|-
 +
|12 µl
 +
|NEB-4 buffer
 +
|-
 +
|1,2 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|40,8 µl
 +
|dd H20
 +
|-
 +
|=60µl
 +
|'''TOTAL'''
 +
|}
 +
* To 20 µl digestive mastermix 20 µl of DNA was added and mixed
 +
* Digestion was processed for 3 hours at 37 C
 +
 +
[[File:31.07.2012 präp.png]]
 +
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Analytical digestion of pTUM104 with PvuII and SwaI===
 +
 +
''' Investigator:''' Georg
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,25 µl
 +
|SWAI (NEB)
 +
|-
 +
|0,25 µl 
 +
|PvuII (NEB)
 +
|-
 +
|2 µl
 +
|NEB-3 buffer
 +
|-
 +
|0,2 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|14,85 µl
 +
|dd H20
 +
|-
 +
|= 17,5µl
 +
|'''TOTAL'''
 +
|}
 +
* After 1 h digestion with SwaI at room temperature, PvuII was added and digested at 37 C, 1 h
 +
 +
[[File:31.07.2012 Testverdau pYes2 mit SwaI + PvuII.png]]
 +
</div>
 +
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Picking from the overnight transformation of ligated P123+PCR38 in E. coli XL1-Blue from July, 27th  ===
=== Picking from the overnight transformation of ligated P123+PCR38 in E. coli XL1-Blue from July, 27th  ===
Line 7,502: Line 8,021:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim of experiment:''' Remove Age1 restriction site in gene coding for lavendula limonene synthase.
'''Aim of experiment:''' Remove Age1 restriction site in gene coding for lavendula limonene synthase.
Line 7,578: Line 8,096:
'''Investigator: Andrea'''
'''Investigator: Andrea'''
-
'''Digestion of PCR1, PCR2 and P155 (pYES) with XbaI and AgeI'''
+
'''Digestion of PCR1, PCR2 and P155 (pTUM104) with XbaI and AgeI'''
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 7,655: Line 8,173:
</div>
</div>
<div class="limonene">
<div class="limonene">
-
===preparative gel electrophoresis===
+
===Preparative gel electrophoresis of PCR1/PCR2, P155===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
Line 7,666: Line 8,184:
<div class="limonene">
<div class="limonene">
-
=== Ligation of digested PCR1 with P133 (pSB1C3) and P175 (pYES) (XbaI and AgeI)===
+
=== Ligation of digested PCR1 with P133 (pSB1C3) and P175 (pTUM104) (XbaI and AgeI)===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
Line 7,815: Line 8,333:
* YPD-Medium, YPD-plates, 10X TE, 10X LiAc, 1x LiAc/0.5x TE
* YPD-Medium, YPD-plates, 10X TE, 10X LiAc, 1x LiAc/0.5x TE
-
</div>
 
</div>
</div>
-
=August 2012=
 
-
<div class="month" id="MAugust_2012">
 
== '''Wednesday, August 1st''' ==
== '''Wednesday, August 1st''' ==
-
<div class="constitutive_promoter">
 
-
=== Preparative digestion of pYesII with SwaI and PvuII ===
 
-
 
-
*Preparative digestion of pYesII
 
-
{|cellspacing="0" border="1"
 
-
|'''Reagent'''
 
-
|'''Volume in µl'''
 
-
|-
 
-
|SwaI
 
-
|2 µl
 
-
|-
 
-
|PvuII
 
-
|2 µl
 
-
|-
 
-
|Neb3 buffer
 
-
|4 µl
 
-
|-
 
-
|BSA
 
-
|0,4 µl
 
-
|-
 
-
|H20
 
-
|14,5 µl
 
-
|-
 
-
|Volume
 
-
|40 µl
 
-
|}
 
-
 
-
Geldigestion was performed with SwaI and BSA at room temperature for 2,5 hours. Afterwards PvuII was added and digested another 2,5  hours at 37 C
 
-
 
-
</div>
 
-
 
-
<div class="constitutive_promoter">
 
-
 
-
=== Nanodrop measurment of P245-P250===
 
-
Gelextraction was performed according to gelextraction protocol
 
-
 
-
Probe:    Concentration:
 
-
P245      4,5 ng/µl
 
-
P246      7,5 ng/µl
 
-
P247      22,7 ng/µl
 
-
P248      21,1 ng/µl
 
-
P249      3,3 ng/µl
 
-
P250      3,8 ng/µl
 
-
 
-
</div>
 
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
Line 8,077: Line 8,547:
'''Procedure:'''
'''Procedure:'''
-
 
* '''PCR reaction mixture'''
* '''PCR reaction mixture'''
Line 8,144: Line 8,613:
'''Aim of the experiment:'''
'''Aim of the experiment:'''
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Preparative digestion of pTUM104 with SwaI and PvuII ===
 +
 +
*Preparative digestion of pYesII
 +
{|cellspacing="0" border="1"
 +
|'''Reagent'''
 +
|'''Volume in µl'''
 +
|-
 +
|SwaI
 +
|2 µl
 +
|-
 +
|PvuII
 +
|2 µl
 +
|-
 +
|Neb3 buffer
 +
|4 µl
 +
|-
 +
|BSA
 +
|0,4 µl
 +
|-
 +
|H20
 +
|31,6 µl
 +
|-
 +
|Volume
 +
|40 µl
 +
|}
 +
 +
Geldigestion was performed with SwaI and BSA at room temperature for 2,5 hours. Afterwards PvuII was added and digested another 2,5  hours at 37 C
 +
 +
[[File:20120801 Präp. Verdau pYes2.png]]
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Preparative Gel of pTUM104 digestion===
 +
 +
'''Investigator:''' Georg
 +
* Preparative Digestion was loaded onto a 1% preparative agarose gel
 +
* Gel was run for 150 min at 70 V
 +
</div>
 +
<div class="constitutive_promoter">
 +
 +
=== Nanodrop measurement of P245-P250===
 +
Gelextraction was performed according to gelextraction protocol
 +
 +
Probe:    Concentration:
 +
P245      4,5 ng/µl
 +
P246      7,5 ng/µl
 +
P247      22,7 ng/µl
 +
P248      21,1 ng/µl
 +
P249      3,3 ng/µl
 +
P250      3,8 ng/µl
 +
</div>
</div>
Line 8,167: Line 8,691:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep and control digest of APT in pYES ===
+
===Miniprep and control digest of APT in pTUM104 ===
Investigator: Katrin
Investigator: Katrin
Line 8,181: Line 8,705:
clone 2 (P262): 153,5 ng/µl
clone 2 (P262): 153,5 ng/µl
clone 3 (P263): 158,4 ng/µl
clone 3 (P263): 158,4 ng/µl
-
 
'''control digest'''
'''control digest'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 8,208: Line 8,730:
|ddH2O
|ddH2O
|}
|}
-
 
expected bands (pYes has 2 AgeI restriction site):
expected bands (pYes has 2 AgeI restriction site):
Line 8,214: Line 8,735:
*pYes fragment 2: 451
*pYes fragment 2: 451
*APT: 1244 bp  
*APT: 1244 bp  
-
 
-
 
[[File:IM000269 APT pyes kontrolle.jpg|500px]]
[[File:IM000269 APT pyes kontrolle.jpg|500px]]
Line 8,233: Line 8,752:
== '''Thursday, August 2nd''' ==
== '''Thursday, August 2nd''' ==
 +
 +
<div class="light_switchable_promoter">
 +
===Transformation of ligation product P207/PCR39===
 +
 +
'''Investigator:''' Lara
 +
 +
'''Aim:''' Transformation of ligation products P207/PCR39 and P207/NK.
 +
 +
''' Transformation into ''E.coli'' Xl1-Blue'''
 +
 +
Unfortunately the lab assistents went home so that the incubation times had to be shortened.
 +
 +
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
 +
* addition of 5 µl of the ligation products
 +
* incubation on ice for 25 min
 +
* heat shock for 5 min at 37 °C
 +
* transfer of cells to 1 ml LB-medium without antibiotics and incubation at 37°C and 180 rpm for 25 min
 +
* plating of 100 µl on an Chlp-LB-plate
 +
* sedimenting the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspension of the sediment in 100 µl LB-medium and plating it as well on an Chlp-LB-plate
 +
</div>
 +
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Gelextraction of pYesII -f1,-Gal4 ===
+
=== Gelextraction of pTUM104 -f1,-Gal4 ===
-
pYes II extraction was performed according to manufacturers protocoll
+
pTUM104 extraction was performed according to manufacturers protocoll
Concentration was measured with nanodrop
Concentration was measured with nanodrop
Line 8,246: Line 8,786:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Circularization of linearized plasmid backbone pYesII===
+
=== Circularization of linearized plasmid backbone pTUM104===
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 8,273: Line 8,813:
Ligation was performed over night at 16 C
Ligation was performed over night at 16 C
Negative control was done with H20 in exchange to pYES2
Negative control was done with H20 in exchange to pYES2
-
</div>
 
-
 
-
<div class="light_switchable_promoter">
 
-
===Transformation of ligation product P207/PCR39===
 
-
 
-
'''Investigator:''' Lara
 
-
 
-
'''Aim:''' Transformation of ligation products P207/PCR39 and P207/NK.
 
-
 
-
''' Transformation into ''E.coli'' Xl1-Blue'''
 
-
 
-
Unfortunately the lab assistents went home so that the incubation times had to be shortened.
 
-
 
-
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
 
-
* addition of 5 µl of the ligation products
 
-
* incubation on ice for 25 min
 
-
* heat shock for 5 min at 37 °C
 
-
* transfer of cells to 1 ml LB-medium without antibiotics and incubation at 37°C and 180 rpm for 25 min
 
-
* plating of 100 µl on an Chlp-LB-plate
 
-
* sedimenting the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspension of the sediment in 100 µl LB-medium and plating it as well on an Chlp-LB-plate
 
</div>
</div>
Line 8,298: Line 8,818:
===Repetition of Quickchange mutagenesis of lavendula limonene synthase===
===Repetition of Quickchange mutagenesis of lavendula limonene synthase===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' No colonies were observable after second transformation of quickchange PCR products. Therefore the quickchange pcr reaction was repeated with a modified protocol:
'''Aim:''' No colonies were observable after second transformation of quickchange PCR products. Therefore the quickchange pcr reaction was repeated with a modified protocol:
-
 
'''PCR'''<br>
'''PCR'''<br>
Line 8,352: Line 8,870:
|Pfu Turbo DNA polymerase (2.5 U / µl)
|Pfu Turbo DNA polymerase (2.5 U / µl)
|}
|}
-
 
'''PCR cycling parameters'''
'''PCR cycling parameters'''
Line 8,386: Line 8,903:
'''! Unfortunately someone turned off the heat block, so that the reaction tube was below 37 °C (approx. 25 °C) for about 45 min. After recognition (after one hour of incubation), the heat block was turned on again and the reaction tube was incubated for another 30 min.'''
'''! Unfortunately someone turned off the heat block, so that the reaction tube was below 37 °C (approx. 25 °C) for about 45 min. After recognition (after one hour of incubation), the heat block was turned on again and the reaction tube was incubated for another 30 min.'''
-
 
''' Transformation into ''E.coli'' Xl1-Blue'''
''' Transformation into ''E.coli'' Xl1-Blue'''
Line 8,406: Line 8,922:
'''Aim:''' To get more PCR product in case another preparative digest is needed.
'''Aim:''' To get more PCR product in case another preparative digest is needed.
-
 
'''Primer with consensus sequence'''
'''Primer with consensus sequence'''
Line 8,438: Line 8,953:
|'''TOTAL'''
|'''TOTAL'''
|}
|}
-
 
'''Primer without consensus sequence'''
'''Primer without consensus sequence'''
Line 8,497: Line 9,011:
|1 h
|1 h
|}
|}
-
 
'''Analytical gel electrophoresis'''
'''Analytical gel electrophoresis'''
Line 8,507: Line 9,020:
<div class="coumaryl">
<div class="coumaryl">
-
===Preparation of YPD Medium and Picking of S. cerevisiae clones===
+
===Preparation of YPD Medium and Picking of ''S. cerevisiae'' clones===
'''Investigator:''' Lara, Katrin
'''Investigator:''' Lara, Katrin
-
 
YPD Yeast Extract Peptone Dextrose Medium (1 liter)
YPD Yeast Extract Peptone Dextrose Medium (1 liter)
Line 8,517: Line 9,029:
* 2% peptone
* 2% peptone
* 2% dextrose (D-glucose)
* 2% dextrose (D-glucose)
-
 
Picking of two clones of S. cerevisiae DD (17.17.2012): The clones were put into YPD medium and incubated at 30 °C over night. Additional 0,8 g Glucose were added to one of the cell culture tubes.
Picking of two clones of S. cerevisiae DD (17.17.2012): The clones were put into YPD medium and incubated at 30 °C over night. Additional 0,8 g Glucose were added to one of the cell culture tubes.
Line 8,524: Line 9,035:
== '''Friday, August 3rd''' ==
== '''Friday, August 3rd''' ==
 +
<div class="constitutive_promoter">
 +
=== Transformation of ''E.coli'' Xl1-blue with Vector pGADT7-AD===
-
<div class="light_switchable_promoter">
+
'''Investigator:'''Georg
-
===Transformation of E.coli XL1 blue with ligation product P207/PCR39===
+
-
'''Investigator:''' Lara
+
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
* 1 µl of pGADT7-AD (P98) was added to 100 µl of competent cells and mixed gently.
-
'''Aim:''' Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation of E.coli XL1 blue with ligation products P207/PCR39 and P207/NK.
+
* 30 min incubation on ice
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on ampicillin plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin plates.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Transformation of ''E.coli'' Xl1-blue with pTUM104 overnight ligation===
 +
 +
'''Investigator:'''Georg
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 1 µl of pGADT7-AD (P98) was added to 100 µl of competent cells and mixed gently.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on ampicillin plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin plates.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Preparative digestion of TEF1-P and ADH1-P with XbaI and PstI===
 +
 +
'''Investigator:''' Georg
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|3 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|3 µl 
 +
|XbaI (NEB)
 +
|-
 +
|12 µl
 +
|NEB-4 buffer
 +
|-
 +
|1,2 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|40,8 µl
 +
|dd H20
 +
|-
 +
|=60µl
 +
|'''TOTAL'''
 +
|}
 +
* 20 µl Mastermix and 20 µl DNA were mixed and digestion processed at 37 C for 3 hours.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== PCR of ADH1-T, TEF2-P, TEF1-T from Saccharomyces cerv. genome===
 +
 +
'''Investigator:''' Georg
 +
 +
* Reaction batch for PCR-ADH1-T:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|10µl
 +
|5x One taq buffer
 +
|-
 +
|1 µl 
 +
|10 mM DNTPs
 +
|-
 +
|1 µl
 +
|O66/10
 +
|-
 +
|1µl
 +
|O67/10
 +
|-
 +
|0,25
 +
|dd H20
 +
|-
 +
|=35,75µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for PCR-TEF2-P:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1,23 ml
 +
|P237
 +
|-
 +
|10µl
 +
|5x One taq buffer
 +
|-
 +
|1 µl 
 +
|10 mM DNTPs
 +
|-
 +
|1 µl
 +
|O64/10
 +
|-
 +
|1µl
 +
|O65/10
 +
|-
 +
|0,25
 +
|dd H20
 +
|-
 +
|=35,52µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for PCR-TEF2-P:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1,23 ml
 +
|P237
 +
|-
 +
|10µl
 +
|5x One taq buffer
 +
|-
 +
|1 µl 
 +
|10 mM DNTPs
 +
|-
 +
|1 µl
 +
|O64/10
 +
|-
 +
|1µl
 +
|O65/10
 +
|-
 +
|0,25
 +
|dd H20
 +
|-
 +
|=35,75µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for PCR-TEF1-T:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1,23 ml
 +
|P237
 +
|-
 +
|10µl
 +
|5x One taq buffer
 +
|-
 +
|1 µl 
 +
|10 mM DNTPs
 +
|-
 +
|1 µl
 +
|O62/10
 +
|-
 +
|1µl
 +
|O63/10
 +
|-
 +
|0,25
 +
|dd H20
 +
|-
 +
|=35,75µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Cycling condition were used as follows:
 +
* 94 C 30 sek
 +
* (30 Cycles) 94 C 30 sek
 +
* (30 Cycles) 56 C 60 sek
 +
* (30 Cycles) 68 C 2 min
 +
* Final extension: 68 C
 +
* Hold: 4 C
 +
* PCR was successful
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
===Transformation of ''E.coli'' XL1 blue with ligation product P207/PCR39===
 +
 +
'''Investigator:''' Lara
 +
 +
'''Aim:''' Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation of ''E.coli'' XL1 blue with ligation products P207/PCR39 and P207/NK.
''' Transformation into ''E.coli'' Xl1-Blue'''
''' Transformation into ''E.coli'' Xl1-Blue'''
Line 8,549: Line 9,258:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Check whether site directed mutagenesis to eliminate Age1 restriction site has worked.
'''Aim:''' Check whether site directed mutagenesis to eliminate Age1 restriction site has worked.
-
 
'''Quickchange PCR product purification''':
'''Quickchange PCR product purification''':
Line 8,559: Line 9,266:
* P241 SDM: 7 ng/µl
* P241 SDM: 7 ng/µl
* P242 SDM: 63 ng/µl
* P242 SDM: 63 ng/µl
-
 
'''Restriction digest of p241 SDM (31.7.), p242 SDM (2.8.) and p242 (as positive control)'''
'''Restriction digest of p241 SDM (31.7.), p242 SDM (2.8.) and p242 (as positive control)'''
Line 8,582: Line 9,288:
|ddH2O
|ddH2O
|}
|}
-
 
'''Analytical Gel'''
'''Analytical Gel'''
Line 8,601: Line 9,306:
8. PCR 43
8. PCR 43
-
 
[[File:TUM12_LS_Quickchange_Analytgel.png]]
[[File:TUM12_LS_Quickchange_Analytgel.png]]
Line 8,608: Line 9,312:
<div class="limonene">
<div class="limonene">
-
===Transformation of E.coli XL1 blue with P242 SDM===
+
===Transformation of ''E.coli'' XL1 blue with P242 SDM===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation with P242 SDM.
'''Aim:''' Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation with P242 SDM.
-
 
''' Transformation into ''E.coli'' Xl1-Blue'''
''' Transformation into ''E.coli'' Xl1-Blue'''
Line 8,629: Line 9,331:
<div class="coumaryl">
<div class="coumaryl">
-
===Repetition of small-Scale Yeast Transformation of 4CL, CHS, OMT, PAL and APT in pYES===
+
===Repetition of small-Scale Yeast Transformation of 4CL, CHS, OMT, PAL and APT in pTUM104===
'''Investigator:''' Mary
'''Investigator:''' Mary
Line 8,635: Line 9,337:
The protocol on page 13 of the pYES2 manual was used.
The protocol on page 13 of the pYES2 manual was used.
-
 
Only modifications are noted:
Only modifications are noted:
Line 8,642: Line 9,343:
step 2: OD600 = 9 -> to determine a OD600 of 0.4 in 50 ml, 2.2 ml yeast suspension and 42.5 ml YPD medium were used, 5ml 20% Glucose was added (wrong information about the YPD-medium: we suggested that Glucose caramelizes when autoclaved together with medium - but it is not the case! Only agar and glucose will caramelize).  
step 2: OD600 = 9 -> to determine a OD600 of 0.4 in 50 ml, 2.2 ml yeast suspension and 42.5 ml YPD medium were used, 5ml 20% Glucose was added (wrong information about the YPD-medium: we suggested that Glucose caramelizes when autoclaved together with medium - but it is not the case! Only agar and glucose will caramelize).  
-
 
steps 3 and 4: centrifugation for 5 min, 4 °C
steps 3 and 4: centrifugation for 5 min, 4 °C
-
 
step 6:  
step 6:  
Line 8,663: Line 9,362:
100 µg denatured sheared salmon sperm: the one from Simon was used -> 10 µl
100 µg denatured sheared salmon sperm: the one from Simon was used -> 10 µl
-
 
step 7:  
step 7:  
Line 8,669: Line 9,367:
7 ml 50% PEG3350 was synthesized (3.5 g in 7 ml bidest.water)
7 ml 50% PEG3350 was synthesized (3.5 g in 7 ml bidest.water)
6.4 ml 50% PEG3350 + 800 µl 10x LiAc + 800 µl 10x TE were mixed
6.4 ml 50% PEG3350 + 800 µl 10x LiAc + 800 µl 10x TE were mixed
-
 
The cells were plated out on SC-U plates with Glucose and incubated the weekend at 30°C
The cells were plated out on SC-U plates with Glucose and incubated the weekend at 30°C
Line 8,676: Line 9,373:
<div class="limonene">
<div class="limonene">
-
===Transformation of E.coli XL1 blue with ligation products===
+
===Transformation of ''E.coli'' XL1 blue with ligation products===
Investigator: Katrin
Investigator: Katrin
Line 8,682: Line 9,379:
Aim: Transformation of ligation products PCR2/P133, PCR1/P133, MK/P133, PCR2/P175, MK/P175
Aim: Transformation of ligation products PCR2/P133, PCR1/P133, MK/P133, PCR2/P175, MK/P175
-
Transformation into E.coli Xl1-Blue
+
Transformation into ''E.coli'' Xl1-Blue
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
Line 8,891: Line 9,588:
* 3 or 4 clones were picked for each ligation. Clones containing pYES2-new were put into 4 ml LB with 4 µl of ampillicin stock solution, clones containing pSB1C3 were put into chloramphenicol containing media. Incubation at 37&nbsp;°C overnight.
* 3 or 4 clones were picked for each ligation. Clones containing pYES2-new were put into 4 ml LB with 4 µl of ampillicin stock solution, clones containing pSB1C3 were put into chloramphenicol containing media. Incubation at 37&nbsp;°C overnight.
</div>
</div>
 +
</div>
 +
 +
=Week 9=
 +
<!--
 +
<p class="limonene">'''Limonene (11 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (10 Experiments):'''</p>
 +
*
 +
 +
<p class="caffeine">'''Caffeine (5 Experiments):'''</p>
 +
*
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (10 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (24 Experiments):'''</p>
 +
*
 +
<html><a class="WDetails" href="#Week_9" id="Week_9">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_9">
== '''Monday, August 6th''' ==
== '''Monday, August 6th''' ==
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR39  ===
+
=== Miniprep of overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P207+PCR39  ===
'''Investigator:''' Jeff, Dennis
'''Investigator:''' Jeff, Dennis
Line 9,249: Line 9,967:
'''Investigator:''' Georg
'''Investigator:''' Georg
-
'''Aim of the experiment:''' Miniprep of overnight cultures of transformed E. coli XL1-Blue
+
'''Aim of the experiment:''' Miniprep of overnight cultures of transformed ''E. coli'' XL1-Blue
'''Procedure:'''
'''Procedure:'''
Line 9,257: Line 9,975:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== PCR of TEF1-Terminator, TEF2-Promoter and ADH1-Terminator ===
+
=== PCR of TEF1-Terminator, TEF2-Promoter and ADH1-Terminator with PCR-purification ===
'''Investigator:''' Georg
'''Investigator:''' Georg
-
'''Aim of the experiment:''' Amplification of TEF1-Terminator, TEF2-Promoter from genomic DNA of Saccharomyces cerevisiae and ADH1-Terminator from yeast Vector PGADT7 AD'''
+
'''Aim of the experiment:''' Amplification of TEF1-Terminator, TEF2-Promoter from genomic DNA of ''Saccharomyces cerevisiae'' and ADH1-Terminator from yeast Vector PGADT7 AD'''
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 9,281: Line 9,999:
|OneTaq Hot Start DNA Polymerase (Final: 1.25 units/50 µl)
|OneTaq Hot Start DNA Polymerase (Final: 1.25 units/50 µl)
|-
|-
-
|1,3µl P237/ 1µl P98
+
|1,3µl P237  
-
|
+
|1µl P98
|-
|-
|33.75 µl  
|33.75 µl  
Line 9,290: Line 10,008:
|'''TOTAL'''
|'''TOTAL'''
|}
|}
-
 
* The PCR program was performed after following scheme:
* The PCR program was performed after following scheme:
Line 9,318: Line 10,035:
|1 h
|1 h
|}
|}
 +
 +
*Afterwards, the PCR-product was purified by Quiaquick PCR purification KIt
 +
*The success of the PCR was tested by analytical gelelectrophoresis
 +
 +
[[File:20120806 PCR ADHt,TEF1t,TEF2p.png]]
</div>
</div>
Line 9,372: Line 10,094:
|'''TOTAL'''
|'''TOTAL'''
|}
|}
 +
 +
[[File:20120806_Prep_Gel TEf1p, ADH1p.png]]
 +
[[File:20120806_prep_gel_PCR Prod.png]]
</div>
</div>
<div class="limonene">
<div class="limonene">
-
===Ligation of lavendula LS and citrus LS with pSB1C3 and pYES===
+
 
 +
===Ligation of lavendula LS and citrus LS with pSB1C3 and pTUM104===
 +
 
 +
Investigator: Andrea
'''Procedure'''
'''Procedure'''
Line 9,509: Line 10,237:
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
===Preparation of SC-U medium with 2% glucose (300ml) or galactose (700 ml) for expression in Saccharomyces cerevisiae===
+
===Preparation of SC-U medium with 2% glucose (300ml) or galactose (700 ml) for expression in ''Saccharomyces cerevisiae''===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
Line 9,530: Line 10,258:
<div class="coumaryl">
<div class="coumaryl">
-
===Inoculation of Saccharomyces cerevisiae colonies of transformation products from August, 3rd===
+
===Inoculation of ''Saccharomyces cerevisiae'' colonies of transformation products from August, 3rd===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
-
'''Aim of the experiment:''' First step of the expression protocol in Saccharomyces cerevisiae
+
'''Aim of the experiment:''' First step of the expression protocol in ''Saccharomyces cerevisiae''
-
Inoculation of a single colony of Saccaromyces cerevisiae transformed with enzymes PAL+/-, 4CL+/-, CHS+/-, OMT+/-, APT and the positive control GFP in pYES, respectively in 15 ml of SC-U medium with 2% glucose.
+
Inoculation of a single colony of ''Saccaromyces cerevisiae'' transformed with enzymes PAL+/-, 4CL+/-, CHS+/-, OMT+/-, APT and the positive control GFP in pTUM104, respectively in 15 ml of SC-U medium with 2% glucose.
Incubation at 30°C over night.
Incubation at 30°C over night.
Line 9,738: Line 10,466:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Prepare digested PCR fragments for further ligation into pYES and pSB1C3.
+
'''Aim:''' Prepare digested PCR fragments for further ligation into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 9,797: Line 10,524:
[[File:TUM12_LS_0808_prepgel2.png]]
[[File:TUM12_LS_0808_prepgel2.png]]
[[File:TUM12_LS_0808_prepgel1.png]]
[[File:TUM12_LS_0808_prepgel1.png]]
-
 
'''Digested PCR products (PCR 42 RL, PCR 43 RL, PCR 56 RL, PCR 57 RL, PCR 58 RL) are stored in the iGEM PCR product box at -20°C. '''
'''Digested PCR products (PCR 42 RL, PCR 43 RL, PCR 56 RL, PCR 57 RL, PCR 58 RL) are stored in the iGEM PCR product box at -20°C. '''
* RL = ready for ligation
* RL = ready for ligation
 +
 +
*concentrations:
 +
 +
PCR 42: 102 ng/µl
 +
 +
PCR 43: 60 ng/µl
 +
 +
PCR 56: 35 ng/µl
 +
 +
PCR 57: 34 ng/µl (consumed)
 +
 +
PCR 58: 40 ng/µl
 +
</div>
</div>
Line 9,809: Line 10,548:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Check ligation of PCR 1 and PCR 2 into pYES and pSB1C3.
+
'''Aim:''' Check ligation of PCR 1 and PCR 2 into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 9,836: Line 10,574:
* Incubation at 37°C for 2 h.
* Incubation at 37°C for 2 h.
-
 
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 9,847: Line 10,584:
<div class="limonene">
<div class="limonene">
-
===Ligation of lavendula LS and citrus LS with pSB1C3 and pYES===
+
===Ligation of lavendula LS and citrus LS with pSB1C3 and pTUM104===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pYES.
+
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pTUM104.
'''Procedure'''
'''Procedure'''
Line 10,140: Line 10,877:
'''Eppis with Ligation products are stored in two 50 ml Falcon tubes at -20°C (lowest drawer)! '''
'''Eppis with Ligation products are stored in two 50 ml Falcon tubes at -20°C (lowest drawer)! '''
-
 
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
===Induction of PAL,4CL,CHS,OMT,APT and GFP in pYES in ''S. cerevisiae'' in SC-U medium with 2% galactose===
+
===Induction of PAL,4CL,CHS,OMT,APT and GFP in pTUM104 in ''S. cerevisiae'' in SC-U medium with 2% galactose===
'''Investigator:''' Mary, Daniela
'''Investigator:''' Mary, Daniela
-
'''Aim of the experiment:''' Expression of all enzymes in Saccharomyces cerevisiae.
+
'''Aim of the experiment:''' Expression of all enzymes in ''Saccharomyces cerevisiae''.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 10,222: Line 10,958:
== '''Wednesday, August 8th''' ==
== '''Wednesday, August 8th''' ==
-
 
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
=== Miniprep of overnight culture of ''E.&nbsp;coli'' containing biobricks BBa_K181000, BBa_K365002 and BBa_K365003 ===
=== Miniprep of overnight culture of ''E.&nbsp;coli'' containing biobricks BBa_K181000, BBa_K365002 and BBa_K365003 ===
Line 10,424: Line 11,159:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Get transformed plasmids for further analytical restriction digest to check whether ligation worked.
'''Aim:''' Get transformed plasmids for further analytical restriction digest to check whether ligation worked.
-
 
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
Line 10,440: Line 11,173:
* PCR2/p133 clone 3: 140 ng/µl
* PCR2/p133 clone 3: 140 ng/µl
* PCR2/p133 clone 4: 510 ng/µl
* PCR2/p133 clone 4: 510 ng/µl
-
 
'''Eppis containing miniprep products were stored in 50 ml Falcon tubes at the lowest drawer of -20°C.'''
'''Eppis containing miniprep products were stored in 50 ml Falcon tubes at the lowest drawer of -20°C.'''
Line 10,451: Line 11,183:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Analytical restriction digest to check whether ligation of Tuesday, July 31st has worked.
'''Aim:''' Analytical restriction digest to check whether ligation of Tuesday, July 31st has worked.
Line 10,512: Line 11,243:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Transform E.coli XL 1 blue with ligation products to produce colonies containing plasmid DNA.
+
'''Aim:''' Transform ''E.coli'' XL 1 blue with ligation products to produce colonies containing plasmid DNA.
-
'''Transformation into E.coli Xl1-Blue'''
+
'''Transformation into ''E.coli'' Xl1-Blue'''
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
Line 10,530: Line 11,261:
'''Aim of the experiment:'''Receive (hopefully) expressed enzymes.
'''Aim of the experiment:'''Receive (hopefully) expressed enzymes.
-
 
The protocol 'Expression Hefe' (Dropbox) was used. If you want to repeat the experiment please read comments before you start.
The protocol 'Expression Hefe' (Dropbox) was used. If you want to repeat the experiment please read comments before you start.
You should make a glycerol stock of clones picked. You should as well take a sample of the uninduced yeast and do a cell lysis to be able to compare the induced and uninduced status.
You should make a glycerol stock of clones picked. You should as well take a sample of the uninduced yeast and do a cell lysis to be able to compare the induced and uninduced status.
-
 
Preparation of sodium phosphate buffer (50 mM):
Preparation of sodium phosphate buffer (50 mM):
Line 10,541: Line 11,270:
*1 M NaH2PO4x2H2O (M = 156.01 g/mol):  0.468 g dissolved in 3 ml ELGA water
*1 M NaH2PO4x2H2O (M = 156.01 g/mol):  0.468 g dissolved in 3 ml ELGA water
*8.095 ml Na2HPO4 and 1.905 ml NaH2PO4 and 190 ml ELGA water were mixed -> pH should be 7.5 but in our case it wasn't. Therefore we used all of the Na2HPO4, but could only achieve an pH of 7.47.
*8.095 ml Na2HPO4 and 1.905 ml NaH2PO4 and 190 ml ELGA water were mixed -> pH should be 7.5 but in our case it wasn't. Therefore we used all of the Na2HPO4, but could only achieve an pH of 7.47.
-
 
Preparation of PMSF (100 mM)->solution is in the fridge:
Preparation of PMSF (100 mM)->solution is in the fridge:
*0.0174 g were dissolved in 1 ml isopropanol (techn.)
*0.0174 g were dissolved in 1 ml isopropanol (techn.)
-
 
Preparation of breaking buffer:
Preparation of breaking buffer:
Line 10,551: Line 11,278:
*750 µl Glycerol (80%)
*750 µl Glycerol (80%)
*24 µl EDTA
*24 µl EDTA
-
 
Preparation of breaking buffer with PMSF:
Preparation of breaking buffer with PMSF:
* 6 ml of breaking buffer
* 6 ml of breaking buffer
* 60 µl of PMSF (100 mM)
* 60 µl of PMSF (100 mM)
-
 
'''Preparations for SDS gel the next day:'''
'''Preparations for SDS gel the next day:'''
Line 10,618: Line 11,343:
|-
|-
|}
|}
-
 
</div>
</div>
Line 10,639: Line 11,363:
=='''Thursday, August 9th'''==
=='''Thursday, August 9th'''==
 +
<div class="constitutive_promoter">
 +
===Gelextraction of PCR 50-55 and P297-P302===
 +
'''Investigator''': Georg
 +
 +
*Gelextraction was done according to Quiaquick gelextraktion protocoll
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Nanodrop measurement of PCR 50-55 and P297-302===
 +
 +
'''Investigator''': Georg
 +
 +
* PCR products 50-55 (ADH1-T, TEf1-T, TEF2-P) and P297-302 (TEF1-P, ADH1-P) were measured with Nanodrop in ng/µl
 +
* ADH1-T: 22,4
 +
* TEF2-P: 7,4
 +
* TEF1-P: 16,8
 +
* ADH1-P: 52,6
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
'''Investigator''': Georg
 +
 +
===Ligation of TEF1-P, TEF2-P ADH1-T, TEF1-T and ADH1-T and pTUM104===
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|3,48 µl
 +
|P132 (psb1c3 33,5 ng/µl)
 +
|-
 +
|2 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|4,52 µl
 +
|TEF1-P (16,8 ng/µl)
 +
|-
 +
|9,5 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|1,46 µl
 +
|P132 (psb1c3 33,5 ng/µl)
 +
|-
 +
|2 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|6,54 µl
 +
|TEF2-P (7,4 ng/µl)
 +
|-
 +
|9,5 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|3,42 µl
 +
|P132 (psb1c3 33,5 ng/µl)
 +
|-
 +
|2 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|4,52 µl
 +
|ADH1-P (52,6 ng/µl)
 +
|-
 +
|9,5 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|0,94 µl
 +
|P132 (psb1c3 33,5 ng/µl)
 +
|-
 +
|2 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|7,06 µl
 +
|TEF1-T (3,1 ng/µl)
 +
|-
 +
|9,5 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|4,44 µl
 +
|P132 (psb1c3 33,5 ng/µl)
 +
|-
 +
|2 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|4,44 µl
 +
|ADH1-T (22,4 ng/µl)
 +
|-
 +
|9,5 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|8 (=100 ng)
 +
|pYESII (12,8 ng/µl)
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|2 µl
 +
|50% PEG 4000
 +
|-
 +
|7,5 µl
 +
|dd H20
 +
|-
 +
|=100µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* From these ligation batches, overnight reactions were generated with negative control.
 +
</div>
<div class ="light_switchable_promoter">
<div class ="light_switchable_promoter">
=== PCR amplification of a fragment of P313 ===
=== PCR amplification of a fragment of P313 ===
Line 10,679: Line 11,576:
Negative control was prepared the same way, with 1 µl ddH2O instead of plasmid template.
Negative control was prepared the same way, with 1 µl ddH2O instead of plasmid template.
-
 
PCR temperature program:
PCR temperature program:
Line 10,747: Line 11,643:
* Then the gel extraction kit from Qiagen was used for extracting the linearized insert from the agarose gel.
* Then the gel extraction kit from Qiagen was used for extracting the linearized insert from the agarose gel.
-
[[File:TUM12_20120809 dennis präp verdau baa36500.jpg]]
+
[[File:TUM12_20120809 dennis präp verdau baa36500.jpg|300px]]
</div>
</div>
Line 10,769: Line 11,665:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Get cells for miniprep for further analytical restriction digest to check whether ligation has worked.
'''Aim:''' Get cells for miniprep for further analytical restriction digest to check whether ligation has worked.
-
 
'''Procedure:''' Picking of 3 clones each of PCR42/p175, PCR43/p175, PCR56/p175, PCR57/p175, PCR58/p175 into 4 ml LB with Amp and PCR42/p133, PCR43/p133, PCR56/p133, PCR57/p133, PCR58/p133 into 4 ml with Chlp. Inbucation at 37°C (shaker) over night.
'''Procedure:''' Picking of 3 clones each of PCR42/p175, PCR43/p175, PCR56/p175, PCR57/p175, PCR58/p175 into 4 ml LB with Amp and PCR42/p133, PCR43/p133, PCR56/p133, PCR57/p133, PCR58/p133 into 4 ml with Chlp. Inbucation at 37°C (shaker) over night.
Line 10,791: Line 11,685:
[[File: TUM12_120809_SDS-PAGE.jpg]]
[[File: TUM12_120809_SDS-PAGE.jpg]]
-
 
Mass of enzymes:
Mass of enzymes:
Line 10,808: Line 11,701:
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast===
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
-
 
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
-
 
'''SDS-PAGE:'''
'''SDS-PAGE:'''
Line 10,860: Line 11,751:
*12 % gel
*12 % gel
*120 V, 1.5 h
*120 V, 1.5 h
-
 
'''Blotting:'''
'''Blotting:'''
Line 10,866: Line 11,756:
*blotting of proteins on a nitrocellulose membrane (Whatman)
*blotting of proteins on a nitrocellulose membrane (Whatman)
*50mA, 1 h
*50mA, 1 h
-
 
'''Blocking:'''
'''Blocking:'''
Line 10,883: Line 11,772:
'''Operational sequence:'''  
'''Operational sequence:'''  
-
The used vectors for the transformations were pSB1C3 RFC25 (p123), and pSB1C3 containing CHS- from the coumaroyl group (p136). Vector lengths are 2070 bps and xxx bps, respectively).
+
The used vectors for the transformations were pSB1C3 RFC25 (p123), and pSB1C3 containing CHS- from the coumaroyl group (p136).  
'''Transformations:'''
'''Transformations:'''
-
* Transformation of (old) chemo competent ''e.coli'' cells, used up to now, and the newly prepared with p123  
+
* Transformation of (old) chemo competent ''E.coli'' cells, used up to now, and the newly prepared with p123  
-
* Transformation of the new chemo competent ''e.coli'' cells with p136 with two slightly different methods:
+
* Transformation of the new chemo competent ''E.coli'' cells with p136 with two slightly different methods:
** as described in previous protocolls, with an heat shock at 37°C for 5 minutes
** as described in previous protocolls, with an heat shock at 37°C for 5 minutes
** with an heat shock at 42°C for 30 seconds, followed by an incubation on ice for 30 minutes (before the cells being incubated with LB- medium)
** with an heat shock at 42°C for 30 seconds, followed by an incubation on ice for 30 minutes (before the cells being incubated with LB- medium)
Line 10,894: Line 11,783:
=='''Friday, August 10th'''==
=='''Friday, August 10th'''==
 +
<div class="constitutive_promoter">
 +
=== Transformation of overnight ligation with TEF1-P, TEF2-P, TEF1-T, ADH1-P, ADH1-T and pTUM104===
 +
 +
'''Investigator''': Georg
 +
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 5 µl of ligation product was added to 100 µl of competent cells and gently mixed.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on chloramphenicol, or ampicillin plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin plates.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===PCR of TEF1-T and TEF2-P from ''Saccharomyces cerevisiae'' genome===
 +
 +
'''Investigator''': Georg
 +
 +
'''Procedure:'''
 +
* Reaction batch for PCR:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|4,3 µl
 +
|P237 (Yeast genome)
 +
|-
 +
|35 µl 
 +
|5x One Taq St. Reaction buffer (NEB)
 +
|-
 +
|3,5 µl
 +
|10 mM dNTPs
 +
|-
 +
|3,5 µl
 +
|O62/10
 +
|-
 +
|3,5 µl
 +
|O63/10
 +
|-
 +
|0.875 µl
 +
|Taq Polym. (NEB)
 +
|-
 +
|124,32 µl
 +
|H20
 +
|-
 +
|=175 µl
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Procedure:'''
 +
* Reaction batch for PCR:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|4,3 µl
 +
|P237 (Yeast genome)
 +
|-
 +
|35 µl 
 +
|5x One Taq St. Reaction buffer (NEB)
 +
|-
 +
|3,5 µl
 +
|10 mM dNTPs
 +
|-
 +
|3,5 µl
 +
|O64/10
 +
|-
 +
|3,5 µl
 +
|O65/10
 +
|-
 +
|0.875 µl
 +
|Taq Polym. (NEB)
 +
|-
 +
|124,32 µl
 +
|H20
 +
|-
 +
|=175 µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* 2x3 PCR reactions were mixed and PCR was run at the following conditions:
 +
* 30 sec, 94 C Initial Denaturation
 +
* (30 Cycles) 94 C, 30 sec.
 +
* (30 Cycles) 57,5, C 30 sec.
 +
* (30 Cycles) 68 C, 1 min
 +
* Final extension 68 C, 10 min
 +
* Hold 4 C
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===PCR-Purification of TEF1-T and TEF2-P ===
 +
 +
'''Investigator''': Georg
 +
 +
* PCR-Purification was accomplished according to Quiaquick PCR-purification protocoll
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Analytical gel of purified PCR-Products (TEF1-T and TEF2-P) ===
 +
[[File:20120810 Anal.Gel PCR TEF2p,TEF1t.png]]
 +
* PCR was succesfull
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Analytical gelelectrophoresis of PCR product of P313 to introduce RFC25 pre- and suffix ===
=== Analytical gelelectrophoresis of PCR product of P313 to introduce RFC25 pre- and suffix ===
Line 10,976: Line 11,982:
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast - continued===
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast - continued===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
-
 
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
-
 
'''Detection:'''
'''Detection:'''
Line 10,990: Line 11,994:
[[File: TUM12_120810WesternBlot.jpg]]
[[File: TUM12_120810WesternBlot.jpg]]
-
 
Expected bands:
Expected bands:
Line 11,009: Line 12,012:
<div class="limonene">
<div class="limonene">
-
===Miniprep===
+
===Miniprep of transformation august 8th===
'''Investigator:''' Dennis
'''Investigator:''' Dennis
-
Minipreps are stored in a disposal bag on the lowest drawer of -20°C.
+
'''Aim:''' Miniprep of transformation August 8th
 +
 
 +
The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 40 µl ddH2O at room temperature, with the columns having been incubated 2 minutes at room temperature before the final centrifugation.
 +
'''Miniprep products are stored in a 50 ml Falcon tube in the lowest drawer at -20°C '''
 +
 
</div>
</div>
Line 11,058: Line 12,065:
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast===
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast===
'''Investigator:''' Ingmar
'''Investigator:''' Ingmar
-
 
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag using Strep MAB classic
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag using Strep MAB classic
-
 
'''SDS-PAGE:'''
'''SDS-PAGE:'''
Line 11,070: Line 12,075:
*12.5 µl sample
*12.5 µl sample
*90 V as long as the samples cross the collecting gel, afterwards 110 V until the dye is close to the lower end of the gel.
*90 V as long as the samples cross the collecting gel, afterwards 110 V until the dye is close to the lower end of the gel.
-
 
'''Blotting:'''
'''Blotting:'''
Line 11,076: Line 12,080:
*blotting of proteins on a nitrocellulose membrane (Whatman) according to the protocol of Nadine Kallweit
*blotting of proteins on a nitrocellulose membrane (Whatman) according to the protocol of Nadine Kallweit
*50mA per gel, 1 h
*50mA per gel, 1 h
-
 
'''Blocking:'''
'''Blocking:'''
Line 11,088: Line 12,091:
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast - continued===
===Western Blot of PAL, 4CL, CHS, OMT, APT and GFP expressed in yeast - continued===
'''Investigator:''' Ingmar
'''Investigator:''' Ingmar
-
 
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
'''Aim of the experiment:''' Detecion of enzymes via Strep-tag
-
 
'''Detection:'''
'''Detection:'''
Line 11,138: Line 12,139:
*Sample taking after variable time after inducton in order to optimizie the amount of desired protein.
*Sample taking after variable time after inducton in order to optimizie the amount of desired protein.
*Test different blocking techniques for the Western Blot to reduce the background signal.
*Test different blocking techniques for the Western Blot to reduce the background signal.
 +
</div>
</div>
</div>
 +
=Week 10=
 +
<!--
 +
<p class="limonene">'''Limonene (16 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (6 Experiments):'''</p>
 +
*
 +
 +
<p class="thaumatin">'''Thaumatin (5 Experiments):'''</p>
 +
*
 +
 +
<p class="caffeine">'''Caffeine (14 Experiments):'''</p>
 +
*
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (13 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (41 Experiments):'''</p>
 +
*
 +
 +
<html><a class="WDetails" href="#Week_10" id="Week_10">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_10">
== '''Monday, August 13th''' ==
== '''Monday, August 13th''' ==
 +
<div class="constitutive_promoter">
 +
===Preparative digestion of PCR-Products TEF2-P and TEF1-T===
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|6 µl
 +
|PstI (NEB)
 +
|-
 +
|6 µl 
 +
|XbaI (NEB)
 +
|-
 +
|30 µl
 +
|NEB-4 buffer
 +
|-
 +
|3 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|105 µl
 +
|dd H20
 +
|-
 +
|=150 µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* To 25 µl mastermix were 25 µl of PCR-product added
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Picking of colonies of psb1c3 with TEF1-t, TEF2-P, ADH1-P und ADH1-t, pTUM104===
 +
 +
'''Investigator:''' Georg
 +
* no colonies of pYES2-TUM
 +
* 10 colonies of TEF1-T, TEF2-P, 8 from ADH1-P and ADH1-T
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Preparative digestion of pTUM104===
 +
 +
'''Investigator:''' Georg
 +
 +
** Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20 µl
 +
|pYESII
 +
|-
 +
|2 µl 
 +
|SwaI
 +
|-
 +
|2 µl 
 +
|PvuII
 +
|-
 +
|4 µl
 +
|NEB-3 buffer
 +
|-
 +
|0,4 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|13,6 µl
 +
|dd H20
 +
|-
 +
|=40µl
 +
|'''TOTAL'''
 +
|}
 +
* Digestion was started with SwaI and BSA, for 3 hours at room temperature. Afterwards PvuII was added and digestion processed at 37 C
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
Line 11,200: Line 12,295:
</div>
</div>
-
<div class="coumaryl">
 
-
 
-
</div>
 
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
Line 11,697: Line 12,789:
* The pellet was resuspended in 100&nbsp;µl of LB-medium and this concentrated cell suspension was plated again on suitable antbiotic plates.
* The pellet was resuspended in 100&nbsp;µl of LB-medium and this concentrated cell suspension was plated again on suitable antbiotic plates.
 +
</div>
 +
 +
<div class="coumaryl">
 +
 +
===  Quick Change mutagenesis to remove SpeI(at 684 bp) in the 4CL and SpeI (at 470 bp) in CHS  ===
 +
 +
'''Investigator: Ingmar'''
 +
 +
Aim of the experiment: Generation of RFC 25 compatible versions of the 4CL and CHS genes.
 +
'''Used plasmids'''
 +
*pYes
 +
**4Cl+: P193
 +
**4CL-: P194
 +
**CHS+: P195
 +
**CHS-: P196
 +
*PSB1C3
 +
**4CL+ P185
 +
**4CL-: P186
 +
**CHS+: P135
 +
**CHS-: P136
 +
 +
'''PCR'''<br>
 +
'''Reaction batch 1'''
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2.5 µl
 +
|10x Pfu Ultra II buffer
 +
|-
 +
|4 µl
 +
|DNA
 +
|-
 +
|0.5 µl
 +
|1:10 dilution of O81 for 4 CL and O83 for CHS (10 pmol/µL)
 +
|-
 +
|16.5 µl
 +
|ddH2O
 +
|-
 +
|0.5 µl
 +
|dNTP mix
 +
|-
 +
|0.5 µl
 +
|Pfu Ultra II DNA polymerase (2.5 U / µl)
 +
|}
 +
 +
'''Reaction batch 2'''
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2.5 µl
 +
|10x Pfu Ultra II buffer
 +
|-
 +
|4 µl
 +
|DNA
 +
|-
 +
|0.5 µl
 +
|1:10 dilution of O82 for 4 CL and O84 for CHS (10 pmol/µL)
 +
|-
 +
|16.5 µl
 +
|ddH2O
 +
|-
 +
|0.5 µl
 +
|dNTP mix
 +
|-
 +
|0.5 µl
 +
|Pfu Ultra II DNA polymerase (2.5 U / µl)
 +
|}
 +
 +
'''PCR cycling parameters'''
 +
{|cellspacing="0" border="1"
 +
|'''Segment'''
 +
|'''Cycles'''
 +
|'''Temperature'''
 +
|'''Time'''
 +
|-
 +
|1
 +
|1
 +
|95 °C
 +
| 30 sec
 +
|-
 +
|2
 +
|10
 +
|95°C
 +
| 30 sec
 +
|-
 +
|
 +
|
 +
|55°C
 +
| 1 min
 +
|-
 +
|
 +
|
 +
|67°C
 +
| 6 min
 +
|-
 +
|}
 +
*Having completed the PCR cycling parameters listed above both PCR reaction batches were mixed together and the cycling parameters listed above were one time more applied.
 +
*Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.
 +
 +
''' Transformation into ''E.coli'' Xl1-Blue'''
 +
'''Operation Sequence'''
 +
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
 +
* addition of 1 µl of the PCR product
 +
* incubation for 30 min on ice
 +
* heat shock for 5 min at 37 °C
 +
* transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
 +
* plate 100 µl on an Amp-LB-plate
 +
* sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate
</div>
</div>
Line 11,719: Line 12,921:
<div class="coumaryl">
<div class="coumaryl">
-
===small-Scale Yeast Transformation of pYES without insert===
+
===Small-Scale Yeast Transformation of pTUM104 without insert===
'''Investigator:''' Katrin, Ingmar
'''Investigator:''' Katrin, Ingmar
-
'''Aim of the experiment:'''Transformation of P152 (pYes without insert) in Yeast  
+
'''Aim of the experiment:'''Transformation of P152 (pTUM104 without insert) in Yeast  
The protocol on page 13 of the pYES2 manual was used. To ensure a positive result, two transformations were made.
The protocol on page 13 of the pYES2 manual was used. To ensure a positive result, two transformations were made.
-
 
Only modifications are noted:
Only modifications are noted:
Line 11,732: Line 12,933:
step 2: OD600 = 5,6 -> to determine a OD600 of 0.4 in 50 ml, 3 ml yeast suspension and 50 ml YPD medium were used.  
step 2: OD600 = 5,6 -> to determine a OD600 of 0.4 in 50 ml, 3 ml yeast suspension and 50 ml YPD medium were used.  
-
 
steps 3 and 4: centrifugation for 5 min, 4 °C
steps 3 and 4: centrifugation for 5 min, 4 °C
-
 
step 6:  
step 6:  
Line 11,769: Line 12,968:
<div class="caffeine">
<div class="caffeine">
-
=== Restriction digest of p123 and p136 and preparative gel electrophoresisb===
+
=== Restriction digest of p123 and p136 and preparative gel electrophoresis===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 11,825: Line 13,024:
'''Aim:'''  
'''Aim:'''  
-
Dilution of dried pUCIDT- Amp vector, which contains the gene synthesis products. Afterwards, transformation of pUCIDT_CaXMT1, pUCIDT_CaMXMT1 and pUCIDT_CaDXMT1 in chemo competent XL-1 blue ''e.coli-'' cells, to make the genes available for cloning in pSB1C3 and pYES2.
+
Dilution of dried pUCIDT- Amp vector, which contains the gene synthesis products. Afterwards, transformation of pUCIDT_CaXMT1, pUCIDT_CaMXMT1 and pUCIDT_CaDXMT1 in chemo competent XL-1 blue ''e.coli-'' cells, to make the genes available for cloning in pSB1C3 and pTUM104
'''Operational sequence'''
'''Operational sequence'''
Line 11,856: Line 13,055:
</div>
</div>
-
== '''Tuesday, August 14th''' ==
+
<div class="thaumatin">
-
<div class="caffeine">
+
=== Preparative restriction digest and gel electrophoresis of the preprothaumatin plasmid and pTUM104 ===
-
=== Analysis of plated XL1-blue chemo competent ''e.coli'' (untransformed) ===
+
'''Investigator:''' Maddin, Aloisius
-
'''Investigator:''' Volker
+
'''Aim:''' Cloning of preprothaumatin on pTUM104
-
'''Aim:'''  
+
'''Operational sequence'''
-
Test of prepared chemo competent cells (empty) due to present resistance for chloramphenicol
+
Preparative restriction digest:
-
'''Results'''
+
* 5 µl pYes2; 1 µl ''Xba''I; 1 µl ''Spe''I; 5 µl 10x NEBuffer 4;0,5 µl BSA; 37.5 µl ddH2O; 37 °C, 1 h.
-
Again 14 colonies have grown on the plate, after incubating at 37°C over night. One can presume, that the newly prepared competent cells have taken up any plasmid providing chloramphenicol resistance (e.g. pSB1C3), makin them unuseful for our experiments. The uptake probably took place when inoculating the LB medium, one day befor the cells were prepared, because a sample of our old competent cells was used for the inoculation instead of a plated colony of ''e.coli-'' XL1-blue.  
+
* 10 µl Preprothaumatinplasmid (gene synthesis!); 1 µl ''Xba''I; 1 µl ''Spe''I; 5 µl 10x NEBuffer 4; 0,5 µl BSA; 32.5 µl ddH2O; 37 °C, 1 h.
 +
 
 +
* Preparative gel electrophoresis: expected lengths for pYes2: backbone: 5.8 kb, (insert: 62 bp); expected length for preprothaumtin plasmid: backbone: 2.2 kb, insert: 721 bp.
 +
 
 +
* Gel extraction according to QIAqick®  Gel  Extraction Kit. Not successful, EtOH was forgotten.
 +
* Transformation of ''E. coli'' XL1-Blue with the preprothaumatin plasmid (selection with amp).
 +
 
 +
</div>
 +
 
 +
== '''Tuesday, August 14th''' ==
 +
<div class="constitutive_promoter">
 +
 
 +
===Analytical digestion of picked colony-DNA with XbaI- + PSTI-HF===
 +
 
 +
''' Investigator''': Georg
 +
 
 +
'''Aim of experiment:''' Find positive clones from transformation with ligation products ADH1-P+psb1c3, ADH1-T+psb1c3,TEF1-t+psb1c3 and TEF1-P+psb1c3
 +
 
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5,5 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|5,5 µl 
 +
|XbaI (NEB)
 +
|-
 +
|44 µl
 +
|NEB-4 buffer
 +
|-
 +
|4,4 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|325,6 µl
 +
|dd H20
 +
|-
 +
|=385µl
 +
|'''TOTAL'''
 +
|}
 +
 
 +
* to 2,5 ml of DNA 17,5 µl reaction batch were added
 +
* Digestion took place at 37°C for 1 h
 +
 
 +
[[File:20120814 Anal.Gel Lig. ADH1-p in pSB1C3.png]]
 +
[[File:20120814 Anal.GEl Lig. TEF1-t in psb1c3.png]]
 +
* NO TEF1-T as insert but TEF1-P, you probably has mismatched tubes
 +
[[File:20120814 Anal.Gel, ADH1 Term lig in pSB1C3.png]]
 +
* Ligation was succesful
 +
*[[File:20120814 TEF2 Prom ligiert in psb1c3 (falsch).png]]
 +
* wrong insert
</div>
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue ===
+
 
 +
=== Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in ''E. coli'' XL1-Blue ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment''': Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue.
+
'''Aim of the experiment''': Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in ''E. coli'' XL1-Blue.
'''Procedure:'''
'''Procedure:'''
Line 11,889: Line 13,140:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Reapeat of transformation of E. coli XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th ===
+
=== Reapeat of transformation of ''E. coli'' XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment''': Reapeat of transformation of E. coli XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th. The reason is that the freshly prepared competent cells are contaminated with a foreign plasmid.
+
'''Aim of the experiment''': Reapeat of transformation of ''E. coli'' XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th. The reason is that the freshly prepared competent cells are contaminated with a foreign plasmid.
'''Procedure:'''
'''Procedure:'''
Line 11,912: Line 13,163:
* The pellet was resuspended in 100&nbsp;µl of LB-medium and this concentrated cell suspension was plated again on suitable antbiotic plates. Accidently, only the pellet of P342+PCR66 and P342 NK was plated.
* The pellet was resuspended in 100&nbsp;µl of LB-medium and this concentrated cell suspension was plated again on suitable antbiotic plates. Accidently, only the pellet of P342+PCR66 and P342 NK was plated.
 +
</div>
 +
 +
<div class="caffeine">
 +
 +
=== Analysis of plated XL1-blue chemo competent ''E.coli'' (untransformed) ===
 +
 +
'''Investigator:''' Volker
 +
 +
'''Aim:'''
 +
 +
Test of prepared chemo competent cells (empty) due to present resistance for chloramphenicol
 +
 +
'''Results'''
 +
 +
Again 14 colonies have grown on the plate, after incubating at 37°C over night. One can presume, that the newly prepared competent cells have taken up any plasmid providing chloramphenicol resistance (e.g. pSB1C3), makin them unuseful for our experiments. The uptake probably took place when inoculating the LB medium, one day befor the cells were prepared, because a sample of our old competent cells was used for the inoculation instead of a plated colony of ''e.coli-'' XL1-blue.
 +
</div>
</div>
Line 11,919: Line 13,186:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pYES and pSB1C3.
+
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 11,948: Line 13,214:
* 2,5 µl DNA added to 17,5 µl Master-Mix
* 2,5 µl DNA added to 17,5 µl Master-Mix
* Incubation at 37°C for 1,5 h.
* Incubation at 37°C for 1,5 h.
-
 
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 11,969: Line 13,234:
*The following media were made:
*The following media were made:
-
 
SC-U medium (synthetic complete medium, without uracil)
SC-U medium (synthetic complete medium, without uracil)
Line 11,983: Line 13,247:
* 5% (v/v) glycerol
* 5% (v/v) glycerol
* 1 mM PMSF
* 1 mM PMSF
 +
 +
</div>
 +
 +
<div class="thaumatin">
 +
 +
=== Minipreparation of the preprothaumatin plasmid (gene synthesis) ===
 +
 +
'''Investigator:''' Martianus, Aloisius
 +
 +
* p343, p344, p345.
</div>
</div>
== '''Wednesday, August 15th''' ==
== '''Wednesday, August 15th''' ==
 +
 +
 +
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
+
 
 +
=== Miniprep of overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment:''' Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
+
'''Aim of the experiment:''' Miniprep of overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
'''Procedure:'''
'''Procedure:'''
Line 12,193: Line 13,471:
<div class="limonene">
<div class="limonene">
-
===Transformation of E.coli XL1 blue with ligation products===
+
===Transformation of ''E.coli'' XL1 blue with ligation products===
Investigator: Andrea
Investigator: Andrea
Line 12,211: Line 13,489:
<div class="limonene">
<div class="limonene">
-
===repetition of analytical restriction digest of ligation products of 10.08. after miniprep===
+
===Repetition of analytical restriction digest of ligation products of 10.08. after miniprep===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pYES and pSB1C3.
+
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 12,244: Line 13,521:
* 2,5 µl DNA added to 17,5 µl Master-Mix
* 2,5 µl DNA added to 17,5 µl Master-Mix
* Incubation at 37°C for 2 h.
* Incubation at 37°C for 2 h.
-
 
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 12,258: Line 13,534:
<div class="limonene">
<div class="limonene">
 +
===Picking of colonies of transformation (August 3rd and August 8th)===
===Picking of colonies of transformation (August 3rd and August 8th)===
'''Investigator:''' Katrin
'''Investigator:''' Katrin
-
 
'''Aim:''' Get cells for miniprep for further analytical restriction digest to check whether ligation has worked.
'''Aim:''' Get cells for miniprep for further analytical restriction digest to check whether ligation has worked.
-
 
'''Procedure:'''  
'''Procedure:'''  
Line 12,280: Line 13,555:
'''Investigator:''' Katrin
'''Investigator:''' Katrin
-
'''Aim of the experiment:'''Picking transformed Saccharomyces cerevisae cells for protein expression in yeast (expression will be done on Thursday, August 16th)
+
'''Aim of the experiment:'''Picking transformed ''Saccharomyces cerevisiae'' cells for protein expression in yeast (expression will be done on Thursday, August 16th)
* Inocultion of overnight cultures: one clone from each plates with PAL+/-, CHS+/-, 4CL+/-, OMT1+/-, APT, GFP was picked,resuspended in 15 ml SCU medium with glucose and incubated at 30 °C overnight
* Inocultion of overnight cultures: one clone from each plates with PAL+/-, CHS+/-, 4CL+/-, OMT1+/-, APT, GFP was picked,resuspended in 15 ml SCU medium with glucose and incubated at 30 °C overnight
Line 12,286: Line 13,561:
== '''Thursday, August 16th''' ==
== '''Thursday, August 16th''' ==
 +
<div class="constitutive_promoter">
 +
===Analytical digestion of P307+P309===
 +
 +
'''Investigator''': Georg
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|0,5 µl 
 +
|XbaI (NEB)
 +
|-
 +
|4µl
 +
|NEB-4 buffer
 +
|-
 +
|0,4 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|29,6 µl
 +
|dd H20
 +
|-
 +
|=35 µl
 +
|'''TOTAL'''
 +
|}
 +
* To 17,5 µl reaction mix, 2,5 µl DNA were added
 +
* Digestion took 1 hour at 37 C
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Gelextraction of linear pTUM104===
 +
 +
'''Investigator:''' Georg
 +
 +
* Gelextraction was done according to Quiaquick gel extraction kit
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Nanodrop for measuring the concentration of P265,264===
 +
 +
'''Investigator:''' Georg
 +
 +
*P265 :11,2 ng/µl
 +
*P264 :12,7 ng/µl
 +
*P264B:13,8 ng/µl
 +
*P265B:14,9 ng/µl
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Ligation of pTUM104===
 +
'''Investigator''': Georg
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|3,36 µl (=50 ng)
 +
|P265B (PYesII digested)
 +
|-
 +
|5 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|2,5 %
 +
|50% PEG 4000
 +
|-
 +
|24,14 µl
 +
|dd H20
 +
|-
 +
|=50µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Ligation took place at 16 C overnight
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Preparative digestion of P 402 + P91===
 +
 +
'''Investigator''': Georg
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|2 µl 
 +
|SpeI-HF (NEB)
 +
|-
 +
|8 µl
 +
|NEB-4 buffer
 +
|-
 +
|0,8 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|27,2 µl
 +
|dd H20
 +
|-
 +
|=40µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Digestion was done at 37 C for 3 hours
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Ligation of TEF2-P (PCR59) and Cyc1-T P131 with P132===
 +
 +
'''Investigator''': Georg
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|2,99 µl (=100 ng)
 +
|P132
 +
|-
 +
|2 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|8,01 µl
 +
|PCR59
 +
|-
 +
|6,5 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|0,5 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|2,99 µl (=100 ng)
 +
|P132
 +
|-
 +
|2 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|9,31 µl
 +
|P131
 +
|-
 +
|5,5 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Ligation was done at 16 C overnight
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Analytic digestion and gelelectrophoresis of P362, P364 and P366 ===
=== Analytic digestion and gelelectrophoresis of P362, P364 and P366 ===
Line 12,338: Line 13,786:
[[File:TUM12_20120816_anal_gel_01.jpg|500px]]
[[File:TUM12_20120816_anal_gel_01.jpg|500px]]
-
</div>
 
-
 
-
<div class="coumaryl">
 
-
=== Induction, Incubation and cell disruption of ''S.c.'' containing PAL+/-, 4Cl+, CHS+/-, OMT+/-, APT and GFP ===
 
-
 
-
'''Investigator:''' Ingmar, Katrin
 
-
 
-
'''Aim of the experiment:''' Take samples at  variable times after induction and disrupt the cells in order to optimize the amount of desired protein.
 
-
'''Procedure:'''
 
-
*at 13:30h the overnight culture was diluted in 50 ml SC-U medium conataining 2 % galactose until an OD600 of 0.4.
 
-
* beginning 4h after induction every 3 h samples were taken and cells were disrupted according to "Expression in Saccharomyces cerevisiae" of Huang FC, Studart-Witkowski C & Schwab W 2010. The supernatant of the disrupted cells were used for protein concentration appreciation using the nanodrop photometer. Afterwards they were stored at -80°C.
 
-
</div>
 
-
 
-
<div class="light_switchable_promoter">
 
-
 
-
=== Picking from the transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue from Tuesday, the 14th ===
 
-
 
-
'''Investigator:''' Jeff
 
-
 
-
'''Aim of the experiment''': Picking from the transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue from Tuesday, the 14th because the same transformation the day before failed because the competent cells were contaminated, e.&nbsp;g. they already carries a plasmid.
 
-
 
-
'''Procedure:'''
 
-
 
-
* 5 colonies of each transformation from P71+P322 (AmpR), P71+P323 (AmpR), P206+P337 (CamR) and P342+PCR66 (AmpR) transformated cells were picked from the transformation from Tuesday, the 14th.
 
-
 
-
* Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4&nbsp;ml of LB-medium and antibiotics (P71+P322 (AmpR), P71+P323 (AmpR), P206+P337 (CamR) and P342+PCR66 (AmpR)). These tubes were put 10&nbsp;h in a 180&nbsp;rpm cell culture shaker at 37&nbsp;°C.
 
</div>
</div>
Line 12,396: Line 13,818:
* Sequencing results:
* Sequencing results:
-
<code>
 
  TATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAA
  TATAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAA
  GGATGATTTCTGGAATTCGCGGCCGCTTCTAGATGGCCGGCGCGAGCGGCGCGGGCGGCA
  GGATGATTTCTGGAATTCGCGGCCGCTTCTAGATGGCCGGCGCGAGCGGCGCGGGCGGCA
Line 12,414: Line 13,835:
  ATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAG
  ATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAG
  GTATCTCAGTTCGGTGTAGGTCG
  GTATCTCAGTTCGGTGTAGGTCG
-
</code>
 
* Sequencing is fine!
* Sequencing is fine!
Line 12,496: Line 13,916:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Preperative digestion of P231 ===
=== Preperative digestion of P231 ===
Line 12,665: Line 14,086:
|-
|-
|Polymerase One Taq  
|Polymerase One Taq  
-
|0,25
+
|0.25
|-
|-
|}
|}
Line 12,683: Line 14,104:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of the 10&nbsp;h culture of transformated E. coli XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
+
 
 +
=== Miniprep of the 10&nbsp;h culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment:''' Miniprep of the 10&nbsp;h culture of transformated E. coli XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
+
'''Aim of the experiment:''' Miniprep of the 10&nbsp;h culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
'''Procedure:'''
'''Procedure:'''
Line 12,765: Line 14,187:
* The ligation was performed at 16&nbsp;°C overnight.
* The ligation was performed at 16&nbsp;°C overnight.
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
=== Picking from the transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in ''E. coli'' XL1-Blue from Tuesday, the 14th ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment''': Picking from the transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue from Tuesday, the 14th because the same transformation the day before failed because the competent cells were contaminated, e.&nbsp;g. they already carries a plasmid.
 +
 +
'''Procedure:'''
 +
 +
* 5 colonies of each transformation from P71+P322 (AmpR), P71+P323 (AmpR), P206+P337 (CamR) and P342+PCR66 (AmpR) transformated cells were picked from the transformation from Tuesday, the 14th.
 +
 +
* Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4&nbsp;ml of LB-medium and antibiotics (P71+P322 (AmpR), P71+P323 (AmpR), P206+P337 (CamR) and P342+PCR66 (AmpR)). These tubes were put 10&nbsp;h in a 180&nbsp;rpm cell culture shaker at 37&nbsp;°C.
 +
</div>
 +
 +
<div class="coumaryl">
 +
=== Induction, Incubation and cell disruption of ''S.c.'' containing PAL+/-, 4Cl+, CHS+/-, OMT+/-, APT and GFP ===
 +
 +
'''Investigator:''' Ingmar, Katrin
 +
 +
'''Aim of the experiment:''' Take samples at  variable times after induction and disrupt the cells in order to optimize the amount of desired protein.
 +
'''Procedure:'''
 +
*at 13:30h the overnight culture was diluted in 50 ml SC-U medium conataining 2 % galactose until an OD600 of 0.4.
 +
* beginning 4h after induction every 3 h samples were taken and cells were disrupted according to "Expression in Saccharomyces cerevisiae" of Huang FC, Studart-Witkowski C & Schwab W 2010. The supernatant of the disrupted cells were used for protein concentration appreciation using the nanodrop photometer. Afterwards they were stored at -80°C.
</div>
</div>
Line 12,792: Line 14,240:
<div class="caffeine">
<div class="caffeine">
-
=== Restriction digest of p373 (pYES2 new MCS RFC25) ===
+
=== Restriction digest of p373 (pTUM104 new MCS RFC25) ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 12,798: Line 14,246:
'''Aim:'''  
'''Aim:'''  
-
Restriction digest of pYES2 new with Xba1 and Pst1-HF to be able to clone the caffeine genes into.  
+
Restriction digest of pTUM104 with Xba1 and Pst1-HF to be able to clone the caffeine genes into.  
'''Operational Sequence'''
'''Operational Sequence'''
Line 12,837: Line 14,285:
{| cellspacing="0" border="1"
{| cellspacing="0" border="1"
|DNA- Ladder
|DNA- Ladder
-
|pYES2newMCS_Xba1Pst1
+
|pTUM104_Xba1Pst1
|}
|}
Line 12,844: Line 14,292:
<div class="caffeine">
<div class="caffeine">
-
=== Picking of transformed ''e.coli-'' XL1-blue cells and preparation of liquid cultures ===
+
=== Picking of transformed ''E.coli-'' XL1-blue cells and preparation of liquid cultures ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 12,865: Line 14,313:
<div class="caffeine">
<div class="caffeine">
-
=== Gel extraction of p373 (=pYES2 new MCS RFC25) ===
+
=== Gel extraction of p373 (=pTUM104) ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 12,871: Line 14,319:
'''Aim:'''  
'''Aim:'''  
-
Extraction of Xba1 and Pst1 digested pYES2 new out of agarose gel, to make it ready for ligation
+
Extraction of Xba1 and Pst1 digested pTUM104 out of agarose gel, to make it ready for ligation
'''Operational sequence:'''
'''Operational sequence:'''
Line 12,885: Line 14,333:
<div class="limonene">
<div class="limonene">
 +
=== PCR of C-LS3 (BBa_I742111, Trafo 19.6) ===
=== PCR of C-LS3 (BBa_I742111, Trafo 19.6) ===
Line 12,890: Line 14,339:
'''Aim:''' To get more PCR product in case another preparative digest is needed.
'''Aim:''' To get more PCR product in case another preparative digest is needed.
-
 
'''Primer with consensus sequence'''
'''Primer with consensus sequence'''
Line 12,922: Line 14,370:
|'''TOTAL'''
|'''TOTAL'''
|}
|}
-
 
'''Primer without consensus sequence'''
'''Primer without consensus sequence'''
Line 12,981: Line 14,428:
|1 h
|1 h
|}
|}
 +
 +
*1: Primer O27 / O30
 +
*2: Primer O28 / O30
</div>
</div>
<div class="limonene">
<div class="limonene">
 +
=== PCR of Schwab plasmid Quickchange-DNA to amplify gene for lavendula LS===
=== PCR of Schwab plasmid Quickchange-DNA to amplify gene for lavendula LS===
Line 13,057: Line 14,508:
|1 h
|1 h
|}
|}
 +
 +
*3: Primer O33/O37
 +
*4: Primer O34/O37
 +
*5: Primer O35/O37
 +
</div>
</div>
<div class="limonene">
<div class="limonene">
-
===Miniprep of pYES clones picked on August 15th===
+
 
 +
===Miniprep of pTUM104 clones picked on August 15th===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
 
'''Aim:''' Get transformed plasmids for further ligations.
'''Aim:''' Get transformed plasmids for further ligations.
-
 
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
Line 13,078: Line 14,533:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
 
'''Aim:''' Get transformed plasmids for further analytical restriction digest to check whether ligation worked.
'''Aim:''' Get transformed plasmids for further analytical restriction digest to check whether ligation worked.
-
 
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
'''Procedure:''' Miniprep was done using Qiagen miniprep kit.
Line 13,121: Line 14,574:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Prepare digested PCR fragments for further ligation into pYES and pSB1C3.
+
'''Aim:''' Prepare digested PCR fragments for further ligation into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 13,158: Line 14,610:
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
 +
 +
Limonensynthase: 1600 bp
[[File:16.08.12 prepgel1 bearbeitet.png|400px]]
[[File:16.08.12 prepgel1 bearbeitet.png|400px]]
[[File:16.08.12 prepgel4 bearbeitet.png|400px]]
[[File:16.08.12 prepgel4 bearbeitet.png|400px]]
-
 
'''Digested PCR products (still in gel) are stored in an disposal bag at the upper drawer of -20°C. '''
'''Digested PCR products (still in gel) are stored in an disposal bag at the upper drawer of -20°C. '''
Line 13,171: Line 14,624:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
 
'''Aim:''' Dephosphorylation of digested PCR products to avoid religation of the insert and enhance ligation rate.
'''Aim:''' Dephosphorylation of digested PCR products to avoid religation of the insert and enhance ligation rate.
Line 13,183: Line 14,635:
* incubate at 37°C for 30 min
* incubate at 37°C for 30 min
* inactivation at 65°C for 15 min
* inactivation at 65°C for 15 min
-
 
</div>
</div>
Line 13,189: Line 14,640:
<div class="thaumatin">
<div class="thaumatin">
-
===Preparative restriction digest of P343, P344, P345, P152 (pYES) and P286 (pSB1C3)===
+
===Preparative restriction digest of P343, P344, P345, P152 (pTUM104) and P286 (pSB1C3)===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Prepare digested Preprothaumatin plasmids for further ligation into pYES and pSB1C3.
+
'''Aim:''' Prepare digested Preprothaumatin plasmids for further ligation into pTUM104 and pSB1C3.
-
 
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 13,227: Line 14,677:
P187 was used as positive control for restriction digest (XbaI and AgeI).
P187 was used as positive control for restriction digest (XbaI and AgeI).
-
Before Gelelectrophoresis Dephosphorylation of vectors (pYES and pSB1C3) was done (see next part) !
+
Before Gelelectrophoresis Dephosphorylation of vectors (pTUM104 and pSB1C3) was done (see next part) !
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 13,240: Line 14,690:
<div class="thaumatin">
<div class="thaumatin">
-
===Dephosphorylation of digested pSB1C3 and pYES (with XbaI and SpeI)===
+
===Dephosphorylation of digested pSB1C3 and pTUM104 (with XbaI and SpeI)===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
 
'''Aim:''' Dephosphorylation of digested vectors to avoid religation and enhance ligation rate.
'''Aim:''' Dephosphorylation of digested vectors to avoid religation and enhance ligation rate.
Line 13,332: Line 14,781:
</div>
</div>
-
<div class="coumaryl">
 
-
===  Quick Change mutagenesis to remove EcoRI(at 310 bp) in the 4CL  ===
 
-
 
-
'''Investigator: Ingmar'''
 
-
 
-
Aim of the experiment: Generation of an RFC 25 compatible version of the 4CL gene.
 
-
 
-
'''PCR'''<br>
 
-
'''Reaction batch 1'''
 
-
{|cellspacing="0" border="1"
 
-
|'''volume'''
 
-
|'''reagent'''
 
-
|-
 
-
|2.5 µl
 
-
|10x Pfu Ultra II buffer
 
-
|-
 
-
|4 µl
 
-
|DNA
 
-
|-
 
-
|0.5 µl
 
-
|1:10 dilution of O79 (10 pmol/µL)
 
-
|-
 
-
|16.5 µl
 
-
|ddH2O
 
-
|-
 
-
|0.5 µl
 
-
|dNTP mix
 
-
|-
 
-
|0.5 µl
 
-
|Pfu Ultra II DNA polymerase (2.5 U / µl)
 
-
|}
 
-
 
-
'''Reaction batch 2'''
 
-
{|cellspacing="0" border="1"
 
-
|'''volume'''
 
-
|'''reagent'''
 
-
|-
 
-
|2.5 µl
 
-
|10x Pfu Ultra II buffer
 
-
|-
 
-
|4 µl
 
-
|DNA
 
-
|-
 
-
|0.5 µl
 
-
|1:10 dilution of O80 (10 pmol/µL)
 
-
|-
 
-
|16.5 µl
 
-
|ddH2O
 
-
|-
 
-
|0.5 µl
 
-
|dNTP mix
 
-
|-
 
-
|0.5 µl
 
-
|Pfu Ultra II DNA polymerase (2.5 U / µl)
 
-
|}
 
-
 
-
 
-
'''PCR cycling parameters'''
 
-
{|cellspacing="0" border="1"
 
-
|'''Segment'''
 
-
|'''Cycles'''
 
-
|'''Temperature'''
 
-
|'''Time'''
 
-
|-
 
-
|1
 
-
|1
 
-
|95 °C
 
-
| 30 sec
 
-
|-
 
-
|2
 
-
|10
 
-
|95°C
 
-
| 30 sec
 
-
|-
 
-
|
 
-
|
 
-
|55°C
 
-
| 1 min
 
-
|-
 
-
|
 
-
|
 
-
|67°C
 
-
| 6 min
 
-
|-
 
-
|}
 
-
*Having completed the PCR cycling parameters listed above both PCR reaction batches were mixed together and the cycling parameters listed above were one time more applied.
 
-
*Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.
 
-
 
-
''' Transformation into ''E.coli'' Xl1-Blue'''
 
-
'''Operation Sequence'''
 
-
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
 
-
* addition of 1 µl of the PCR product
 
-
* incubation for 30 min on ice
 
-
* heat shock for 5 min at 37 °C
 
-
* transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
 
-
* plate 100 µl on an Amp-LB-plate
 
-
* sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate
 
-
</div>
 
-
 
-
 
-
</div>
 
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
Line 13,579: Line 14,927:
* Incubation at 37&nbsp;°C overnight.
* Incubation at 37&nbsp;°C overnight.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Transformation of ''E.coli'' Xl1-Blue with ligation of TEF2-p, CYC1-t with psb1c3 and pTUM104 selfligation ===
 +
''' Investigator''': Georg
 +
 +
*5 µl of each ligation reaction were transferred to 100 µl of competent cells.
 +
*Cells were kept on ice for 30 min.
 +
*Cells were heatshocked for 5 min. at 37 C
 +
*Cells were incubated for 45 min. at 37 C
 +
*Cells that were transformed with psb1c3 ligation product were transferred on Agarplates with Chla. Cells with *pYesII ligation product were palste on Amp Agar plates.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Preparation of probes for sequencing ===
 +
 +
'''Investigator''': Georg
 +
 +
For sequencing of ligation product of Tef1-p, ADH1-p, Tef1-t and ADH1-t, with vector psb1c3 ligation products were diluted on a concentration between 50 ng/µl and 100 ng/µl at a min. volume of 15 µl.
 +
Sequencing primers were diluted to 2 µM at an min. volume of 15 µl
 +
 +
*ADH1-P (188 ng/µl):2 = 7,5 µl (P401) + 7,5 µl H20
 +
*ADH-T (153,5 ng :2 = 7,5 µl + 7,5 µl H20
 +
*TEF1-P (207,8 ng/µl) :3 = 5 µl + 10 µl H20
 +
*Tef1-T (202,2 ng/µl) :3 = 5 µl + 10 µl H20
 +
*TEF2 (PCR-Product)  (12,3 ng/µl)= 6,1 µl (TEF2-p) + 8,9 µl H20 = 5 ng/µl
 +
 +
Sequencing primer: VF2 for ADH1-p, ADH1-t, TEF1-p, TEF1-t. VR for ADH1-p rv. TEF2p_fw for TEF2-p
 +
                 
 +
</div>
 +
 +
<div class="coumaryl">
 +
 +
===  Quick Change mutagenesis to remove EcoRI(at 310 bp) in the 4CL  ===
 +
 +
'''Investigator: Ingmar'''
 +
 +
Aim of the experiment: Generation of an RFC 25 compatible version of the 4CL gene.
 +
 +
'''PCR'''<br>
 +
'''Reaction batch 1'''
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2.5 µl
 +
|10x Pfu Ultra II buffer
 +
|-
 +
|4 µl
 +
|DNA
 +
|-
 +
|0.5 µl
 +
|1:10 dilution of O79 (10 pmol/µL)
 +
|-
 +
|16.5 µl
 +
|ddH2O
 +
|-
 +
|0.5 µl
 +
|dNTP mix
 +
|-
 +
|0.5 µl
 +
|Pfu Ultra II DNA polymerase (2.5 U / µl)
 +
|}
 +
 +
'''Reaction batch 2'''
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2.5 µl
 +
|10x Pfu Ultra II buffer
 +
|-
 +
|4 µl
 +
|DNA
 +
|-
 +
|0.5 µl
 +
|1:10 dilution of O80 (10 pmol/µL)
 +
|-
 +
|16.5 µl
 +
|ddH2O
 +
|-
 +
|0.5 µl
 +
|dNTP mix
 +
|-
 +
|0.5 µl
 +
|Pfu Ultra II DNA polymerase (2.5 U / µl)
 +
|}
 +
 +
'''PCR cycling parameters'''
 +
{|cellspacing="0" border="1"
 +
|'''Segment'''
 +
|'''Cycles'''
 +
|'''Temperature'''
 +
|'''Time'''
 +
|-
 +
|1
 +
|1
 +
|95 °C
 +
| 30 sec
 +
|-
 +
|2
 +
|10
 +
|95°C
 +
| 30 sec
 +
|-
 +
|
 +
|
 +
|55°C
 +
| 1 min
 +
|-
 +
|
 +
|
 +
|67°C
 +
| 6 min
 +
|-
 +
|}
 +
*Having completed the PCR cycling parameters listed above both PCR reaction batches were mixed together and the cycling parameters listed above were one time more applied.
 +
*Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.
 +
 +
''' Transformation into ''E.coli'' Xl1-Blue'''
 +
'''Operation Sequence'''
 +
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
 +
* addition of 1 µl of the PCR product
 +
* incubation for 30 min on ice
 +
* heat shock for 5 min at 37 °C
 +
* transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 30 min
 +
* plate 100 µl on an Amp-LB-plate
 +
* sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate
</div>
</div>
Line 13,586: Line 15,063:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Extract digested PCR products for further ligation.
'''Aim:''' Extract digested PCR products for further ligation.
-
 
Due to previous phosphatase treatment (and presumably application of only 20 µl on the preparative gel), concentrations of products were very low:
Due to previous phosphatase treatment (and presumably application of only 20 µl on the preparative gel), concentrations of products were very low:
Line 13,605: Line 15,080:
<div class="limonene">
<div class="limonene">
-
===Ligation of PCR 42, 43, 56, 57 and 58 with pYES (p175) and pSB1C3 (p133)===
+
===Ligation of PCR 42, 43, 56, 57 and 58 with pTUM104 (p175) and pSB1C3 (p133)===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pYES.
+
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pTUM104.
'''Procedure'''
'''Procedure'''
Line 13,876: Line 15,351:
|=25&nbsp;µl
|=25&nbsp;µl
|}
|}
-
 
-
 
*ligation for 2 h at room temperature.
*ligation for 2 h at room temperature.
* 5 µl of ligation product was transformed. The remaining products were incubated at 16 °C (waterbath) for the weekend.
* 5 µl of ligation product was transformed. The remaining products were incubated at 16 °C (waterbath) for the weekend.
-
 
</div>
</div>
Line 13,889: Line 15,361:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
'''Aim:''' Extract digested prepro-thaumatin for further ligation.
'''Aim:''' Extract digested prepro-thaumatin for further ligation.
-
 
Due to previous phosphatase treatment (and presumably application of only 20 µl on the preparative gel), concentrations of products were very low:
Due to previous phosphatase treatment (and presumably application of only 20 µl on the preparative gel), concentrations of products were very low:
Line 13,911: Line 15,381:
'''Investigators:''' Katrin (digest), Lara (gelelectrophoresis)
'''Investigators:''' Katrin (digest), Lara (gelelectrophoresis)
-
 
'''Aim:''' Check whether ligations have worked (transformation products of 3.8. (ligation 31.7.) & 8.8. (ligation 7.8.))
'''Aim:''' Check whether ligations have worked (transformation products of 3.8. (ligation 31.7.) & 8.8. (ligation 7.8.))
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 13,944: Line 15,412:
[[File:TUM12_LS_analytgel2_1708.png]]
[[File:TUM12_LS_analytgel2_1708.png]]
[[File:TUM12_LS_analytgel3_1708.png]]
[[File:TUM12_LS_analytgel3_1708.png]]
-
 
-
 
</div>
</div>
Line 13,955: Line 15,421:
'''Investigator:''' Lara
'''Investigator:''' Lara
 +
'''Aim:''' Transform ''E.coli'' XL 1 blue with ligation products (PCR42/p133, PCR42/p175, PCR43/p133, PCR43/p175, PCR56/p133, PCR56/p175, PCR57/p133, PCR57/p175, PCR58/p133, PCR58/p175)  to produce colonies containing plasmid DNA.
-
'''Aim:''' Transform E.coli XL 1 blue with ligation products (PCR42/p133, PCR42/p175, PCR43/p133, PCR43/p175, PCR56/p133, PCR56/p175, PCR57/p133, PCR57/p175, PCR58/p133, PCR58/p175)  to produce colonies containing plasmid DNA.
+
'''Transformation into ''E.coli'' Xl1-Blue'''
-
 
+
-
 
+
-
'''Transformation into E.coli Xl1-Blue'''
+
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
Line 14,003: Line 15,467:
'''Aim:''' Digest of plasmids with Xba1 and Pst1 to gain the caffeine- synthesis genes and pSB1C3 backbone, respectively.
'''Aim:''' Digest of plasmids with Xba1 and Pst1 to gain the caffeine- synthesis genes and pSB1C3 backbone, respectively.
-
 
'''Operational Sequence:'''
'''Operational Sequence:'''
Line 14,092: Line 15,555:
<div class="caffeine">
<div class="caffeine">
-
=== Ligation of genes envolved in caffeine synthesis into pYES2new and pSB1C3 ===
+
=== Ligation of genes envolved in caffeine synthesis into pTUM104 ===
'''Investigator:''' Roman
'''Investigator:''' Roman
-
'''Aim:''' Ligation of the genes, which are responsible for caffeine synthesis, into pYES2new (for further expression studies) and pSB1C3 (to create BioBricks).
+
'''Aim:''' Ligation of the genes, which are responsible for caffeine synthesis, into pTUM104 (for further expression studies) and pSB1C3 (to create BioBricks).
'''Operational Sequence:'''
'''Operational Sequence:'''
Line 14,108: Line 15,571:
|'''volume'''
|'''volume'''
|-
|-
-
|pYES2new
+
|pTUM104
|1,5 µl (ca. 120 ng)
|1,5 µl (ca. 120 ng)
|-
|-
Line 14,134: Line 15,597:
</div>
</div>
-
== '''Saturday, August 19th''' ==
+
== '''Saturday, August 18th''' ==
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
=== Picking of plated transformated ''E.&nbsp;coli'' XL1-Blue colonies with ligated P207+PCR69 and P207+PCR70 ===
=== Picking of plated transformated ''E.&nbsp;coli'' XL1-Blue colonies with ligated P207+PCR69 and P207+PCR70 ===
Line 14,158: Line 15,621:
* make sure you have PCR tubes and cell culture tubes labeled sufficiently. you need to have one pcr tube and one cell culture tube for each colony.
* make sure you have PCR tubes and cell culture tubes labeled sufficiently. you need to have one pcr tube and one cell culture tube for each colony.
* pick a colony with a sterile toothpick or pipet tip, smear some of the cells onto the wall of the pcr tube (a bit of pressure and smearing) and subsequently put the toothpick into a  cell culture tube with LB-medium and antibiotic.
* pick a colony with a sterile toothpick or pipet tip, smear some of the cells onto the wall of the pcr tube (a bit of pressure and smearing) and subsequently put the toothpick into a  cell culture tube with LB-medium and antibiotic.
-
 
'''19 Clones of PCR58/p133 (transformation of August 17th) were picked + 1 clone of 4CL+(PCR15)/p132 as positive control'''
'''19 Clones of PCR58/p133 (transformation of August 17th) were picked + 1 clone of 4CL+(PCR15)/p132 as positive control'''
-
 
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 14,231: Line 15,692:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
 
+
'''Aim:''' Repetition of analytical digestion of products of miniprep on August 16th (clone 6,11,24) and August 10th (PCR56/p175 clone 1; PCR56/p175 clone 3; PCR57/p175 clone 2, PCR58/p175 clone 1)
-
'''Aim:''' Repetition of analytical digestion of products of miniprep on August 17th (clone 6,11,24) and August 10th (PCR56/p175 clone 1; PCR56/p175 clone 3; PCR57/p175 clone 2, PCR58/p175 clone 1)
+
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 14,263: Line 15,723:
</div>
</div>
-
== '''Sunday, August 20th''' ==
+
== '''Sunday, August 19th''' ==
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of the overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR69 and P207+PCR70 ===
+
=== Miniprep of the overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P207+PCR69 and P207+PCR70 ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment:''' Miniprep of the overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR69 and P207+PCR70.
+
'''Aim of the experiment:''' Miniprep of the overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P207+PCR69 and P207+PCR70.
'''Procedure:'''
'''Procedure:'''
Line 14,278: Line 15,738:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Analytical digestion and gelelectrophoresis of the minipreps of transformated ''E.&nbsp;coli'' XL1-Blue with ligation products of P207+PCR69 and P207+PCR70 ===
=== Analytical digestion and gelelectrophoresis of the minipreps of transformated ''E.&nbsp;coli'' XL1-Blue with ligation products of P207+PCR69 and P207+PCR70 ===
Line 14,377: Line 15,838:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Picking Clones for Ingma and Roman ===
+
=== Picking Clones for Ingmar and Roman ===
'''Investigator:''' Volker
'''Investigator:''' Volker
Line 14,389: Line 15,850:
* on all positive plates there was a sufficient number of clons (30-200)<br>
* on all positive plates there was a sufficient number of clons (30-200)<br>
</div>
</div>
 +
</div>
 +
 +
=Week 11=
 +
<!--
 +
<p class="limonene">'''Limonene (21 Experiments):'''</p>
 +
*
 +
 +
<p class="coumaryl">'''Xanthohumol (7 Experiments):'''</p>
 +
*
 +
 +
<p class="thaumatin">'''Thaumatin (8 Experiments):'''</p>
 +
*
 +
 +
<p class="caffeine">'''Caffeine (12 Experiments):'''</p>
 +
*
 +
 +
<p class="constitutive_promoter">'''Constitutive Promoter (28 Experiments):'''</p>
 +
*
 +
 +
<p class="light_switchable_promoter">'''Light Switchable Promoter (24 Experiments):'''</p>
 +
*
 +
 +
<html><a class="WDetails" href="#Week_11" id="Week_11">Show Details ...</a></html>
 +
-->
 +
<div class="week" id="WWeek_11">
 +
== '''Monday, August 20th''' ==
 +
 +
<div class="light_switchable_promoter">
 +
=== Preperative digestion and gelelectrophoresis of P422, P331, P417, P290 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Preperative digestion and gelelectrophoresis of P422 (AgeI+PstI-HF), P331 (NgoMIV+PstI-HF), P417 (NgoMIV+PstI-HF), P290 (XbaI+PstI).
 +
 +
'''Procedure:'''
 +
* Reaction batch for P422:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|P422
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer&nbsp;4 (10x)
 +
|-
 +
|0.4&nbsp;µl
 +
|BSA (100x)
 +
|-
 +
|1&nbsp;µl
 +
|AgeI(20&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|13.6&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for P331:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|P331
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer&nbsp;4 (10x)
 +
|-
 +
|2&nbsp;µl
 +
|NgoMIV(10&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|13&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for P417:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|P417
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer&nbsp;4 (10x)
 +
|-
 +
|2&nbsp;µl
 +
|NgoMIV(10&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|13&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for P290:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|P290
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer&nbsp;4 (10x)
 +
|-
 +
|0.4&nbsp;µl
 +
|BSA (100x)
 +
|-
 +
|1&nbsp;µl
 +
|XbaI(20&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|AgeI-HF (20&nbsp;U/µl)
 +
|-
 +
|13.6&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* These reaction batches were incubated for 3&nbsp;h at 37&nbsp;°C.
 +
 +
* Following gelelectrophoresis was performed with whole digestion batch after adding 4.44&nbsp;µl of DNA loading buffer (10x) to each digestion batch at 70&nbsp;V for 1.5&nbsp;h on 1% low-melting agarose gel.
 +
 +
* Pocket order:
 +
{|cellspacing="0" border="1"
 +
|P422 (AgeI-HF+PstI-HF)
 +
|100&nbsp;bp DNA ladder
 +
|P331 (NgoMIV+PstI-HF)
 +
|1&nbsp;kbp DNA ladder
 +
|-
 +
|Backbone incl. PhyB was cut out
 +
|
 +
|Insert was cut out
 +
|
 +
|}
 +
 +
[[File:TUM12_20120820_prep_gel_p422_p331.jpg|500px]]
 +
 +
* Pocket order:
 +
{|cellspacing="0" border="1"
 +
|P417 (NgoMIV+PstI-HF)
 +
|100&nbsp;bp DNA ladder
 +
|P290 (XbaI+PstI-HF)
 +
|1&nbsp;kbp DNA ladder
 +
|-
 +
|Insert was cut out
 +
|
 +
|Backbone was cut out
 +
|
 +
|}
 +
 +
[[File:TUM12_20120820_prep_gel_p417_p290.jpg|500px]]
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
=== Sequencing of P395, P398, P422, P331, PCR2/P133 Klon 4 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Sequencing of P395, P398, P422, P331, PCR2/P133 Klon 4.
 +
 +
'''Procedure:'''
 +
 +
* Plasmid concentrations were measured by nanodrop to calculate the dilution factor to have a concentration between 50&nbsp;ng/µl and 100&nbsp;ng/µl.
 +
 +
* Plasmid concentration, determinated by nanodropping.
 +
{|cellspacing="0" border="1"
 +
|'''Plasmid'''
 +
|'''Concentration in ng/µl'''
 +
|-
 +
|P395
 +
|465.6
 +
|-
 +
|P398
 +
|391.8
 +
|-
 +
|P422
 +
|375.8
 +
|-
 +
|P331
 +
|210.9
 +
|-
 +
|PCR2/P133 Klon 4
 +
|469.1
 +
|}
 +
 +
* To get an end concentration between 50-100&nbsp;ng/µl and an end volume of 15&nbsp;µl, the dilution was performed as following:
 +
{|cellspacing="0" border="1"
 +
|'''Plasmid'''
 +
|'''Concentration in ng/µl'''
 +
|-
 +
|P395
 +
|1:5 dilution: 3&nbsp;µl plasmid&nbsp;+&nbsp;12&nbsp;µl ddH2O
 +
|-
 +
|P398 dilution:
 +
|1:4 dilution: 3.75&nbsp;µl plasmid&nbsp;+&nbsp;11.25&nbsp;µl ddH2O
 +
|-
 +
|P422
 +
|1:4 dilution: 3.75&nbsp;µl plasmid&nbsp;+&nbsp;11.25&nbsp;µl ddH2O
 +
|-
 +
|P331
 +
|1:3 dilution: 5&nbsp;µl plasmid&nbsp;+&nbsp;10&nbsp;µl ddH2O
 +
|-
 +
|PCR2/P133 Klon 4
 +
|1:5 dilution: 3&nbsp;µl plasmid&nbsp;+&nbsp;12&nbsp;µl ddH2O
 +
|}
 +
 +
* Also the VF2 forward primer must have a end concentration of 2&nbsp;ng/µl. So a mastermix for everybody was done with O68 (100&nbsp;ng/µl)
 +
 +
{|cellspacing="0" border="1"
 +
|O68 (VF2, 100&nbsp;pmol/µl)
 +
|20&nbsp;µl
 +
|-
 +
|ddH2O
 +
|980&nbsp;µl
 +
|-
 +
|'''TOTAL (2&nbsp;pmol/µl)'''
 +
|'''1000&nbsp;µl'''
 +
|}
 +
 +
* 15&nbsp;µl was sent with each of P422, P331 and PCR2/P133 Klon 4 in a seperate ERG.
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
=== Ligation of P436+P437 and P206+P438 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Ligation of P436+P437 (PhyB(908NT)&nbsp;+&nbsp;20aaLinker-LexA)and P206+P438 (20aaLinker&nbsp;+&nbsp;Gal4DBD.
 +
 +
'''Procedure:'''
 +
 +
* Reaction batch for P436+P437:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1.11&nbsp;µl
 +
|P436
 +
|-
 +
|4.21&nbsp;µl
 +
|P437
 +
|-
 +
|2&nbsp;µl
 +
|T4 ligase buffer (10x)
 +
|-
 +
|0.5&nbsp;µl
 +
|T4 ligase (1&nbsp;U/µl)
 +
|-
 +
|12.18&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=20&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for P206+P438:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1.69&nbsp;µl
 +
|P207
 +
|-
 +
|4.92&nbsp;µl
 +
|P438
 +
|-
 +
|2&nbsp;µl
 +
|T4 ligase buffer (10x)
 +
|-
 +
|0.5&nbsp;µl
 +
|T4 ligase (1&nbsp;U/µl)
 +
|-
 +
|10.89&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=20&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* These ligation batches including their negative controls, which only contain ddH2O instead of the insert, were put on a 16&nbsp;°C waterbath and were incubated overnight.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Ligation of pTUM100 without f1-origin and Gal-promoter ===
 +
 +
*Reaction batch for pYes2 circulation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|10,5 µl
 +
|T4-Ligase
 +
|-
 +
|6,72 µl (100 ng)
 +
|Dig. pYes 2
 +
|-
 +
|10 µl
 +
|PEG 4000
 +
|-
 +
|10 µl
 +
|10,5 x T4 ligase buffer
 +
|-
 +
|68,28 µl
 +
|H20
 +
|-
 +
|= 106 µl
 +
|total
 +
|}
 +
 +
The mastermix was heated up to 72 C for 5 min bevore T4 ligase was added. It was separated in one reaction at room temperature and one reaction over night at 16 C.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Transformation of ''E.coli'' Xl1-blue ===
 +
 +
To 100 µl competent cells of E. coli Xl1-blue 10 µl of the pYes II Ligation reaction were added.
 +
Cells were kept on ice for 30 minutes.
 +
Heatshock was done at 37 C for 5 minutes
 +
Cells were incubated for 45 minutes in 1 ml LB-medium at 37 C
 +
Transformed cells were transferred on Agar plates with ampicillin
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Preparative gelrun of TEF1-p, ADH1-p psb1c3 after digestion with PstI-HF and SpeI-HF ===
 +
 +
After preparative digestion with PstI and SpeI, 44,4 µl of each reaction were transferred onto
 +
an agarose gel. Gelrun was performed at 70 Volt for 90 min.
 +
[[File:20120820 Prep.Verdau von ADH1,TEF1 in psb1c3, SpeI +Pst.png]]
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Picking colonies of ''E.coli'' Xl1-blue, transforemed with Tef2-p + psb1c3 and  Cyc-t + psb1c3 ===
 +
 +
15 colonies from Tef2-p and 6 from Cyc-t were picked and transferred into LB-medium with 1x Chloramphenicole.
 +
Incubation was performed over night at 37 C.
 +
</div>
 +
 +
<div class="limonene">
 +
 +
=== Colony PCR of PCR43/p175 and PCR58/p133===
 +
 +
'''Investigator:''' Lara
 +
 +
'''Aim:''' Establish colony PCR to increase speed of clone screening.
 +
 +
* make sure you have PCR tubes and cell culture tubes labeled sufficiently. you need to have one pcr tube and one cell culture tube for each colony.
 +
* pick a colony with a sterile toothpick or pipet tip, smear some of the cells onto the wall of the pcr tube (a bit of pressure and smearing) and subsequently put the toothpick into a  cell culture tube with LB-medium and antibiotic.
 +
 +
*'''Citrus''': 8 clones of PCR43/p175 were picked.
 +
* '''Lavendula''': 8 clones of PCR58/p133 (5 clones of transformation of August 17th, 3 clones of August 8th) and PCR58/p175 (8 of transformation of August 17th) were picked
 +
* plasmid DNA of PCR2/p133 clone 4 as positive control
 +
 +
'''Citrus'''
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl
 +
|5x OneTaq Standard Reaction Buffer
 +
|-
 +
|0.5 µl
 +
|10 mM dNTPs
 +
|-
 +
|0.5 µl
 +
|10 µM O28
 +
|-
 +
|0.5 µl
 +
|10 µM O30
 +
|-
 +
|0.13 µl
 +
|OneTaq Hot Start DNA Polymerase
 +
|-
 +
|18.37 µl
 +
|dd water
 +
|-
 +
|25 µL
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Lavendula'''
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl
 +
|5x OneTaq Standard Reaction Buffer
 +
|-
 +
|0.5 µl
 +
|10 mM dNTPs
 +
|-
 +
|0.5 µl
 +
|10 µM O35
 +
|-
 +
|0.5 µl
 +
|10 µM O37
 +
|-
 +
|0.13 µl
 +
|OneTaq Hot Start DNA Polymerase
 +
|-
 +
|18.37 µl
 +
|dd water
 +
|-
 +
|25 µL
 +
|'''TOTAL'''
 +
|}
 +
 +
* PCR program:
 +
{|cellspacing="0" border="1"
 +
|Initial denaturation
 +
|94 °C
 +
|10 min
 +
|-
 +
|30 cycles
 +
|95 °C
 +
|30 s
 +
|-
 +
|
 +
|59 °C
 +
|30 s
 +
|-
 +
|
 +
|68 °C
 +
|1 min 55 sec
 +
|-
 +
|Final extension
 +
|68 °C
 +
|5 min
 +
|-
 +
|Hold
 +
|4 °C
 +
|
 +
|}
 +
 +
Labels of the cell culture tubes/PCR tubes:
 +
 +
1-8: PCR43/p175
 +
 +
9: PCR2/p133 clone 4 (positive control)
 +
 +
10-17: PCR58/p175
 +
 +
18-22: PCR58/p133, transformation of August 17th
 +
 +
23-25: PCR58/p133, transformation of August 8th
 +
 +
[[File:TUM12_LS_analytcolonyPCR3.png]]
 +
[[File:TUM12_LS_analytcolonyPCR4.png]]
 +
[[File:TUM12_LS_analytcolonyPCR5.png]]
 +
 +
</div>
 +
 +
<div class="limonene">
 +
 +
=== Miniprep of PCR58/p133 ===
 +
 +
'''Investigator:''' Dennis
 +
 +
'''Aim:''' Miniprep of over night cultures with number 1,2,4,6,7,9,12,13,15,16,18 (clones that were picked for colony PCR on saturday, PCR58/p133).
 +
 +
The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 40 µl of elution buffer (Kit) at room temperature, with the columns having been incubated 5 minutes at room temperature before the final centrifugation.
 +
'''Miniprep products are stored in a 50 ml Falcon tube in the lowest drawer at -20°C '''
 +
 +
Miniprep does not work.
 +
 +
</div>
 +
 +
<div class="limonene">
 +
 +
=== Miniprep of PCR58/p133 ===
 +
 +
'''Investigator:''' Saskia
 +
 +
'''Aim:''' Miniprep of over night cultures with number 3,5,8,10,11,14,17 (clones that were picked for colony PCR on saturday, PCR58/p133).
 +
 +
The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 40 µl of elution buffer (Kit) at room temperature, with the columns having been incubated 5 minutes at room temperature before the final centrifugation.
 +
 +
{|cellspacing="0" border="1"
 +
|'''Number'''
 +
|'''Concentration in ng/µl'''
 +
|-
 +
|3
 +
|254.7
 +
|-
 +
|5
 +
|223.4
 +
|-
 +
|8
 +
|339.4
 +
|-
 +
|10
 +
|303.5
 +
|-
 +
|11
 +
|162.4
 +
|-
 +
|14
 +
|142.1
 +
|-
 +
|17
 +
|151.8
 +
|-
 +
|}
 +
 +
'''Miniprep products are stored in a 50 ml Falcon tube in the lowest drawer at -20°C. (Falcon tube label: Miniprep Saskia 20.8.)'''
 +
 +
</div>
 +
 +
<div class="thaumatin">
 +
 +
===Ligation of insert and pTUM104===
 +
Investigator: Martin y Aloís
 +
 +
Aim: Ligate the extracted plasmids of the experiment before
 +
 +
Due to the small yield we only were able to run 4 ligations:
 +
  1: pSB1C3 and P343
 +
  I: pSB1C3 and P343 OVER NIGHT at 16 °C
 +
  4: pYes and P343
 +
  IV: pYes and P344 OVER NIGHT at 16 °C
 +
 +
1 and 4 were directly transformed in ''E. Coli'' - to be picked the next day.
 +
 +
</div>
 +
 +
<div class="caffeine">
 +
 +
=== Transformation of over-weekend ligation of caffeine synthesis genes in pSB1C3 and pTUM104 ===
 +
 +
'''Investigator:''' Saskia
 +
 +
'''Aim:''' Transformation of the ligation
 +
 +
'''Operational Sequence'''
 +
 +
The transformation procedure was carried out as previously described, whereas the entire ligation batch was used for transformation in XL1 blue chemo competent ''e.coli-''cells. The 30 minutes on ice incubation was followed by the heat shock at 37°C for 5 minutes and an incubation at 180 rpm at 37°C for about 45 minutes. Afterwords, the suspension was plated on appropriate plates (pSB1C3 transformants with chloramphenicol, pTUM104 transformants with ampicillin) and incubated at 37°C over night. Besides, the pellet was also plated out (resuspension in about ca. 100 µl LB medium).
 +
 +
'''Note:''' This transformation was performed without knowing, that a transformation with 5 µl of every ligation batch was already done on saturday. Furthermore, clone picking and preparing of over night liquid cultures was made, too (on sunday).
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Miniprep of picked clones of possible positive pSB1C3_Caffeine_involved_gene and pTUM104_caffeine_involved_gene transformants ===
 +
 +
'''Investigator:''' Roman, Saskia
 +
 +
'''Aim:'''
 +
 +
Isolation of plasmids pSB1C3 and pTUM104, to check for uptaken inserts by an analytical restriction digest.
 +
 +
'''Operational sequence:'''
 +
 +
The putative positive clones were picked and used for inoculation on monday, 1 am. Thus, the plasmid preparation took place at 3 pm. Four clones of each plate had been picked. The plates were stored in the fridge, at 4°C.
 +
The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 40 µl of elution buffer (Kit) at room temperature, with the columns having been incubated 5 minutes at room temperature before the final centrifugation.
 +
 +
'''Plasmidconcentration:''' Nanodroplet
 +
 +
{|cellspacing="0" border="1"
 +
|'''pSB1C3_Caffeine_involved_gene'''
 +
|'''Concentration in ng/µl'''
 +
|-
 +
|B1A
 +
|196.5
 +
|-
 +
|B1B
 +
|220.6
 +
|-
 +
|B1C
 +
|203.8
 +
|-
 +
|B1D
 +
|190.6
 +
|-
 +
|B2A
 +
|273.1
 +
|-
 +
|B2B
 +
|225.2
 +
|-
 +
|B2C
 +
|209.2
 +
|-
 +
|B2D
 +
|161.7
 +
|-
 +
|B3A
 +
|235.3
 +
|-
 +
|B3B
 +
|228.5
 +
|-
 +
|B3C
 +
|228.1
 +
|-
 +
|B3D
 +
|226.4
 +
|-
 +
|}
 +
 +
{|cellspacing="0" border="1"
 +
|'''pTUM104_caffeine_involved_gene'''
 +
|'''Concentration in ng/µl'''
 +
|-
 +
|Y1A
 +
|117.5
 +
|-
 +
|Y1B
 +
|200.9
 +
|-
 +
|Y1C
 +
|175.8
 +
|-
 +
|Y1D
 +
|206.7
 +
|-
 +
|Y2A
 +
|266.1
 +
|-
 +
|Y2B
 +
|306.2
 +
|-
 +
|Y2C
 +
|290.6
 +
|-
 +
|Y2D
 +
|302.7
 +
|-
 +
|Y3A
 +
|278.4
 +
|-
 +
|Y3B
 +
|162.7
 +
|-
 +
|Y3C
 +
|117.6
 +
|-
 +
|Y3D
 +
|211.3
 +
|-
 +
|}
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Analytical digest of pSB1C3_Caffeine_involved_gene and pTUM104_caffeine_involved_gene plasmids ===
 +
 +
'''Investigator:''' Saskia
 +
 +
'''Aim:'''
 +
 +
Analytical digest of B1A-D, B2A-D, B3A-D, Y1A-D, Y2A-D, Y3A-D with PstI ans XbaI to controll the ligation of the inserts in pSB1C3 and pTUM104.
 +
 +
'''Procedure:'''
 +
 +
* Digestion reaction batch
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2.5&nbsp;µl
 +
|Plasmid-DNA
 +
|-
 +
|0.25&nbsp;µl
 +
|XbaI
 +
|-
 +
|0.25&nbsp;µl
 +
|PstI-HF
 +
|-
 +
|2&nbsp;µl
 +
|NEBuffer 4 (10x)
 +
|-
 +
|0.2&nbsp;µl
 +
|BSA (100x)
 +
|-
 +
|14.8&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=20&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
Digestion over night at 37 °C.
 +
 +
</div>
 +
 +
=='''Tuesday, August 21st'''==
 +
 +
<div class="light_switchable_promoter">
 +
=== Transformation of overnight ligation with P436+P437 and P206+P438 in ''E.&nbsp;coli'' XL1-Blue ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Transformation of overnight ligation with P436+P437 and P206+P438 in ''E.&nbsp;coli'' XL1-Blue.
 +
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 5&nbsp;µl of the ligation products (P436+P437 and P206+P438) and their negative controls (P436 NK, P206 NK) were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice.
 +
 +
* 30&nbsp;min incubation on ice.
 +
 +
* 5&nbsp;min heat shock at 37&nbsp;°C
 +
 +
* Adding of 1&nbsp;ml LB-medium to each tube.
 +
 +
* Incubation for 45&nbsp;min at 37&nbsp;°C in the 180&nbsp;rpm cell-culture shaker.
 +
 +
* 100&nbsp;µl of those cell suspension were plated on chloramphenicol plates.
 +
 +
* The rest were centrifuged for 1&nbsp;min at 13000&nbsp;rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100&nbsp;µl of LB-medium and this concentrated cell suspension was plated again on new chloramphenicol plates.
 +
 +
* Incubation at 37&nbsp;°C overnight.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Miniprep of overnight cultures of TEF2-P in psb1c3 and CYC-T in psb1c3===
 +
'''Investigator:''' Georg
 +
 +
'''Procedure:'''
 +
* Plasmid extraction from over-night grown colonies was done according to the protocoll of Quiaprep Spin genextraction kit.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Analytical digestion of TEF2-P and Cyc-T in psb1c3===
 +
''' Investigator:''' Georg
 +
 +
'''Aim of the experiment:''' To find positive clones of TEF2-P and Cyc-T
 +
 +
'''Procedure'''
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5,5 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|5,5 µl 
 +
|XbaI (NEB)
 +
|-
 +
|44 µl
 +
|NEB-4 buffer
 +
|-
 +
|4,4 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|325,6 µl
 +
|dd H20
 +
|-
 +
|=385µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* to 2,5 ml of DNA 17,5 µl reaction batch were added
 +
* Digestion took place at 37°C for 1 h
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Analytical gel with Transformants of TEF2-P and CYC-T in psb1c3-Vector===
 +
''' Investigator''': Georg
 +
 +
''' Aim of the experiment''': Find positive clones
 +
 +
* 9 µl of analytical digestion was applicated onto a 1% analytical agarose gel
 +
* Run was performed at 90 Volt for 1h
 +
*Result: Gelrun showed only two positive TEF2 clones and no CYC-T clone
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Transformation of overnight ligation with P265B (pTUM100)===
 +
'''Investigator:''' Georg
 +
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 10 µl of ligation product (P265B) was added to 100 µl of competent cells and gently mixed.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on ampicillin plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin plates.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Preparative digestion of P451 (TEF2-P in psb1c3) with SpeI-HF and PstI-HF===
 +
'''Investigator''':Georg, Dennis
 +
 +
'''Aim of the experiment''': Prepare TEF2-P for cloning
 +
 +
'''Procedure'''
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|1 µl 
 +
|Spe-HF (NEB)
 +
|-
 +
|0,4 µl
 +
|100xBSA (NEB)
 +
|-
 +
|4 µl
 +
|NEB-4 buffer
 +
|-
 +
|20 µl
 +
|P 451
 +
|-
 +
|13,6 µl
 +
|dd H20
 +
|-
 +
|=40 µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Digestion took place at 37 C for 3 hours
 +
</div>
 +
 +
<div class="limonene">
 +
 +
===Miniprep of "positive" colonies of colony PCR===
 +
 +
'''Investigator:''' Lara
 +
 +
'''Aim:''' Get plasmid DNA of the plasmids that were identified as insert-positive clones.
 +
 +
Clones 2, 8, 11, 13, 18 & 20 of colony PCR (20.8.) were miniprepped.
 +
 +
* Clone 2: 214 ng/µl
 +
* Clone 8: 142 ng/µl
 +
* Clone 11: 152 ng/µl
 +
* Clone 13: 252 ng/µl
 +
* Clone 18: 132 ng/µl
 +
* Clone 20: 210 ng/µl
 +
 +
'''Plasmid DNA is stored in a 50 ml Falcon tube at the lowest drawer of -20°C. (label: Miniprep 21.8. Lara)'''
 +
 +
</div>
 +
 +
<div class="limonene">
 +
 +
===Analytical restriction digest of miniprep products 21.8. ("positive" clones of colony PCR) and miniprep products 20.8.===
 +
 +
'''Investigator:''' Lara
 +
 +
'''Aim:''' Check whether clones contain insert.
 +
Gel 1: Some clones that were picked for colony PCR of Saturday, August 18th.
 +
Gel 2: Clones that were identified as positive in colony PCR of Monday, August 20th.
 +
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl
 +
|plasmid DNA
 +
|-
 +
|0.25 µl
 +
|Xba1
 +
|-
 +
|0.25 µl
 +
|Spe1
 +
|-
 +
|2 µl
 +
|NEBuffer 4
 +
|-
 +
|0.2 µl
 +
|BSA (100x)
 +
|-
 +
|12.3 µl
 +
|ddH2O
 +
|}
 +
 +
* digest at 37°C for 2.5h.
 +
[[File:TUM12_LS_analytgel2108_gel1.png]]
 +
[[File:TUM12_LS_analytgel2108.png]]
 +
 +
</div>
 +
 +
<div class="limonene">
 +
===Colony PCR of PCR42/p133 and PCR56/p133===
 +
 +
'''Investigator:''' Lara
 +
 +
'''Aim:''' To decrease number of false positive PCR products, a different primer combination was used: Instead of forward + reverse primers for the insert, the forward primer of the vector backbone and the reverse primer of the insert were used.
 +
* extension time of PCR reaction was adjusted to the longer PCR product (insert+primers+backbone from primer binding site)
 +
* annealing temperature was adjusted to lowest primer melting temperature
 +
 +
*'''Citrus''': 5 clones of PCR42/p133 (transformation of 8.8.) and PCR42/p175 (trafo 17.8.) were picked.
 +
* '''Lavendula''': 5 clones of PCR56/p133 (trafo 17.8.) and PCR56/p175 (transformation of August 17th) were picked.
 +
* positive control: plasmid DNA of PCR2/p133 clone 4 as positive control
 +
* negative controls: 1. clone containing pSB1C3 with proteinlinker (Jeff); 2. ddH2O; 3. clone containing pTUM104 (P50, no insert)
 +
 +
'''Citrus in pSB1C3''' (PCR42/p133)
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl
 +
|5x OneTaq Standard Reaction Buffer
 +
|-
 +
|0.5 µl
 +
|10 mM dNTPs
 +
|-
 +
|0.5 µl
 +
|10 µM O68
 +
|-
 +
|0.5 µl
 +
|10 µM O30
 +
|-
 +
|0.13 µl
 +
|OneTaq Hot Start DNA Polymerase
 +
|-
 +
|18.37 µl
 +
|dd water
 +
|-
 +
|25 µL
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Citrus in pYES''' (PCR42/p175)
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl
 +
|5x OneTaq Standard Reaction Buffer
 +
|-
 +
|0.5 µl
 +
|10 mM dNTPs
 +
|-
 +
|0.5 µl
 +
|10 µM O8
 +
|-
 +
|0.5 µl
 +
|10 µM O30
 +
|-
 +
|0.13 µl
 +
|OneTaq Hot Start DNA Polymerase
 +
|-
 +
|18.37 µl
 +
|dd water
 +
|-
 +
|25 µL
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Lavendula in pSB1C3''' (PCR56/p133)
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl
 +
|5x OneTaq Standard Reaction Buffer
 +
|-
 +
|0.5 µl
 +
|10 mM dNTPs
 +
|-
 +
|0.5 µl
 +
|10 µM O68
 +
|-
 +
|0.5 µl
 +
|10 µM O37
 +
|-
 +
|0.13 µl
 +
|OneTaq Hot Start DNA Polymerase
 +
|-
 +
|18.37 µl
 +
|dd water
 +
|-
 +
|25 µL
 +
|'''TOTAL'''
 +
|}
 +
 +
'''Lavendula in pYES''' (PCR56/p175)
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5 µl
 +
|5x OneTaq Standard Reaction Buffer
 +
|-
 +
|0.5 µl
 +
|10 mM dNTPs
 +
|-
 +
|0.5 µl
 +
|10 µM O8
 +
|-
 +
|0.5 µl
 +
|10 µM O37
 +
|-
 +
|0.13 µl
 +
|OneTaq Hot Start DNA Polymerase
 +
|-
 +
|18.37 µl
 +
|dd water
 +
|-
 +
|25 µL
 +
|'''TOTAL'''
 +
|}
 +
 +
* PCR program:
 +
{|cellspacing="0" border="1"
 +
|Initial denaturation
 +
|94 °C
 +
|10 min
 +
|-
 +
|30 cycles
 +
|95 °C
 +
|30 s
 +
|-
 +
|
 +
|50 °C
 +
|30 s
 +
|-
 +
|
 +
|68 °C
 +
|1 min 55 sec
 +
|-
 +
|Final extension
 +
|68 °C
 +
|5 min
 +
|-
 +
|Hold
 +
|4 °C
 +
|
 +
|}
 +
 +
'''Labels:'''
 +
 +
1-5: PCR42/p133 (Trafo 8.8)
 +
6: PCR2/p133 clone 4 (positive control, trafo 8.8.)
 +
7: pSB1C3 neg. control (proteinlinker)
 +
8-12: PCR56/p133
 +
13-17: PCR42/p175
 +
18: neg. control: ddH2O
 +
19: p50 clone
 +
20-24: PCR56/p175
 +
 +
[[File:TUM12_LS_analytcolonyPCR6.png]]
 +
[[File:TUM12_LS_analytcolonyPCR7.png]]
 +
[[File:TUM12_LS_analytcolonyPCR8.png]]
 +
 +
</div>
 +
 +
<div class="limonene">
 +
 +
=== Miniprep of ligation of 17th August===
 +
 +
'''Investigator:''' Andrea
 +
 +
The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 50 µl of elution buffer (Kit) at room temperature, with the columns having been incubated 5 minutes at room temperature before the final centrifugation.
 +
 +
{|cellspacing="0" border="1"
 +
|'''Number'''
 +
|'''Concentration in ng/µl'''
 +
|-
 +
|PCR56 in P133 (clone 1)
 +
|63.7
 +
|-
 +
|PCR56 in P133 (clone 2)
 +
|50.6
 +
|-
 +
|PCR56 in P133 (clone 3)
 +
|63.3
 +
|-
 +
|PCR56 in P133 (clone 4)
 +
|77.9
 +
|-
 +
|PCR56 in P133 (clone 5)
 +
|82.1
 +
|-
 +
|PCR56 in P175 (clone 1)
 +
|94.3
 +
|-
 +
|PCR56 in P175 (clone 2)
 +
|50.6
 +
|-
 +
|PCR56 in P175 (clone 3)
 +
|55.9
 +
|-
 +
|PCR56 in P175 (clone 4)
 +
|120.9
 +
|-
 +
|PCR56 in P175 (clone 5)
 +
|119.4
 +
|-
 +
|PCR 57 in P133 (clone 1)
 +