Team:TU Munich/Notebook/Labjournal

From 2012.igem.org

(Difference between revisions)
(Ligation of citrus limonene synthase into pSB1C3 containing TEF1/TEF2 promoter)
(Undo revision 300635 by AndiB (talk))
 
(1053 intermediate revisions not shown)
Line 1: Line 1:
{{Team:TU_Munich/Header}}
{{Team:TU_Munich/Header}}
{{Team:TU_Munich/LabHeader}}
{{Team:TU_Munich/LabHeader}}
 +
{{Team:TU_Munich/ExCol}}
__NOTOC__
__NOTOC__
<html>
<html>
Line 8: Line 9:
<input class="labcheckbox" type="checkbox" name="category" value="vector_design" id="ui-test1" /><b style="color: rgb(166, 126, 166)">Vector Design</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="vector_design" id="ui-test1" /><b style="color: rgb(166, 126, 166)">Vector Design</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="limonene" id="ui-test2" /><b style="color: rgb(116, 183, 112)">Limonene</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="limonene" id="ui-test2" /><b style="color: rgb(116, 183, 112)">Limonene</b><br>
-
<input class="labcheckbox" type="checkbox" name="category" value="coumaryl" id="ui-test3" /><b style="color: rgb(255, 122, 97)">Coumaryl</b><br>
+
<input class="labcheckbox" type="checkbox" name="category" value="coumaryl" id="ui-test3" /><b style="color: rgb(255, 122, 97)">Xanthohumol</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="thaumatin" id="ui-test4" /><b style="color: rgb(202, 85, 85)">Thaumatin</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="thaumatin" id="ui-test4" /><b style="color: rgb(202, 85, 85)">Thaumatin</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="caffeine" id="ui-test5" /><b style="color:rgb(192, 167, 4)">Caffeine</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="caffeine" id="ui-test5" /><b style="color:rgb(192, 167, 4)">Caffeine</b><br>
-
<input class="labcheckbox" type="checkbox" name="category" value="constitutive_promoter" id="ui-test6" /><b style="color: rgb(115, 208, 255)">Constituve promoter</b><br>
+
<input class="labcheckbox" type="checkbox" name="category" value="constitutive_promoter" id="ui-test6" /><b style="color: rgb(115, 208, 255)">Constitutive promoter</b><br>
<input class="labcheckbox" type="checkbox" name="category" value="light_switchable_promoter" id="ui-test7"  
<input class="labcheckbox" type="checkbox" name="category" value="light_switchable_promoter" id="ui-test7"  
-
/><b style="color: rgb(0, 32, 96)">Light switchable promoter</b><br>
+
/><b style="color: rgb(0, 32, 96)">Light-switchable promoter</b><br>
-
         <input class="labcheckbox" type="checkbox" name="category" value="integration" id="ui-test8" /><b style="color: rgb(222, 77, 185)">Genome integration</b><br>
+
         <input class="labcheckbox" type="checkbox" name="category" value="ethanol_inducible_promoter" id="ui-test8"
 +
/><b style="color: rgb(0, 102, 0)">Ethanol-inducible promoter</b><br>
 +
        <input class="labcheckbox" type="checkbox" name="category" value="integration" id="ui-test9" /><b style="color: rgb(222, 77, 185)">Genome integration</b><br>
         <br><a href="#" id="ExAll">Expand All ...</a><br>
         <br><a href="#" id="ExAll">Expand All ...</a><br>
         <a href="#" id="ColAll">Collapse All ...</a><br>
         <a href="#" id="ColAll">Collapse All ...</a><br>
Line 20: Line 23:
         <br><i>You can also click on individual experiments to show/hide them</i><br>
         <br><i>You can also click on individual experiments to show/hide them</i><br>
         <b>Jump to:</b><br>
         <b>Jump to:</b><br>
-
         <a href="#Week_1">Week 1</a>&nbsp;<a href="#Week_2">Week 2</a><br>
+
         <a href="#Week_1">Week 1</a> 13.6-17.6<br>
-
         <a href="#Week_3">Week 3</a>&nbsp;<a href="#Week_4">Week 4</a><br>
+
        <a href="#Week_2">Week 2</a> 18.6-24.6<br>
-
         <a href="#Week_5">Week 5</a>&nbsp;<a href="#Week_6">Week 6</a><br>
+
         <a href="#Week_3">Week 3</a> 25.6-1.7<br>
-
         <a href="#Week_7">Week 7</a>&nbsp;<a href="#Week_8">Week 8</a><br>
+
        <a href="#Week_4">Week 4</a> 2.7-8.7<br>
-
         <a href="#Week_9">Week 9</a>&nbsp;<a href="#Week_10">Week 10</a><br>
+
         <a href="#Week_5">Week 5</a> 9.7-15.7<br>
-
         <a href="#Week_11">Week 11</a>&nbsp;<a href="#Week_12">Week 12</a><br>
+
        <a href="#Week_6">Week 6</a> 16.7-22.7<br>
-
         <a href="#Week_13">Week 13</a>&nbsp;<a href="#Week_14">Week 14</a><br>
+
         <a href="#Week_7">Week 7</a> 23.7-29.7<br>
-
         <a href="#Week_15">Week 15</a>&nbsp;<a href="#Week_16">Week 16</a>
+
        <a href="#Week_8">Week 8</a> 30.7-5.8<br>
 +
         <a href="#Week_9">Week 9</a> 6.8-12.8<br>
 +
        <a href="#Week_10">Week 10</a> 13.8-19.8<br>
 +
         <a href="#Week_11">Week 11</a> 20.8-26.8<br>
 +
        <a href="#Week_12">Week 12</a> 27.8-2.9<br>
 +
         <a href="#Week_13">Week 13</a> 3.9-9.9<br>
 +
        <a href="#Week_14">Week 14</a> 10.9-16.9<br>
 +
         <a href="#Week_15">Week 15</a> 17.9-23.9<br>
 +
        <a href="#Week_16">Week 16</a> 24.9-27.9
         </fieldset>
         </fieldset>
         </form>
         </form>
Line 43: Line 54:
= Labjournal =
= Labjournal =
<hr/>
<hr/>
 +
 +
P1-923 and PCR1-73 are the tube numbers for plasmids/PCR products from our [[Team:TU_Munich/Notebook/Inventory|inventory list (most of the descriptions are in german)]]
 +
 +
For a shorter summary of what happened each week, see our [[Team:TU_Munich/Notebook/Meetings|meeting protocols]].
<div class="labbook">
<div class="labbook">
=Week 1=
=Week 1=
-
 
+
<!--
<p class="vector_design">'''Vector Design (4 Experiments):''' </p>
<p class="vector_design">'''Vector Design (4 Experiments):''' </p>
-
* Exchange of Multiple Cloning Site of pYES2
+
* Exchange of Multiple Cloning Site of pTUM104
<p class="limonene">'''Limonene (2 Experiments):''' </p>
<p class="limonene">'''Limonene (2 Experiments):''' </p>
Line 55: Line 70:
<html><a class="WDetails" href="#Week_1" id="Week_1">Show Details ...</a></html>
<html><a class="WDetails" href="#Week_1" id="Week_1">Show Details ...</a></html>
-
 
+
-->
<div class="week" id="WWeek_1">
<div class="week" id="WWeek_1">
=='''Wednesday, June 13th'''==
=='''Wednesday, June 13th'''==
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2 ===
+
===Exchange of the Multiple Cloning Site of pTUM104 ===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Hybridisation of the primers O1 with O2 and O3 with O4'''
'''Hybridisation of the primers O1 with O2 and O3 with O4'''
Line 122: Line 137:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2 ===
+
===Exchange of the Multiple Cloning Site of pTUM104 ===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
-
'''Digestion of pYES2 with HindIII and XbaI'''
+
'''Digestion of pTUM104 with HindIII and XbaI'''
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 161: Line 176:
*70 V, 90 min
*70 V, 90 min
-
[[File:TUM12_pYES2_verdaut.jpg]]
+
[[File:TUM12_pYES2digested.jpg]]
'''Gelextration'''
'''Gelextration'''
Line 195: Line 210:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Analytical DNA gel electrophoresis'''
'''Analytical DNA gel electrophoresis'''
Line 209: Line 224:
*band 4: 3 µl O6 + 7 µl TAE-buffer + 1 µl loading dye
*band 4: 3 µl O6 + 7 µl TAE-buffer + 1 µl loading dye
*band 5: 10 µl DNA ladder (100 bp)
*band 5: 10 µl DNA ladder (100 bp)
-
[[File:TUM12_pYES_und_Primer.jpg]]
+
[[File:TUM12_pYES2_and_primer.jpg]]
'''Ligation of Plasmid P5 (pYES2 digested) with the hybridized primers O5 and O6'''
'''Ligation of Plasmid P5 (pYES2 digested) with the hybridized primers O5 and O6'''
Line 298: Line 313:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Picking clones for Miniprep'''
'''Picking clones for Miniprep'''
Line 312: Line 327:
=Week 2=
=Week 2=
-
 
+
<!--
<p class="vector_design">'''Vector Design (4 Experiments):'''</p>
<p class="vector_design">'''Vector Design (4 Experiments):'''</p>
-
* Exchange of Multiple Cloning Site of pYES2
+
* Exchange of Multiple Cloning Site of pTUM104
-
* Quick Change mutagenisis of pYES2 for RFC25 compatibility
+
* Quick Change mutagenisis of pTUM104 for RFC25 compatibility
<p class="limonene">'''Limonene (3 Experiments):'''</p>
<p class="limonene">'''Limonene (3 Experiments):'''</p>
* Transformation with limonene BioBricks
* Transformation with limonene BioBricks
-
<p class="coumaryl">'''Coumaryl (2 Experiments):'''</p>
+
<p class="coumaryl">'''Xanthohumol (2 Experiments):'''</p>
* Amplification of plasmids containing the genes for the enzymes PAL, 4Cl and CHS
* Amplification of plasmids containing the genes for the enzymes PAL, 4Cl and CHS
Line 327: Line 342:
<html><a class="WDetails" href="#Week_2" id="Week_2">Show Details ...</a></html>
<html><a class="WDetails" href="#Week_2" id="Week_2">Show Details ...</a></html>
-
 
+
-->
<div class="week" id="WWeek_2">
<div class="week" id="WWeek_2">
== '''Monday, June 18th''' ==
== '''Monday, June 18th''' ==
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
'''Miniprep of transformed E.coli with P6'''
'''Miniprep of transformed E.coli with P6'''
Line 437: Line 452:
gel 1:  
gel 1:  
*band 1: 10 µl DNA ladder (1 kb)
*band 1: 10 µl DNA ladder (1 kb)
-
*band 2: 3 µl pYES2 SH 1.7.3 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
+
*band 2: 3 µl pTUM104 SH 1.7.3 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with HindIII and XbaI + 7 µl TAE buffer + 1 µl loading dye
-
[[File:TUM12_pYES_mit_neuer_MCS_verd_mit_Xbal_und_HindIII.jpg]]
+
[[File:TUM12_pYES_new_mcs_digested_with_Xbal_and_HindIII.jpg]]
gel 2:
gel 2:
*band 1: 10 µl DNA ladder (1 kb)
*band 1: 10 µl DNA ladder (1 kb)
-
*band 2: 3 µl pYES2 SH 1.7.3 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
+
*band 2: 3 µl pTUM104 SH 1.7.3 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
*band 3 - 12: 3 µl P7-P16 digested with NgoMIV + 7 µl TAE buffer + 1 µl loading dye
-
[[File:TUM12_pYES_mit_neuer_MCS_verd_mit_NgoMIV.jpg]]
+
[[File:TUM12_pYES_new_mcs_digested_with_NgoMIV.jpg]]
</div>
</div>
Line 476: Line 491:
<div class="vector_design">
<div class="vector_design">
-
===Exchange of the Multiple Cloning Site of pYES2===
+
===Exchange of the Multiple Cloning Site of pTUM104===
'''Investigator:''' Saskia, Daniela
'''Investigator:''' Saskia, Daniela
-
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pYES2
+
'''Aim of the experiment:''' Exchange of the Multiple Cloning Site of pTUM104
-
'''Sequencing of P13 and P14: pYES2 with new MCS'''
+
'''Sequencing of P13 and P14: pTUM104 with new MCS'''
sequencing primer:
sequencing primer:
*1.6 µM forward primer O9
*1.6 µM forward primer O9
Line 614: Line 629:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove NgoMIV from pYES2 ===
+
=== Quick Change mutagenis to remove NgoMIV from pTUM104 ===
'''Investigator:''' Ingmar, Volker
'''Investigator:''' Ingmar, Volker
-
'''Aim of the experiment:''' Generation of an RFC 25 compatible version of the pYes2 Vector.
+
'''Aim of the experiment:''' Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 706: Line 721:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove NgoMIV from pYES2 ===
+
=== Quick Change mutagenis to remove NgoMIV from pTUM104 ===
'''Investigator:''' Ingmar, Volker
'''Investigator:''' Ingmar, Volker
-
'''Aim of the experiment:''' Removal of a NgoMIV restriction site in the backbone of pYes2.
+
'''Aim of the experiment:''' Removal of a NgoMIV restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 752: Line 767:
=Week 3=
=Week 3=
-
 
+
<!--
<p class="vector_design">'''Vector Design (9 Experiments):'''</p>
<p class="vector_design">'''Vector Design (9 Experiments):'''</p>
-
* Quick Change mutagenisis of pYES2 for RFC25 compatibility and  
+
* Quick Change mutagenisis of pTUM104 for RFC25 compatibility and  
<p class="limonene">'''Limonene (1 Experiment):'''</p>
<p class="limonene">'''Limonene (1 Experiment):'''</p>
* Repetition of analytical gelectrophoresis
* Repetition of analytical gelectrophoresis
-
<p class="coumaryl">'''Coumaryl (3 Experiments):'''</p>
+
<p class="coumaryl">'''Xanthohumol (3 Experiments):'''</p>
* PCR of PAL, 4CL, CHS, OMT
* PCR of PAL, 4CL, CHS, OMT
Line 766: Line 781:
<html><a class="WDetails" href="#Week_3" id="Week_3">Show Details ...</a></html>
<html><a class="WDetails" href="#Week_3" id="Week_3">Show Details ...</a></html>
-
 
+
-->
<div class="week" id="WWeek_3">
<div class="week" id="WWeek_3">
== '''Monday, June 25th''' ==
== '''Monday, June 25th''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Miniprep of ''E. coli'' XL1-Blue with pYes2_RFC25 MCS 1.2 ===
+
=== Miniprep of ''E. coli'' XL1-Blue with pTUM104_RFC25 MCS 1.2 ===
'''Investigator:''' Alois, Martin
'''Investigator:''' Alois, Martin
-
'''Aim of the experiment:''' proof of successful removal of NgoMIV in the backbone of pYes2
+
'''Aim of the experiment:''' proof of successful removal of NgoMIV in the backbone of pTUM104
Operation Sequence:
Operation Sequence:
-
* Mini prep of pYes2 1.2. The resulting purified DNA is P33.
+
* Mini prep of pTUM104 1.2. The resulting purified DNA is P33.
-
* Control digest of pYes2_RFC25 MCS 1.2 and p13 (+ analytical gel electrophoresis: 90 V, 1 h:
+
* Control digest of pTUM104_RFC25 MCS 1.2 and p13 (+ analytical gel electrophoresis: 90 V, 1 h:
  *  15 µl ddH20
  *  15 µl ddH20
  *  2 µl NEBuffer4
  *  2 µl NEBuffer4
  * 0,5 µl NgoMIV
  * 0,5 µl NgoMIV
-
  * 2,5 µl pYes2 1.2/p13
+
  * 2,5 µl pTUM104 1.2/p13
  * 37°C, 1 h.
  * 37°C, 1 h.
</div>
</div>
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove SpeI from pYES2_RFC25 MCS 1.2 ===
+
=== Quick Change mutagenis to remove SpeI from pTUM104_RFC25 MCS 1.2 ===
'''Investigator:''' Ingmar, Volker
'''Investigator:''' Ingmar, Volker
-
'''Aim of the experiment:''' Generation of an RFC 25 compatible version of the pYes2 Vector.
+
'''Aim of the experiment:''' Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 851: Line 866:
|}
|}
*The procedure was furthermore applied to P13 and P14.
*The procedure was furthermore applied to P13 and P14.
-
*The vector resulting from the '''PCR-product was named pYes2_RFC25 MCS 1.3'''.
+
*The vector resulting from the '''PCR-product was named pTUM104_RFC25 MCS 1.3'''.
*Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.
*Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.
Line 889: Line 904:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove SpeI from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove SpeI from  pTUM104_RFC25 MCS ===
'''Investigator:''' Ingmar
'''Investigator:''' Ingmar
-
'''Aim of the experiment:''' Removal of a SpeI restriction site in the backbone of pYes2.
+
'''Aim of the experiment:''' Removal of a SpeI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 1,011: Line 1,026:
<div class="coumaryl">
<div class="coumaryl">
-
=== PCR of PAL, 4CL, CHS, OMT (Coumaryl-CoA) ===
+
=== PCR of PAL, 4CL, CHS, OMT (Xanthohumol-CoA) ===
'''Investigator: Daniela, Mary'''
'''Investigator: Daniela, Mary'''
Line 1,252: Line 1,267:
<div class="vector_design">
<div class="vector_design">
-
===  Quick Change mutagenesis to remove PstI in URA3 from pYES2_RFC25 MCS 1.2 ===
+
===  Quick Change mutagenesis to remove PstI in URA3 from pTUM104_RFC25 MCS 1.2 ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 1,331: Line 1,346:
== '''Saturday, June 30th''' ==
== '''Saturday, June 30th''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 1,343: Line 1,358:
== '''Sunday, July 1st''' ==
== '''Sunday, July 1st''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove PstI in the URA 3 gene from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 1,419: Line 1,434:
<div class="vector_design">
<div class="vector_design">
-
===  Quick Change mutagenesis to remove PstI in the 2µ ori from pYES2_RFC25 MCS  ===
+
===  Quick Change mutagenesis to remove PstI in the 2µ ori from pTUM104_RFC25 MCS  ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector.
'''PCR'''<br>
'''PCR'''<br>
Line 1,519: Line 1,534:
=Week 4=
=Week 4=
 +
<!--
<p class="vector_design">'''Vector Design (6 Experiments):'''</p>
<p class="vector_design">'''Vector Design (6 Experiments):'''</p>
* Further Quickchanges for RFC25 compatibility and insertion of Ala before the strep tag
* Further Quickchanges for RFC25 compatibility and insertion of Ala before the strep tag
Line 1,526: Line 1,542:
* PCR of both Schwab and BioBrick to make them RFC25 compatible
* PCR of both Schwab and BioBrick to make them RFC25 compatible
-
<p class="coumaryl">'''Coumaryl (4 Experiments):'''</p>
+
<p class="coumaryl">'''Xanthohumol (4 Experiments):'''</p>
* Repetition of PCR with PAL and troubleshooting
* Repetition of PCR with PAL and troubleshooting
Line 1,539: Line 1,555:
<html><a class="WDetails" href="#Week_4" id="Week_4">Show Details ...</a></html>
<html><a class="WDetails" href="#Week_4" id="Week_4">Show Details ...</a></html>
-
 
+
-->
<div class="week" id="WWeek_4">
<div class="week" id="WWeek_4">
== '''Monday, July 2nd''' ==
== '''Monday, July 2nd''' ==
Line 1,715: Line 1,731:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 1,726: Line 1,742:
<div class="limonene">
<div class="limonene">
-
=== PCR of BBa_I742111 (Limonenesynthase) Clone 3 (Trafo 19.06.12) ===
+
=== PCR of BBa_I742111 (Limonenesynthase) Clone 3 (Transformation of 19.06.12) ===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
Line 1,828: Line 1,844:
== '''Wednesday, July 4th''' ==
== '''Wednesday, July 4th''' ==
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pYes2_RFC25 MCS ===
+
=== Quick Change mutagenis to remove PstI in the 2µ Ori from  pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Removal of a PstI restriction site in the backbone of pYes2.
+
Aim of the experiment: Removal of a PstI restriction site in the backbone of pTUM104.
Operational sequence:
Operational sequence:
Line 1,879: Line 1,895:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to  insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS  ===
+
=== Quick Change mutagenis to  insert Ala in front of the Strep - tag II in pTUM104_RFC25 MCS  ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector; operating purfication possibility via Strep-tag II.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector; operating purfication possibility via Strep-tag II.
'''PCR'''<br>
'''PCR'''<br>
Line 2,067: Line 2,083:
Plasmids were digested, 2 µl loading dye (10x) was added to each sample. Gel was loaded in the following order:
Plasmids were digested, 2 µl loading dye (10x) was added to each sample. Gel was loaded in the following order:
-
1. 6 µl gene ruler 1 kb, 2.-6. 11 µl of: P39, P40, P41, P42, Coumaryl-Plasmid (Katrin)
+
1. 6 µl gene ruler 1 kb, 2.-6. 11 µl of: P39, P40, P41, P42, Xanthohumol-Plasmid (Katrin)
[[File:TUM12_VerdauSchwabPlasmide0507.png]]
[[File:TUM12_VerdauSchwabPlasmide0507.png]]
Line 2,105: Line 2,121:
<div class="vector_design">
<div class="vector_design">
-
=== Quick Change mutagenis to insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS ===
+
=== Quick Change mutagenis to insert Ala in front of the Strep - tag II in pTUM104_RFC25 MCS ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector; operating purfication possibility via Strep-tag II.  
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector; operating purfication possibility via Strep-tag II.  
Operational sequence:
Operational sequence:
Line 2,138: Line 2,154:
== '''Friday, July 6th''' ==
== '''Friday, July 6th''' ==
<div class="vector_design">
<div class="vector_design">
-
===Quick Change mutagenis to insert Ala in front of the Strep - tag II in pYES2_RFC25 MCS===
+
===Quick Change mutagenis to insert Ala in front of the Strep - tag II in pTUM104_RFC25 MCS===
*Afterwards a control digestion of P45 and P46 was done.
*Afterwards a control digestion of P45 and P46 was done.
Line 2,283: Line 2,299:
== '''Saturday, July 7th''' ==
== '''Saturday, July 7th''' ==
<div class="vector_design">
<div class="vector_design">
-
===  Quick Change mutagenesis to insert Ala in front of the Strep-tag II in pYES2_RFC25 MCS  ===
+
===  Quick Change mutagenesis to insert Ala in front of the Strep-tag II in pTUM104_RFC25 MCS  ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
Aim of the experiment: Generation of an RFC 25 compatible version of the pYes2 Vector.
+
Aim of the experiment: Generation of an RFC 25 compatible version of the pTUM104 Vector.
*As the sequencing of the first attempt to introduce Ala in front of the Strep-tag II did not show a successfull insertion of Ala, the quickchange mutagense was performed once again with a modified setup. Presumably a formation of primer dimers was responsable for the experiment's results. Therefore the second PCR was operated in two steps as shown below.
*As the sequencing of the first attempt to introduce Ala in front of the Strep-tag II did not show a successfull insertion of Ala, the quickchange mutagense was performed once again with a modified setup. Presumably a formation of primer dimers was responsable for the experiment's results. Therefore the second PCR was operated in two steps as shown below.
'''PCR'''<br>
'''PCR'''<br>
Line 2,405: Line 2,421:
=Week 5=
=Week 5=
-
 
+
<!--
<p class="limonene">'''Limonene (4 Experiments):'''</p>
<p class="limonene">'''Limonene (4 Experiments):'''</p>
* Ligation of Schwab and BioBricks PCR products in pYES and pSB1C3
* Ligation of Schwab and BioBricks PCR products in pYES and pSB1C3
-
<p class="coumaryl">'''Coumaryl (10 Experiments):'''</p>
+
<p class="coumaryl">'''Xanthohumol (10 Experiments):'''</p>
* Repetition of PCR with PAL
* Repetition of PCR with PAL
* Transformation with PCR products of OMT, 4Cl and CHS  
* Transformation with PCR products of OMT, 4Cl and CHS  
Line 2,424: Line 2,440:
<html><a class="WDetails" href="#Week_5" id="Week_5">Show Details ...</a></html>
<html><a class="WDetails" href="#Week_5" id="Week_5">Show Details ...</a></html>
-
 
+
-->
<div class="week" id="WWeek_5">
<div class="week" id="WWeek_5">
== '''Monday, July 9th''' ==
== '''Monday, July 9th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Picking of colonies of TEF2-P, ADH1-P, ADH1-T (Igem)===
+
=== Picking of colonies of TEF2-P, ADH1-P, ADH1-T (iGEM)===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 2,446: Line 2,462:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Repetition of picking of colonies of TEF2-P, ADH1-P, ADH1-T (Igem)===
+
=== Repetition of picking of colonies of TEF2-P, ADH1-P, ADH1-T (iGEM)===
'''Investigator:''' Georg
'''Investigator:''' Georg
*Only ADH1 promoter showed cell proliferation. The rest showed no proliferation.The reason was a 10x too high amount of antibiotics.
*Only ADH1 promoter showed cell proliferation. The rest showed no proliferation.The reason was a 10x too high amount of antibiotics.
Line 2,745: Line 2,761:
<div class="coumaryl">
<div class="coumaryl">
-
=== Preparative Digest of pYES_iGEM===
+
=== Preparative Digest of pYES2_iGEM===
'''Investigator: Katrin, Daniela'''
'''Investigator: Katrin, Daniela'''
Line 2,958: Line 2,974:
== '''Thursday, July 12th''' ==
== '''Thursday, July 12th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Genextraction and analytical digestion of CYC1-terminator, TEF1-promoter, and PGK1-Promoter from '''pSB1C3 and pSB1A2===
+
=== Gelextraction and analytical digestion of CYC1-terminator, TEF1-promoter, and PGK1-Promoter from pSB1C3 and pSB1A2===
'''Investigator: Georg'''
'''Investigator: Georg'''
Line 3,014: Line 3,030:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Picking of transformated (pGADT7 and pGBKT7) E.&nbsp;coli cells on antibiotic selection plates  ===
+
=== Picking of transformated (pGADT7 and pGBKT7) ''E.coli cells'' on antibiotic selection plates  ===
'''Investigator: Jeff'''
'''Investigator: Jeff'''
Line 3,026: Line 3,042:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of transformated E.&nbsp;coli from overnight culture (8 plasmids containing biobricks)  ===
+
 
 +
=== Miniprep of transformated ''E.coli'' from overnight culture (8 plasmids containing biobricks)  ===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
Line 3,137: Line 3,154:
<div class="coumaryl">
<div class="coumaryl">
-
=== Transformation of Ligationproducts of pYES2 + OMT, 4Cl and CHS in E.coli===
+
=== Transformation of Ligationproducts of pTUM104 + OMT, 4Cl and CHS in ''E.coli''===
'''Investigator: Mary'''
'''Investigator: Mary'''
-
* adding 5µl ligation product in 100µl competent XL blue E.coli cells
+
* adding 5µl ligation product in 100µl competent XL blue ''E.coli'' cells
* incubation 30 min on ice
* incubation 30 min on ice
* 5 min at 37°C
* 5 min at 37°C
Line 3,483: Line 3,500:
<div class="limonene">
<div class="limonene">
-
=== Preperative gel electrophoresis ===
+
=== Preparative gel electrophoresis of digested plasmids PCR1-PCR7 and PCR9 ===
'''Investigator: Andrea'''  
'''Investigator: Andrea'''  
Line 3,895: Line 3,912:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Preperative digestion and gelelectrophoresis of P79 and O56??? ===
+
=== Preperative digestion and gelelectrophoresis of P79 and O56 ===
'''Investigator:''' Jeff, Saskia, Georg
'''Investigator:''' Jeff, Saskia, Georg
Line 4,034: Line 4,051:
===Transformation of P94 - P97 (ligationproducts of pSB1C3 with CHS and OMT respectively) in ''E.coli''===
===Transformation of P94 - P97 (ligationproducts of pSB1C3 with CHS and OMT respectively) in ''E.coli''===
Investigator: Daniela
Investigator: Daniela
-
* adding 5µl ligation product (P94-P97) in 100µl competent XL blue E.coli cells
+
* adding 5µl ligation product (P94-P97) in 100µl competent XL blue ''E.coli'' cells
* incubation 30 min on ice
* incubation 30 min on ice
* 5 min at 37°C
* 5 min at 37°C
Line 4,050: Line 4,067:
'''Transformation'''
'''Transformation'''
-
* adding 5µl ligation product (PCR1-PCR7) in 100µl competent XL blue E.coli cells
+
* adding 5µl ligation product (PCR1-PCR7) in 100µl competent XL blue ''E.coli'' cells
* incubation 30 min on ice
* incubation 30 min on ice
* 5 min at 37°C
* 5 min at 37°C
Line 4,181: Line 4,198:
=Week 6=
=Week 6=
-
 
+
<!--
<p class="vector_design">'''Vector Design (2 Experiments):'''</p>
<p class="vector_design">'''Vector Design (2 Experiments):'''</p>
*
*
Line 4,188: Line 4,205:
*  
*  
-
<p class="coumaryl">'''Coumaryl (17 Experiments):'''</p>
+
<p class="coumaryl">'''Xanthohumol (17 Experiments):'''</p>
*  
*  
Line 4,201: Line 4,218:
<html><a class="WDetails" href="#Week_6" id="Week_6">Show Details ...</a></html>
<html><a class="WDetails" href="#Week_6" id="Week_6">Show Details ...</a></html>
-
 
+
-->
<div class="week" id="WWeek_6">
<div class="week" id="WWeek_6">
== '''Monday, July 16th ''' ==
== '''Monday, July 16th ''' ==
Line 4,332: Line 4,349:
<div class="limonene">
<div class="limonene">
-
=== Analytical gel electrophoresis ===
+
=== Analytical gel electrophoresis of p116-p122 ===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 4,363: Line 4,380:
'''Aim of the experiment:''' Get a lot of pSB1C3 for further experiments
'''Aim of the experiment:''' Get a lot of pSB1C3 for further experiments
-
Midipreparation of the pellet from over night cultures (E.coli, Transformed with pSB1C3 - RFC25; name in registry: K365005)
+
Midipreparation of the pellet from over night cultures (''E.coli'', Transformed with pSB1C3 - RFC25; name in registry: K365005)
was done with the Midiprep Kit from Qiagen
was done with the Midiprep Kit from Qiagen
Line 4,371: Line 4,388:
</div>
</div>
-
<div=coumaryl>
+
<div=Xanthohumol>
<div class="coumaryl">
<div class="coumaryl">
Line 4,594: Line 4,611:
'''investigator: ''' Daniela, Mary
'''investigator: ''' Daniela, Mary
-
'''Aim of the experiment:''' digestion of PCR-Products to gain the correct cutting sites for ligation in pYES2 and pSB1C3 afterwards
+
'''Aim of the experiment:''' digestion of PCR-Products to gain the correct cutting sites for ligation in pTUM104 and pSB1C3 afterwards
Purification of PCR-Products with PCR-Purification Kit
Purification of PCR-Products with PCR-Purification Kit
Line 4,634: Line 4,651:
<div class="coumaryl">
<div class="coumaryl">
-
=== Repetition of ligation of PCR 15-20 (4CL, CHS and OMT) with pYES (P71 and P72 respectively)===
+
=== Repetition of ligation of PCR 15-20 (4CL, CHS and OMT) with pTUM104 (P71 and P72 respectively)===
'''Investigator: Mary, Daniela'''
'''Investigator: Mary, Daniela'''
Line 4,775: Line 4,792:
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of ligationproducts of 4CL, OMT and CHS respectively in pYES in ''E.coli''===
+
===Transformation of ligationproducts of 4CL, OMT and CHS respectively in pTUM104 in ''E.coli''===
Investigator: Mary,Daniela
Investigator: Mary,Daniela
Line 4,786: Line 4,803:
results:
results:
-
*CHS+ in pYES (P72) 100 µl: 7 clones
+
*CHS+ in pTUM104 (P72) 100 µl: 7 clones
-
*CHS- in pYES (P72) 100 µl: 9 clones
+
*CHS- in pTUM104 (P72) 100 µl: 9 clones
-
*CHS+ in pYES (P72) Pellet: 111 clones
+
*CHS+ in pTUM104 (P72) Pellet: 111 clones
-
*CHS- in pYES (P72) Pellet: 77 clones
+
*CHS- in pTUM104 (P72) Pellet: 77 clones
-
*4CL+ in pYES (P71) 100 µl: 9 clones
+
*4CL+ in pTUM104 (P71) 100 µl: 9 clones
-
*4CL- in pYES (P71) 100 µl: 3 clones
+
*4CL- in pTUM104 (P71) 100 µl: 3 clones
-
*4CL+ in pYES (P71) Pellet: 47 clones
+
*4CL+ in pTUM104 (P71) Pellet: 47 clones
-
*4CL- in pYES (P71) Pellet: 45 clones
+
*4CL- in pTUM104 (P71) Pellet: 45 clones
-
*OMT+ in pYES (P72) 100 µl: 7 clones
+
*OMT+ in pTUM104 (P72) 100 µl: 7 clones
-
*OMT- in pYES (P72) 100 µl: 5 clones
+
*OMT- in pTUM104 (P72) 100 µl: 5 clones
-
*OMT+ in pYES (P72) Pellet: 30 clones
+
*OMT+ in pTUM104 (P72) Pellet: 30 clones
-
*OMT- in pYES (P72) Pellet: 53 clones
+
*OMT- in pTUM104 (P72) Pellet: 53 clones
*negative control P71 100 µl: 14
*negative control P71 100 µl: 14
Line 4,826: Line 4,843:
== '''Wednesday, July 18th''' ==
== '''Wednesday, July 18th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Extraction of Plasmid-DNA===
+
=== Minipreparation of ADH1-T Plasmids===
'''Investigator:''' Georg
'''Investigator:''' Georg
-
* ADH1-T Plasmids were extracted according to protocoll of Quiaprep genextraction protocoll
+
* ADH1-T Plasmids were extracted according to protocoll of Quiaprep gelextraction protocoll
</div>
</div>
<div class="constitutive_promoter">
<div class="constitutive_promoter">
 +
=== Analytical digestion of ADH1-T and gelelectrophoresis===
=== Analytical digestion of ADH1-T and gelelectrophoresis===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 4,868: Line 4,886:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Ligation of plasmid pSB1C3 containing 20aaLinker with LexA and plasmid containing Gal4AD with Pif3 for fusion protein construction ===
+
=== Ligation of plasmid pSB1C3 containing 20aaLinker with LexA and plasmid containing Gal4AD with Pif3 for fusion protein construction<br> ===
</div>
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of overnight culture from picked transformed E. coli containing biobrick BBa_K165055 ===
+
 
 +
=== Miniprep of overnight culture from picked transformed ''E. coli'' containing biobrick BBa_K165055 ===
</div>
</div>
<div class="thaumatin">
<div class="thaumatin">
 +
=== Inoculation of YPD medium with ''S. cerevisiae'' and brewing yeast strain 34/70 (part 2/3) ===
=== Inoculation of YPD medium with ''S. cerevisiae'' and brewing yeast strain 34/70 (part 2/3) ===
Line 4,962: Line 4,982:
<div class="vector_design">
<div class="vector_design">
-
=== new Miniprep of P50 pYES2 ===
+
=== New Miniprep of P50 pTUM104 ===
'''Investigators: Andrea'''
'''Investigators: Andrea'''
Line 4,970: Line 4,990:
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of P50 (pYes) in ''E.coli''===
+
 
 +
===Transformation of P50 (pTUM104) in ''E.coli''===
Investigator: Katrin
Investigator: Katrin
-
'''Aim of the experiment:''' Get more P50(pYes) for further experiments
+
'''Aim of the experiment:''' Get more P50(pTUM104) for further experiments
* adding 2-3 µl of plasmid P50 in 100µl competent XL blue E.coli cells
* adding 2-3 µl of plasmid P50 in 100µl competent XL blue E.coli cells
* incubation 30 min on ice
* incubation 30 min on ice
Line 4,982: Line 5,003:
<div class="coumaryl">
<div class="coumaryl">
-
===Ligation of 4CL and PAL in pSB1C3-RFC25 and ligation of PAL in pYES===
+
===Ligation of 4CL and PAL in pSB1C3-RFC25 and ligation of PAL in pTUM104===
Investigator: Katrin, Daniela
Investigator: Katrin, Daniela
Line 5,079: Line 5,100:
|}
|}
-
PAL+ (PCR 32) with P72 (pYES)
+
PAL+ (PCR 32) with P72 (pTUM104)
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
|'''volume'''
|'''volume'''
Line 5,100: Line 5,121:
|}
|}
-
PAL- (PCR 33) with P72 (pYES)
+
PAL- (PCR 33) with P72 (pTUM104)
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
|'''volume'''
|'''volume'''
Line 5,196: Line 5,217:
<div class="coumaryl">
<div class="coumaryl">
-
=== Picking clones of 4CL, CHS and OMT in pYES ===
+
=== Picking clones of 4CL, CHS and OMT in pTUM104 ===
'''investigator: ''' Katrin, Daniela
'''investigator: ''' Katrin, Daniela
Line 5,446: Line 5,467:
<div class="limonene">
<div class="limonene">
-
===Preparative gel===
+
===Preparative gel of pSB1C3 and pTUM104===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
*40 µl pSB1C3 + 4 µl loading dye
*40 µl pSB1C3 + 4 µl loading dye
-
*40 µl pYES2 + 4 µl loading dye
+
*40 µl pTUM104 + 4 µl loading dye
*20 µl PCR1 + 2 µl loading dye
*20 µl PCR1 + 2 µl loading dye
*Limonensynthase: 1600 bp
*Limonensynthase: 1600 bp
-
*pYES2: 5800 bp
+
*pTUM104: 5800 bp
*pSB1C3: 2000bp
*pSB1C3: 2000bp
Line 5,497: Line 5,518:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep of 4CL, CHS and OMT in pYES (P71 and P72)===
+
===Miniprep of 4CL, CHS and OMT in pTUM104 (P71 and P72)===
Investigator: Daniela
Investigator: Daniela
-
'''Aim of the experiment''': Extract plasmids (pYES) that contain 4CL, CHS and OMT
+
'''Aim of the experiment''': Extract plasmids (pTUM104) that contain 4CL, CHS and OMT
The day before 2 clones were picked for each enzyme.
The day before 2 clones were picked for each enzyme.
Line 5,509: Line 5,530:
Concentration:
Concentration:
-
*4CL+ in pYES clone 1: c = 172.5 ng/µl
+
*4CL+ in pTUM104 clone 1: c = 172.5 ng/µl
-
*4CL- in pYES clone 1: c = 192.1 ng/µl
+
*4CL- in pTUM104 clone 1: c = 192.1 ng/µl
-
*CHS+ in pYES clone 1: c = 136.6 ng/µl
+
*CHS+ in pTUM104 clone 1: c = 136.6 ng/µl
-
*CHS- in pYES clone 1: c = 85.7 ng/µl
+
*CHS- in pTUM104 clone 1: c = 85.7 ng/µl
-
*OMT+ in pYES clone 1: c = 116.0 ng/µl
+
*OMT+ in pTUM104 clone 1: c = 116.0 ng/µl
-
*OMT- in pYES clone 1: c = 129.7 ng/µl
+
*OMT- in pTUM104 clone 1: c = 129.7 ng/µl
-
*4CL+ in pYES clone 2: c = 160.0 ng/µl
+
*4CL+ in pTUM104 clone 2: c = 160.0 ng/µl
-
*4CL- in pYES clone 2: c = 144.5 ng/µl
+
*4CL- in pTUM104 clone 2: c = 144.5 ng/µl
-
*CHS+ in pYES clone 2: c = 128.5 ng/µl
+
*CHS+ in pTUM104 clone 2: c = 128.5 ng/µl
-
*CHS- in pYES clone 2: c = 116.2 ng/µl
+
*CHS- in pTUM104 clone 2: c = 116.2 ng/µl
-
*OMT+ in pYES clone 2: c = 142.8 ng/µl
+
*OMT+ in pTUM104 clone 2: c = 142.8 ng/µl
-
*OMT- in pYES clone 2: c = 134.5 ng/µl
+
*OMT- in pTUM104 clone 2: c = 134.5 ng/µl
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
===Control digest of 4CL, CHS and OMT in pYES===
+
===Control digest of 4CL, CHS and OMT in pTUM104===
Investigator: Daniela
Investigator: Daniela
-
'''Aim of the experiment:''' Test whether the ligation of 4CL, CHS and OMT in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of 4CL, CHS and OMT in pTUM104 was successful
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 5,537: Line 5,558:
|-
|-
|2.5 µl
|2.5 µl
-
|4CL+ in pYES clone 1 / 4CL- in pYES clone 1
+
|4CL+ in pTUM104 clone 1 / 4CL- in pTUM104 clone 1
|-
|-
|0.25 µl
|0.25 µl
Line 5,560: Line 5,581:
|-
|-
|3 µl
|3 µl
-
|4CL+ in pYES clone 2
+
|4CL+ in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,583: Line 5,604:
|-
|-
|3.5 µl
|3.5 µl
-
|4CL- in pYES clone 2
+
|4CL- in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,606: Line 5,627:
|-
|-
|3.5 µl
|3.5 µl
-
|CHS+ in pYES clone 1 / OMT+ in pYES clone 1 / OMT- in pYES clone 1 / CHS+ in pYES clone 2 / OMT+ in pYES clone 2 / OMT- in pYES clone 2
+
|CHS+ in pTUM104 clone 1 / OMT+ in pTUM104 clone 1 / OMT- in pTUM104 clone 1 / CHS+ in pTUM104 clone 2 / OMT+ in pTUM104 clone 2 / OMT- in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,629: Line 5,650:
|-
|-
|4 µl
|4 µl
-
|CHS- in pYES clone 2
+
|CHS- in pTUM104 clone 2
|-
|-
|0.25 µl
|0.25 µl
Line 5,652: Line 5,673:
|-
|-
|5 µl
|5 µl
-
|CHS- in pYES clone 1
+
|CHS- in pTUM104 clone 1
|-
|-
|0.25 µl
|0.25 µl
Line 5,671: Line 5,692:
expected bands:
expected bands:
-
*pYES: about 5800bp
+
*pTUM104: about 5800bp
*4CL: 1685bp
*4CL: 1685bp
*CHS: 1173bp
*CHS: 1173bp
Line 5,682: Line 5,703:
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of ligationsproducts of 4CL and PAL in pSB1C3-RFC25 and of PAL in pYES in ''E.coli'' (see July, 18th)===
+
===Transformation of ligationsproducts of 4CL and PAL in pSB1C3-RFC25 and of PAL in pTUM104 in ''E.coli'' (see July, 18th)===
Investigator: Daniela
Investigator: Daniela
Line 5,689: Line 5,710:
*PAL+ (PCR32) in pSB1C3-RFC25 (P133) ->Chlp
*PAL+ (PCR32) in pSB1C3-RFC25 (P133) ->Chlp
*PAL- (PCR33) in pSB1C3-RFC25 (P133) ->Chlp
*PAL- (PCR33) in pSB1C3-RFC25 (P133) ->Chlp
-
*PAL+ (PCR32) in pYES(P72) ->Amp
+
*PAL+ (PCR32) in pTUM104(P72) ->Amp
-
*PAL- (PCR33) in pYES(P72) ->Amp
+
*PAL- (PCR33) in pTUM104(P72) ->Amp
*negative control: P72 ->Amp
*negative control: P72 ->Amp
*negative control: P132 ->Chlp
*negative control: P132 ->Chlp
Line 5,754: Line 5,775:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of transformed ''E.&nbsp;coli'' XL1-Blue with pYES2 new from P50 tube (4x), BBa_K365005 (4x), BBa_K207000 (1x)and BBa_K207001 (1x)  ===
+
=== Miniprep of transformed ''E.&nbsp;coli'' XL1-Blue with pTUM104 new from P50 tube (4x), BBa_K365005 (4x), BBa_K207000 (1x)and BBa_K207001 (1x)  ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
Line 5,867: Line 5,888:
<div class="vector_design">
<div class="vector_design">
-
===Control digest of pYES (P153 and P154)===
+
===Control digest of pTUM104 (P153 and P154)===
Investigator: Mary, Ingmar, Daniela
Investigator: Mary, Ingmar, Daniela
-
'''Aim of the experiment:''' Test whether the vector pYES is right.
+
'''Aim of the experiment:''' Test whether the vector pTUM104 is right.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 6,220: Line 6,241:
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
=== Preparative digest of pYes2 RFC 25 and ligation with PCR products PCR 15 - 20 and 32+33 ===
+
=== Preparative digest of pTUM104 RFC25 and ligation with PCR products PCR 15 - 20 and 32+33 ===
'''Investigator: Ingmar'''
'''Investigator: Ingmar'''
-
'''Aim of the experiment:''' Intsert the genes of PAL, 4CL, CHS and OMT in pYEs2 RFC 25 in order to test their expression in yeast.
+
'''Aim of the experiment:''' Intsert the genes of PAL, 4CL, CHS and OMT in pTUM104 RFC 25 in order to test their expression in yeast.
'''Preparative digest of P 154 with XbaI and NgoMIV and of P 153 with XbaI and PstI'''
'''Preparative digest of P 154 with XbaI and NgoMIV and of P 153 with XbaI and PstI'''
Line 6,380: Line 6,401:
=Week 7=
=Week 7=
-
 
+
<!--
<p class="limonene">'''Limonene (7 Experiments):'''</p>
<p class="limonene">'''Limonene (7 Experiments):'''</p>
*  
*  
-
<p class="coumaryl">'''Coumaryl (18 Experiments):'''</p>
+
<p class="coumaryl">'''Xanthohumol (18 Experiments):'''</p>
*  
*  
Line 6,394: Line 6,415:
<html><a class="WDetails" href="#Week_7" id="Week_7">Show Details ...</a></html>
<html><a class="WDetails" href="#Week_7" id="Week_7">Show Details ...</a></html>
-
 
+
-->
<div class="week" id="WWeek_7">
<div class="week" id="WWeek_7">
== '''Monday, July 23rd''' ==
== '''Monday, July 23rd''' ==
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep of PAL, 4CL in pSB1C3 and PAL in pYES===
+
===Miniprep of PAL, 4CL in pSB1C3 and PAL in pTUM104===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment''': Extract plasmids (pYES and pSB1C3-RFC25) that contain 4CL and PAL´
+
'''Aim of the experiment''': Extract plasmids (pTUM104 and pSB1C3-RFC25) that contain 4CL and PAL´
The day before one clone were picked for each enzyme from plates from 19th July 2012.
The day before one clone were picked for each enzyme from plates from 19th July 2012.
Line 6,416: Line 6,437:
*PAL- (PCR33) in pSB1C3-RF25 (P133): c = 255 ng/µl -> new name of Ligationproduct after Miniprep: P188
*PAL- (PCR33) in pSB1C3-RF25 (P133): c = 255 ng/µl -> new name of Ligationproduct after Miniprep: P188
-
*PAL+ (PCR32) in pYES (P72): c = 190 ng/µl
+
*PAL+ (PCR32) in pTUM104 (P72): c = 190 ng/µl
-
*PAL- (PCR33) in pYES (P72): c = 238 ng/µl
+
*PAL- (PCR33) in pTUM104 (P72): c = 238 ng/µl
</div>
</div>
Line 6,423: Line 6,444:
<div class="coumaryl">
<div class="coumaryl">
-
===Control digest of 4CL, PAL in pSB1C3-RFC25 and PAL in pYES===
+
===Control digest of 4CL, PAL in pSB1C3-RFC25 and PAL in pTUM104===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL in pSB1C3-RFC25 and PAL in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL in pSB1C3-RFC25 and PAL in pTUM104 was successful
Plasmids are taken from miniprep from 23.07.2012
Plasmids are taken from miniprep from 23.07.2012
Line 6,501: Line 6,522:
expected bands:
expected bands:
-
*pYES: about 5800bp
+
*pTUM104: about 5800bp
*pSB1C3-RFC25: 2070bp
*pSB1C3-RFC25: 2070bp
*4CL: 1685bp
*4CL: 1685bp
Line 6,508: Line 6,529:
[[File:TUM12_120723_kontrollverdau_wdh.jpg|500px]]
[[File:TUM12_120723_kontrollverdau_wdh.jpg|500px]]
-
Ligation of PAL+/- in pYES was not succesful
+
Ligation of PAL+/- in pTUM104 was not succesful
Ligation of PAL+/- and 4CL+/- in pSB1C3-RFC25 were succesful! (pSB1C3 is overlapping with PAL)
Ligation of PAL+/- and 4CL+/- in pSB1C3-RFC25 were succesful! (pSB1C3 is overlapping with PAL)
Line 6,519: Line 6,540:
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' solubilisation of the synthetic gene of APT and transformation of sent plasmid (including APT) in E.coli to copy it if necessary
+
'''Aim of the experiment:''' solubilisation of the synthetic gene of APT and transformation of sent plasmid (including APT) in ''E.coli'' to copy it if necessary
short zentrifugation of sent product and adding 50µl bidest. H2O to it (5µg in 50µl = concentration of 0.1 µg/µl)
short zentrifugation of sent product and adding 50µl bidest. H2O to it (5µg in 50µl = concentration of 0.1 µg/µl)
Line 6,572: Line 6,593:
<div class="coumaryl">
<div class="coumaryl">
-
===Transformation of  ligationsproducts of 4CL, CHS, OMT  and PAL in pYES in E.Coli (Ligation see 22th of July)===
+
===Transformation of  ligationsproducts of 4CL, CHS, OMT  and PAL in pTUM104 in ''E.Coli'' (Ligation see 22th of July)===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' ligation of enzymes in pYES to transform it into yeast if this was successful.
+
'''Aim of the experiment:''' ligation of enzymes in pTUM104 to transform it into yeast if this was successful.
* 4CL+ (PCR15) in pYES (P176) -> new name: P177
* 4CL+ (PCR15) in pYES (P176) -> new name: P177
* 4CL- (PCR16) in pYES (P176) -> new name: P178
* 4CL- (PCR16) in pYES (P176) -> new name: P178
Line 6,586: Line 6,607:
* PAL- (PCR33) in pYES (P175) -> new name: P184
* PAL- (PCR33) in pYES (P175) -> new name: P184
-
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells  
+
* adding 5µl ligation product in 100 µl competent XL blue ''E.coli'' cells  
* incubation 30 min on ice  
* incubation 30 min on ice  
* 5 min at 37°C  
* 5 min at 37°C  
Line 6,608: Line 6,629:
== '''Tuesday, July 24nd''' ==
== '''Tuesday, July 24nd''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== GElextraction of preparative digested ADH1-P, CYC1-T, TEF2-P, TEF1-P,PGK1-P===
+
=== Gelextraction of preparative digested ADH1-P, CYC1-T, TEF2-P, TEF1-P,PGK1-P===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 6,615: Line 6,636:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop===
+
===Nanodrop: measuring concentration of P128-P131, P168-P169===
''' Investigator:''' Georg
''' Investigator:''' Georg
Line 6,891: Line 6,912:
* Negative control P133
* Negative control P133
-
* adding 5µl ligation product in 100 µl competent XL blue E.coli cells  
+
* adding 5µl ligation product in 100 µl competent XL blue ''E.coli'' cells  
* incubation 30 min on ice  
* incubation 30 min on ice  
* 5 min at 37°C  
* 5 min at 37°C  
Line 6,899: Line 6,920:
<div class="coumaryl">
<div class="coumaryl">
-
=== Picking Clones of 4CL, CHS, OMT and PAL in pYES and APT in original plasmid===
+
=== Picking Clones of 4CL, CHS, OMT and PAL in pTUM104 and APT in original plasmid===
'''investigator: ''' Daniela
'''investigator: ''' Daniela
Line 7,078: Line 7,099:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep of 4CL, CHS, OMT, PAL in pYes and APT in original plasmid from GeneArt===
+
===Miniprep of 4CL, CHS, OMT, PAL in pTUM104 and APT in original plasmid from GeneArt===
Investigator: Katrin
Investigator: Katrin
-
'''Aim of the experiment''': extraction of plasmids (pYes2) that contain 4CL, CHS, OMT, PAL; extraction of original plasmid from GeneArt with APT
+
'''Aim of the experiment''': extraction of plasmids (pTUM104) that contain 4CL, CHS, OMT, PAL; extraction of original plasmid from GeneArt with APT
QIAprepS Spin Miniprep Kit
QIAprepS Spin Miniprep Kit
Line 7,113: Line 7,134:
* cells were prefilled with 1 ml of LB-medium and incubated in a cell-culture shaker at 37 °C for 40 min
* cells were prefilled with 1 ml of LB-medium and incubated in a cell-culture shaker at 37 °C for 40 min
-
* 100 µl of these cell suspension were plated on antibiotic selection plates (ligations in pYES: Ampicillin; ligations in pSB1C3: Chloramphenicol)
+
* 100 µl of these cell suspension were plated on antibiotic selection plates (ligations in pTUM104: Ampicillin; ligations in pSB1C3: Chloramphenicol)
* cell suspension was centrifuged at 13000 rpm for 90 s for resuspending the pellet with 100 µl LB and plating also
* cell suspension was centrifuged at 13000 rpm for 90 s for resuspending the pellet with 100 µl LB and plating also
Line 7,185: Line 7,206:
<div class="coumaryl">
<div class="coumaryl">
-
===Control digest of 4CL, PAL, CHS, OMT, APT in pYES===
+
===Control digest of 4CL, PAL, CHS, OMT, APT in pTUM104===
Investigator: Mary
Investigator: Mary
-
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL, CHS, OMT, APT in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of 4CL, PAL, CHS, OMT, APT in pTUM104 was successful
Plasmids are taken from miniprep from 25.07.2012
Plasmids are taken from miniprep from 25.07.2012
Line 7,228: Line 7,249:
<div class="coumaryl">
<div class="coumaryl">
-
=== pour on yeast agarplates ===
+
=== Pour on yeast agarplates for selection of yeast cells ===
Investigator: Mary
Investigator: Mary
Line 7,240: Line 7,261:
<div class="limonene">
<div class="limonene">
 +
===Picking of clones of transformation from 25.07.===
===Picking of clones of transformation from 25.07.===
Line 7,250: Line 7,272:
<div class="limonene">
<div class="limonene">
-
===Transformation of plasmids P40&P42 into E.coli XL1 blue===
+
===Transformation of plasmids P40&P42 into ''E.coli'' XL1 blue===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 7,256: Line 7,278:
'''Aim:'''  
'''Aim:'''  
-
Transformation of plasmids P40 and P42 into E.coli XL1 blue to get plasmids of higher quality. P40&P42 are directly extracted from the expression strain BL21(DE). The quality of the plasmids might not be sufficient for Quickchange site-directed mutagenesis. Therefore transformation into E.coli XL1 blue and subsequent plasmid preparation to get plasmids with sufficient quality for SDM.
+
Transformation of plasmids P40 and P42 into ''E.coli'' XL1 blue to get plasmids of higher quality. P40&P42 are directly extracted from the expression strain BL21(DE). The quality of the plasmids might not be sufficient for Quickchange site-directed mutagenesis. Therefore transformation into ''E.coli'' XL1 blue and subsequent plasmid preparation to get plasmids with sufficient quality for SDM.
'''Procedure:'''  
'''Procedure:'''  
Line 7,281: Line 7,303:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Transferring ''E.&nbsp;coli''XL1-Blue colonies, transformed with BBa_I15008 (heme oxygenase) and BBa_K105005 (LexA), from old antibiotic plates on new plates ===
+
=== Transferring ''E.&nbsp;coli'' XL1-Blue colonies, transformed with BBa_I15008 (heme oxygenase) and BBa_K105005 (LexA), from old antibiotic plates on new plates ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
Line 7,302: Line 7,324:
Investigator: Ingmar
Investigator: Ingmar
-
'''Aim of the experiment:''' Test whether the ligation of PAL in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of PAL in pTUM104 was successful
'''Miniprep'''
'''Miniprep'''
Line 7,336: Line 7,358:
*PAL: 2151bp
*PAL: 2151bp
-
[[File:TUM12_Coumaryl_P219_und_P220__27.07.2012.jpg|500px]]
+
[[File:TUM12_Xanthohumol_P219_und_P220__27.07.2012.jpg|500px]]
As the picture only shows one band at the expected length of the vecotr backbone the ligation was not successfull and will be repeated with a reduced quotient of insert to vector of 3.
As the picture only shows one band at the expected length of the vecotr backbone the ligation was not successfull and will be repeated with a reduced quotient of insert to vector of 3.
Line 7,394: Line 7,416:
<div class="limonene">
<div class="limonene">
-
=== Plasmid extraction of plasmids PCR1/pYes, P144/pYES, PCR1/pSB1C3 ===
+
=== Plasmid extraction of plasmids PCR1/pTUM104, P144/pTUM104, PCR1/pSB1C3 ===
'''Investigator: Lara'''
'''Investigator: Lara'''
-
'''Aim of the experiment:''' Extract plasmids from ligation of PCR1 in pYES, P144 in pYES and PCR1 in pSB1C3 for further analytical restriction digest. (6 clones were picked for each ligation and plasmids subsequently extracted.)
+
'''Aim of the experiment:''' Extract plasmids from ligation of PCR1 in pYES, P144 in pTUM104 and PCR1 in pSB1C3 for further analytical restriction digest. (6 clones were picked for each ligation and plasmids subsequently extracted.)
'''Prodedure:''' Plasmids were extraced by using Qiagen plasmid miniprep kit.
'''Prodedure:''' Plasmids were extraced by using Qiagen plasmid miniprep kit.
Line 7,432: Line 7,454:
<div class="limonene">
<div class="limonene">
-
=== Restriction digest of plasmids from 6 clones each of PCR1/pYESnew, P144(PCR2)/pYESnew, PCR1/pSB1C3 ===
+
=== Restriction digest of plasmids from 6 clones each of PCR1/pTUM104new, P144(PCR2)/pTUM104new, PCR1/pSB1C3 ===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 7,469: Line 7,491:
<div class="limonene">
<div class="limonene">
-
=== Analytical gel electrophoresis ===
+
=== Analytical gel electrophoresis of PCR1/pTUM104new, P144(PCR2)/pTUM104new, PCR1/pSB1C3 ===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 7,482: Line 7,504:
<div class="coumaryl">
<div class="coumaryl">
-
===Small-Scale Yeast Transformation of 4CL, CHS, OMT and PAL- in pYES===
+
===Small-Scale Yeast Transformation of 4CL, CHS, OMT and PAL- in pTUM104===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
Line 7,544: Line 7,566:
=Week 8=
=Week 8=
-
 
+
<!--
<p class="limonene">'''Limonene (14 Experiments):'''</p>
<p class="limonene">'''Limonene (14 Experiments):'''</p>
*  
*  
-
<p class="coumaryl">'''Coumaryl (5 Experiments):'''</p>
+
<p class="coumaryl">'''Xanthohumol (5 Experiments):'''</p>
*  
*  
Line 7,561: Line 7,583:
<html><a class="WDetails" href="#Week_8" id="Week_8">Show Details ...</a></html>
<html><a class="WDetails" href="#Week_8" id="Week_8">Show Details ...</a></html>
-
 
+
-->
<div class="week" id="WWeek_8">
<div class="week" id="WWeek_8">
== '''Monday, July 30th''' ==
== '''Monday, July 30th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Extraction of Yeast genomic DNA===
+
===Extraction of Yeast genomic DNA for amplify TEF2-P, TEF1-T,ADH1-T===
'''Investigator''': Georg
'''Investigator''': Georg
Line 7,591: Line 7,613:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop of yeast genomic DNA===
+
===Nanodrop of yeast genomic DNA to measuring the concentration===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 7,717: Line 7,739:
<div class="coumaryl">
<div class="coumaryl">
-
=== Transformation of ligation products of PAL+ (PCR32) and APT(P189) in pYES2 RFC 25 (P175)into ''E.coli'' Xl1-Blue===
+
=== Transformation of ligation products of PAL+ (PCR32) and APT(P189) in pTUM104 RFC25 (P175)into ''E.coli'' Xl1-Blue===
'''Investigator:''' Ingmar
'''Investigator:''' Ingmar
-
'''Aim of the experiment:'''Transformation of the ligation products of PAL+ (PCR32), APT (P189) and the  negative control in pYes in XL1 Blue.
+
'''Aim of the experiment:'''Transformation of the ligation products of PAL+ (PCR32), APT (P189) and the  negative control in pTUM104 in XL1 Blue.
'''Operation Sequence'''
'''Operation Sequence'''
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
Line 7,733: Line 7,755:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep and control digest of PAL+ in pYES picked on sunday 29th July===
+
===Miniprep and control digest of PAL+ in pTUM104 picked on sunday 29th July===
Investigator: Ingmar
Investigator: Ingmar
-
'''Aim of the experiment:''' Test whether the ligation of PAL in pYES was successful
+
'''Aim of the experiment:''' Test whether the ligation of PAL in pTUM104 was successful
'''Miniprep'''
'''Miniprep'''
-
Using a Quiagen Miniprep kit a plasmid isolation of two picked clones of the PAL+ in pYes2 RFC25 ligation was done. The miniprep product of the first clone was named P235, the one of the second clone P236. Both were used for the following control digest.
+
Using a Quiagen Miniprep kit a plasmid isolation of two picked clones of the PAL+ in pTUM104 RFC25 ligation was done. The miniprep product of the first clone was named P235, the one of the second clone P236. Both were used for the following control digest.
'''control digest'''
'''control digest'''
Line 7,776: Line 7,798:
<div class="limonene">
<div class="limonene">
-
===Miniprep of Schwab plasmids P40 & P42 from E.coli XL1 blue===
+
===Miniprep of Schwab plasmids P40 & P42 from ''E.coli'' XL1 blue===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 7,860: Line 7,882:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim of experiment:''' Check whether ligations PCR1/pYESnew, P144(PCR2)/pYESnew and PCR1/pSB1C3 have worked. This time, a standard protocol with 2,5 µl of DNA was used. Furthermore, Pst-1 HF was used instead of Spe1 (as on Friday, July 27th).
+
'''Aim of experiment:''' Check whether ligations PCR1/pTUM104new, P144(PCR2)/pTUM104new and PCR1/pSB1C3 have worked. This time, a standard protocol with 2,5 µl of DNA was used. Furthermore, Pst-1 HF was used instead of Spe1 (as on Friday, July 27th).
-
*Digest of plasmids PCR1/pYESnew clone 1,3,5 and 6; P144(PCR2)/pYESnew clone 1,3,5 and 6; PCR1/pSB1C3 clone 1,5 and 6.
+
*Digest of plasmids PCR1/pTUM104new clone 1,3,5 and 6; P144(PCR2)/pTUM104 new clone 1,3,5 and 6; PCR1/pSB1C3 clone 1,5 and 6.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 7,895: Line 7,917:
== '''Tuesday, July 31st''' ==
== '''Tuesday, July 31st''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop===
+
===Nanodrop for measuring Plasmidconcentrations of P54,P55,P57,P87,P86,P88,P90,P91,P89===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 7,913: Line 7,935:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
 +
===Prep. digestion of P90, P87, P55 and prep. gelelectrophoresis===
===Prep. digestion of P90, P87, P55 and prep. gelelectrophoresis===
Line 7,949: Line 7,972:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Analytical digestion of pYESII with PvuII and SwaI===
+
=== Analytical digestion of pTUM104 with PvuII and SwaI===
''' Investigator:''' Georg
''' Investigator:''' Georg
Line 8,073: Line 8,096:
'''Investigator: Andrea'''
'''Investigator: Andrea'''
-
'''Digestion of PCR1, PCR2 and P155 (pYES) with XbaI and AgeI'''
+
'''Digestion of PCR1, PCR2 and P155 (pTUM104) with XbaI and AgeI'''
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 8,150: Line 8,173:
</div>
</div>
<div class="limonene">
<div class="limonene">
-
===preparative gel electrophoresis===
+
===Preparative gel electrophoresis of PCR1/PCR2, P155===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
Line 8,161: Line 8,184:
<div class="limonene">
<div class="limonene">
-
=== Ligation of digested PCR1 with P133 (pSB1C3) and P175 (pYES) (XbaI and AgeI)===
+
=== Ligation of digested PCR1 with P133 (pSB1C3) and P175 (pTUM104) (XbaI and AgeI)===
'''Investigator: Andrea'''
'''Investigator: Andrea'''
Line 8,593: Line 8,616:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Preparative digestion of pYesII with SwaI and PvuII ===
+
=== Preparative digestion of pTUM104 with SwaI and PvuII ===
*Preparative digestion of pYesII
*Preparative digestion of pYesII
Line 8,626: Line 8,649:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Preparative Gel of pYESII digestion===
+
===Preparative Gel of pTUM104 digestion===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 8,668: Line 8,691:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep and control digest of APT in pYES ===
+
===Miniprep and control digest of APT in pTUM104 ===
Investigator: Katrin
Investigator: Katrin
Line 8,751: Line 8,774:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Gelextraction of pYesII -f1,-Gal4 ===
+
=== Gelextraction of pTUM104 -f1,-Gal4 ===
-
pYes II extraction was performed according to manufacturers protocoll
+
pTUM104 extraction was performed according to manufacturers protocoll
Concentration was measured with nanodrop
Concentration was measured with nanodrop
Line 8,763: Line 8,786:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Circularization of linearized plasmid backbone pYesII===
+
=== Circularization of linearized plasmid backbone pTUM104===
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 8,997: Line 9,020:
<div class="coumaryl">
<div class="coumaryl">
-
===Preparation of YPD Medium and Picking of S. cerevisiae clones===
+
===Preparation of YPD Medium and Picking of ''S. cerevisiae'' clones===
'''Investigator:''' Lara, Katrin
'''Investigator:''' Lara, Katrin
Line 9,013: Line 9,036:
== '''Friday, August 3rd''' ==
== '''Friday, August 3rd''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of E.coli Xl1-blue with Vector pGADT7-AD===
+
=== Transformation of ''E.coli'' Xl1-blue with Vector pGADT7-AD===
'''Investigator:'''Georg
'''Investigator:'''Georg
Line 9,037: Line 9,060:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of E.coli Xl1-blue with pYES-TUM overnight ligation===
+
=== Transformation of ''E.coli'' Xl1-blue with pTUM104 overnight ligation===
'''Investigator:'''Georg
'''Investigator:'''Georg
Line 9,209: Line 9,232:
* Final extension: 68 C
* Final extension: 68 C
* Hold: 4 C
* Hold: 4 C
 +
* PCR was successful
</div>
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
===Transformation of E.coli XL1 blue with ligation product P207/PCR39===
+
 
 +
===Transformation of ''E.coli'' XL1 blue with ligation product P207/PCR39===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation of E.coli XL1 blue with ligation products P207/PCR39 and P207/NK.
+
'''Aim:''' Incubation times of transformation of August 2nd had to be shortened because the lab employees left. Therefore the transformation didn't work properly. --> Repetition of the transformation of ''E.coli'' XL1 blue with ligation products P207/PCR39 and P207/NK.
''' Transformation into ''E.coli'' Xl1-Blue'''
''' Transformation into ''E.coli'' Xl1-Blue'''
Line 9,287: Line 9,312:
<div class="limonene">
<div class="limonene">
-
===Transformation of E.coli XL1 blue with P242 SDM===
+
===Transformation of ''E.coli'' XL1 blue with P242 SDM===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 9,306: Line 9,331:
<div class="coumaryl">
<div class="coumaryl">
-
===Repetition of small-Scale Yeast Transformation of 4CL, CHS, OMT, PAL and APT in pYES===
+
===Repetition of small-Scale Yeast Transformation of 4CL, CHS, OMT, PAL and APT in pTUM104===
'''Investigator:''' Mary
'''Investigator:''' Mary
Line 9,348: Line 9,373:
<div class="limonene">
<div class="limonene">
-
===Transformation of E.coli XL1 blue with ligation products===
+
===Transformation of ''E.coli'' XL1 blue with ligation products===
Investigator: Katrin
Investigator: Katrin
Line 9,354: Line 9,379:
Aim: Transformation of ligation products PCR2/P133, PCR1/P133, MK/P133, PCR2/P175, MK/P175
Aim: Transformation of ligation products PCR2/P133, PCR1/P133, MK/P133, PCR2/P175, MK/P175
-
Transformation into E.coli Xl1-Blue
+
Transformation into ''E.coli'' Xl1-Blue
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
Line 9,566: Line 9,591:
=Week 9=
=Week 9=
-
 
+
<!--
<p class="limonene">'''Limonene (11 Experiments):'''</p>
<p class="limonene">'''Limonene (11 Experiments):'''</p>
*  
*  
-
<p class="coumaryl">'''Coumaryl (10 Experiments):'''</p>
+
<p class="coumaryl">'''Xanthohumol (10 Experiments):'''</p>
*  
*  
Line 9,583: Line 9,608:
<html><a class="WDetails" href="#Week_9" id="Week_9">Show Details ...</a></html>
<html><a class="WDetails" href="#Week_9" id="Week_9">Show Details ...</a></html>
-
 
+
-->
<div class="week" id="WWeek_9">
<div class="week" id="WWeek_9">
== '''Monday, August 6th''' ==
== '''Monday, August 6th''' ==
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR39  ===
+
=== Miniprep of overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P207+PCR39  ===
'''Investigator:''' Jeff, Dennis
'''Investigator:''' Jeff, Dennis
Line 9,942: Line 9,967:
'''Investigator:''' Georg
'''Investigator:''' Georg
-
'''Aim of the experiment:''' Miniprep of overnight cultures of transformed E. coli XL1-Blue
+
'''Aim of the experiment:''' Miniprep of overnight cultures of transformed ''E. coli'' XL1-Blue
'''Procedure:'''
'''Procedure:'''
Line 9,953: Line 9,978:
'''Investigator:''' Georg
'''Investigator:''' Georg
-
'''Aim of the experiment:''' Amplification of TEF1-Terminator, TEF2-Promoter from genomic DNA of Saccharomyces cerevisiae and ADH1-Terminator from yeast Vector PGADT7 AD'''
+
'''Aim of the experiment:''' Amplification of TEF1-Terminator, TEF2-Promoter from genomic DNA of ''Saccharomyces cerevisiae'' and ADH1-Terminator from yeast Vector PGADT7 AD'''
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 10,076: Line 10,101:
<div class="limonene">
<div class="limonene">
-
===Ligation of lavendula LS and citrus LS with pSB1C3 and pYES===
+
===Ligation of lavendula LS and citrus LS with pSB1C3 and pTUM104===
Investigator: Andrea
Investigator: Andrea
Line 10,212: Line 10,237:
</div>
</div>
<div class="coumaryl">
<div class="coumaryl">
-
===Preparation of SC-U medium with 2% glucose (300ml) or galactose (700 ml) for expression in Saccharomyces cerevisiae===
+
===Preparation of SC-U medium with 2% glucose (300ml) or galactose (700 ml) for expression in ''Saccharomyces cerevisiae''===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
Line 10,233: Line 10,258:
<div class="coumaryl">
<div class="coumaryl">
-
===Inoculation of Saccharomyces cerevisiae colonies of transformation products from August, 3rd===
+
===Inoculation of ''Saccharomyces cerevisiae'' colonies of transformation products from August, 3rd===
'''Investigator:''' Daniela
'''Investigator:''' Daniela
-
'''Aim of the experiment:''' First step of the expression protocol in Saccharomyces cerevisiae
+
'''Aim of the experiment:''' First step of the expression protocol in ''Saccharomyces cerevisiae''
-
Inoculation of a single colony of Saccaromyces cerevisiae transformed with enzymes PAL+/-, 4CL+/-, CHS+/-, OMT+/-, APT and the positive control GFP in pYES, respectively in 15 ml of SC-U medium with 2% glucose.
+
Inoculation of a single colony of ''Saccaromyces cerevisiae'' transformed with enzymes PAL+/-, 4CL+/-, CHS+/-, OMT+/-, APT and the positive control GFP in pTUM104, respectively in 15 ml of SC-U medium with 2% glucose.
Incubation at 30°C over night.
Incubation at 30°C over night.
Line 10,441: Line 10,466:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Prepare digested PCR fragments for further ligation into pYES and pSB1C3.
+
'''Aim:''' Prepare digested PCR fragments for further ligation into pTUM104 and pSB1C3.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 10,523: Line 10,548:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Check ligation of PCR 1 and PCR 2 into pYES and pSB1C3.
+
'''Aim:''' Check ligation of PCR 1 and PCR 2 into pTUM104 and pSB1C3.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 10,559: Line 10,584:
<div class="limonene">
<div class="limonene">
-
===Ligation of lavendula LS and citrus LS with pSB1C3 and pYES===
+
===Ligation of lavendula LS and citrus LS with pSB1C3 and pTUM104===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pYES.
+
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pTUM104.
'''Procedure'''
'''Procedure'''
Line 10,856: Line 10,881:
<div class="coumaryl">
<div class="coumaryl">
-
===Induction of PAL,4CL,CHS,OMT,APT and GFP in pYES in ''S. cerevisiae'' in SC-U medium with 2% galactose===
+
===Induction of PAL,4CL,CHS,OMT,APT and GFP in pTUM104 in ''S. cerevisiae'' in SC-U medium with 2% galactose===
'''Investigator:''' Mary, Daniela
'''Investigator:''' Mary, Daniela
-
'''Aim of the experiment:''' Expression of all enzymes in Saccharomyces cerevisiae.
+
'''Aim of the experiment:''' Expression of all enzymes in ''Saccharomyces cerevisiae''.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 11,218: Line 11,243:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Transform E.coli XL 1 blue with ligation products to produce colonies containing plasmid DNA.
+
'''Aim:''' Transform ''E.coli'' XL 1 blue with ligation products to produce colonies containing plasmid DNA.
-
'''Transformation into E.coli Xl1-Blue'''
+
'''Transformation into ''E.coli'' Xl1-Blue'''
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
Line 11,348: Line 11,373:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop measurement===
+
===Nanodrop measurement of PCR 50-55 and P297-302===
'''Investigator''': Georg
'''Investigator''': Georg
-
* PCR products 50-55 (ADH1-T, TEf1-T, TEF2-P) and P297-302 (TEF1-P, ADH1-P) were measured with Nanodrop
+
* PCR products 50-55 (ADH1-T, TEf1-T, TEF2-P) and P297-302 (TEF1-P, ADH1-P) were measured with Nanodrop in ng/µl
* ADH1-T: 22,4
* ADH1-T: 22,4
* TEF2-P: 7,4
* TEF2-P: 7,4
Line 11,363: Line 11,388:
'''Investigator''': Georg
'''Investigator''': Georg
-
===Ligation of TEF1-P, TEF2-P ADH1-T, TEF1-T and ADH1-T and pYESII-Tum===  
+
===Ligation of TEF1-P, TEF2-P ADH1-T, TEF1-T and ADH1-T and pTUM104===  
'''Procedure:'''
'''Procedure:'''
* Reaction batch for Ligation:
* Reaction batch for Ligation:
Line 11,618: Line 11,643:
* Then the gel extraction kit from Qiagen was used for extracting the linearized insert from the agarose gel.
* Then the gel extraction kit from Qiagen was used for extracting the linearized insert from the agarose gel.
-
[[File:TUM12_20120809 dennis präp verdau baa36500.jpg]]
+
[[File:TUM12_20120809 dennis präp verdau baa36500.jpg|300px]]
</div>
</div>
Line 11,747: Line 11,772:
'''Operational sequence:'''  
'''Operational sequence:'''  
-
The used vectors for the transformations were pSB1C3 RFC25 (p123), and pSB1C3 containing CHS- from the coumaroyl group (p136). Vector lengths are 2070 bps and xxx bps, respectively).
+
The used vectors for the transformations were pSB1C3 RFC25 (p123), and pSB1C3 containing CHS- from the coumaroyl group (p136).  
'''Transformations:'''
'''Transformations:'''
-
* Transformation of (old) chemo competent ''e.coli'' cells, used up to now, and the newly prepared with p123  
+
* Transformation of (old) chemo competent ''E.coli'' cells, used up to now, and the newly prepared with p123  
-
* Transformation of the new chemo competent ''e.coli'' cells with p136 with two slightly different methods:
+
* Transformation of the new chemo competent ''E.coli'' cells with p136 with two slightly different methods:
** as described in previous protocolls, with an heat shock at 37°C for 5 minutes
** as described in previous protocolls, with an heat shock at 37°C for 5 minutes
** with an heat shock at 42°C for 30 seconds, followed by an incubation on ice for 30 minutes (before the cells being incubated with LB- medium)
** with an heat shock at 42°C for 30 seconds, followed by an incubation on ice for 30 minutes (before the cells being incubated with LB- medium)
Line 11,759: Line 11,784:
=='''Friday, August 10th'''==
=='''Friday, August 10th'''==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of overnight ligation with TEF1-P, TEF2-P, TEF1-T, ADH1-P, ADH1-T and pYE2II-TUM===
+
=== Transformation of overnight ligation with TEF1-P, TEF2-P, TEF1-T, ADH1-P, ADH1-T and pTUM104===
'''Investigator''': Georg
'''Investigator''': Georg
Line 11,785: Line 11,810:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===PCR of TEF1-T and TEF2-P from Saccharomyces cerv. genome===
+
===PCR of TEF1-T and TEF2-P from ''Saccharomyces cerevisiae'' genome===
'''Investigator''': Georg
'''Investigator''': Georg
Line 11,862: Line 11,887:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===PCR-Purification===
+
===PCR-Purification of TEF1-T and TEF2-P ===
'''Investigator''': Georg
'''Investigator''': Georg
Line 11,870: Line 11,895:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Analytical gel of purified PCR-Products===
+
===Analytical gel of purified PCR-Products (TEF1-T and TEF2-P) ===
[[File:20120810 Anal.Gel PCR TEF2p,TEF1t.png]]
[[File:20120810 Anal.Gel PCR TEF2p,TEF1t.png]]
* PCR was succesfull
* PCR was succesfull
Line 11,987: Line 12,012:
<div class="limonene">
<div class="limonene">
-
===Miniprep===
+
===Miniprep of transformation august 8th===
'''Investigator:''' Dennis
'''Investigator:''' Dennis
-
Minipreps are stored in a disposal bag on the lowest drawer of -20°C.
+
'''Aim:''' Miniprep of transformation August 8th
 +
 
 +
The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 40 µl ddH2O at room temperature, with the columns having been incubated 2 minutes at room temperature before the final centrifugation.
 +
'''Miniprep products are stored in a 50 ml Falcon tube in the lowest drawer at -20°C '''
 +
 
</div>
</div>
Line 12,114: Line 12,143:
=Week 10=
=Week 10=
-
 
+
<!--
<p class="limonene">'''Limonene (16 Experiments):'''</p>
<p class="limonene">'''Limonene (16 Experiments):'''</p>
*  
*  
-
<p class="coumaryl">'''Coumaryl (6 Experiments):'''</p>
+
<p class="coumaryl">'''Xanthohumol (6 Experiments):'''</p>
*  
*  
Line 12,134: Line 12,163:
<html><a class="WDetails" href="#Week_10" id="Week_10">Show Details ...</a></html>
<html><a class="WDetails" href="#Week_10" id="Week_10">Show Details ...</a></html>
-
 
+
-->
<div class="week" id="WWeek_10">
<div class="week" id="WWeek_10">
== '''Monday, August 13th''' ==
== '''Monday, August 13th''' ==
Line 12,167: Line 12,196:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Picking of colonies of psb1c3 with TEF1-t, TEF2-P, ADH1-P und ADH1-t, pyes2-Tum===
+
===Picking of colonies of psb1c3 with TEF1-t, TEF2-P, ADH1-P und ADH1-t, pTUM104===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 12,175: Line 12,204:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Preparative digestion of pYES2===
+
===Preparative digestion of pTUM104===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 12,892: Line 12,921:
<div class="coumaryl">
<div class="coumaryl">
-
===small-Scale Yeast Transformation of pYES without insert===
+
===Small-Scale Yeast Transformation of pTUM104 without insert===
'''Investigator:''' Katrin, Ingmar
'''Investigator:''' Katrin, Ingmar
-
'''Aim of the experiment:'''Transformation of P152 (pYes without insert) in Yeast  
+
'''Aim of the experiment:'''Transformation of P152 (pTUM104 without insert) in Yeast  
The protocol on page 13 of the pYES2 manual was used. To ensure a positive result, two transformations were made.
The protocol on page 13 of the pYES2 manual was used. To ensure a positive result, two transformations were made.
Line 12,939: Line 12,968:
<div class="caffeine">
<div class="caffeine">
-
=== Restriction digest of p123 and p136 and preparative gel electrophoresisb===
+
=== Restriction digest of p123 and p136 and preparative gel electrophoresis===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 12,995: Line 13,024:
'''Aim:'''  
'''Aim:'''  
-
Dilution of dried pUCIDT- Amp vector, which contains the gene synthesis products. Afterwards, transformation of pUCIDT_CaXMT1, pUCIDT_CaMXMT1 and pUCIDT_CaDXMT1 in chemo competent XL-1 blue ''e.coli-'' cells, to make the genes available for cloning in pSB1C3 and pYES2.
+
Dilution of dried pUCIDT- Amp vector, which contains the gene synthesis products. Afterwards, transformation of pUCIDT_CaXMT1, pUCIDT_CaMXMT1 and pUCIDT_CaDXMT1 in chemo competent XL-1 blue ''e.coli-'' cells, to make the genes available for cloning in pSB1C3 and pTUM104
'''Operational sequence'''
'''Operational sequence'''
Line 13,028: Line 13,057:
<div class="thaumatin">
<div class="thaumatin">
-
=== Preparative restriction digest and gel electrophoresis of the preprothaumatin plasmid and pYes2 ===
+
=== Preparative restriction digest and gel electrophoresis of the preprothaumatin plasmid and pTUM104 ===
'''Investigator:''' Maddin, Aloisius
'''Investigator:''' Maddin, Aloisius
-
'''Aim:''' Cloning of preprothaumatin on pYes2
+
'''Aim:''' Cloning of preprothaumatin on pTUM104
'''Operational sequence'''
'''Operational sequence'''
Line 13,097: Line 13,126:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue ===
+
=== Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in ''E. coli'' XL1-Blue ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment''': Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue.
+
'''Aim of the experiment''': Picking from the overnight transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in ''E. coli'' XL1-Blue.
'''Procedure:'''
'''Procedure:'''
Line 13,111: Line 13,140:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Reapeat of transformation of E. coli XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th ===
+
=== Reapeat of transformation of ''E. coli'' XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment''': Reapeat of transformation of E. coli XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th. The reason is that the freshly prepared competent cells are contaminated with a foreign plasmid.
+
'''Aim of the experiment''': Reapeat of transformation of ''E. coli'' XL1-Blue with ligation products of P71+P322, P71+P323, P206+P337 and P342+PCR66 from August, the 13th. The reason is that the freshly prepared competent cells are contaminated with a foreign plasmid.
'''Procedure:'''
'''Procedure:'''
Line 13,138: Line 13,167:
<div class="caffeine">
<div class="caffeine">
-
=== Analysis of plated XL1-blue chemo competent ''e.coli'' (untransformed) ===
+
=== Analysis of plated XL1-blue chemo competent ''E.coli'' (untransformed) ===
'''Investigator:''' Volker
'''Investigator:''' Volker
Line 13,157: Line 13,186:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pYES and pSB1C3.
+
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pTUM104 and pSB1C3.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 13,232: Line 13,261:
== '''Wednesday, August 15th''' ==
== '''Wednesday, August 15th''' ==
-
<div class="constitutive_promoter">
 
-
=== Sequencing of TEF1-T, TEF1-P, ADH1-P, ADH1-T (noch machen)===
 
-
'''Investigator''': Georg
+
 
-
</div>
+
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
+
 
 +
=== Miniprep of overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment:''' Miniprep of overnight culture of transformated E. coli XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
+
'''Aim of the experiment:''' Miniprep of overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
'''Procedure:'''
'''Procedure:'''
Line 13,444: Line 13,471:
<div class="limonene">
<div class="limonene">
-
===Transformation of E.coli XL1 blue with ligation products===
+
===Transformation of ''E.coli'' XL1 blue with ligation products===
Investigator: Andrea
Investigator: Andrea
Line 13,462: Line 13,489:
<div class="limonene">
<div class="limonene">
-
===repetition of analytical restriction digest of ligation products of 10.08. after miniprep===
+
===Repetition of analytical restriction digest of ligation products of 10.08. after miniprep===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pYES and pSB1C3.
+
'''Aim:''' Check ligation of PCR 42 and PCR43 (Citrus) & PCR 56, PCR 57 and PCR 58 (Lavendula) into pTUM104 and pSB1C3.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 13,507: Line 13,534:
<div class="limonene">
<div class="limonene">
 +
===Picking of colonies of transformation (August 3rd and August 8th)===
===Picking of colonies of transformation (August 3rd and August 8th)===
Line 13,527: Line 13,555:
'''Investigator:''' Katrin
'''Investigator:''' Katrin
-
'''Aim of the experiment:'''Picking transformed Saccharomyces cerevisae cells for protein expression in yeast (expression will be done on Thursday, August 16th)
+
'''Aim of the experiment:'''Picking transformed ''Saccharomyces cerevisiae'' cells for protein expression in yeast (expression will be done on Thursday, August 16th)
* Inocultion of overnight cultures: one clone from each plates with PAL+/-, CHS+/-, 4CL+/-, OMT1+/-, APT, GFP was picked,resuspended in 15 ml SCU medium with glucose and incubated at 30 °C overnight
* Inocultion of overnight cultures: one clone from each plates with PAL+/-, CHS+/-, 4CL+/-, OMT1+/-, APT, GFP was picked,resuspended in 15 ml SCU medium with glucose and incubated at 30 °C overnight
Line 13,565: Line 13,593:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Gelextraction of linear pYESII-Tum===
+
===Gelextraction of linear pTUM104===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 13,573: Line 13,601:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop===
+
===Nanodrop for measuring the concentration of P265,264===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 13,584: Line 13,612:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Ligation of pYESII-TUM===
+
 
 +
===Ligation of pTUM104===
'''Investigator''': Georg
'''Investigator''': Georg
Line 13,648: Line 13,677:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===ligation of TEF2-P (PCR59) and Cyc1-T P131 with P132===
+
===Ligation of TEF2-P (PCR59) and Cyc1-T P131 with P132===
'''Investigator''': Georg
'''Investigator''': Georg
Line 13,706: Line 13,735:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Analytic digestion and gelelectrophoresis of P362, P364 and P366 ===
=== Analytic digestion and gelelectrophoresis of P362, P364 and P366 ===
Line 14,075: Line 14,105:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of the 10&nbsp;h culture of transformated E. coli XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
+
=== Miniprep of the 10&nbsp;h culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment:''' Miniprep of the 10&nbsp;h culture of transformated E. coli XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
+
'''Aim of the experiment:''' Miniprep of the 10&nbsp;h culture of transformated ''E. coli'' XL1-Blue with with ligated P71+P292, P71+P293, P206+P337 and P342+PCR66.
'''Procedure:'''
'''Procedure:'''
Line 14,161: Line 14,191:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Picking from the transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in E. coli XL1-Blue from Tuesday, the 14th ===
+
=== Picking from the transformation of ligated P71+P322, P71+P323, P206+P337 and P342+PCR66 product in ''E. coli'' XL1-Blue from Tuesday, the 14th ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
Line 14,210: Line 14,240:
<div class="caffeine">
<div class="caffeine">
-
=== Restriction digest of p373 (pYES2 new MCS RFC25) ===
+
=== Restriction digest of p373 (pTUM104 new MCS RFC25) ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 14,216: Line 14,246:
'''Aim:'''  
'''Aim:'''  
-
Restriction digest of pYES2 new with Xba1 and Pst1-HF to be able to clone the caffeine genes into.  
+
Restriction digest of pTUM104 with Xba1 and Pst1-HF to be able to clone the caffeine genes into.  
'''Operational Sequence'''
'''Operational Sequence'''
Line 14,255: Line 14,285:
{| cellspacing="0" border="1"
{| cellspacing="0" border="1"
|DNA- Ladder
|DNA- Ladder
-
|pYES2newMCS_Xba1Pst1
+
|pTUM104_Xba1Pst1
|}
|}
Line 14,262: Line 14,292:
<div class="caffeine">
<div class="caffeine">
-
=== Picking of transformed ''e.coli-'' XL1-blue cells and preparation of liquid cultures ===
+
=== Picking of transformed ''E.coli-'' XL1-blue cells and preparation of liquid cultures ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 14,283: Line 14,313:
<div class="caffeine">
<div class="caffeine">
-
=== Gel extraction of p373 (=pYES2 new MCS RFC25) ===
+
=== Gel extraction of p373 (=pTUM104) ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 14,289: Line 14,319:
'''Aim:'''  
'''Aim:'''  
-
Extraction of Xba1 and Pst1 digested pYES2 new out of agarose gel, to make it ready for ligation
+
Extraction of Xba1 and Pst1 digested pTUM104 out of agarose gel, to make it ready for ligation
'''Operational sequence:'''
'''Operational sequence:'''
Line 14,303: Line 14,333:
<div class="limonene">
<div class="limonene">
 +
=== PCR of C-LS3 (BBa_I742111, Trafo 19.6) ===
=== PCR of C-LS3 (BBa_I742111, Trafo 19.6) ===
Line 14,486: Line 14,517:
<div class="limonene">
<div class="limonene">
-
===Miniprep of pYES clones picked on August 15th===
+
===Miniprep of pTUM104 clones picked on August 15th===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
Line 14,543: Line 14,574:
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Prepare digested PCR fragments for further ligation into pYES and pSB1C3.
+
'''Aim:''' Prepare digested PCR fragments for further ligation into pTUM104 and pSB1C3.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 14,609: Line 14,640:
<div class="thaumatin">
<div class="thaumatin">
-
===Preparative restriction digest of P343, P344, P345, P152 (pYES) and P286 (pSB1C3)===
+
===Preparative restriction digest of P343, P344, P345, P152 (pTUM104) and P286 (pSB1C3)===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
-
'''Aim:''' Prepare digested Preprothaumatin plasmids for further ligation into pYES and pSB1C3.
+
'''Aim:''' Prepare digested Preprothaumatin plasmids for further ligation into pTUM104 and pSB1C3.
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
Line 14,646: Line 14,677:
P187 was used as positive control for restriction digest (XbaI and AgeI).
P187 was used as positive control for restriction digest (XbaI and AgeI).
-
Before Gelelectrophoresis Dephosphorylation of vectors (pYES and pSB1C3) was done (see next part) !
+
Before Gelelectrophoresis Dephosphorylation of vectors (pTUM104 and pSB1C3) was done (see next part) !
'''Gelelectrophoresis:'''
'''Gelelectrophoresis:'''
Line 14,659: Line 14,690:
<div class="thaumatin">
<div class="thaumatin">
-
===Dephosphorylation of digested pSB1C3 and pYES (with XbaI and SpeI)===
+
===Dephosphorylation of digested pSB1C3 and pTUM104 (with XbaI and SpeI)===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
Line 14,899: Line 14,930:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of E.coli Xl1-Blue with ligation of TEF2-p, CYC1-t with psb1c3 and pYES2 selfligation ===
+
=== Transformation of ''E.coli'' Xl1-Blue with ligation of TEF2-p, CYC1-t with psb1c3 and pTUM104 selfligation ===
''' Investigator''': Georg
''' Investigator''': Georg
Line 15,049: Line 15,080:
<div class="limonene">
<div class="limonene">
-
===Ligation of PCR 42, 43, 56, 57 and 58 with pYES (p175) and pSB1C3 (p133)===
+
===Ligation of PCR 42, 43, 56, 57 and 58 with pTUM104 (p175) and pSB1C3 (p133)===
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pYES.
+
'''Aim:''' Ligate both lavendula and citrus limonene synthase (with all primer combinations -> with or without consensus sequence) with pSB1C3 and pTUM104.
'''Procedure'''
'''Procedure'''
Line 15,390: Line 15,421:
'''Investigator:''' Lara
'''Investigator:''' Lara
-
'''Aim:''' Transform E.coli XL 1 blue with ligation products (PCR42/p133, PCR42/p175, PCR43/p133, PCR43/p175, PCR56/p133, PCR56/p175, PCR57/p133, PCR57/p175, PCR58/p133, PCR58/p175)  to produce colonies containing plasmid DNA.
+
'''Aim:''' Transform ''E.coli'' XL 1 blue with ligation products (PCR42/p133, PCR42/p175, PCR43/p133, PCR43/p175, PCR56/p133, PCR56/p175, PCR57/p133, PCR57/p175, PCR58/p133, PCR58/p175)  to produce colonies containing plasmid DNA.
-
'''Transformation into E.coli Xl1-Blue'''
+
'''Transformation into ''E.coli'' Xl1-Blue'''
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
* thawing of 100 µl Ca-competent E.coli XL1-Blue cells on ice
Line 15,524: Line 15,555:
<div class="caffeine">
<div class="caffeine">
-
=== Ligation of genes envolved in caffeine synthesis into pYES2new and pSB1C3 ===
+
=== Ligation of genes envolved in caffeine synthesis into pTUM104 ===
'''Investigator:''' Roman
'''Investigator:''' Roman
-
'''Aim:''' Ligation of the genes, which are responsible for caffeine synthesis, into pYES2new (for further expression studies) and pSB1C3 (to create BioBricks).
+
'''Aim:''' Ligation of the genes, which are responsible for caffeine synthesis, into pTUM104 (for further expression studies) and pSB1C3 (to create BioBricks).
'''Operational Sequence:'''
'''Operational Sequence:'''
Line 15,540: Line 15,571:
|'''volume'''
|'''volume'''
|-
|-
-
|pYES2new
+
|pTUM104
|1,5 µl (ca. 120 ng)
|1,5 µl (ca. 120 ng)
|-
|-
Line 15,695: Line 15,726:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Miniprep of the overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR69 and P207+PCR70 ===
+
=== Miniprep of the overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P207+PCR69 and P207+PCR70 ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment:''' Miniprep of the overnight culture of transformated E. coli XL1-Blue with with ligated P207+PCR69 and P207+PCR70.
+
'''Aim of the experiment:''' Miniprep of the overnight culture of transformated ''E. coli'' XL1-Blue with with ligated P207+PCR69 and P207+PCR70.
'''Procedure:'''
'''Procedure:'''
Line 15,707: Line 15,738:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Analytical digestion and gelelectrophoresis of the minipreps of transformated ''E.&nbsp;coli'' XL1-Blue with ligation products of P207+PCR69 and P207+PCR70 ===
=== Analytical digestion and gelelectrophoresis of the minipreps of transformated ''E.&nbsp;coli'' XL1-Blue with ligation products of P207+PCR69 and P207+PCR70 ===
Line 15,806: Line 15,838:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
-
=== Picking Clones for Ingma and Roman ===
+
=== Picking Clones for Ingmar and Roman ===
'''Investigator:''' Volker
'''Investigator:''' Volker
Line 15,821: Line 15,853:
=Week 11=
=Week 11=
-
 
+
<!--
<p class="limonene">'''Limonene (21 Experiments):'''</p>
<p class="limonene">'''Limonene (21 Experiments):'''</p>
*  
*  
-
<p class="coumaryl">'''Coumaryl (7 Experiments):'''</p>
+
<p class="coumaryl">'''Xanthohumol (7 Experiments):'''</p>
*  
*  
Line 15,841: Line 15,873:
<html><a class="WDetails" href="#Week_11" id="Week_11">Show Details ...</a></html>
<html><a class="WDetails" href="#Week_11" id="Week_11">Show Details ...</a></html>
-
 
+
-->
<div class="week" id="WWeek_11">
<div class="week" id="WWeek_11">
== '''Monday, August 20th''' ==
== '''Monday, August 20th''' ==
Line 16,122: Line 16,154:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Ligation of pYES2 without f1-origin and Gal-promoter ===
+
=== Ligation of pTUM100 without f1-origin and Gal-promoter ===
*Reaction batch for pYes2 circulation:
*Reaction batch for pYes2 circulation:
Line 16,152: Line 16,184:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of E.coli Xl1-blue ===
+
 
 +
=== Transformation of ''E.coli'' Xl1-blue ===
To 100 µl competent cells of E. coli Xl1-blue 10 µl of the pYes II Ligation reaction were added.  
To 100 µl competent cells of E. coli Xl1-blue 10 µl of the pYes II Ligation reaction were added.  
Line 16,171: Line 16,204:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Picking colonies of E.coli Xl1-blue, transforemed with Tef2-p + psb1c3 and  Cyc-t + psb1c3 ===
+
=== Picking colonies of ''E.coli'' Xl1-blue, transforemed with Tef2-p + psb1c3 and  Cyc-t + psb1c3 ===
15 colonies from Tef2-p and 6 from Cyc-t were picked and transferred into LB-medium with 1x Chloramphenicole.
15 colonies from Tef2-p and 6 from Cyc-t were picked and transferred into LB-medium with 1x Chloramphenicole.
Line 16,179: Line 16,212:
<div class="limonene">
<div class="limonene">
-
=== Colony PCR===
+
=== Colony PCR of PCR43/p175 and PCR58/p133===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 16,293: Line 16,326:
<div class="limonene">
<div class="limonene">
-
=== Miniprep ===
+
=== Miniprep of PCR58/p133 ===
'''Investigator:''' Dennis
'''Investigator:''' Dennis
Line 16,308: Line 16,341:
<div class="limonene">
<div class="limonene">
-
=== Miniprep ===
+
=== Miniprep of PCR58/p133 ===
'''Investigator:''' Saskia
'''Investigator:''' Saskia
Line 16,349: Line 16,382:
<div class="thaumatin">
<div class="thaumatin">
-
===Ligation of insert and pYes===
+
===Ligation of insert and pTUM104===
Investigator: Martin y Aloís
Investigator: Martin y Aloís
Line 16,366: Line 16,399:
<div class="caffeine">
<div class="caffeine">
-
=== Transformation of over-weekend ligation of caffeine synthesis genes in pSB1C3 and pYES2new ===
+
=== Transformation of over-weekend ligation of caffeine synthesis genes in pSB1C3 and pTUM104 ===
'''Investigator:''' Saskia
'''Investigator:''' Saskia
Line 16,374: Line 16,407:
'''Operational Sequence'''
'''Operational Sequence'''
-
The transformation procedure was carried out as previously described, whereas the entire ligation batch was used for transformation in XL1 blue chemo competent ''e.coli-''cells. The 30 minutes on ice incubation was followed by the heat shock at 37°C for 5 minutes and an incubation at 180 rpm at 37°C for about 45 minutes. Afterwords, the suspension was plated on appropriate plates (pSB1C3 transformants with chloramphenicol, pYES2new transformants with ampicillin) and incubated at 37°C over night. Besides, the pellet was also plated out (resuspension in about ca. 100 µl LB medium).
+
The transformation procedure was carried out as previously described, whereas the entire ligation batch was used for transformation in XL1 blue chemo competent ''e.coli-''cells. The 30 minutes on ice incubation was followed by the heat shock at 37°C for 5 minutes and an incubation at 180 rpm at 37°C for about 45 minutes. Afterwords, the suspension was plated on appropriate plates (pSB1C3 transformants with chloramphenicol, pTUM104 transformants with ampicillin) and incubated at 37°C over night. Besides, the pellet was also plated out (resuspension in about ca. 100 µl LB medium).
'''Note:''' This transformation was performed without knowing, that a transformation with 5 µl of every ligation batch was already done on saturday. Furthermore, clone picking and preparing of over night liquid cultures was made, too (on sunday).
'''Note:''' This transformation was performed without knowing, that a transformation with 5 µl of every ligation batch was already done on saturday. Furthermore, clone picking and preparing of over night liquid cultures was made, too (on sunday).
Line 16,382: Line 16,415:
<div class ="caffeine">
<div class ="caffeine">
-
=== Miniprep of picked clones of possible positive pSB1C3_Caffeine_involved_gene and pYES2new_caffeine_involved_gene transformants ===
+
=== Miniprep of picked clones of possible positive pSB1C3_Caffeine_involved_gene and pTUM104_caffeine_involved_gene transformants ===
'''Investigator:''' Roman, Saskia
'''Investigator:''' Roman, Saskia
Line 16,388: Line 16,421:
'''Aim:'''  
'''Aim:'''  
-
Isolation of plasmids pSB1C3 and pYES2, to check for uptaken inserts by an analytical restriction digest.
+
Isolation of plasmids pSB1C3 and pTUM104, to check for uptaken inserts by an analytical restriction digest.
'''Operational sequence:'''
'''Operational sequence:'''
Line 16,440: Line 16,473:
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
-
|'''pYES2new_caffeine_involved_gene'''
+
|'''pTUM104_caffeine_involved_gene'''
|'''Concentration in ng/µl'''
|'''Concentration in ng/µl'''
|-
|-
Line 16,484: Line 16,517:
<div class ="caffeine">
<div class ="caffeine">
-
=== Analytical digest of pSB1C3_Caffeine_involved_gene and pYES2new_caffeine_involved_gene plasmids ===
+
=== Analytical digest of pSB1C3_Caffeine_involved_gene and pTUM104_caffeine_involved_gene plasmids ===
'''Investigator:''' Saskia
'''Investigator:''' Saskia
Line 16,490: Line 16,523:
'''Aim:'''  
'''Aim:'''  
-
Analytical digest of B1A-D, B2A-D, B3A-D, Y1A-D, Y2A-D, Y3A-D with PstI ans XbaI to controll the ligation of the inserts in pSB1C3 and pYES2new.
+
Analytical digest of B1A-D, B2A-D, B3A-D, Y1A-D, Y2A-D, Y3A-D with PstI ans XbaI to controll the ligation of the inserts in pSB1C3 and pTUM104.
'''Procedure:'''
'''Procedure:'''
Line 16,612: Line 16,645:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of overnight ligation with P265B (pYes-TUM)===
+
=== Transformation of overnight ligation with P265B (pTUM100)===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 16,637: Line 16,670:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
 +
=== Preparative digestion of P451 (TEF2-P in psb1c3) with SpeI-HF and PstI-HF===
=== Preparative digestion of P451 (TEF2-P in psb1c3) with SpeI-HF and PstI-HF===
'''Investigator''':Georg, Dennis
'''Investigator''':Georg, Dennis
Line 16,734: Line 16,768:
<div class="limonene">
<div class="limonene">
-
===Colony PCR===
+
===Colony PCR of PCR42/p133 and PCR56/p133===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 16,745: Line 16,779:
* '''Lavendula''': 5 clones of PCR56/p133 (trafo 17.8.) and PCR56/p175 (transformation of August 17th) were picked.
* '''Lavendula''': 5 clones of PCR56/p133 (trafo 17.8.) and PCR56/p175 (transformation of August 17th) were picked.
* positive control: plasmid DNA of PCR2/p133 clone 4 as positive control
* positive control: plasmid DNA of PCR2/p133 clone 4 as positive control
-
* negative controls: 1. clone containing pSB1C3 with proteinlinker (Jeff); 2. ddH2O; 3. clone containing pYES (P50, no insert)
+
* negative controls: 1. clone containing pSB1C3 with proteinlinker (Jeff); 2. ddH2O; 3. clone containing pTUM104 (P50, no insert)
'''Citrus in pSB1C3''' (PCR42/p133)
'''Citrus in pSB1C3''' (PCR42/p133)
Line 17,136: Line 17,170:
<div class="coumaryl">
<div class="coumaryl">
-
===Miniprep of 4CL in psB1C3 and pYES after Quick Change from August 17th===
+
===Miniprep of 4CL in psB1C3 and pTUM104 after Quick Change from August 17th===
'''Investigator: Saskia, Daniela'''
'''Investigator: Saskia, Daniela'''
Line 17,142: Line 17,176:
Overnight culutres were grown too long. To obtain bacteria with plasmids we exchanged the media and let them grow for another 6 hours. A Miniprep was done afterwards.
Overnight culutres were grown too long. To obtain bacteria with plasmids we exchanged the media and let them grow for another 6 hours. A Miniprep was done afterwards.
-
Using a Quiagen Miniprep kit, a plasmid isolation of three picked clones of a APT in pYes2 RFC25 ligation was done.  
+
Using a Quiagen Miniprep kit, a plasmid isolation of three picked clones of a APT in pTUM104 RFC25 ligation was done.  
The resulting plamid-concentrations (measured with nanodrop) were:
The resulting plamid-concentrations (measured with nanodrop) were:
Line 17,181: Line 17,215:
<div class ="caffeine">
<div class ="caffeine">
-
=== Analytical DNA-gelelectrophoresis of pSB1C3_Caffeine_involved_gene and pYES2new_caffeine_involved_gene plasmids after digestion with PstI and XbaI===
+
=== Analytical DNA-gelelectrophoresis of pSB1C3_Caffeine_involved_gene and pTUM104_caffeine_involved_gene plasmids after digestion with PstI and XbaI===
'''Investigator:''' Roman, Saskia
'''Investigator:''' Roman, Saskia
Line 17,187: Line 17,221:
'''Aim:'''  
'''Aim:'''  
-
Analytical DNA-gelelectrophoresis of B1A-D, B2A-D, B3A-D, Y1A-D, Y2A-D, Y3A-D with PstI ans XbaI to controll the ligation of the inserts in pSB1C3 and pYES2new.
+
Analytical DNA-gelelectrophoresis of B1A-D, B2A-D, B3A-D, Y1A-D, Y2A-D, Y3A-D with PstI ans XbaI to controll the ligation of the inserts in pSB1C3 and pTUM104.
'''Procedure:'''
'''Procedure:'''
Line 17,218: Line 17,252:
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
|1 kp ladder DNA ladder
|1 kp ladder DNA ladder
-
|'''B1D'''
+
|'''B3D'''
|'''Y1A'''
|'''Y1A'''
|'''Y1B'''
|'''Y1B'''
Line 17,249: Line 17,283:
<div class ="caffeine">
<div class ="caffeine">
-
=== Preparation for transformation of pYESnew with caffeine genes in yeast===
+
=== Preparation for transformation of pTUM104 with caffeine genes in yeast===
'''Investigator:''' Saskia
'''Investigator:''' Saskia
Line 17,255: Line 17,289:
'''Aim:'''  
'''Aim:'''  
-
Transformation of ''S. cerevisiae'' INVSc1 with pYESnew with CaXMT1, CaMXMT1 and CaDXMT1.
+
Transformation of ''S. cerevisiae'' INVSc1 with pTUM104 with CaXMT1, CaMXMT1 and CaDXMT1.
'''Procedure:'''
'''Procedure:'''
-
production of YPD medium as described in the pYES manual
+
production of YPD medium as described in the pYES2 manual
Incubation of ''S. cerevisiae'' INVSc1 in 4 ml YPD as described in the pYES manual
Incubation of ''S. cerevisiae'' INVSc1 in 4 ml YPD as described in the pYES manual
Line 17,267: Line 17,301:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Minipreparation of pYes2_Preprothaumatin_RFC10 and pSB1C3_Preprothaumatin_RFC10===
+
=== Minipreparation of pTUM104_Preprothaumatin_RFC10 and pSB1C3_Preprothaumatin_RFC10===
'''Investigator:''' Martianus Capella, Albertus Magnus
'''Investigator:''' Martianus Capella, Albertus Magnus
Line 17,500: Line 17,534:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop measurement===
+
===Nanodrop measurement of ADH1-P===
''' Investigator''': Georg
''' Investigator''': Georg
Line 17,511: Line 17,545:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Preparative gel of TEF1-P (P309), TEF2-P (P451) in psb1c3 and pYESII without GAL-P and f1===
+
 
 +
===Preparative gel of TEF1-P (P309), TEF2-P (P451) in psb1c3 and pTUM104 without GAL-P and f1 (pTUM100)===
* Preparative digests were loaded onto 1% preparative agarose gels
* Preparative digests were loaded onto 1% preparative agarose gels
Line 17,550: Line 17,585:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Preparative Digestion of P375 (pYesII)===
+
===Preparative Digestion of P375 (pTUM104)===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 17,582: Line 17,617:
|}
|}
-
* pYes was first digested with SwaI and BSA at room temperature. Afterwards PvuII was added and digested for another 3 hours at 37°C
+
* pTUM104 was first digested with SwaI and BSA at room temperature. Afterwards PvuII was added and digested for another 3 hours at 37°C
</div>
</div>
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Control digest of pYes2_Preprothaumatin and pSB1C3_Preprothaumatin===
+
=== Control digest of pTUM104_Preprothaumatin and pSB1C3_Preprothaumatin===
'''Investigator:''' Cicero, Platon
'''Investigator:''' Cicero, Platon
Line 17,612: Line 17,647:
<div class="caffeine">
<div class="caffeine">
-
=== Small scale yeast transformation with pYES2new_CaXMT1, pYES2new_CaMXMT1 and pYES2new_CaDXMT1 ===
+
=== Small scale yeast transformation with pTUM104_CaXMT1, pTUM104_CaMXMT1 and pTUM104_CaDXMT1 ===
'''Investigator:''' Saskia, Roman
'''Investigator:''' Saskia, Roman
-
'''Aim:''' To transform our yeast strain ''saccharomyces cerevisiae'' INVSC1 -URA with the created pYES2new plasmids, to be able to start expression of our genes.
+
'''Aim:''' To transform our yeast strain ''saccharomyces cerevisiae'' INVSC1 -URA with the created pTUM104 plasmids, to be able to start expression of our genes.
'''Operational sequence:'''
'''Operational sequence:'''
Line 17,622: Line 17,657:
* The transformation of the yeast cells was performed as described in the pYES2 Manual of Invitrogen (small scale  yeast transformation).  
* The transformation of the yeast cells was performed as described in the pYES2 Manual of Invitrogen (small scale  yeast transformation).  
-
* Used plasmids pYES2_RFC25_Insert were previously isolated out of clones: Y1B, Y2D, Y3A
+
* Used plasmids pTUM104_Insert were previously isolated out of clones: Y1B, Y2D, Y3A
-
* As positive control, we used a pYES2_eGFP plasmid (provided by Simon) and as negative control, no plasmid (water) was "transformed".
+
* As positive control, we used a pTUM104_eGFP plasmid (provided by Simon) and as negative control, no plasmid (water) was "transformed".
* 1xTE and 1xLiAc/40%PEG-3350/1xTE solution were created immediately before use and sterilized by steril- filtration. The other solutions had already been available (and had also been sterilized by steril- filtration).
* 1xTE and 1xLiAc/40%PEG-3350/1xTE solution were created immediately before use and sterilized by steril- filtration. The other solutions had already been available (and had also been sterilized by steril- filtration).
-
* The resuspended pellets were plated on adequate selective SC -URA plates (minimal, defined medium for yeast, without uracil, due to selection for pYES2new vector).
+
* The resuspended pellets were plated on adequate selective SC -URA plates (minimal, defined medium for yeast, without uracil, due to selection for pTUM104 vector).
* Plates were incubated at 30°C over night
* Plates were incubated at 30°C over night
Line 17,683: Line 17,718:
<div class="coumaryl">
<div class="coumaryl">
-
===Control digest of 4CL in pYES and pSB1C3-RFC25 after Quick Change from August 17th===
+
===Control digest of 4CL in pTUM104 and pSB1C3-RFC25 after Quick Change from August 17th===
Investigator: Daniela
Investigator: Daniela
Line 17,832: Line 17,867:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Preparative digest of pSB1C3_Preprothaumatin (p456) and ligation with p400 (pYes2 digested with XbaI and PstI)===
+
=== Preparative digest of pSB1C3_Preprothaumatin (p456) and ligation with p400 (pTUM104 digested with XbaI and PstI)===
'''Investigator:''' Martin, Dennis, Alois
'''Investigator:''' Martin, Dennis, Alois
Line 17,879: Line 17,914:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Gelextraction ===
+
=== Gelextraction of preparative digested TEF1-P, TEF2-P in psb1c3, and digested pTUM104===
'''Investigator''': Georg
'''Investigator''': Georg
Line 17,890: Line 17,925:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Nanodrop Measurement===
+
=== Nanodrop Measurement of TEF1-P and TEF2-P===
'''Investigator''': Georg
'''Investigator''': Georg
Line 17,900: Line 17,935:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Self-ligation (self-circularization) of pYESII-TUM ===
+
 
 +
=== Self-ligation (self-circularization) of pTUM100 ===
''' Aim of the experiment:''' Ligation of pYESII-TUM for transformation in E.coli XL1-blue
''' Aim of the experiment:''' Ligation of pYESII-TUM for transformation in E.coli XL1-blue
Line 17,960: Line 17,996:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
 +
===Preparative digestion of ADH1-P (720 bp)in psb1c3 with SpeI and PSTI===
===Preparative digestion of ADH1-P (720 bp)in psb1c3 with SpeI and PSTI===
Line 18,001: Line 18,038:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Transformation EYFP (Dist. Kit) ECFP (Distr. Kit), Lig. pYesII 1h, 50ng and 100 ng of E.coli Xl-1 blue===
+
===Transformation EYFP (Dist. Kit) ECFP (Distr. Kit), Lig. pTUM100 1h, 50ng and 100 ng of E.coli Xl-1 blue===
'''Investigator''': Georg
'''Investigator''': Georg
Line 18,027: Line 18,064:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
===Transformation of E.coli Xl1-blue competent cells with ligation batches at room temperature===
===Transformation of E.coli Xl1-blue competent cells with ligation batches at room temperature===
Line 18,305: Line 18,343:
<div class="limonene">
<div class="limonene">
-
===Preparative restriction digest of PCR58 / P133 Klon20 (lavendula LS in pSB1C3, Miniprep 21rst August) and PCR2 / P133 Klon4 (citrus LS in pSB1C3, Miniprep 8th August) and P373 (pYES2)===
+
===Preparative restriction digest of PCR58 / P133 Klon20 (lavendula LS in pSB1C3, Miniprep 21rst August) and PCR2 / P133 Klon4 (citrus LS in pSB1C3, Miniprep 8th August) and P373 (pTUM104)===
'''Investigator:''' Lara (digest), Andrea (gel electrophoresis)
'''Investigator:''' Lara (digest), Andrea (gel electrophoresis)
Line 18,403: Line 18,441:
<div class="limonene">
<div class="limonene">
-
===ligation of PCR2/P133 (Miniprep 08.08.) and PCR58/133 (Miniprep 21.08.) in pYES2 (P375)===
+
===Ligation of PCR2/P133 (Miniprep 08.08.) and PCR58/133 (Miniprep 21.08.) in pTUM104 (P375)===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
Line 18,551: Line 18,589:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Transformation of pYes2_Preprothaumatin and inoculation===
+
=== Transformation of pTUM104_Preprothaumatin and inoculation===
'''Investigator:''' Martin, Alois
'''Investigator:''' Martin, Alois
Line 18,573: Line 18,611:
<div class="limonene">
<div class="limonene">
-
===Colony PCR===
+
===Colony PCR of PCR43/p175 and PCR57/p133===
'''Investigator:''' Lara
'''Investigator:''' Lara
Line 18,775: Line 18,813:
<div class ="caffeine">
<div class ="caffeine">
-
=== Sequencing of plasmids pSB1C3_Insert and pYES2_RFC25_Insert ===
+
=== Sequencing of plasmids pSB1C3_Insert and pTUM104_Insert ===
'''Investigator:''' Roman, Saskia
'''Investigator:''' Roman, Saskia
Line 18,786: Line 18,824:
* pSB1C3_CaDXMT1 (clone B3D): sequence ok
* pSB1C3_CaDXMT1 (clone B3D): sequence ok
-
* pYES2_RFC25_CaXMT1 (clone Y1B): sequencing failed
+
* pTUM104CaXMT1 (clone Y1B): sequencing failed
-
* pYES2_RFC25_CaMXMT1 (clone Y2D): sequencing failed
+
* pTUM104_CaMXMT1 (clone Y2D): sequencing failed
-
* pYES2_RFC25_CaDXMT1 (clone Y3A): sequencing failed
+
* pTUM104_CaDXMT1 (clone Y3A): sequencing failed
-
Note: Sequencing of pYES2- plasmids will be repeated next week with newly picked clones. Sequencing results of all three pSB1C3 plasmids (containing inserts) were positive.
+
Note: Sequencing of pTUM104 plasmids will be repeated next week with newly picked clones. Sequencing results of all three pSB1C3 plasmids (containing inserts) were positive.
</div>
</div>
Line 18,846: Line 18,884:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Nanodrop===
+
=== Nanodrop for concentration measuring of ADH1-P, P434, P299, P432===
'''Investigator''':Georg
'''Investigator''':Georg
Line 18,857: Line 18,895:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Picking of colonies of pYESII-Tum, GFP and ADH1-P (720 bp)===
+
 
 +
===Picking of colonies of pTUM104, GFP and ADH1-P (720 bp)===
'''Investigator''': Georg
'''Investigator''': Georg
Line 19,092: Line 19,131:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Minipreparation of pSB1C3_Preprothaumatin and pYes2_Preprothaumatin ===
+
=== Minipreparation of pSB1C3_Preprothaumatin and pTUM104_Preprothaumatin ===
'''Investigator:''' Martin, Alois
'''Investigator:''' Martin, Alois
Line 19,104: Line 19,143:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Control digest of pYes2_Preprothaumatin ===
+
=== Control digest of pTUM104_Preprothaumatin ===
'''Investigator:''' Martin, Alois
'''Investigator:''' Martin, Alois
Line 19,126: Line 19,165:
<div class ="thaumatin">
<div class ="thaumatin">
-
=== Small scale yeast transformation of ''S. cerevisiae'' with pYes2_Preprothaumatin ===
+
=== Small scale yeast transformation of ''S. cerevisiae'' with pTUM104_Preprothaumatin ===
'''Investigator:''' Martin, Alois
'''Investigator:''' Martin, Alois
Line 19,399: Line 19,438:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Miniprep ===
+
=== Miniprep pTUM100, GFP and ADH1-P (720 bp) ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
-
'''Aim of the experiment:''' Miniprep of ???
+
'''Aim of the experiment:''' Miniprep of pTUM100, GFP and ADH1-P (720 bp)
'''Procedure:'''
'''Procedure:'''
Line 19,511: Line 19,550:
'''Aim:'''  
'''Aim:'''  
-
Preparation of pYESnew Y1B, Y2D and Y3A for sequencing.
+
Preparation of pTUM104 Y1B, Y2D and Y3A for sequencing.
'''Plasmidconcentration:''' Nanodroplet
'''Plasmidconcentration:''' Nanodroplet
{|cellspacing="0" border="1"
{|cellspacing="0" border="1"
-
|'''pYES2new_caffeine_involved_gene'''
+
|'''pTUM104_caffeine_involved_gene'''
|'''Concentration in ng/µl'''
|'''Concentration in ng/µl'''
|-
|-
Line 19,533: Line 19,572:
<div class="limonene">
<div class="limonene">
-
===Picking of colonies ===
+
===Picking of colonies of PCR2 pTUM104 and PCR58 pTUM104 and of PCR1 pTUM104 and PCR56 pSBC3 ===
'''Investigator:''' Saskia
'''Investigator:''' Saskia
'''Procedure:'''  
'''Procedure:'''  
-
* Picking of 5 clones each of PCR2 pYES and PCR58 pYES and picking of 2 clone each of PCR1 pYES and PCR56 pSBC3
+
* Picking of 5 clones each of PCR2 pTUM104 and PCR58 pTUM104 and picking of 2 clone each of PCR1 pTUM104 and PCR56 pSBC3
* Inbucation at 37°C (shaker) over night.
* Inbucation at 37°C (shaker) over night.
Line 19,544: Line 19,583:
<div class="coumaryl">
<div class="coumaryl">
 +
===Analytical restriction digest and analytical gel electrophoresis===
===Analytical restriction digest and analytical gel electrophoresis===
'''Investigator:''' Saskia and Katrin
'''Investigator:''' Saskia and Katrin
Line 19,920: Line 19,960:
== '''Tuesday, August 28th''' ==
== '''Tuesday, August 28th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Analytical gelelectrophoresis of pYES2-TUM undigested===
+
===Analytical gelelectrophoresis of pTUM100 undigested===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 19,927: Line 19,967:
* pYES2 served as control plasmid
* pYES2 served as control plasmid
* colonies 1-4 and 6-10 showed positive pYES-TUM2 variants
* colonies 1-4 and 6-10 showed positive pYES-TUM2 variants
 +
[[File:20120828 pYES2-TUM Kol ungeschnitten (Gel1).png]]
 +
[[File:20120828 pYes2-Tum Kol.png]]
</div>
</div>
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Analytical digestion of pYES2-TUM===
+
 
 +
=== Analytical digestion of pTUM100===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 19,957: Line 20,000:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Analytical gelelectrophoresis of pYES2-TUM===
+
 
 +
=== Analytical gelelectrophoresis of pTUM100===
'''Investigator:'''
'''Investigator:'''
Line 19,963: Line 20,007:
* Digested pYES2-Tum clones were analyzed on 0,5% Agarose gels
* Digested pYES2-Tum clones were analyzed on 0,5% Agarose gels
* Clones 1-4 and 6-10 were positive
* Clones 1-4 and 6-10 were positive
 +
[[File:20120829 Anal.png]]
 +
[[File:20120829 Gel 2 pYES2-tum.png]]
</div>
</div>
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop===
+
 
 +
===Nanodrop for concentration measuring of ADH-P,pTUM100,GFP===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 19,989: Line 20,036:
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Cycled ligation of P399+P552 ===
=== Cycled ligation of P399+P552 ===
Line 20,040: Line 20,088:
<div class="limonene">
<div class="limonene">
-
===Ligation of PCR57 in pYES and pSB1C3, of PCR 42 in pSB1C3, of PCR 56 in pYES===
+
===Ligation of PCR57 in pTUM104 and pSB1C3, of PCR 42 in pSB1C3, of PCR 56 in pTUM104===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
Line 20,139: Line 20,187:
<div class="limonene">
<div class="limonene">
-
===Transformation into E.coli (ligation 28.8.)===
+
===Transformation into ''E.coli'' (ligation 28.8.)===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
Line 20,326: Line 20,374:
<div class="caffeine">
<div class="caffeine">
-
=== Plasmid isolation of pYES2_RFC25_Insert containing over night cultures ===
+
=== Plasmid isolation of pTUM104_Insert containing over night cultures ===
'''Investigator:''' Roman
'''Investigator:''' Roman
'''Aim of the experiment:'''  
'''Aim of the experiment:'''  
-
Isolation of plasmids pYES2_RFC25_CaXMT1, pYES2_RFC25_CaMXMT1 and pYES2_RFC25_CaDXMT1 to be able to repeat yeast transformation
+
Isolation of plasmids pTUM104_CaXMT1, pTUM104_CaMXMT1 and pTUM104_CaDXMT1 to be able to repeat yeast transformation
'''Operational sequence:'''
'''Operational sequence:'''
Line 20,355: Line 20,403:
<div class="caffeine">
<div class="caffeine">
-
=== Control digest of isolated pYES2_Insert plasmids with Xba1 and Pst1-HF ===
+
=== Control digest of isolated pTUM104_Insert plasmids with Xba1 and Pst1-HF ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 20,440: Line 20,488:
'''Aim of the experiment:'''
'''Aim of the experiment:'''
-
Transformation of yeast cells (INVSCN1) with the plasmids pYES2_RFC25_CaXMT1, pYES2_RFC25_CaMXMT1 and pYES2_RFC25_CaDXMT1, as well as pYES2_RFC25_eGFP (positive controll).
+
Transformation of yeast cells (INVSCN1) with the plasmids pTUM104_CaXMT1, pTUM104_CaMXMT1 and pTUM104_CaDXMT1, as well as pTUM104_eGFP (positive controll).
'''Operational sequence:'''
'''Operational sequence:'''
Line 20,505: Line 20,553:
'''Operational sequence:'''
'''Operational sequence:'''
-
To express the gene products, a single yeast colonie (transformation was performed on last wednesday) of each plate was used for inoculation of 15ml  SC -URA 2% glucose medium. However, there was no colony of a pYES2_RFC25_CaDXMT1 transformant (repetition of transformation is already in progress). Incubation was performed at 30°C over night and 180 rpm.
+
To express the gene products, a single yeast colonie (transformation was performed on last wednesday) of each plate was used for inoculation of 15ml  SC -URA 2% glucose medium. However, there was no colony of a pTUM104_CaDXMT1 transformant (repetition of transformation is already in progress). Incubation was performed at 30°C over night and 180 rpm.
</div>
</div>
Line 20,551: Line 20,599:
* To 20 µl reaction batch 20 µl of plasmid with insert were added
* To 20 µl reaction batch 20 µl of plasmid with insert were added
* Digestion was performed at 37C for 3 hours
* Digestion was performed at 37C for 3 hours
 +
[[File:20120829 Präp. Verdau ADH1-P (720bp), Limonensyn.png]]
</div>
</div>
<div class="constitutive_promoter">
<div class="constitutive_promoter">
 +
=== Ligation of TEF2-P in psb1c3 with Thaumatin P467 ===
=== Ligation of TEF2-P in psb1c3 with Thaumatin P467 ===
Line 20,743: Line 20,793:
* Ligation was performed for 1h at room temperature
* Ligation was performed for 1h at room temperature
-
</div>
 
-
 
-
<div class="constitutive_promoter">
 
-
=== Preparative gelrun of preparative digested ADH-P, Limonensynthase, GFP ===
 
-
 
-
'''Investigator:''' Georg
 
-
'''Procedure:'''
 
-
 
-
*Preparative gel was run at 70 V for 3h
 
-
 
</div>
</div>
Line 20,764: Line 20,804:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Transformation of E.coli Xl1-blue with ligation batch (1h) psb1c3 with Thaumatin, Cyc1-T, TEF1-T and Thaumatin with P492,P493 and P494 ===
+
 
 +
=== Transformation of ''E.coli'' Xl1-blue with ligation batch (1h) psb1c3 with Thaumatin, Cyc1-T, TEF1-T and Thaumatin with P492,P493 and P494 ===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 21,093: Line 21,134:
<div class ="caffeine">
<div class ="caffeine">
-
=== Sequencing of newly prepared pYES2_RFC25_Insert plasmids (clones: Y1G, Y2G, Y3G) ===
+
=== Sequencing of newly prepared pTUM104_RFC25_Insert plasmids (clones: Y1G, Y2G, Y3G) ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 21,101: Line 21,142:
'''Results:'''  
'''Results:'''  
-
''Coming Up''
+
* pTUM104_CaXMT1 with T7 primer
 +
GCCGCTTCTAGAGTACACAATGTCTTTACAAGAAGTCTTGAGAATGAACGGTGGTGAAGGTGATACTTCTTACGCTAAAA
 +
ACTCCGCCTACAATCAATTGGTTTTGGCTAAAGTTAAGCCAGTCTTGGAACAATGCGTCAGAGAATTATTGAGAGCTAAC
 +
TTGCCAAACATCAACAAGTGCATTAAGGTTGCTGATTTGGGTTGTGCTTCTGGTCCAAATACTTTGTTGACTGTTAGAGA
 +
CATCGTCCAATCCATTGATAAGGTTGGTCAAGAAAAGAAGAACGAATTGGAAAGACCAACCATCCAAATTTTCTTGAACG
 +
ACTTGTTCCCAAACGACTTCAACTCTGTTTTTAAGTTGTTGCCATCCTTCTACAGAAAGTTGGAAAAAGAAAACGGTAGA
 +
AAGATCGGTTCCTGTTTGATTGGTGCTATGCCAGGTTCTTTCTACTCCAGATTATTTCCTGAAGAATCCATGCATTTCTT
 +
GCACTCTTGTTATTGCTTGCAATGGTTGTCTCAAGTTCCATCTGGTTTGGTTACTGAATTGGGTATTTCTACCAACAAGG
 +
GTTCCATCTACTCTTCTAAAGCTTCAAGATTGCCAGTTCAAAAGGCCTACTTGGATCAATTCACTAAGGATTTCACCACC
 +
TTTTTGAGAATCCACTCCGAAGAATTATTCTCCCACGGTAGAATGTTGTTGACCTGTATATGTAAGGGTGTTGAATTGGA
 +
TGCTAGAAACGCCATTGATTTGTTGGAAATGGCTATCAACGATTTGGTTGTTGAAGGTCACTTAGAAGAAGAAAAGTTGG
 +
ACTCTTTCAACTTGCCAGTTTACATTCCATCTGCCGAAGAAGTTAAGTGCATCGTTGAAGAAGAAGGTTCCTTCGAAATC
 +
TTGTACTTGGAAACTTTCAAGGTCTTGTACGATGCCGGTTTCTCTATTGATGATGAACATATTAAGGCCGAATACGTTGC
 +
CTCTTCTGTTAGAGCTGTTTACGAACCTATTTTGGCTTCTCATTTCGGTGAAGCC
 +
* pTUM104_CaXMT1 with reversed primer
 +
GCGTGATGTAGCGTGACATAACTAATTACATGATGCGGCCCTCTAGTCTGCAGCGGCCGCTACTAGTATCATCACTTTTC
 +
GAATTGTGGATGTGACCAAGCAGAAACATCAGACTTTTCTGGCTTTTTGGCCAAGGAGATGATCAAGTTGTTGTAAAAAC
 +
CTTTACCCAATGGCAAAACCTTAGCAGCGTGCTTAGCAAATCTATGAAAGATATCTGGGATAATGGCTTCACCGAAATGA
 +
GAAGCCAAAATAGGTTCGTAAACAGCTCTAACAGAAGAGGCAACGTATTCGGCCTTAATATGTTCATCATCAATAGAGAA
 +
ACCGGCATCGTACAAGACCTTGAAAGTTTCCAAGTACAAGATTTCGAAGGAACCTTCTTCTTCAACGATGCACTTAACTT
 +
CTTCGGCAGATGGAATGTAAACTGGCAAGTTGAAAGAGTCCAACTTTTCTTCTTCTAAGTGACCTTCAACAACCAAATCG
 +
TTGATAGCCATTTCCAACAAATCAATGGCGTTTCTAGCATCCAATTCAACACCCTTACATATACAGGTCAACAACATTCT
 +
ACCGTGGGAGAATAATTCTTCGGAGTGGATTCTCAAAAAGGTGGTGAAATCCTTAGTGAATTGATCCAAGTAGGCCTTTT
 +
GAACTGGCAATCTTGAAGCTTTAGAAGAGTAGATGGAACCCTTGTTGGTAGAAATACCCAATTCAGTAACCAAACCAGAT
 +
GGAACTTGAGACAACCATTGCAAGCAATAACAAGAGTGCAAGAAATGCATGGATTCTTCAGGAAATAATCTGGAGTAGAA
 +
AGAACCTGGCATAGCACCAATCAAACAGGAACCGATCTTTCTACCGTTTTCTTTTTCCAACTTTCTGTAGAAGAT
 +
 +
* pTUM104_CaMXMT1 with T7 primer
 +
GCGCTTCTAGAGTACACAATGTCTTTACAAGAAGTCTTGCACATGAACGAAGGTGAAGGTGATACTTCTTACGCTAAGAA
 +
TGCTTCTTACAACTTGGCTTTGGCTAAGGTTAAGCCATTCTTGGAACAATGCATCAGAGAATTATTGAGAGCCAACTTGC
 +
CAAACATCAACAAGTGTATTAAGGTTGCTGATTTGGGTTGTGCTTCTGGTCCAAATACTTTGTTGACTGTTAGAGACATC
 +
GTCCAATCCATTGATAAGGTTGGTCAAGAAGAAAAGAACGAATTGGAAAGACCAACCATCCAAATTTTCTTGAACGACTT
 +
GTTCCAAAACGACTTCAACTCCGTTTTTAAGTTGTTGCCATCCTTCTACAGAAAGTTGGAAAAAGAAAACGGTAGAAAGA
 +
TCGGTTCCTGCTTGATTTCTGCTATGCCAGGTTCTTTTTACGGTAGATTATTCCCTGAAGAATCCATGCATTTCTTGCAC
 +
TCTTGTTACTCTGTTCACTGGTTGTCTCAAGTTCCATCTGGTTTGGTTATTGAATTGGGTATTGGTGCTAACAAGGGTTC
 +
CATCTATTCTTCTAAAGGTTGTAGACCACCAGTTCAAAAGGCTTACTTGGATCAATTCACTAAGGACTTCACCACTTTCT
 +
TGAGAATCCACTCCAAAGAATTATTCTCCAGAGGTAGAATGTTGTTGACCTGTATCTGTAAGGTTGACGAATTTGATGAA
 +
CCTAACCCATTGGATTTGTTGGATATGGCCATTAACGATTTGATCGTCGAAGGTTTGTTGGAAGAAGAAAAGTTGGACTC
 +
CTTCAACATTCCATTCTTTACTCCATCTGCCGAAGAAGTTAAGTGCATCGTTGAAGAAGACGTTCTTGCGAAATCTTGTA
 +
CTTGGAAACTTTCAAGGCTCATTACGATGCTGCCTTCTCTATTGATGATGATTACCCAGTTAGATCCCACGAACAAATCA
 +
AGCTGAT
 +
 +
* pTUM104_CaMXMT1 with reversed primer
 +
CGTGATGTAGCGTGACATAACTAATTACATGATGCGGCCCTCTAGTCTGCAGCGGCCGCTACTAGTATCATCACTTTTCG
 +
AATTGTGGATGTGACCAAGCAGAAACATCAGACTTTTCTGGCTTTTTGGCCAAGGAGATAATCAAGTTGTTGTAACAACC
 +
CTTACCCATGTGTAAAACCTTAGCAGCATGTTTAGCCAATCTGTGAAACAAATCTGGCATAATAGCTTCACCGAAATGAG
 +
AGGCCAAAATAGGTTCGTAAACAGATCTGATCAAGGAGGCAACGTATTCAGCTTTGATTTGTTCGTGGGATCTAACTGGG
 +
TAATCATCATCAATAGAGAAGGCAGCATCGTAATGAGCCTTGAAAGTTTCCAAGTACAAGATTTCGCAAGAACCTTCTTC
 +
TTCAACGATGCACTTAACTTCTTCGGCAGATGGAGTAAAGAATGGAATGTTGAAGGAGTCCAACTTTTCTTCTTCCAACA
 +
AACCTTCGACGATCAAATCGTTAATGGCCATATCCAACAAATCCAATGGGTTAGGTTCATCAAATTCGTCAACCTTACAG
 +
ATACAGGTCAACAACATTCTACCTCTGGAGAATAATTCTTTGGAGTGGATTCTCAAGAAAGTGGTGAAGTCCTTAGTGAA
 +
TTGATCCAAGTAAGCCTTTTGAACTGGTGGTCTACAACCTTTAGAAGAATAGATGGAACCCTTGTTAGCACCAATACCCA
 +
ATTCAATAACCAAACCAGATGGAACTTGAGACAACCAGTGAACAGAGTAACAAGAGTGCAAGAAATGCATGGATTCTTCA
 +
GGGAATAATCTACCGTAAAAAGAACCTGGCATAGCAGAATCAAGCAGGAACCGATCTTTCTACCGTTTTCTTTTTCCAAC
 +
TTTCTGTAGAAGGATGGCAACAACTTAAAAACGGAGTTGAAGTCGTTTTGGACAAGTCGTTCAGAAAATTTGGATGGTTG
 +
GTCTTTCCATTCGTTCTTTCTTCTTGACCAACCTTA
 +
 +
* pTUM104_CaDXMT1 with T7 primer
 +
CGGCCGCTTCTAGAGTACACAATGTCTTTACAAGAAGTCTTGCATATGAACGGTGGTGAAGGTGATACTTCTTACGCTAA
 +
GAACTCTTTCTACAACTTGTTCTTGATCAGAGTCAAGCCAATCTTGGAACAATGCATCCAAGAATTATTGAGAGCCAACT
 +
TGCCAAACATCAACAAGTGTATTAAGGTTGCTGATTTGGGTTGTGCTTCTGGTCCAAATACTTTGTTGACTGTTAGAGAC
 +
ATCGTCCAATCCATTGATAAGGTTGGTCAAGAAAAGAAGAACGAATTGGAAAGACCAACCATCCAAATTTTCTTGAACGA
 +
CTTGTTCCAAAACGACTTCAACTCCGTTTTTAAGTCCTTGCCATCCTTCTACAGAAAGTTGGAAAAAGAAAACGGTAGAA
 +
AGATCGGTTCCTGTTTGATTGGTGCTATGCCAGGTTCTTTTTACGGTAGATTATTCCCTGAAGAATCCATGCATTTCTTG
 +
CATTCTTGTTACTGCTTGCACTGGTTGTCTCAAGTTCCATCTGGTTTGGTTACTGAATTGGGTATTTCTGCTAACAAGGG
 +
TTGCATCTACTCTTCTAAAGCTTCAAGACCACCAATTCAAAAGGCCTACTTGGATCAATTCACTAAGGATTTCACCACTT
 +
TCTTGAGAATCCACTCCGAAGAATTGATCAGTAGAGGTAGAATGTTGTTGACCTGGATCTGCAAAGAAGATGAATTTGAA
 +
AACCCAAACTCCATCGATTTGTTGGAAATGTCCATCAACGATTTGGTTATCGAAGGTCACTTAGAAGAAGAAAAGTTGGA
 +
CTCTTTCAACGTTCCAATCTATGCTCCATCTACCGAAGAAGTTAAGTGCATCGTTGAAGAAGAAGGTTCCTTCGAAATCT
 +
TGTACTTGGAAACCTTTAAAGTTCCATACGATGCCGGTTTCTCTATCGATGATGATTATCAAGGTAGATCCCACTCTCCA
 +
GTTTCTTGTGATGAACATGCTAGAGCTGCTCATGTTGCTTCAGTTGTAGAT
 +
 +
* pTUM104_CaDXMT1 with reversed primer
 +
CGTGATGTAGCGTGACATAACTAATTACATGATGCGGCCCTCTAGTCTGCAGCGGCCGCTACTAGTATCATCACTTTTCG
 +
AATTGTGGATGTGACCAAGCAGAAACATCGGACTTTTCTGGCTTTTTGGCCAAGGAAATAATCAAGGAGTCGTAAAAACC
 +
CTTACCAGATCTCAAAACCTTGGCAGCATTCTTAGCAATTCTATGGGACAAATCTGGCATAATAGCTTCACCGAAATGAG
 +
AGGCAACGATAGGTTCGAAAATAGATCTAACAACTGAAGCAACATGAGCAGCTCTAGCATGTTCATCACAAGAAACTGGA
 +
GAGTGGGATCTACCTTGATAATCATCATCGATAGAGAAACCGGCATCGTATGGAACCTTAAAGGTTTCCAAGTACAAGAT
 +
TTCGAAGGAACCTTCTTCTTCAACGATGCACTTAACTTCTTCGGTAGATGGAGCATAGATTGGAACGTTGAAAGAGTCCA
 +
ACTTTTCTTCTTCTAAGTGACCTTCGATAACCAAATCGTTGATGGACATTTCCAACAAATCGATGGAGTTTGGGTTTTCA
 +
AATTCATCTTCTTTGCAGATCCAGGTCAACAACATTCTACCTCTACTGATCAATTCTTCGGAGTGGATTCTCAAGAAAGT
 +
GGTGAAATCCTTAGTGAATTGATCCAAGTAGGCCTTTTGAATTGGTGGTCTTGAAGCTTTAGAAGAGTAGATGCAACCCT
 +
TGTTAGCAGAAATACCCAATTCAGTAACCAAACCAGATGGAACTTGAGACAACCAGTGCAAGCAGTAACAAGAATGCAAG
 +
AAATGCATGGATTCTTCAGGGAATAATCTACCGTAAAAAGAACCTGGCATAGCACCAATCAAACAGGAACCGATCTTTCT
 +
ACCGTTTTCTTTTTCCAACTTTCTGTAGAAGGATGGCAAGGACTTAAAAACGGAGTTGAAGTCGTTTTGGAACAGTCGTT
 +
CAGAAAATTTGGATGGTTGGTCTTTCCAATTCGTTCTTCTTTCTTGACCACCTTATCAATGGATTGGACGATGTCTCTAA
 +
C
 +
 +
'''Conclusion:'''
 +
 +
The sequencing has worked and the sequences are right. These clones will be used for the further experiments (yeast transformation, expression, etc.)
</div>
</div>
<div class ="caffeine">
<div class ="caffeine">
-
=== Miniprep ===
+
=== Miniprep of B2A,B1B,B3D===
'''Investigator:''' Dennis
'''Investigator:''' Dennis
Line 21,162: Line 21,293:
<div class ="caffeine">
<div class ="caffeine">
-
===preperative Gelelectrophoresis===  
+
===Preperative Gelelectrophoresis of pSB1C3_CaMXMT1===  
'''Investigator:''' Dennis
'''Investigator:''' Dennis
Line 21,319: Line 21,450:
== '''Thursday, August 30th''' ==
== '''Thursday, August 30th''' ==
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Miniprep of picked colonies from E.coli transformed with TEF2-P in psb1c3 from P451===
+
=== Miniprep of picked colonies from ''E.coli'' transformed with TEF2-P in psb1c3 from P451===
''' Investigator:''' Georg
''' Investigator:''' Georg
Line 21,356: Line 21,487:
* To 20 µl reaction batch 20 µl plasmid-DNA was added
* To 20 µl reaction batch 20 µl plasmid-DNA was added
* Digestion was performed for 3 h at 37C
* Digestion was performed for 3 h at 37C
 +
[[File:20120830 TEF2-P ausgeschn mit xbaI und PstI.png]]
</div>
</div>
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Preparative gelrun of P588 and P591===
 
-
''' Investigator:''' Georg
 
-
 
-
* 2x40 µl of preparative digestion was loaded on 1% preparative agarose gel
 
-
</div>
 
-
 
-
<div class="constitutive_promoter">
 
===Gelextraction of digested TEF2-P===
===Gelextraction of digested TEF2-P===
Line 21,374: Line 21,499:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
===Nanodrop measurement===
+
===Nanodrop measurement of digested limonensynthases, GFP, ADH1-P, TEF2-P===
'''Investigator:''' Georg
'''Investigator:''' Georg
*P578 Limonens.: 36,7 ng/µl
*P578 Limonens.: 36,7 ng/µl
Line 21,387: Line 21,512:
<div class="constitutive_promoter">
<div class="constitutive_promoter">
 +
===Ligation of P494 and P567===
===Ligation of P494 and P567===
'''Investigator:''' Georg
'''Investigator:''' Georg
Line 21,557: Line 21,683:
<div class="vector_design">
<div class="vector_design">
-
=== Design of an minimal multiple cloning site to insert protein coding part between promoter and terminator for pYES2new-without-promoter and pSB1C3 ===
+
=== Design of an minimal multiple cloning site to insert protein coding part between promoter and terminator for pTUM104new-without-promoter and pSB1C3 ===
'''Investigator:''' Jeff
'''Investigator:''' Jeff
Line 21,724: Line 21,850:
<div class ="caffeine">
<div class ="caffeine">
-
=== Transformation of ''E.&nbsp;coli''''' ===
+
=== Transformation of ''E.&nbsp;coli'' with P492+B1B, P492+B2A, P493+B3D ''' ===
'''Investigator:''' Dennis
'''Investigator:''' Dennis
Line 21,754: Line 21,880:
<div class="thaumatin">
<div class="thaumatin">
-
=== Small scale yeast transformation of ''S. cerevisiae'' with pYes2_Preprothaumatin, Integration-Vector_mOrange and pYes2_GFP ===
+
=== Small scale yeast transformation of ''S. cerevisiae'' with pTUM104_Preprothaumatin, Integration-Vector_mOrange and pTUM104_GFP ===
'''Investigator:''' Martin, Alois
'''Investigator:''' Martin, Alois
Line 21,964: Line 22,090:
== '''Friday, August 31st''' ==
== '''Friday, August 31st''' ==
 +
<div class="constitutive_promoter">
 +
=== Transformation of ''E.coli'' with ligation product pTUM100 with PCR59 (TEF1-T), TEF2-P, TEF1-P and ADH1-P===
 +
'''Investigator: Georg'''
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 10 µl of ligation product (P265B) was added to 100 µl of competent cells and gently mixed.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on ampicillin plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin plates.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Picking of colonies with ligation products CYC-T+psb1c3, TEF1-T-psb1c3, Thaumatin+ ADH1-TEF2-TEF1-P===
 +
 +
'''Investigator:Georg'''
 +
 +
 +
* 42 colonies were picked and transferred to 5 ml medium with 5 µl 1000x CAM in case of ligation and CYC-T and TEF1-T
 +
 +
* Ampicillin in case of ligation products of Thaumatin
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
Line 22,250: Line 22,411:
== '''Saturday, September 1st''' ==
== '''Saturday, September 1st''' ==
 +
<div class="constitutive_promoter">
 +
=== Gelextraction of colonies with Cyc-T-TEF1-T+psb1c3 and Thaumatin with ADH1P-TEF2P-TEF1P in pTUM104===
 +
'''Investigator:Georg'''
 +
 +
*Gelextraction was done according to Quiaprep-protocol
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Analytical digestion of colonies with Cyc-T-TEF1-T+psb1c3 and Thaumatin with ADH1P-TEF2P-TEF1P in pTUM100 ===
 +
 +
'''Investigator:Georg'''
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|11,25 µl
 +
|EcorI-HF (NEB)
 +
|-
 +
|11,25 µl 
 +
|PstI-HF (NEB)
 +
|-
 +
|90 µl
 +
|NEB-4 buffer
 +
|-
 +
|9 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|778,5 µl
 +
|dd H20
 +
|-
 +
|=900 µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* to 2,5 ml of DNA 17,5 µl reaction batch were added
 +
* Digestion took place at 37°C for 1 h
 +
[[File:20120903 Cyc1-T in psb1c3 und Tef1-P+Thaum.png]]
 +
[[File:20120903 Negativkontr.+ADH1 mit Thaum.png]]
 +
[[File:20120903 TEF1-T+Cyc-t in psb1c3.png]]
 +
[[File:20120903 TEF2-P+ Thaum + Negativ.png]]
 +
[[File:20120904 Promoteren ADH1,TEF2,TEF1 auf pyes2-tum.png]]
 +
 +
* TEF1-T, CYC1-T, ADH1-P+Thaum and Tef2-P+Thaum were succesfully transformated into E.coli
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Ligation of P571(psb1c3) with PCR 62 (TEF1-T)===
 +
 +
'''Investigator:Georg'''
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|8,16 µl
 +
|PCR62
 +
|-
 +
|2,54 µl (=100 ng)
 +
|P571 
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|6,3 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Ligation was cycled at 12 and 22 C
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
Line 22,399: Line 22,639:
== '''Sunday, September 2nd''' ==
== '''Sunday, September 2nd''' ==
<div class="integration">
<div class="integration">
-
=== Picking of ''S. cerevisiae'' clones from SC-U plates (pYes_preprothaumatin and pYes_limonene-synthase) and YPD-Kan plates (integrational vector) ===
+
=== Picking of ''S. cerevisiae'' clones from SC-U plates (pTUM104_preprothaumatin and pTUM104_limonene-synthase) and YPD-Kan plates (integrational vector) ===
'''Investigator:''' Martin
'''Investigator:''' Martin
Line 22,410: Line 22,650:
</div>
</div>
 +
 +
=Week 13=
 +
<div class="week" id="WWeek_13">
 +
== '''Monday, September 3rd''' ==
 +
<div class="constitutive_promoter">
<div class="constitutive_promoter">
-
=== Miniprepping of Clones (Schorsch! Nachtragen!) ===
+
=== Plasmidextraction of P451,P450, P51 and P403===
-
'''Investigator:''' Martin
+
'''Investigator: Georg'''
-
'''Results:''' Probably Dreck. Maybe doch nicht!
+
*Plasmid-DNA was extracted according to Quiaprep genextraction kit
-
*P617-P637
+
</div>
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Preparative Digestion of ADH1-P and TEF2-P(P451) with XbaI+PstI-HF, as well as Spei-HF and PstI-HF===
 +
 +
''' Investigator: Georg'''
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2,5 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|2,5 µl 
 +
|XbaI (NEB)
 +
|-
 +
|10 µl
 +
|NEB-4 buffer
 +
|-
 +
|1 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|34 µl
 +
|dd H20
 +
|-
 +
|=50µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2,5 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|2,5 µl 
 +
|SpeI-HF (NEB)
 +
|-
 +
|10 µl
 +
|NEB-4 buffer
 +
|-
 +
|1 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|34 µl
 +
|dd H20
 +
|-
 +
|=50µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* To 20 µl reaction batch, 20 µl of DNA were added and digested for 3 h at 37 C
</div>
</div>
-
=Week 13=
+
<div class="constitutive_promoter">
 +
=== Nanodrop measurement of ADH-T and TEF2-P===
 +
'''Investigator:Georg'''
 +
*ADH1-T(1) in psb1c3: 113,2 ng/µl
 +
*ADH1-T(2) in psb1cr: 158,2 ng/µl
 +
* " "(3): 159,2 ng/µl
 +
*TEF2-P in psb1c3:214,3 ng/µl
 +
*TEF2-P in psb1c3:108,2 ng/µl
 +
*TEF2-P in psb1c3:200 ng/µl
 +
 
 +
 
 +
* P678: 90,2 ng/µl
 +
* P679: 79,6 ng/µl
 +
* P680 : 52,2 ng/µl
 +
</div>
 +
 
 +
<div class="constitutive_promoter">
 +
 
 +
=== Ligation of P578 with P680 and P679===
 +
 
 +
'''Investigator: Georg'''
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|2,45 µl (=100 ng)
 +
|P578
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|1,91 µl
 +
|P680
 +
|-
 +
|12,64 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 
 +
'''Investigator: Georg'''
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|2,55 µl (=100 ng)
 +
|P578
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|1,25 µl
 +
|P680
 +
|-
 +
|13,2 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 
 +
* Negative controls were mixed with ddH20 instead of the insert
 +
* Cycled ligation has been performed after following protocol in a thermocycler:
 +
{|cellspacing="0" border="1"
 +
|100 cycles
 +
|12&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|
 +
|22&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|Hold
 +
|16&nbsp;°C
 +
|infinite
 +
|}
 +
 
 +
</div>
 +
 
 +
<div class="constitutive_promoter">
 +
=== Preparation of P588 (TEF2-P (450) for sequencing===
 +
 
 +
'''Investigator: Georg'''
 +
* 5 µl DNA (289,7 ng/µl) and 12 ml H20 with seq. Number 025
 +
</div>
 +
 
 +
<div class="constitutive¬_promoter">
 +
<div class="constitutive¬_promoter">
 +
<div class="constitutive_promoter">
 +
===Transformation of TEF1-T-psb1c3===
 +
'''Investigator:Georg'''
 +
* E.coli was transformed with with P638 for amplification
 +
'''Procedure:'''
 +
 
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 
 +
* 10 µl of ligation product (P265B) was added to 100 µl of competent cells and gently mixed.
 +
 
 +
* 30 min incubation on ice
 +
 
 +
* 5 min. heat shock at 37°C
 +
 
 +
* Adding of 1ml LB-medium to each tube.
 +
 
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 
 +
* 100µl of those cell suspension were plated on CAM plates.
 +
 
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new CAM plates.
 +
</div>
-
<div class="week" id="WWeek_13">
 
-
== '''Monday, September 3rd''' ==
 
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Analytical digestion and gelelectrophoresis of the minipreps P534-P539, P611-P616 ===
=== Analytical digestion and gelelectrophoresis of the minipreps P534-P539, P611-P616 ===
Line 22,736: Line 23,156:
'''Aim of the experiment:'''Picking transformed Saccharomyces cerevisiae cells for protein expression in yeast
'''Aim of the experiment:'''Picking transformed Saccharomyces cerevisiae cells for protein expression in yeast
-
* Inoculation of overnight cultures: one clone from plate with PCR 1 in P175 clone 2 (Miniprep 21.08.) (29) & one clone from plate with P542 (Miniprep 28.08.) was picked,resuspended in 15 ml SCU medium with glucose and incubated at 30 °C overnight
+
* Inoculation of overnight cultures: one clone from plate with PCR 1 in P175 clone 2 (Miniprep 21.08.) (29) & one clone from plate with P542 (PCR2) (Miniprep 28.08.) was picked,resuspended in 15 ml SCU medium with glucose and incubated at 30 °C overnight
</div>
</div>
Line 22,809: Line 23,229:
<div class="caffeine">
<div class="caffeine">
-
=== Miniprep ===
+
=== Miniprep of B2A, B1B, B3D ===
'''Investigator:''' Dennis
'''Investigator:''' Dennis
Line 22,822: Line 23,242:
<div class="caffeine">
<div class="caffeine">
-
=== analytic digestion of B2A, B1B, B3D ===
+
=== Analytic digestion of B2A, B1B, B3D ===
'''Investigator:''' Dennis
'''Investigator:''' Dennis
Line 22,858: Line 23,278:
<div class="caffeine">
<div class="caffeine">
-
===analytic Gelelectrophoresis===  
+
===Analytic Gelelectrophoresis of B2A, B1B, B3D===  
'''Investigator:''' Dennis
'''Investigator:''' Dennis
Line 22,887: Line 23,307:
<div class="caffeine">
<div class="caffeine">
-
===Transformation of ''E.Coli'' with pYES2_RFC25_CaXMT1, pYES2_RFC25_CaMXMT1 and pYES2_RFC25_CaDXMT1 as backup===
+
===Transformation of ''E.Coli'' with pTUM104_CaXMT1, pTUM104_CaMXMT1 and pTUM104_CaDXMT1 as backup===
'''Investigator:''' Roman
'''Investigator:''' Roman
-
'''Aim:''' To fill up the amount of available pYES2_RFC25 for further yeast transformations
+
'''Aim:''' To fill up the amount of available pTUM104 for further yeast transformations
'''Operational sequence:'''
'''Operational sequence:'''
Line 22,900: Line 23,320:
== '''Tuesday, September 4th''' ==
== '''Tuesday, September 4th''' ==
 +
<div class="constitutive_promoter">
 +
===Transformation of P403 (ADH1-T in psb1c3) in ''E.coli'' Xl1-blue===
 +
 +
'''Investigator:Georg'''
 +
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 10 µl of ligation product (P265B) was added to 100 µl of competent cells and gently mixed.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on CAM plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new CAM plates.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Preparative digestion of Cyc1-T-Kol2, TEF1-P-Kol1, ADH1-P and TEF2-P Kol6 in psb1c3 with XbaI and PstI-HF===
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|4 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|4 µl 
 +
|XbaI (NEB)
 +
|-
 +
|24 µl
 +
|NEB-4 buffer
 +
|-
 +
|2,4 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|63,2 µl
 +
|dd H20
 +
|-
 +
|=80µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* 17,8 µl were taken from each batch for digestion and added to 20 ml of the mastermix
 +
[[File:20120904 ADH1-P+ Thaumatin, TEF2-P und Thaum.png]]
 +
[[File:20120904 TEF1-P+Thaum, Cyc-T.png]]
 +
</div>
 +
<div class="constitutive_promoter">
 +
 +
=== Preparation of P450 TEF2-P in psb1c3 for sequencing===
 +
 +
'''Investigator: Georg'''
 +
* 10 µl P450 were mixed with 5 µl ddH20 for 50-100 ng/µl DNA
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Gelextraction of digested TEF1-Thaum,TEF2-Thaum, ADH1-P-Thaum and Cyc-T===
 +
 +
'''Investigator: Georg'''
 +
 +
* Gelextraction was performed according to Quiaquick gelextraction protocol
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Ligation of P572 (dig. pTUM100)with P684, P682, P683===
 +
'''Investigator: Georg'''
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|3,24 µl (=100 ng)
 +
|P684 (PYesII digested)
 +
|-
 +
|2 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|10,6 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|3,16 µl
 +
|P572
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|3,24 µl
 +
|P684
 +
|-
 +
|2 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|10,6 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|3,14 µl
 +
|P572
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|3,16 µl
 +
|P683 
 +
|-
 +
|2 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|10,6 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|3,17 µl
 +
|P572
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|1,11 µl
 +
|P682 
 +
|-
 +
|2 µl
 +
|10x T4-ligase buffer
 +
|-
 +
|12,72 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Negative controls were also prepared, instead of the insert the same amount of ddH20 was added
 +
* Cycled ligation has been performed after following protocol in a thermocycler:
 +
{|cellspacing="0" border="1"
 +
|100 cycles
 +
|12&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|
 +
|22&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|Hold
 +
|16&nbsp;°C
 +
|infinite
 +
|}
 +
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Nanodrop measurement of digested CYC1-T, P684, P682, P683 ===
 +
 +
'''Investigator: Georg'''
 +
* Cyc1-T (xbaI+PstI)P681 :19,4 ng/µl
 +
* ADH-P with Thaumatin (P684): 28 ng/µl
 +
* TEF1-P with Thaumatin (P682): 61,9 ng/µl
 +
* TEF2-P with Thaumatin (P683):27 ng/µl
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Cycled ligation of P493+P639, P643+P299, P640+P642, P641+P642 ===
=== Cycled ligation of P493+P639, P643+P299, P640+P642, P641+P642 ===
Line 23,351: Line 23,971:
== '''Wednesday, September 5th''' ==
== '''Wednesday, September 5th''' ==
 +
<div class="constitutive_promoter">
 +
=== Transformation of P451 (TEF2-P in psb1c3) in ''E.coli'' Xl1-blue)===
 +
 +
'''Investigator: Georg'''
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 10 µl of ligation product (P265B) was added to 100 µl of competent cells and gently mixed.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on CAM plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new CAM plates.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Preparative digestion of TEF1-P and ADH1-P in pTUM104===
 +
''' Investigator: Georg'''
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|3 µl
 +
|SpeI-HF
 +
|-
 +
|3 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|12 µl
 +
|NEB-4 buffer
 +
|-
 +
|1,2 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|40,8 µl
 +
|dd H20
 +
|-
 +
|=60 µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* To 20 µl of reaction batch 20 µl of DNA were added and digested for at 37 C over night
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Preparative gelelectrophoresis of ADH1-P, TEF1-P and TEF2-P in pTUM100===
 +
 +
'''Investigator:Georg
 +
 +
* Digestions were loaded onto 1% ultra pure Agarose gels
 +
* gelrun took 90 min at 70 V
 +
[[File:20120905 Präp ptumm100 mit 3 promotoren.png]]
 +
[[File:20120906 ADH-P  TEF1-P, TEF2-P in PyesII-TUM.png]]
 +
*Digestion was succesfull
 +
</div>
 +
 +
<div class="thaumatin">
<div class="thaumatin">
Line 23,370: Line 24,060:
<div class ="caffeine">
<div class ="caffeine">
-
=== Miniprep of ''E.Coli'' over night cultures, transformed with pYES2_RFC25 constructs ===
+
=== Yeast transformation with pTUM104_RFC25_CaDXMT1 ===
 +
 
 +
'''Investigator:''' Roman
 +
 
 +
'''Aim of the experiment:'''
 +
 
 +
The aim of the experiment was the transformation of chemo competent yeast cells with the plasmid pTUM104_CaDXMT1, which contains the enzyme "caffeine synthase", being the last enzyme of the caffein biosynthesis pathway.
 +
 
 +
'''Operational sequence:'''
 +
 
 +
Contrary to previous experiments, this transformation was done with the ''S.C.'' EasyComp(TM) Transformation Kit (Invitrogen). The chemocompetent yeast cells have already been prepared (thanks to the chair of Prof. Schwab, Biotechnology of natural compounds) as 50µl aliquots.
 +
 
 +
Ca. 2 µg of plasmid DNA (Clone Y3G) were added to the competent cells together with "Solution III" (Kit) as described in the manufacturers protocoll.
 +
 
 +
The reaction batch was plated on SC-U agar plates and incubated at 30°C for 3 - 4 days.
 +
 
 +
</div>
 +
 
 +
<div class ="caffeine">
 +
 
 +
=== Miniprep of ''E.Coli'' over night cultures, transformed with pTUM104_RFC25 constructs ===
'''Investigator:''' Roman
'''Investigator:''' Roman
Line 23,376: Line 24,086:
'''Aim of experiment:'''
'''Aim of experiment:'''
-
Isolation of plasmids: pYES2_RFC25_CaXMT1, pYES2_RFC25_CaMXMT1 and pYES2_RFC25_CaDXMT1 for further usage.
+
Isolation of plasmids: pTUM104_CaXMT1, pTUM104_CaMXMT1 and pTUM104_CaDXMT1 for further usage.
'''Operational sequence:'''
'''Operational sequence:'''
Line 23,385: Line 24,095:
'''Determined concentrations (NanoDrop)'''
'''Determined concentrations (NanoDrop)'''
-
* pYES2_RFC25_CaXMT1 (p553): 179,6 ng/µl
+
* pTUM104_CaXMT1 (p553): 179,6 ng/µl
-
* pYES2_RFC25_CaMXMT1 (p554): 340,7 ng/µl
+
* pTUM104_CaMXMT1 (p554): 340,7 ng/µl
-
* pYES2_RFC25_CaDXMT1 (p555): 182,9 ng/µl
+
* pTUM104_CaDXMT1 (p555): 182,9 ng/µl
</div>
</div>
Line 23,393: Line 24,103:
<div class="caffeine">
<div class="caffeine">
-
=== Transformation of ''E.&nbsp;coli''''' ===
+
=== Transformation of ''E.&nbsp;coli'' with ADH1+B1B_2, ADH1+B2A_3, ADH1+B3D_2''' ===
'''Investigator:''' Dennis
'''Investigator:''' Dennis
Line 23,680: Line 24,390:
'''Aim:''' picking of clones for a 2 l expression experiment
'''Aim:''' picking of clones for a 2 l expression experiment
2 clones of S. cerevisiae containing citrus limonene synthase (mit consensus sequence) were picked from the plate Andrea 29 (22.08.) and resuspended in 100 ml SCU medium + glucose
2 clones of S. cerevisiae containing citrus limonene synthase (mit consensus sequence) were picked from the plate Andrea 29 (22.08.) and resuspended in 100 ml SCU medium + glucose
 +
 +
</div>
 +
 +
<div class="coumaryl">
 +
===Vectorfragmentation of structural genes of Xanthohumol===
 +
'''Investigator:''' Ingmar
 +
 +
'''Aim of the experiment:''' The detection of our desired proteins via western blot failed three times. To rule out that recombinations of vector elements did take place, the vector backbone of our gene constructs and of a pYes vector from the limonengroup containing a gene insert whose protein could be detected via western blot was fragmented and the fragmentation patterns were compared.
 +
 +
'''Operational sequence:'''
 +
* General reaction batch:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|x µl
 +
|DNA Template
 +
|-
 +
|1.2 µl
 +
|NEB buffer 3 (10x)
 +
|-
 +
|0.8 µl
 +
|Tango buffer (10x)
 +
|-
 +
|0.2µl
 +
|BSA (100x)
 +
|-
 +
|0.25 µl
 +
|NotI (20 U/µl)
 +
|-
 +
|0,25 µl
 +
|PvuI (20 U/µl)
 +
|-
 +
|0.25 µl
 +
|AflIII (20 U/µl)
 +
|-
 +
|y µl
 +
|ddH2O
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
* The volume of DNA was calculated to have 500 ng of DNA. A suitable volume water was added to result in a total volume of 20 µl.
 +
*Incubation at 37 °C for 2h.
 +
*Verification of control digest by agarose gel electrophoresis:
 +
 +
20 µl of each digest product was mixed with 4 µl 6x DNA loading buffer and loaded into the gel. The separation process lasted 1h at 90 V.
 +
 +
[[File:TUM12_Xanthohumol_Vektorfragmentierung_1.jpg|800px|Gel picture of vectorfragmentation 1]]
 +
 +
 +
 +
[[File:TUM12_Xanthohumol_Vektorfragmentierung_2.jpg|800px|Gel picture of vectorfragmentation 2]]
 +
 +
The fragmentation pattern does not show unexpeted bonds. Therefore the gene constructs might have some point mutations which are not visible via Agarose gel electrophoresis. As the transformation of yeast with our constructs resulted in a reasonable number of cfu, it is likely that the URA3 gene and the 2µOri are not affected by possible mutations. Thats why we will continue our work with sequencing our gene constructs including their respective promoters.
</div>
</div>
== '''Thursday, September 6th''' ==
== '''Thursday, September 6th''' ==
 +
<div class="constitutive_promoter">
 +
=== Gelextraction of P678, P679, P680===
 +
 +
'''Investigator: Georg'''
 +
* Gelextraction was done according to the Quiaquick extraction kit protocoll
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===analytical gelelectrophoresis with P678, P680 and P679===
 +
 +
''' Investigator: Georg'''
 +
* Gelelectrophoresis was done on 0,5% analytical agarose gels with 90 V for 60 min
 +
[[File:20120906 TEF2-P (P450), ADH-P,TEF1-P in Pyes2tum.png]]
 +
* Experiment done in order to differentiate tubes
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Transformation of ''E. coli'' Xl1-blue with ligation products P572 and TEF2-P-Thaum, TEF1-P-Thaum and ADH1-P-Thaum===
 +
 +
'''Investigator:Georg'''
 +
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 10 µl of ligation product (P265B) was added to 100 µl of competent cells and gently mixed.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on ampicillin plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin plates.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Picking of colonies from transformants with P403 (ADH1-T), P451 (TEF2-P), P450 (TEF2-P) and P51 (eGFP)===
 +
 +
* 5 µl of 1000x Amp-solution were added to 5 ml LB-medium
 +
* colonies were picked to AMP-LB medium
 +
* Colonies grew over night at 37 C
 +
</div>
 +
 +
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Miniprep of ''E.&nbsp;coli'' XL-Blue cells, transformated with biobrick BBa_K268000 (emtpy yeast vector) ===
=== Miniprep of ''E.&nbsp;coli'' XL-Blue cells, transformated with biobrick BBa_K268000 (emtpy yeast vector) ===
Line 23,805: Line 24,623:
<div class="thaumatin">
<div class="thaumatin">
-
===Picking of pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term pSB1C3_TEF1Prom_Preprothaumatin (p647) and pYes2_Preprothaumatin===
+
===Picking of pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term pSB1C3_TEF1Prom_Preprothaumatin (p647) and pTUM104_Preprothaumatin===
'''Investigator:''' Eriugena, Nietzsche
'''Investigator:''' Eriugena, Nietzsche
Line 23,853: Line 24,671:
<div class="thaumatin">
<div class="thaumatin">
-
===Minipreparation of pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term pSB1C3_TEF1Prom_Preprothaumatin (p647) and pYes2_Preprothaumatin===
+
===Minipreparation of pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term pSB1C3_TEF1Prom_Preprothaumatin (p647) and pTUM104_Preprothaumatin===
-
'''Investigator:''' Eriugena, Nietzsche
+
'''Investigator:''' Eriugena, Nietzsche, masterblaster
'''Aim:''' Getting pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term.
'''Aim:''' Getting pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term.
Line 23,888: Line 24,706:
'''Result:'''  
'''Result:'''  
 +
 +
[[File:thaumatin_expression_cassette_analytical_TUM12.Tif]]
 +
 +
On the left you see the digest with EcoRI and PstI. The bands show the desired length - the ligation was a historic triumph. The bands on the right show the same plasmids digested with NotI - as indicated by sequence data obtained bei Schorsch, the TefI-Terminator lost the NotI restriction site due to a punctual mutation.
</div>
</div>
Line 23,928: Line 24,750:
<div class="caffeine">
<div class="caffeine">
-
===Gelextraction ===
+
===Gel extraction of separated fragments===
'''Investigator''':Dennis
'''Investigator''':Dennis
Line 23,987: Line 24,809:
--> ligations failed
--> ligations failed
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Cell lysis of 5ml samples taken 20min after expression induction===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim of the experiment:'''
 +
 +
Cell lysis of yeast cell- samples taken 20 min after expression. The idea is to compare the gene expression 20min after induction and 20h after induction. The signals on the western blott should show, that the two bands of our expressed enzymes are only visible after 20h.
 +
 +
'''Operational sequence:'''
 +
 +
* an adequate amount of breaking buffer (containing PMSF) was given to the frozen cell pellet, as well as an equal amount of glass beads. '''Note:''' because the supernatant could not be taken after 10 min centrifugation, another 30µl of breaking buffer were added.
 +
 +
* cell- walls were disrupted by vortexing for 30 sec, followed by 30 sek on ice. This procedure was repeated 4 times.
 +
 +
* protein concentration was determined by NanoDrop (blank: breaking buffer)
 +
 +
** CaXMT1 crude extract: 1 mg/ml
 +
** CaMXMT1 crude extract: 2,23 mg/ml
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== SDS- Page of protein crude extracts, taken at different times after induction of expression ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim of the experiment:'''
 +
 +
Aim of the experiment is the preparation of a SDS- page, to make a subsequent western blot and to compare the samples, taken at different expression times.
 +
 +
'''Operational sequence:'''
 +
 +
The SDS- gel was prepared as previously described (12%). 20µg protein crude extract of each sample were loaded on the gel. Running- time: ca. 2h at 120V.
 +
Additionally to the prestained protein marker, we used an un- prestained marker, which contained a 45 kDa protein.
 +
Afterwards, the gel was immediately used for the western blot.
</div>
</div>
Line 24,013: Line 24,876:
*wash 3x7min with PBS-T0.1
*wash 3x7min with PBS-T0.1
*the membrane is blocked over night in PBS-T0.1 with 3% BSA at 4 °C on a shaking device
*the membrane is blocked over night in PBS-T0.1 with 3% BSA at 4 °C on a shaking device
-
 
</div>
</div>
-
<div class ="caffeine">
+
<div class="coumaryl">
-
=== Cell lysis of 5ml samples taken 20min after expression induction===
+
===Sequencing of structural genes of Xanthohumol including the promoter===
 +
'''Investigator:''' Ingmar
-
'''Investigator:''' Roman
+
'''Aim of the experiment:''' Check wheather the gene constructs have mutations in the promoters
-
'''Aim of the experiment:'''
+
'''Results:'''
 +
The following geneconstructs were sequenced including the promoter: 
 +
P194 4Cl- in pYes
 +
P263 APT in pYes
 +
P197 OMT+ in pYes
 +
P198 OMT- in pYes
 +
P200 PAL- in pYes
 +
P236 PAL+ in pYes
 +
All of these sequences did not show any mutation in the promoter. Therefore the fact that our proteins were not detectable might be a result of errors during the transformation. Hence the transformation will be repeated. Parallely our gene constructs will be cloned into a pYes vector backbone of the Limonen group who could successfully express and detect their proteins.
 +
</div>
-
Cell lysis of yeast cell- samples taken 20 min after expression. The idea is to compare the gene expression 20min after induction and 20h after induction. The signals on the western blott should show, that the two bands of our expressed enzymes are only visible after 20h.
+
== '''Friday, September 7th''' ==
 +
<div class="constitutive_promoter">
 +
=== Plasmidextraction of P451,P450, P51 and P403===
-
'''Operational sequence:'''
+
'''Investigator: Georg'''
-
* an adequate amount of breaking buffer (containing PMSF) was given to the frozen cell pellet, as well as an equal amount of glass beads. '''Note:''' because the supernatant could not be taken after 10 min centrifugation, another 30µl of breaking buffer were added.
+
*Plasmid-DNA was extracted according to Quiaprep genextraction kit
 +
</div>
-
* cell- walls were disrupted by vortexing for 30 sec, followed by 30 sek on ice. This procedure was repeated 4 times.
 
-
* protein concentration was determined by NanoDrop (blank: breaking buffer)
+
<div class="light_switchable_promoter">
-
** CaXMT1 crude extract: 1 mg/ml
 
-
** CaMXMT1 crude extract: 2,23 mg/ml
 
-
 
-
</div>
 
-
 
-
== '''Friday, September 7th''' ==
 
-
<div class="light_switchable_promoter">
 
=== Miniprep of ''E.&nbsp;coli'' XL-Blue cells, transformated with ligation products P493+P639, P643+P299, P640+P642, P641+P642 ===
=== Miniprep of ''E.&nbsp;coli'' XL-Blue cells, transformated with ligation products P493+P639, P643+P299, P640+P642, P641+P642 ===
Line 24,260: Line 25,127:
<div class="limonene">
<div class="limonene">
-
===Preparative restriction digest of PCR1/pYES (P515neu) and PCR58/pSB1C3 (P510)===
+
===Preparative restriction digest of PCR1/pTUM104 (P515neu) and PCR58/pSB1C3 (P510)===
'''Investigator:''' Andrea
'''Investigator:''' Andrea
Line 24,302: Line 25,169:
pYES: 5800 bp
pYES: 5800 bp
-
 
+
[[File:07.09.2012 prepgel bearbeitet.png|400px]]
</div>
</div>
<div class="limonene">
<div class="limonene">
 +
===Single colony streak of PCR2 in yeast ===
===Single colony streak of PCR2 in yeast ===
Line 24,342: Line 25,210:
=== analytic digestion of B2A_3+ADH1 terminator, B1B_2+ADH1 terminator, B3D_3+ADH1 terminator ===
=== analytic digestion of B2A_3+ADH1 terminator, B1B_2+ADH1 terminator, B3D_3+ADH1 terminator ===
-
'''Investigator:''' Dennis
+
'''experimenter:''' Dennis
-
 
+
-
'''Aim of the experiment:''' analytic digestion of clone === Preperative digestion of B2A, B1B, B3D ===
+
-
 
+
-
'''Investigator:''' Dennis
+
-
'''Aim of the experiment:''' preperative digestion of B2A_3+ADH1 terminator, B1B_2+ADH1 terminator, B3D_3+ADH1 terminator
+
'''Aim of the experiment:''' analytic digestion of B2A_3+ADH1 terminator, B1B_2+ADH1 terminator, B3D_3+ADH1 terminator
'''Procedure:'''
'''Procedure:'''
Line 24,375: Line 25,239:
|'''TOTAL'''
|'''TOTAL'''
|}
|}
 +
 +
 +
* gelelectrophoresis: B2A_3+ADH1 terminator (3 times), B1B_2+ADH1 terminator (3 times), B3D_3+ADH1 terminator (3 times)
 +
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Staining with Ponceau's reagent and western blot analysis of protein crude extract of CaXMT1, CaMXMT1 and eGFP transformants after 20 minutes and 20 hours of expression ===
 +
 +
'''Investigator:''' Saskia, Roman
 +
 +
'''Aim of the experiment:'''
 +
 +
Detection of expressed proteins CaXMT1, CaMXMT1, eGFP.
 +
 +
'''Operational sequence:'''
 +
 +
The western blot membran (having been blocked over the night at 4°C) was washed with PBS- T0.1 four times (4x 15min).
 +
Because of the use of un- prestained protein marker (see Thursday, 6.9.), we stained the western blot membran with Ponceau's reagent and assigned the bands, followed by washing the membran with PBS- T0.1 again (15 minutes, 2x).
 +
Afterwards, the membran was incubated for 1h with detection reagent.
 +
Detection reagent:
 +
* 10ml 1xPBS
 +
* 0,2% BSA (0,02g have been weighted in)
 +
* 2µl anti body MABclassic
 +
 +
After incubating with the first antibody, the membran was washed again with PBS-T0.1 three times (3x 5min), followed by the incubation with the second antibody (anti mouse, fused with alk. phosphatase) for another our.
 +
Second detection reagent:
 +
* 10ml 1xPBS
 +
* 0,2% BSA (see above)
 +
* 5µl AntiMouse-alk. Phosphatase conjugate (1/2000 dilution)
 +
 +
The development was performed after washing the membran with PBS- T0.1 for 10 min (two times) and with 1xPBS for 10 min (two times).
 +
For this, the membran was shortly washed with AP buffer and then incubated with a solution containing 15ml AP buffer, 45µl BCIP (50mg/ml in DMF) and 7,5µl NBT (75mg/ml in 70% DMF) for a few minutes, until clear bands appeared.
 +
 +
Western blot membran:
 +
 +
[[File:TUM12_IGEM_WB_coff.jpg|500px]]
 +
 +
From left to right (with expression time in brackets):
 +
 +
{| cellspacing="0" border="1"
 +
|Prestained protein marker (Page Ruler Plus)
 +
| CaXMT1 crude extract (20min)
 +
| CaMXMT1 crude extract (20min)
 +
| eGFP(20h)
 +
|CaMXMT1 crude extract (20h)
 +
|CaXMT1 crude extract (20h)
 +
|Unstained protein marker (pen marking)
 +
|}
 +
 +
'''Picture with annotations:'''
 +
 +
[[File:TUM12_WBIIannotiert.jpg|500px]]
</div>
</div>
<div class="limonene">
<div class="limonene">
 +
===Preparing of controls for large-scale expression ===
===Preparing of controls for large-scale expression ===
Line 24,402: Line 25,322:
<div class="limonene">
<div class="limonene">
-
===Transfer of yeast containing PCR/pYES into induction medium (+Gal) ===
+
===Transfer of yeast containing PCR/pTUM104 into induction medium (+Gal) ===
'''Investigator:''' Andrea, Lara
'''Investigator:''' Andrea, Lara
Line 24,416: Line 25,336:
</div>
</div>
-
<div class="limonene">
+
<div class = Xanthohumol>
 +
===Cloning of Xanthohumol gene constructs in pTUM104 vector backbone of the Limonen group===
 +
'''Investigator:''' Ingmar
 +
 
 +
'''Aim of the experiment:''' Rule out negative effects of possible mutations in the vector backbone.
 +
 
 +
'''Operational sequence:'''
 +
 
 +
* Reaction batch for digestion of P515(Limonen vector) and of Xanthohumol gene construts with XbaI+PstI-HF:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|DNA template
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer&nbsp;3 (10x)
 +
|-
 +
|-
 +
|0.4&nbsp;µl
 +
|BSA&nbsp; (100x)
 +
|-
 +
|2&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|2&nbsp;µl
 +
|XbaI (20&nbsp;U/µl)
 +
|-
 +
|11.6&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 
 +
* Reaction batch was incubated at 37&nbsp;°C for 3&nbsp;h
 +
 
 +
* 4.5&nbsp;µl of DNA loading buffer (10x) was added to the digested product and preperative gelelectrophoresis was performed at 70&nbsp;V for 1.5&nbsp;h.
 +
 
 +
[[File:TUM12_Prepgel_07.09.2012_Limonensynthase_in_pYes.jpg|500px]]
 +
 
 +
[[File:TUM12_Xanthohumol_Prepgel_07.09.2012_P193_P194_P197_.jpg|500px]]
 +
 
 +
 
 +
[[File:TUM12_Xanthohumol_Prepgel_07.09.2012_P200_P236_.jpg|500px]]
 +
 
 +
 
 +
[[File:TUM12_Xanthohumol_Prepgel_07.09.2012_P261_P428_P429.jpg|500px]]
 +
 
 +
*The desired bonds of the genes were cut out of the gel and the DNA was extracted using a Quiagen gel extraction kit. Resulting DNA samples:
 +
{|cellspacing="0" border="1"
 +
|'''Label'''
 +
|'''Content'''
 +
|'''Concentration [ng/µl]'''
 +
|-
 +
|P755
 +
|PAL+(P236)
 +
|7.4
 +
|-
 +
|P756
 +
|PAL-(P200)
 +
|6.9
 +
|-
 +
|P757
 +
|4CL+(P193)
 +
|5.7
 +
|-
 +
|P758
 +
|4Cl-(P194)
 +
|7.5
 +
|-
 +
|P759
 +
|CHS+(P428)
 +
|53.5
 +
|-
 +
|P760
 +
|CHS-(P429)
 +
|3.3
 +
|-
 +
|P761
 +
|OMT+(P197)
 +
|3.9
 +
|-
 +
|P762
 +
|APT(P263)
 +
|6.4
 +
|-
 +
|P763
 +
|pYes backbone of P515
 +
|116.5
 +
|}
 +
 
 +
*Ligation batches:
 +
The component volumina were calculated to result in a ratio 1:6 vector to insert. The ligation process lasted overnight with a repeated sequence of 1 min at 16°C and 1 min at 22°C
 +
{| {{table}}
 +
| align="center" style="background:#f0f0f0;"|'''Insert'''
 +
| align="center" style="background:#f0f0f0;"|'''Insertvolume [µl]'''
 +
| align="center" style="background:#f0f0f0;"|'''Vectorvolume (P763) [µl]'''
 +
| align="center" style="background:#f0f0f0;"|'''T4 DNA Ligase'''
 +
| align="center" style="background:#f0f0f0;"|'''T4 DNA Ligase Buffer'''
 +
| align="center" style="background:#f0f0f0;"|'''Water'''
 +
| align="center" style="background:#f0f0f0;"|'''Sum'''
 +
|-
 +
| PAL+ (P755)||7,78||0,22||1||2||9||20
 +
|-
 +
| PAL-(P756)||7,8||0,2||1||2||9||20
 +
|-
 +
| 4Cl+(P757)||7,79||0,21||1||2||9||20
 +
|-
 +
| 4Cl-(P758)||7,72||0,28||1||2||9||20
 +
|-
 +
| CHS+(P759)||5,84||2,16||1||2||9||20
 +
|-
 +
| CHS-(P760)||7,82||0,18||1||2||9||20
 +
|-
 +
| APT(P761)||7,67||0,33||1||2||9||20
 +
|-
 +
| OMT-(P762)||7,77||0,23||1||2||9||20
 +
|-
 +
|
 +
|}
 +
 
 +
</div>
 +
 
== '''September, Saturday 8th''' ==
== '''September, Saturday 8th''' ==
 +
 +
<div class="coumaryl">
 +
===Cloning of Xanthohumol gene constructs in pTUM104 vector backbone of the Limonen group===
 +
''' Transformation into ''E.coli'' Xl1-Blue'''
 +
'''Operation Sequence'''
 +
* melting of 100 µl Ca-competent  ''E.coli'' XL1-Blue cells on ice
 +
* addition of 5 µl of the ligation batch from 07.09.2012
 +
* incubation for 30 min on ice
 +
* heat shock for 5 min at 37 °C
 +
* transfer of cells to 1 ml LB-medium without antibiotics and incubate at 37°C and 180 rpm for 45 min
 +
* plate 100 µl on an Amp-LB-plate
 +
* sediment the leftover in a centrifuge (30 - 60 sec, 13 000 rpm) and resuspend the sediment in 100 µl LB-medium and plate it as well on an Amp-LB-plate
 +
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Preparative gelelectrophoresis of preparative digestion of P687, P690, P693, P697 ===
=== Preparative gelelectrophoresis of preparative digestion of P687, P690, P693, P697 ===
-
'''Investigator:''' Jeff
+
'''Investigator:''' Jeff, Saskia
'''Aim of the experiment:''' Preparative gelelectrophoresis was performed from the samples from the preparative digestion overnight of P687 (SpeI-HF+PstI-HF), P690 (XbaI+PstI-HF), P693(XbaI+PstI-HF), P697(XbaI+PstI-HF).
'''Aim of the experiment:''' Preparative gelelectrophoresis was performed from the samples from the preparative digestion overnight of P687 (SpeI-HF+PstI-HF), P690 (XbaI+PstI-HF), P693(XbaI+PstI-HF), P697(XbaI+PstI-HF).
Line 24,427: Line 25,485:
'''Procedure:'''
'''Procedure:'''
-
* Preparative gelelectrophoresis was performed at 70&nbsp;V for xxx&nbsp;h.
+
* 4.44&nbsp;µl of DNA loading buffer was added to the digestion mixture.
 +
 
 +
* Preparative gelelectrophoresis was performed at 70&nbsp;V for 3&nbsp;h.
 +
 
 +
{|cellspacing="0" border="1"
 +
|P687 SpeI&nbsp;+&nbsp;PstI-HF
 +
|1&nbsp;kbp DNA ladder
 +
|P690 XbaI-HF&nbsp;+&nbsp;PstI-HF
 +
|-
 +
|Band was cut out (3316 bp, 75.5 ng/µl)
 +
|
 +
|Lower band was cut out (988 bp, 30.4 ng/µl)
 +
|}
 +
 
 +
[[File:TUM12 20120908 prep gel P687 P690.jpg|500px]]
 +
 
 +
{|cellspacing="0" border="1"
 +
|P693 XbaI-HF&nbsp;+&nbsp;PstI-HF
 +
|1&nbsp;kbp DNA ladder
 +
|P697 XbaI-HF&nbsp;+&nbsp;PstI-HF
 +
|-
 +
|Upper band was cut out (3848 bp, 68.7 ng/µl)
 +
|
 +
|Upper band was cut out (4013 bp, 69.8 ng/µl)
 +
|}
 +
 
 +
[[File:TUM12 20120908 prep gel P693 P697.jpg|500px]]
</div>
</div>
<div class="light_switchable_promoter">
<div class="light_switchable_promoter">
 +
=== Transformation of ''E.&nbsp;coli'' XL1-Blue with BBa_I712019, BBa_E2020, BBa_E2030 ===
=== Transformation of ''E.&nbsp;coli'' XL1-Blue with BBa_I712019, BBa_E2020, BBa_E2030 ===
'''Investigator:''' Saskia  
'''Investigator:''' Saskia  
 +
 +
'''Aim of the experiment:''' Transformation of ''E.&nbsp;coli'' XL1-Blue with BBa_I712019, BBa_E2020, BBa_E2030 (H10, 12D, 12B)
 +
 +
'''Procedure:'''
 +
 +
* 2µl of each ligation product were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice.
 +
 +
* 30&nbsp;min incubation on ice.
 +
 +
* 5&nbsp;min heat shock at 37&nbsp;°C
 +
 +
* Adding of 1&nbsp;ml LB-medium to each tube.
 +
 +
* Incubation for 45&nbsp;min at 37&nbsp;°C in the 180&nbsp;rpm cell-culture shaker.
 +
 +
* The cells were centrifuged for 1&nbsp;min at 13000&nbsp;rpm and the supernatant was dicarded.
 +
 +
* The pellets were resuspended in 100&nbsp;µl of LB-medium and plated on: H10 Ampicillin plates, 12D Kanamycin plates, 12B Kanamycin plates
 +
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
=== Cycled ligation of P698+P699 ===
 +
 +
'''Investigator:''' Saskia
 +
 +
'''Aim of the experiment:''' Cycled ligation of P698+P699 (TEF1 promoter - SV40NLS-Gal4AD-30aaLinker-Pif3(100NT) + TEF1 terminator - TEF1 promoter).
 +
 +
'''Procedure:'''
 +
 +
* Ligation batch for P698+P699
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1.32&nbsp;µl
 +
|P698 (75.5&nbsp;ng/µl, 3316&nbsp;bp)
 +
|-
 +
|1.19&nbsp;µl
 +
|P699 (30.4&nbsp;ng/µl, 988&nbsp;bp)
 +
|-
 +
|2&nbsp;µl
 +
|T4 ligase buffer (10x)
 +
|-
 +
|1&nbsp;µl
 +
|T4 ligase (1&nbsp;U/µl)
 +
|-
 +
|14.49&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=20&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Negative control was als prepared. Instead of the insert, the same volume of ddH2O was added to the reaction batch and was labeled as P698 NK.
 +
 +
* Cycled ligation has been performed after following protocol in a thermocycler:
 +
{|cellspacing="0" border="1"
 +
|100 cycles
 +
|12&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|
 +
|22&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|Hold
 +
|16&nbsp;°C
 +
|infinite
 +
|}
 +
 +
Lid temperature&nbsp;=&nbsp;37&nbsp;°C
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
=== Analytical digestion and gelelectrophoresis of P676, P73, P81, P134 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Analytical digestion and gelelectrophoresis of P676 (pSB6A0 (BBa_K268000)), P73 (BBa_K207001 in pSB1A2), P81 (BBa_K207000 in pSB3K3), P134 (BBa_K165055 in BBa_J63009).
 +
 +
'''Procedure:'''
 +
 +
* Reaction batch for digestion of P676 with EcoRI-HF and SpeI-HF:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2.5&nbsp;µl
 +
|Plasmid DNA (P676)
 +
|-
 +
|2&nbsp;µl
 +
|NEBuffer 4 (10x)
 +
|-
 +
|0.2&nbsp;µl
 +
|BSA (100x)
 +
|-
 +
|0.25&nbsp;µl
 +
|EcoRI-HF (20&nbsp;U/µl) (NEB)
 +
|-
 +
|0.25&nbsp;µl
 +
|SpeI-HF (20&nbsp;U/µl) (NEB)
 +
|-
 +
|14.8&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=60&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Mastermix for digestion of P676 (pSB6A0 (BBa_K268000)), P73 (BBa_K207001 in pSB1A2), P81 (BBa_K207000 in pSB3K3), P134 (BBa_K165055 in BBa_J63009):
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|8&nbsp;µl
 +
|NEBuffer 4 (10x)
 +
|-
 +
|0.8&nbsp;µl
 +
|BSA (100x)
 +
|-
 +
|1&nbsp;µl
 +
|XbaI (20&nbsp;U/µl) (NEB)
 +
|-
 +
|1&nbsp;µl
 +
|PstI (20&nbsp;U/µl) (NEB)
 +
|-
 +
|49.2&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=60&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* For digestion of P73, P81, P134 15&nbsp;µl of the mastermix for XbaI+PstI-HF was added to 5&nbsp;µl of plasmid DNA.
 +
 +
* Analytical digestion mixes were incubated at 37&nbsp;°C for 1.5&nbsp;h.
 +
 +
* 2&nbsp;µl of DNA loading buffer (10x) was added to each reaction batch.
 +
 +
* 10&nbsp;µl of each sample was loaded into the gel pocket.
 +
 +
* Analytical gelelectrophoresis was performed at 90&nbsp;V for 1&nbsp;h
 +
 +
{|cellspacing="0" border="1"
 +
|1&nbsp;kbp DNA ladder
 +
|P676(pSB6A0 (BBa_K268000))
 +
|P73 (BBa_K207001 in pSB1A2)
 +
|P81 (BBa_K207000 in pSB3K3)
 +
|P134 (BBa_K165055 in BBa_J63009)
 +
|-
 +
|
 +
|Bands like expected!
 +
|Corrupt!
 +
|Corrupt!
 +
|Corrupt!
 +
|}
 +
 +
[[File:TUM12 20120908 anal gel P676 P73 P81 P134.jpg|500px]]
 +
 +
* Conclusion for P676 (=pSB6A0 (BBa_K268000)): This part contains at least one forbidden restriction site (XbaI or PstI, please see analytical gel from September, the 6th. But here, one can see that EcoRI and SpeI can nevertheless be used for cloning parts into pSB6A0
 +
 +
* The other parts (P73 (BBa_K207001 in pSB1A2), P81 (BBa_K207000 in pSB3K3), P134 (BBa_K165055 in BBa_J63009)) are all completely wrong! Wrong size of bands and partially also the vector!
 +
 +
</div>
</div>
<div class="limonene">
<div class="limonene">
 +
===Ligation of citrus limonene synthase into pSB1C3 containing TEF1/TEF2 promoter ===
===Ligation of citrus limonene synthase into pSB1C3 containing TEF1/TEF2 promoter ===
Line 24,468: Line 25,721:
|}
|}
 +
'''Negative control water in P492'''
 +
{|cellspacing="0" border="1"
 +
|'''Substance'''
 +
|'''Volume'''
 +
|-
 +
|P492 (digested with Xba1+Age1)
 +
|1.52&nbsp;µl
 +
|-
 +
|ddH2O
 +
|6.488&nbsp;µl
 +
|-
 +
|T4 ligase
 +
|1&nbsp;µl
 +
|-
 +
|T4 ligase buffer
 +
|1&nbsp;µl
 +
|-
 +
|'''TOTAL'''
 +
|=10&nbsp;µl
 +
|}
'''Citrus LS (p578) in pSB1C3 with TEF1 (p493)'''
'''Citrus LS (p578) in pSB1C3 with TEF1 (p493)'''
Line 24,489: Line 25,762:
|=10&nbsp;µl
|=10&nbsp;µl
|}
|}
 +
 +
'''Negative control water in P493'''
 +
{|cellspacing="0" border="1"
 +
|'''Substance'''
 +
|'''Volume'''
 +
|-
 +
|P493 (digested with Xba1+Age1)
 +
|2.05&nbsp;µl
 +
|-
 +
|ddH2O
 +
|5.958&nbsp;µl
 +
|-
 +
|T4 ligase
 +
|1&nbsp;µl
 +
|-
 +
|T4 ligase buffer
 +
|1&nbsp;µl
 +
|-
 +
|'''TOTAL'''
 +
|=10&nbsp;µl
 +
|}
 +
 +
'''Citrus LS (PCR1, restriction digest on 7th September) in pSB1C3 (restriction digest 7th September)'''
 +
{|cellspacing="0" border="1"
 +
|'''Substance'''
 +
|'''Volume'''
 +
|-
 +
|pSB1C3 (digested with Xba1+Age1)
 +
|0.71&nbsp;µl
 +
|-
 +
|LS (PCR1 digested with Xba1+Age1)
 +
|7.298&nbsp;µl
 +
|-
 +
|T4 ligase
 +
|1&nbsp;µl
 +
|-
 +
|T4 ligase buffer
 +
|1&nbsp;µl
 +
|-
 +
|'''TOTAL'''
 +
|=10&nbsp;µl
 +
|}
 +
 +
'''Negative control water in pSB1C3 (restriction digest 7th September)'''
 +
{|cellspacing="0" border="1"
 +
|'''Substance'''
 +
|'''Volume'''
 +
|-
 +
|pSB1C3 (digested with Xba1+Age1)
 +
|0.71&nbsp;µl
 +
|-
 +
|ddH2O
 +
|7.298&nbsp;µl
 +
|-
 +
|T4 ligase
 +
|1&nbsp;µl
 +
|-
 +
|T4 ligase buffer
 +
|1&nbsp;µl
 +
|-
 +
|'''TOTAL'''
 +
|=10&nbsp;µl
 +
|}
 +
 +
'''ligation reactions are stored in a 50 ml falcon at the lowest drawer of -20°C.'''
 +
</div>
</div>
 +
<div class="limonene">
 +
 +
===Large-scale cell lysation ===
 +
 +
'''Investigator:''' Volker, Lara
 +
 +
'''Aim:''' Production of cell lysate (large-scale).
 +
 +
 +
1. OD of cell cultures were measured:
 +
* clone 1: OD600=4.2
 +
* clone 2: OD600=2.8
 +
* control: clone 2 (uninduced) OD600=5,6 (medium: SC+Glu)
 +
* control: S. cer (not transformed) OD600=4,6 (medium:SC+uracil)
 +
 +
 +
2. Cell cultures were centrifuged (large scale:25 min at 3000 rpm; controls: 10 min at 3000rpm) and the pellet was washed in breaking buffer (without PMSF).
 +
*200 ml BB for large-scale cultures
 +
*50 ml BB for controls
 +
 +
 +
3. After centrifugation, pellets were resuspended in breaking buffer (with PMSF) to reach an OD of 70-100.
 +
* large-scale cultures(2L): 80 ml BB+PMSF
 +
* controls (50ml): 2,5 ml BB+PMSF
 +
 +
 +
4. 1 volume of glass beads (0,5 mm) was added. In cool room: 20-40 cycles of vortexing (30 sec) and incubation (30 sec).
 +
 +
 +
5. the supernatant was transferred to fresh tubes.
 +
 +
Samples were stored at the lowest drawer of -20°C in a 50 ml falcon tube.
 +
 +
'''Suggestion for next time:''' Take a transformed yeast (induced) in small-scale as third control.
 +
 +
 +
 +
</div>
 +
 +
<div class="limonene">
 +
 +
===Production of Breaking buffer ===
 +
 +
'''Investigator:''' Lara, Andrea
 +
 +
'''For 1 L of 1 M sodium phosphate buffer:'''
 +
 +
prepare:
 +
* 127,8 g Na2HPO4; add 900 ml of distilled water -> solution 1
 +
* 24 g of NaH2PO4; add 200 ml of distilled water -> solution 2
 +
 +
* mix 845 ml of solution 1 with 155 ml of solution 2 (you can measure the amount by weight scale)
 +
* adjust pH to pH=7.5 by adding more of solution 1 or solution 2
 +
* autoclave and store at room temperature
 +
 +
'''For PMSF solution:'''
 +
 +
* has to be made each time, can not be stored due to short half time
 +
* 0,0522 g PMSF; add 3 ml isopropanol
 +
 +
'''For breaking buffer with PMSF:'''
 +
 +
50 mM sodium phosphate buffer
 +
1 mM EDTA
 +
5 % glycerol
 +
1 mM PMSF
 +
 +
</div>
 +
 +
<div class="limonene">
 +
=== Transformation of ''E.&nbsp;coli''''' ===
 +
 +
'''Investigator:''' Saskia
 +
 +
'''Aim of the experiment:''' Transformation of ''E.&nbsp;coli'' XL1-Blue with the ligation products Lara 1,2,3 and NK492, NK493, NKpSB1C3
 +
 +
'''Procedure:'''
 +
 +
* 5µl of each ligation product were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice.
 +
 +
* 30&nbsp;min incubation on ice.
 +
 +
* 5&nbsp;min heat shock at 37&nbsp;°C
 +
 +
* Adding of 1&nbsp;ml LB-medium to each tube.
 +
 +
* Incubation for 45&nbsp;min at 37&nbsp;°C in the 180&nbsp;rpm cell-culture shaker.
 +
 +
* 100&nbsp;µl of those cell suspension were plated on chloramphenicol plates.
 +
 +
* The rest was centrifuged for 1&nbsp;min at 13000&nbsp;rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100&nbsp;µl of LB-medium and this concentrated cell suspension was plated again on chloramphenicol plates.
 +
 +
*incubation over night (37°C)
 +
</div>
 +
<div class="coumaryl">
 +
 +
===Cloning of Xanthohumol gene constructs in pTUM104 vector backbone of the Limonen group continued===
 +
'''Investigator:''' Ingmar
 +
*From each gene construct transformed in XL1 blue cells on saturday 08th september 2012 a single clone was picked an transferred into 7 ml fresh LB-media containing 1:1000 ampicilin(as the number of colonies of CHS+/- was low a few clones were picked). Incubation overnight at 37°C and 180 rpm.
 +
</div>
 +
 +
== '''Sunday, September 9th''' ==
 +
 +
<div class="light_switchable_promoter">
 +
=== Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation products P698+P699 and biobricks BBa_J52008, BBa_E0020, BBa_E2060, BBa_E0026, BBa_E0036, BBa_E0040, BBa_E1010 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation products P698+P699 and biobricks BBa_J52008 in pSB1AK3, BBa_E0020 in pSB1A2, BBa_E2060 in pSB2K3, BBa_E0026 in pSB1A2, BBa_E0036 in pSB1A2, BBa_E0040 in pSB1A2, BBa_E1010 in pSB2K3.
 +
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 5&nbsp;µl of the ligation product (P698+P699) and it's negative control (P698 NK) were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice. 2&nbsp;µl of the biobricks BBa_J52008 in pSB1AK3, BBa_E0020 in pSB1A2, BBa_E2060 in pSB2K3, BBa_E0026 in pSB1A2, BBa_E0036 in pSB1A2, BBa_E0040 in pSB1A2, BBa_E1010 in pSB2K3 were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice.
 +
 +
* 30&nbsp;min incubation on ice.
 +
 +
* 5&nbsp;min heat shock at 37&nbsp;°C
 +
 +
* Adding of 1&nbsp;ml LB-medium to each tube.
 +
 +
* Incubation for 45&nbsp;min at 37&nbsp;°C in the 180&nbsp;rpm cell-culture shaker.
 +
 +
* 100&nbsp;µl of those cell suspension (only ligation products!) were plated on chloramphenicol plates.
 +
 +
* The rest (ligation products and biobricks) were centrifuged for 1&nbsp;min at 13000&nbsp;rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100&nbsp;µl of LB-medium and these concentrated cell suspensions was plated on suitable antibiotic plates.
 +
 +
* Incubation at 37&nbsp;°C overnight.
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
=== Cycled ligation of P698+P699 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Cycled ligation of P698+P699 (TEF1 promoter - SV40NLS-Gal4AD-30aaLinker-Pif3(100NT) + TEF1 terminator - TEF1 promoter).
 +
 +
'''Procedure:'''
 +
 +
* Ligation batch for P698+P699
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1.32&nbsp;µl
 +
|P698 (75.5&nbsp;ng/µl, 3316&nbsp;bp)
 +
|-
 +
|2.92&nbsp;µl
 +
|P699 (30.4&nbsp;ng/µl, 988&nbsp;bp)
 +
|-
 +
|2&nbsp;µl
 +
|T4 ligase buffer (10x)
 +
|-
 +
|1&nbsp;µl
 +
|T4 ligase (1&nbsp;U/µl)
 +
|-
 +
|12.76&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=20&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Negative control was als prepared. Instead of the insert, the same volume of ddH2O was added to the reaction batch and was labeled as P698 NK.
 +
 +
* Cycled ligation has been performed after following protocol in a thermocycler:
 +
{|cellspacing="0" border="1"
 +
|100 cycles
 +
|12&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|
 +
|22&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|Hold
 +
|16&nbsp;°C
 +
|infinite
 +
|}
 +
 +
Lid temperature&nbsp;=&nbsp;37&nbsp;°C
 +
</div>
 +
 +
<div class="coumaryl">
 +
=== Cloning of Xanthohumol gene constructs in pTUM104 vector backbone of the Limonen group continued ===
 +
 +
'''Investigator:''' Ingmar
 +
 +
'''Aim of the experiment:''' Get purified DNA for transformation in yeast and check wheather the inserts are correct.
 +
 +
'''Procedure:'''
 +
* Using a Quiagen kit a miniprep of the overnight culture was done.
 +
* The resulting purified DNA was aliquoted in new tubes labeled as follows:
 +
{| {{table}}
 +
| align="center" style="background:#f0f0f0;"|'''Plasmid number'''
 +
| align="center" style="background:#f0f0f0;"|'''Content'''
 +
| align="center" style="background:#f0f0f0;"|'''Concentration'''
 +
|-
 +
| P739||PAL+ (P236) in Limonen pYes(P515)||220,9 ng/µl
 +
|-
 +
| P740||PAL- (P200) in Limonen pYes(P515)||133,6 ng/µl
 +
|-
 +
| P741||4Cl+ (P193)in Limonen pYes (P515)||312,7 ng/µl
 +
|-
 +
| P742||4Cl- (P194)in Limonen pYes(P515)||89,4 ng/µl
 +
|-
 +
| P743||CHS+ (P428)in Limonen pYes(P515)||204,7 ng/µl
 +
|-
 +
| P744||CHS in Limonen pYes||53,1 ng/µl
 +
|-
 +
| P745||CHS- (P429)in Limonen pYes(P515)||65,8 ng/µl
 +
|-
 +
| P746||CHS- (P429)in Limonen pYes(P515)||531,8 ng/µl
 +
|-
 +
| P747||CHS- (P429)in Limonen pYes(P515)||53,6 ng/µl
 +
|-
 +
| P748||OMT- (P198)in Limonen pYes(P515)||250,4 ng/µl
 +
|-
 +
| P749||APT (P263)in Limonen pYes(P515)||97,1 ng/µl
 +
|-
 +
|}
 +
 +
*Afterwards a control digestion of P739-P749 was done.
 +
 +
'''Reaction batch'''
 +
{|cellspacing="0" border="1"
 +
|Plasmid DNA
 +
|2.5 µl
 +
|-
 +
|NEB3 buffer
 +
|2 µl
 +
|-
 +
|PstI-HF
 +
|0.25 µl
 +
|-
 +
|XbaI
 +
|0.25 µl
 +
|-
 +
|ddH2O
 +
|15 µl
 +
|-
 +
|Sum
 +
|20 µl
 +
|}
 +
*Incubation at 37 °C for 1h.
 +
*Verification of control digest by agarose gel electrophoresis:
 +
 +
20 µl of each digest product was mixed with 2 µl 10x DNA loading buffer and loaded into the gel. The separation process lasted 1h at 90 V.
 +
 +
[[File:TUM12_Xanthohumol_Strukturenzyme_in_pYes_Limonen_Kontrollverdau_beschriftet_1.jpg|500px|Gel picture of control digest genes in limonene pYes 1]]
 +
 +
 +
The ligation of all batches except P 743 was successfull as the bonds appear at the expected length.
 +
</div>
 +
 +
<div class="coumaryl">
 +
 +
===  Quick Change mutagenesis to remove mutations found by sequencing in our gene constructs  ===
 +
 +
'''Investigator: Ingmar'''
 +
 +
'''Aim of the experiment: '''Deletion of found mutations.
 +
 +
'''Operational sequence'''
 +
 +
 +
'''1. PCR general setup'''<br>
 +
'''Reaction batch 1'''
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2.5 µl
 +
|10x Pfu Ultra II buffer
 +
|-
 +
|4 µl
 +
|DNA template
 +
|-
 +
|0.5 µl
 +
|1:10 dilution of appropriate Oligo (= 5 pmol)
 +
|-
 +
|17 µl
 +
|ddH2O
 +
|-
 +
|0.5 µl
 +
|dNTP mix
 +
|-
 +
|0.5 µl
 +
|Pfu Ultra II DNA polymerase (2.5 U / µl)
 +
|}
 +
 +
'''Reaction batch 2'''
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2.5 µl
 +
|10x Pfu Ultra II buffer
 +
|-
 +
|4 µl
 +
|DNA template
 +
|-
 +
|0.5 µl
 +
|1:10 dilution of appropriate Oligo (= 5 pmol)
 +
|-
 +
|17 µl
 +
|ddH2O
 +
|-
 +
|0.5 µl
 +
|dNTP mix
 +
|-
 +
|0.5 µl
 +
|Pfu Ultra II DNA polymerase (2.5 U / µl)
 +
|}
 +
 +
 +
'''PCR cycling parameters'''
 +
{|cellspacing="0" border="1"
 +
|'''Segment'''
 +
|'''Cycles'''
 +
|'''Temperature'''
 +
|'''Time'''
 +
|-
 +
|1
 +
|1
 +
|95 °C
 +
| 30 sec
 +
|-
 +
|2
 +
|10
 +
|95°C
 +
| 30 sec
 +
|-
 +
|
 +
|
 +
|55°C
 +
| 1 min
 +
|-
 +
|
 +
|
 +
|67°C
 +
| 6 min
 +
|-
 +
|}
 +
*Having completed the PCR cycling parameters listed above both PCR reaction batches were mixed together and the cycling parameters listed above were one time more applied.
 +
 +
'''2. Used constructs and primers'''
 +
{| {{table}}
 +
| align="center" style="background:#f0f0f0;"|'''Quickchange number'''
 +
| align="center" style="background:#f0f0f0;"|'''Plasmid number'''
 +
| align="center" style="background:#f0f0f0;"|'''Geneconstruct'''
 +
| align="center" style="background:#f0f0f0;"|'''Primer number'''
 +
| align="center" style="background:#f0f0f0;"|'''Primer'''
 +
|-
 +
| QC 1||P428||CHS+ pYes||O104 & O105||c614t
 +
|-
 +
| QC 2||P429||CHS- pYes||O104 & O105||c614t
 +
|-
 +
| QC 3||P430||CHS+ pSB1C3||O104 & O105||c614t
 +
|-
 +
| QC 4||P431||CHS- pSB1C3||O104 & O105||c614t
 +
|-
 +
| QC 5||P197||OMT+ pYes||O96 & O97||a1055g
 +
|-
 +
| QC 6||P198||OMT- pYes||O96 & O97||a1055g
 +
|-
 +
| QC 7||P236||PAL+ pYes||O108 & O109||a770g
 +
|-
 +
| QC 8||P200||PAL- pYes||O108 & O109||a770g
 +
|-
 +
| QC 9||P188||PAL- pSB1C3||O108 & O109||a770g
 +
|-
 +
| QC 10||P187||PAL+ pSB1C3||O108 & O109||a770g
 +
|-
 +
|
 +
|}
 +
*Digestion of the parental DNA with DpnI: Addition of 1 µl DpnI to the PCR batch and incubate for 1 h at 37 °C.
 +
 +
</div>
 +
</div>
 +
 +
=Week 14=
 +
 +
<div class=week id="WWeek_14">
 +
== '''Monday, September 10th''' ==
 +
<div class="constitutive_promoter">
 +
===Transformation of ''E.coli'' Xl1-blue with ligation of P578 and P679,P680===
 +
 +
'''Investigator: Georg'''
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 10 µl of ligation product (P265B) was added to 100 µl of competent cells and gently mixed.
 +
 +
* 30 min incubation on ice
 +
 +
* 5 min. heat shock at 37°C
 +
 +
* Adding of 1ml LB-medium to each tube.
 +
 +
* Incubation for 45min at 37°C in the 180rpm cell-culture shaker.
 +
 +
* 100µl of those cell suspension were plated on ampicillin plates.
 +
 +
* The rest were centrifuged for 1min at 13000rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100µl of LB-medium and this concentrated cell suspension was plated again on new ampicillin plates.
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Gelextraction of TEF2-P clone P451 (xbaI and PSTI-HF, SpeI-HF PstI-HF) and ADH1-T (XbaI PstI-HF, SpeI-HF and PstI-HF===
 +
 +
'''Investigator:Georg'''
 +
* Gelextraction was done according to Quiaquick gelextraction protocoll
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
===Nanodrop measurement of P707, P708, P709 and P710===
 +
''' Investigator:Georg'''
 +
* P707: 9,9 ng/µl
 +
* P708: 19,6 ng/µl
 +
* P709: 55,7 ng/µl
 +
* P710: 61,6 ng/µl
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Ligation of TEF2-P (clone P451) with pTUM100 and of P578 with P710===
 +
'''Investigator: Georg'''
 +
 +
'''Procedure:'''
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|2,48 µl
 +
|P578
 +
|-
 +
|1,62 µl
 +
|P710
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|12,9 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for Ligation:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|T4-Ligase (1u/µl)
 +
|-
 +
|3,17 µl
 +
|P572
 +
|-
 +
|2,08 µl
 +
|P708
 +
|-
 +
|2
 +
|10x T4-ligase buffer
 +
|-
 +
|11,75 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* From each ligation, negative controls were made with ddH20 instead of the insert
 +
* Cycled ligation has been performed after following protocol in a thermocycler:
 +
{|cellspacing="0" border="1"
 +
|100 cycles
 +
|12&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|
 +
|22&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|Hold
 +
|16&nbsp;°C
 +
|infinite
 +
|}
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Picking colonies from P638, BBa_J52008, BBa_E2060, BBa_E0036, BBa_E1010===
 +
 +
''' Investigator: Georg'''
 +
* Colonies were picked and transferred into 5 ml LB-medium with 1x CAM (P638), Kan (BBa_J52008,BBa_E2060), Amp (BBa_E0036)
 +
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
=== Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation product P698+P699 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation product.
 +
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 5&nbsp;µl of the ligation product (P698+P699) and it's negative control (P698 NK) were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice.
 +
 +
* 30&nbsp;min incubation on ice.
 +
 +
* 5&nbsp;min heat shock at 37&nbsp;°C
 +
 +
* Adding of 1&nbsp;ml LB-medium to each tube.
 +
 +
* Incubation for 45&nbsp;min at 37&nbsp;°C in the 180&nbsp;rpm cell-culture shaker.
 +
 +
* 100&nbsp;µl of those cell suspension were plated on chloramphenicol plates.
 +
 +
* The rest of the suspension was centrifuged for 1&nbsp;min at 13000&nbsp;rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100&nbsp;µl of LB-medium and was plated on chloramphenicol plates.
 +
 +
* Incubation at 37&nbsp;°C overnight.
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
=== Electroporation of electrocompetent ''E.&nbsp;coli'' with P698+699 ===
 +
 +
'''Investigator:''' Jeff, Adam
 +
 +
'''Aim of the experiment:''' Electroporation of electrocompetent ''E.&nbsp;coli'' with P698+699
 +
 +
'''Procedure:'''
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
=== Preparative digestion and gelelectrophoresis of P676 ===
 +
 +
'''Investigator:''' Alois, Martin
 +
 +
'''Aim of the experiment:''' Preparative digestion and gelelectrophoresis of P676.
 +
 +
'''Procedure:'''
 +
 +
* Reaction batch for digestion of P687 with SpeI-HF+PstI-HF:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|P676
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer&nbsp;4 (10x)
 +
|-
 +
|-
 +
|0.4&nbsp;µl
 +
|BSA&nbsp; (100x)
 +
|-
 +
|1&nbsp;µl
 +
|EcoRI-HF (20&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|SpeI-HF (20&nbsp;U/µl)
 +
|-
 +
|13.6&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Preparative digestion mix was incubated for 2&nbsp;h at 37&nbsp;°C.
 +
 +
* After incubation ~4-5&nbsp;µl of DNA loading buffer (10x) was added to reaction mix.
 +
 +
* Preparative gelelectrophoresis was performed for xxx&nbsp;h at 70&nbsp;V
 +
 +
{|cellspacing="0" border="1"
 +
|Part from other subproject
 +
|1&nbsp;kbp DNA ladder
 +
|Part from other subproject
 +
|P676 EcoRI-HF&nbsp;+&nbsp;SpeI-HF
 +
|-
 +
|
 +
|
 +
|
 +
|Band was cut out (4791 bp, 76.1 ng/µl)
 +
|}
 +
 +
[[File:TUM12_20120910_120910_GenomTTT.jpg|500px]]
 +
 +
* Gel purification after manufacturer's protocol (Qiagen) after cutting out the DNA band.
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
=== Picking of ''E.&nbsp;coli'' XL1-Blue transformated with biobricks BBa_J52008, BBa_E2060, BBa_E0036, BBa_E1010 ===
 +
 +
'''Investigator:''' Georg
 +
 +
'''Aim of the experiment:''' Picking of ''E.&nbsp;coli'' XL1-Blue transformated with biobricks BBa_J52008 in pSB1AK3, BBa_E2060 in pSB2K3, BBa_E0036 in pSB1A2, BBa_E1010 in pSB2K3.
 +
 +
'''Procedure:'''
 +
 +
* 4 colonies of each transformation were taken.
 +
 +
* Colonies were picked with pipette tips and transferred into a new cell-culture tube with 4&nbsp;ml of LB-medium and suitable antibiotics. These tubes were put overnight in a 180&nbsp;rpm cell culture shaker at 37&nbsp;°C.
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
=== Preparative digestion of P686, P691, P692, P696 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Preparative digestion of P686 (SpeI-HF+PstI-HF), P691 (XbaI+PstI-HF), P692(XbaI+PstI-HF), P696(XbaI+PstI-HF).
 +
 +
'''Procedure:'''
 +
 +
* Reaction batch for digestion of P686 with SpeI-HF+PstI-HF:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|P686
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer&nbsp;4 (10x)
 +
|-
 +
|-
 +
|0.4&nbsp;µl
 +
|BSA&nbsp; (100x)
 +
|-
 +
|1&nbsp;µl
 +
|Spe-HF (20&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|13.6&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for digestion of P691 with XbaI+PstI-HF:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|P691
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer&nbsp;4 (10x)
 +
|-
 +
|-
 +
|0.4&nbsp;µl
 +
|BSA&nbsp; (100x)
 +
|-
 +
|1&nbsp;µl
 +
|XbaI (20&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|13.6&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for digestion of P692 with XbaI+PstI-HF:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|P692
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer&nbsp;4 (10x)
 +
|-
 +
|-
 +
|0.4&nbsp;µl
 +
|BSA&nbsp; (100x)
 +
|-
 +
|1&nbsp;µl
 +
|XbaI (20&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|13.6&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch for digestion of P696 with XbaI+PstI-HF:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|20&nbsp;µl
 +
|P696
 +
|-
 +
|4&nbsp;µl
 +
|NEBuffer&nbsp;4 (10x)
 +
|-
 +
|-
 +
|0.4&nbsp;µl
 +
|BSA&nbsp; (100x)
 +
|-
 +
|1&nbsp;µl
 +
|XbaI (20&nbsp;U/µl)
 +
|-
 +
|1&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|13.6&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=40&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Reaction batch was incubated at 37&nbsp;°C overnight.
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Induction of expression of CaDXMT1 ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim of the experiment:'''
 +
 +
Aim of the experiment was the start of the expression of CaDXMT1. This is the third and last gene, neccessary for caffeine- synthesis (previous transformation experiments did not work).
 +
 +
'''Operational sequence:'''
 +
 +
First of all, the OD600 of the over night culture was determined: 4,42 (0,442 at 1/10 dilution). Next, 200ml of SC-U 2% galactose medium were inoculated with an adequate amount of the over night culture (has grown in SC-U 2% glucose).
 +
'''Note:''' Not the whole amount of the calculated over night culture was centrifuged down. Thus, about 12 ml of glucose medium were given to the galactose medium. In theory, the expression will start a little bit later, due to the repression of the Gal1 promoter (glucose mediated).
 +
 +
'''Sampling:'''
 +
 +
* 15 min after induction (12:00 am) (OD600: 0,442)
 +
* xx min after induction
 +
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Picking of colonies for miniprep ===
 +
 +
'''Investigator:''' Dennis
 +
 +
'''Aim:''' New miniprep for new transformation of E. coli with ligation batch B2A_3+ADH1 terminator and B1B_2+ ADH1 terminator and B3D_3+ ADH1 terminator
 +
 +
* Picking of 3 clones each of  ligation batch
 +
* Inbucation at 37°C (shaker) over night.
 +
 +
</div>
 +
 +
<div class="caffeine">
 +
 +
=== Transformation of ''E.&nbsp;coli''''' ===
 +
 +
'''Investigator:''' Dennis
 +
 +
'''Aim of the experiment:''' Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation products of ADH1 Terminator+B1B_1, ADH1 terminator+ B3D_3.
 +
 +
'''Procedure:'''
 +
 +
* 20&nbsp;µl of each ligation products were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice.
 +
 +
* 30&nbsp;min incubation on ice.
 +
 +
* 5&nbsp;min heat shock at 37&nbsp;°C
 +
 +
* Adding of 1&nbsp;ml LB-medium to each tube.
 +
 +
* Incubation for 45&nbsp;min at 37&nbsp;°C in the 180&nbsp;rpm cell-culture shaker.
 +
 +
* 100&nbsp;µl of those cell suspension were plated on chloramphenicol plates.
 +
 +
* The rest were centrifuged for 1&nbsp;min at 13000&nbsp;rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100&nbsp;µl of LB-medium and this concentrated cell suspension was plated again on chloramphenicol plates.
 +
 +
* Incubation at 37&nbsp;°C overnight.
 +
 +
</div>
 +
 +
<div class="caffeine">
 +
 +
=== Ligation of ADH1+B1B_1, ADH1+B3D_3 ===
 +
 +
'''Investigator:''' Dennis
 +
 +
'''Aim of the experiment:''' ligation was performed for B1B_1 and B3D_3
 +
 +
'''Procedure:'''
 +
 +
 +
* Ligation batch for ADH1+B1B_1
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2,66 &nbsp;µl
 +
|ADH1 (16,6&nbsp;ng/µl, 2048&nbsp;bp)
 +
|-
 +
|1,8 &nbsp;µl
 +
|B1B_1 (91,4 &nbsp;ng/µl, 825&nbsp;bp)
 +
|-
 +
|2&nbsp;µl
 +
|T4 ligase buffer (10x)
 +
|-
 +
|1&nbsp;µl
 +
|T4 ligase (1&nbsp;U/µl)
 +
|-
 +
|12,5 ddH2O
 +
|=20&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* the ligation has been performed at 16 °C
 +
 +
</div>
 +
 +
<div class="caffeine">
 +
 +
=== Plating of transformed yeast colony (with pTUM104_CaDXMT1) ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim:''' Backup of the transformant for further usage
 +
 +
'''Operational sequence:'''
 +
 +
150 µl were plated on SC-U agar plates (2% glucose) and incubated at 30°C for a few days.
 +
 +
</div>
 +
 +
<div class ="thaumatin">
 +
 +
=== Preparative digest of p667 (pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term) and ligation with p649 (integration vector digested with EcoRI and SpeI) + Trafo ===
 +
 +
'''Investigator:''' Martin, Alois
 +
 +
'''Aim of the experiment:''' Getting integration_vector_TEF1Prom_Preprothaumatin_TEF1Term
 +
 +
Preparative digest:
 +
 +
* 30 µl p667, 1 µl EcoRI, 1 µl SpeI, 0.5 µl BSA, 5 µl NEBuffer 4, 12.5 µl ddH2O; 37°C, 2 h.
 +
 +
Preparative gel electrophoresis: 1 kb, p667, (p468), (Jeff).
 +
 +
[[File:120910_GenomTTT_TUM12.jpg|220px]]
 +
 +
* Expected: backbone: 2.2 kb, insert: 1.7 kb. '''Successful'''.
 +
 +
Gel extraction:
 +
 +
* pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term digested with EcoRI and SpeI = p735.
 +
 +
Ligation of p735 and p649 (=> p737)
 +
 +
* 1 µl T4 DNA ligase, 2 µl T4 DNA ligase buffer, 10 µl p649, 8.5 µl p735; 45 min RT.
 +
 +
Transformation of p737 integration_vector_TEF1Prom_Preprothaumatin_TEF1Term (=> Amp).
 +
 +
 +
 +
</div>
 +
 +
<div class ="thaumatin">
 +
 +
=== Preparative digest of p468 ("pSB1C3_backbone") and ligation with p735 ("TEF1Prom_Preprothaumatin_TEF1Term") + Trafo ===
 +
 +
'''Investigator:''' Martin, Alois, Fabiano Celentano
 +
 +
'''Aim of the experiment:''' Getting pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term with functional NotI
 +
 +
Preparative digest:
 +
 +
* 20 µl p468, 1 µl EcoRI, 1 µl SpeI, 0.5 µl BSA, 5 µl NEBuffer 4, 22.5 µl ddH2O; 37°C, 2 h.
 +
 +
Preparative gel electrophoresis: 1 kb, (p667), p468, (Jeff).
 +
 +
 +
[[File:120910_GenomTTT_TUM12.jpg|220px]]
 +
 +
* Expected: backbone: > 2.2, insert: 2.2 kb ("pSB1C3_backbone"). '''Successful'''.
 +
 +
Gel extraction:
 +
 +
* pSB1C3_backbone digested with EcoRI and SpeI = p736.
 +
 +
Ligation of p736 and p735 (=> p738)
 +
 +
* 1 µl T4 DNA ligase, 2 µl T4 DNA ligase buffer, 1.3 µl p736, 13.5 µl p735, 2 µl ddH2O; 45 min RT.
 +
 +
Transformation of p738 = pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term with functional NotI (Cam).
 +
 +
 +
</div>
 +
 +
<div class="limonene">
 +
===Western blot of samples of the expressed Limonenesynthase (harvested on 5th September and on 8th September)===
 +
 +
'''Investigator:''' Andrea
 +
 +
'''Aim:''' Analysis of the expression of Limonenesynthase
 +
 +
'''Procedure:'''
 +
 +
'''SDS-PAGE'''
 +
*order: I am not sure about the order, but it is noted (sheet in labjournal) --> the marker is on the right side !!
 +
*120V, 2h
 +
 +
'''preparation of solutions:''' as described in the materials
 +
*PBS-T0.1
 +
*PBS-T0.1 with 3% BSA
 +
 +
'''Blotting:'''
 +
 +
*blotting of proteins on Nitrocellulose Membrane
 +
*gel and membrane in transferbuffer for 10 min
 +
*50mA, 1.25 h
 +
 +
'''Blocking:'''
 +
 +
*wash 3x5min with PBS-T0.1
 +
*the membrane is blocked over night in PBS-T0.1 with 3% BSA at 4 °C on a shaking device
 +
 +
</div>
 +
 +
<div class ='Xanthohumol'>
 +
=== Transformation of ''E.&nbsp;coli'' XL1-Blue  ===
 +
 +
'''Investigator:''' Ingmar, Daniela
 +
 +
'''Aim of the experiment:''' Transformation of ''E.&nbsp;coli'' XL1-Blue with quickchange products and plasmids for stemm preservation.
 +
 +
'''Procedure:'''
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
* 5&nbsp;µl of the quickchange products and 1 µl of the miniprep products  were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice.
 +
* Used DNA:
 +
** P430 CHS+ in pSb1C3
 +
** P431 CHS- in pSB1C3
 +
** P593 4Cl+ in pSB1C3 after sdm 24.08.2012
 +
** P594 4Cl- in pSB1C3 after sdm 24.08.2012
 +
** P595 4Cl+ in pYes after sdm 24.08.2012
 +
** P596 4Cl- in pYes after sdm 24.08.2012
 +
** P209 APT in pSb1C3
 +
** P137 OMT+ in pSB1C3
 +
** Quickchange products:
 +
*** P428 CHS+ in pYes sdm with c614t
 +
*** P429 CHS- in pYes sdm with c614t
 +
*** P430 CHS+ in pSb1C3 sdm with c614t
 +
*** P431 CHS- in pSb1C3 sdm with c614t
 +
*** P197 OMT+ in pYes sdm with a1055g
 +
*** P198 OMT- in pYes sdm with a1055g
 +
*** P236 PAL+ in pYes sdm with a770g
 +
*** P200 PAL- in pYes sdm with a770g
 +
*** P188 PAL- in pSb1C3 sdm with a770g
 +
*** P187 PAL+ in pSb1C3 sdm with a770g
 +
* 30&nbsp;min incubation on ice.
 +
* 5&nbsp;min heat shock at 37&nbsp;°C
 +
* Adding of 1&nbsp;ml LB-medium to each tube.
 +
* Incubation for 45&nbsp;min at 37&nbsp;°C in the 180&nbsp;rpm cell-culture shaker.
 +
* 100&nbsp;µl of those cell suspension were plated on LB plates containing the appropriate antibiotics.
 +
* The rest of the suspension was centrifuged for 1&nbsp;min at 13000&nbsp;rpm and the supernatant was dicarded.
 +
* The pellet was resuspended in 100&nbsp;µl of LB-medium and was plated on LB plates containing the appropriate antibiotics.
 +
* Incubation at 37&nbsp;°C overnight.
 +
</div>
 +
 +
== '''Tuesday, September 11th''' ==
 +
<div class="constitutive_promoter">
 +
===Tranformation of ''E.coli'' Xl1-blue with ligation product from 07.9.2012===
 +
'''Investigator: Georg'''
 +
* Last time, heat shock was forgotten and plates didn't show any transformants
 +
* Therefore the experiment was repeated
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
=== Plasmid-extraction of picked colonies from 10.9.2012===
 +
'''Investigator: Georg'''
 +
* Plasmid-DNA was extracted according to Quiaprep-genextraction protocoll
 +
</div>
 +
 +
 +
<div class="constitutive_promoter">
 +
=== Analytical digestion of minipreped BBa_J52008, BBa_E2060, BBa_E1010, BBa_E0036===
 +
'''Investigator: Georg'''
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|2,75 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|2,75 µl 
 +
|EcorI (NEB)
 +
|-
 +
|22 µl
 +
|NEB-4 buffer
 +
|-
 +
|2,2 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|166 µl
 +
|dd H20
 +
|-
 +
|=192,5µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* to 2,5 ml of DNA 17,5 µl reaction batch were added
 +
* Digestion took place at 37°C for 1 h
 +
[[File:20120911 Anal. Verdau Reporterproteine.png]]
 +
* only BBa_J52008 and BBa_E1010 showed positive inserts
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
===Preparative digestion of pTUM100 (3), P638 and psb1c3-TEF1-P===
 +
'''Investigator: Georg'''
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|PstI-HF (NEB)
 +
|-
 +
|1 µl 
 +
|XbaI (NEB)
 +
|-
 +
|4 µl
 +
|NEB-4 buffer
 +
|-
 +
|0,4 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|13,6 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* 20 µl pTUM104 were added
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|SpeI-HF(NEB)
 +
|-
 +
|1 µl 
 +
|EcorI-HF (NEB)
 +
|-
 +
|4 µl
 +
|NEB-4 buffer
 +
|-
 +
|0,4 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|13,6 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* 20 µl of pTUM104 (3) were added
 +
* Digestion took place at 37°C for 3 h
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1 µl
 +
|EcorI-HF (NEB)
 +
|-
 +
|5,5 µl 
 +
|SpeI-HF (NEB)
 +
|-
 +
|4 µl
 +
|NEB-4 buffer
 +
|-
 +
|0,4 µl
 +
|100 x BSA (NEB)
 +
|-
 +
|13,6 µl
 +
|dd H20
 +
|-
 +
|=20µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* to 20 µl of reaction batch 20 µl of psb1c3-TEF1-P were added
 +
* Digestion took place at 37°C for 3 h
 +
 +
[[File:20120912 Psb1c3 (spe+EcorI), PyesII XbaI+PstI, TEF1-T (Spe+EcorI).png]]
 +
</div>
 +
 +
<div class="constitutive_promoter">
 +
 +
=== Analytical gelelectrophoresis of picked BBa_J52008, BBa_E2060, BBa_E1010, BBa_E0036 ===
 +
''' Investigator: Georg'''
 +
 +
* DNA was applicated onto a 1% analytical agarose Gel
 +
* Analytical gelelectrophoresis was performed 1 h at 90 V
 +
</div>
 +
 +
 +
<div class="constitutive_promoter">
 +
=== Preparative digestion of BBa_J52008, BBa_E1010 and psb1c3-Limonensynth.===
 +
'''Investigator: Georg'''
 +
 +
* Reaction batch for digestion:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|12 µl
 +
|PstI-HF (Ferm)
 +
|-
 +
|6 µl 
 +
|XbaI (Ferm)
 +
|-
 +
|12 µl
 +
|Tango-buffer
 +
|-
 +
|40 µl
 +
|dd H20
 +
|-
 +
|=80µl
 +
|'''TOTAL'''
 +
|}
 +
 +
 +
* To 20 µl reaction batch, 20 ml of BBa_J52008,TEF2-pTUM104 or BBa_E1010 were added
 +
* Digestion was performed over night at 37 C
 +
 +
[[File:20120912 E1010,J52008 und Tef2-P-Limonens.png]]
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
=== Preparative gelelectrophoresis of preparative digestion of P686, P691, P692, P696 ===
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Preparative gelelectrophoresis of preparative digestion of P686, P691, P692, P696.
 +
 +
'''Procedure:'''
 +
 +
* 4.44&nbsp;µl of DNA loading buffer was added to the digestion mixture.
 +
 +
* Preparative gelelectrophoresis was performed at 70&nbsp;V for 2-3&nbsp;h.
 +
 +
{|cellspacing="0" border="1"
 +
|P686 SpeI&nbsp;+&nbsp;PstI-HF
 +
|1&nbsp;kbp DNA ladder
 +
|P691 XbaI-HF&nbsp;+&nbsp;PstI-HF
 +
|-
 +
|Band was cut out (3316 bp, 80.3 ng/µl)
 +
|
 +
|Lower band was cut out (988 bp, 34.3 ng/µl)
 +
|}
 +
 +
[[File:TUM12 20120911 prep gel P686 P691.jpg|500px]]
 +
 +
{|cellspacing="0" border="1"
 +
|P692 XbaI-HF&nbsp;+&nbsp;PstI-HF
 +
|1&nbsp;kbp DNA ladder
 +
|P696 XbaI-HF&nbsp;+&nbsp;PstI-HF
 +
|-
 +
|Upper band was cut out (3848 bp, 68.7 ng/µl)
 +
|
 +
|Upper band was cut out (4013 bp, 69.8 ng/µl)
 +
|}
 +
 +
[[File:TUM12 20120911 prep gel P692 P696.jpg|500px]]
 +
 +
* Gel extraction was performed with gel extraction kit from Qiagen after manufacturer's protoco..
 +
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
=== Cycled ligation of P751+P752 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Cycled ligation of P751+P752.
 +
 +
'''Procedure:'''
 +
 +
* Ligation batch for P751+P752
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|1.25&nbsp;µl
 +
|P751 (80.3&nbsp;ng/µl, 3316&nbsp;bp)
 +
|-
 +
|2.61&nbsp;µl
 +
|P752 (34.3&nbsp;ng/µl, 988&nbsp;bp)
 +
|-
 +
|2&nbsp;µl
 +
|T4 ligase buffer (10x)
 +
|-
 +
|1&nbsp;µl
 +
|T4 ligase (1&nbsp;U/µl)
 +
|-
 +
|13.14&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=20&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
* Negative control was als prepared. Instead of the insert, the same volume of ddH2O was added to the reaction batch and was labeled as P751 NK.
 +
 +
* Cycled ligation has been performed after following protocol in a thermocycler:
 +
{|cellspacing="0" border="1"
 +
|100 cycles
 +
|12&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|
 +
|22&nbsp;°C
 +
|60&nbsp;s
 +
|-
 +
|Hold
 +
|16&nbsp;°C
 +
|infinite
 +
|}
 +
 +
Lid temperature&nbsp;=&nbsp;37&nbsp;°C
 +
 +
</div>
 +
 +
<div class="light_switchable_promoter">
 +
 +
=== Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation product P751+P752 ===
 +
 +
'''Investigator:''' Jeff
 +
 +
'''Aim of the experiment:''' Transformation of ''E.&nbsp;coli'' XL1-Blue with ligation product P751+P752.
 +
 +
'''Procedure:'''
 +
 +
* CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells were put out from the stock in -80&nbsp;°C freezer and were gently thawed on ice.
 +
 +
* 5&nbsp;µl of the ligation product (P751+P752) and it's negative control (P751 NK) were added to 100&nbsp;µl of CaCl2 competent ''E.&nbsp;coli'' XL1-Blue cells on ice.
 +
 +
* 30&nbsp;min incubation on ice.
 +
 +
* 5&nbsp;min heat shock at 37&nbsp;°C
 +
 +
* Adding of 1&nbsp;ml LB-medium to each tube.
 +
 +
* Incubation for 45&nbsp;min at 37&nbsp;°C in the 180&nbsp;rpm cell-culture shaker.
 +
 +
* 100&nbsp;µl of those cell suspension were plated on chloramphenicol plates.
 +
 +
* The rest of the suspension was centrifuged for 1&nbsp;min at 13000&nbsp;rpm and the supernatant was dicarded.
 +
 +
* The pellet was resuspended in 100&nbsp;µl of LB-medium and was plated on chloramphenicol plates.
 +
 +
* Incubation at 37&nbsp;°C overnight.
 +
 +
</div>
 +
 +
<div class="coumaryl">
 +
 +
===Picking of clones of tranformations done on monday 10th september===
 +
'''Investigator:''' Ingmar
 +
*From each gene construct transformed in XL1 blue cells on monday1 8th september 2012 a single clone was picked an transferred into 7 ml fresh LB-media containing 1:1000 of the apropriate antibiotics. Incubation overday at 37°C and 180 rpm.
 +
</div>
 +
 +
<div class="coumaryl">
 +
 +
=== Miniprep of clones of tranformations done on monday 10th september ===
 +
 +
'''Investigator:''' Ingmar
 +
 +
'''Aim of the experiment:''' Get purified DNA for transformation in yeast and stem preservation.
 +
 +
'''Procedure:'''
 +
* Using a Quiagen kit a miniprep of the overday culture was done.
 +
* The resulting purified DNA was aliquoted in new tubes labeled as follows:
 +
{| {{table}}
 +
| align="center" style="background:#f0f0f0;"|'''Plasmid number'''
 +
| align="center" style="background:#f0f0f0;"|'''Content'''
 +
| align="center" style="background:#f0f0f0;"|'''Concentration'''
 +
|-
 +
| P766||P428 CHS+ in pYes nach sdm c614t||364,7 ng/µl
 +
|-
 +
| P767||P429 CHS- in pYes nach sdm c614t||42,7 ng/µl
 +
|-
 +
| P768||P430 CHS+ in pSB1C3 nach sdm c614t||158,5ng/µl
 +
|-
 +
| P769||P431 CHS- in pSB1C3 nach sdm c614t||336,2 ng/µl
 +
|-
 +
| P770||P197 OMT+ in pYes sdm with a1055g||146 ng/µl
 +
|-
 +
| P771||P198 OMT- in pYes sdm with a1055g||114,3 ng/µl
 +
|-
 +
| P772||P236 PAL+ in pYes sdm with a770g||395,6 ng/µl
 +
|-
 +
| P773||P200 PAL- in pYes sdm with a770g||
 +
|-
 +
| P774||P188 PAL- in pSb1C3 sdm with a770g||227,4 ng/µl
 +
|-
 +
| P775||P187 PAL+ in pSb1C3 sdm with a770g||124,8 ng/µl
 +
|-
 +
| P776||P430 CHS+ in pSb1C3||71,2 ng/µl
 +
|-
 +
| P777||P431 CHS- in pSB1C3||18,1 ng/µl
 +
|-
 +
| P778||P593 4Cl+ in pSB1C3 after sdm 24.08.2012||205,3 ng/µl
 +
|-
 +
| P779||P594 4Cl- in pSB1C3 after sdm 24.08.2012||207 ng/µl
 +
|-
 +
| P780||P595 4Cl+ in pYes after sdm 24.08.2012||174,5 ng/µl
 +
|-
 +
| P781||P596 4Cl- in pYes after sdm 24.08.2012||240,5 ng/µl
 +
|-
 +
| P782||P209 APT in pSb1C3||148,7 ng/µl
 +
|-
 +
| P783||P137 OMT+ in pSB1C3||117,5 ng/µl
 +
|-
 +
| P784||P431 CHS- in pSB1C3 nach sdm c614t Klon 2||115,8 ng/µl
 +
|-
 +
|
 +
|}
 +
 +
The side directed mutagenesis leading to P773 (P200 PAL- in pYes sdm with a770g) was not successfull and will be repeated. As the yield of P777 (P431 CHS- in pSB1C3, C = 18,1 ng/µl) is very low a new clone will be picked for an overnight culture.
 +
</div>
 +
 +
<div class ="thaumatin">
 +
 +
=== Picking and Miniprep of p737 (pIntVector_TEF1Prom_Preprothaumatin_TEF1Term) and p738 (pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term_Not1) ===
 +
 +
'''Investigator:''' Martin, Alois
 +
 +
'''Aim of the experiment:''' Getting pSB1C3_TEF1Prom_Preprothaumatin_TEF1Term with functional NotI
 +
 +
</div>
 +
 +
<div class ="thaumatin">
 +
 +
=== Expression of pTUM104_Preprothaumatin in ''S. cerevisiae'' ===
 +
 +
'''Investigator:''' Martin, Alois
 +
 +
Expression according to pYes2_manuel:
 +
 +
* Preparation of SC-U medium with 2% glucose/2% galactose: 50 ml-amino acid aliquot + 6.7tg Yeast Nitrogen Base + 850 ml Elga; devide solution in 270 ml and 630 ml; autoclave, add 30 ml 20% glucose to 270 ml and 70 ml 20% galactose to 630 ml.
 +
 +
* 1. Inoculate a single colony of ''S. cerevisiae'' containing your pYES2 construct (pYes2_Preprothaumatin) into 5 ml of SC-U medium containing 2% glucose. Grow overnight at 30°C with shaking.
 +
 +
* 2. Determine the OD600 of your overnight culture. Calculate the amount of overnight culture necessary to obtain an OD600 of 0.4 in 50 ml of induction medium (0.4*50 ml = OD600*X ml). 3. Remove the amount of overnight culture as determined in Step 2 (X ml) and pellet the cells at 1,500 g for 5 minutes at 4°C. 4. Resuspend the cells in 1–2 ml of induction medium (SC-U medium containing 2% galactose) and inoculate into 50 ml of induction medium. Grow at 30°C with shaking. 5. Harvest an aliquot of cells at 0, 2, 4, 6, 8, and 10 hours (+ over night) after addition of cells to the induction medium. For each time point, remove '''"1 ml <=> OD = 1"''' of culture from the flask. 6. Centrifuge the cells at 1,500 g for 5 minutes at 4°C. 7. Decant the '''supernatant'''; we only need the supernatant.
 +
 +
</div>
 +
 +
<div class ="thaumatin">
 +
 +
=== Glycerol stock of pTUM104_Preprothaumatin in ''S. cerevisiae'' ===
 +
 +
'''Investigator:''' Martin, Alois
 +
 +
* Colony + 5 ml YPD (50 ml-Erlenmeyer flask), 30°C over night; addition of 1 ml sterile 80% glycerol; 1 ml aliquots were stored at -80°C.
 +
 +
</div>
 +
 +
<div class="limonene">
 +
=== Western blot analysis of limonene synthase ===
 +
 +
'''Investigator:''' Lara
 +
 +
'''Aim of the experiment:'''
 +
 +
Detection of expressed limonene synthase (citrus).
 +
 +
'''Operational sequence:'''
 +
 +
The western blot membran (having been blocked over the night at 4°C) was washed with PBS- T0.1 three times (3x 10-15min). Afterwards, the membran was incubated for 1h with detection reagent: The membrane was put into a 50 ml falcon tube containing detection reagent and the falcon was incubated in the cold room on the rollator.
 +
Detection reagent:
 +
* 10ml 1xPBS+0.1%Tween
 +
* 0,2% BSA (0,02g have been weighted in)
 +
* 2µl anti body MABclassic
 +
 +
After incubating with the first antibody, the membran was washed again with PBS-T0.1 three times (3x 5min), followed by the incubation with the second antibody (anti mouse, fused with alk. phosphatase) for another hour.
 +
Second detection reagent:
 +
* 10ml 1xPBS
 +
* 0,2% BSA (see above)
 +
* 5µl AntiMouse-alk. Phosphatase conjugate (1/2000 dilution)
 +
 +
The development was performed after washing the membran with PBS- T0.1 for 10 min (two times) and with 1xPBS for 10 min (two times).
 +
For this, the membran was shortly washed with AP buffer and then incubated with a solution containing 15ml AP buffer, 45µl BCIP (50mg/ml in DMF) and 7,5µl NBT (75mg/ml in 70% DMF) for a few minutes, until clear bands appeared.
 +
 +
Western blot membrane:
 +
 +
 +
From left to right:
 +
*1. Clone 1 (after dialysis), large-scale (LS with consensus sequence, PCR1)
 +
*2. Clone 2 (after dialysis), large-scale (LS with consensus sequence, PCR1)
 +
*3. LS without consensus sequence (PCR2) (cell lysis 5.9., Katrin, 17 h after induction of expression)
 +
*4. LS without consensus sequence (PCR2) (cell lysis 5.9., Katrin, 20 h after induction of expression)
 +
*5. Clone 1 (before dialysis), large-scale cell lysis on 8.9 (PCR1).
 +
*6. Clone 2 (before dialysis), large-scale cell lysis on 8.9 (PCR1).
 +
*7. Clone 2 (not induced), cell lysis on 8.9 (PCR1).
 +
*8. Yeast, not transformed, cell lysis on 8.9.
 +
*9. page ruler plus
 +
 +
[[File:TUM12_LS_westernblot.png]]
 +
 +
 +
 +
</div>
 +
 +
<div class="caffeine">
 +
 +
=== Miniprep of transformation September 10th===
 +
 +
'''Investigator:''' Dennis
 +
 +
'''Aim:''' Miniprep of 9 over night cultures with number B2A + terminator ADH1 (3 times, colony 1,2,3), B1B + terminator ADH1(3 times, colony 1,2,3), B3D + ADH1 terminator (3 times, colony 1,2,3). Clones were isolated of over night culture, 5ml LB-medium with CHLP.
 +
 +
The plasmid preparation was performed as described in the manufactueres protocol (Quiagen). Elution was done with 40 µl ddH2O at room temperature, with the columns having been incubated 2 minutes at room temperature before the final centrifugation.
 +
'''Miniprep products are stored in a 50 ml Falcon tube in the lowest drawer at -20°C '''
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Analytic digestion of B2A_3+ADH1 terminator, B1B_2+ADH1 terminator, B3D_3+ADH1 terminator ===
 +
 +
 +
'''Investigator:''' Dennis
 +
 +
'''Aim of the experiment:''' analytic digestion of B2A_3+ADH1 terminator, B1B_2+ADH1 terminator, B3D_3+ADH1 terminator, B3D_2+ADH1 terminator (plate 5)
 +
 +
'''Procedure:'''
 +
 +
* Reaction batch:
 +
{|cellspacing="0" border="1"
 +
|'''volume'''
 +
|'''reagent'''
 +
|-
 +
|5&nbsp;µl
 +
|B2A_3+ADH1 terminator, B1B_2+ADH1 terminator, B3D_3+ADH1 terminator
 +
|-
 +
|2&nbsp;µl
 +
|NEBuffer&nbsp;4 (10x)
 +
|-
 +
|0,5 &nbsp;µl
 +
|EcorI (20&nbsp;U/µl)
 +
|-
 +
|0,5&nbsp;µl
 +
|PstI-HF (20&nbsp;U/µl)
 +
|-
 +
|12&nbsp;µl
 +
|ddH2O
 +
|-
 +
|=20&nbsp;µl
 +
|'''TOTAL'''
 +
|}
 +
 +
</div>
 +
 +
<div class="caffeine">
 +
 +
===Analytic gel electrophoresis===
 +
 +
'''experimenter:''' Dennis
 +
 +
* 1&nbsp;µl of DNA loading buffer (10x) was added to the digestion mix after incubation time.
 +
 +
* analytic gelelectrophoresis was perforemd at 90&nbsp;V for 1&nbsp;h.
 +
 +
{|cellspacing="0" border="1" style="font-size:75%"
 +
|1&nbsp;kbp DNA ladder
 +
|pSB1C3 CaMXMT1 (clone B2A colony 1)
 +
|pSB1C3 CaMXMT1 (clone B2A colony 2)
 +
|pSB1C3 CaMXMT1 (clone B2A colony 3)
 +
|pSB1C3 CaMXMT1 (clone B1B colony 1)
 +
|pSB1C3 CaMXMT1 (clone B1B colony 2)
 +
|pSB1C3 CaMXMT1 (clone B1B colony 3)
 +
|pSB1C3 CaMXMT1 (clone B3D colony 1)
 +
|pSB1C3 CaMXMT1 (clone B3D colony 2)
 +
|pSB1C3 CaMXMT1 (clone B3D colony 3)
 +
|pSB1C3 CaMXMT1 (clone B3D 5 colony 1)
 +
|pSB1C3 CaMXMT1 (clone B3D 5 colony 2)
 +
|pSB1C3 CaMXMT1 (clone B3D 5 colony 3)
 +
|}
 +
 +
{|cellspacing="0" border="1"
 +
|1&nbsp;kbp DNA ladder
 +
|}
 +
 +
[[File:20120911 analytgel dennis1.png|250px]] + [[File:20120911 analytgel dennis2.png|250px]]
 +
</div>
 +
 +
<div class="caffeine">
 +
 +
=== Sampling of expressed proteins ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim of the experiment:'''
 +
 +
Aim of the experiment was to take a 5 ml sample of the cell suspension 20h after expression induction.
 +
 +
'''Operational sequence:'''
 +
 +
At first, the OD600 was measured (1/10 dilution) and determined as 4,0. Afterwards, 5 ml of the cell suspension were taken out and pelleted by centrifugation for 5 min at 4°C and 1500xg. The pellet was washed with 500µl of sterile water, followed by a second centrifugation step. The pellet was then stored at -80°C until cell lysis.
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Cell lysis of stored pellets and SDS page ===
 +
 +
'''Investigator:''' Roman
 +
 +
'''Aim of the experiment:'''
 +
 +
Aim of the experiment was to isolate the protein crude extract out of the stored cell pellet.
 +
Afterwards, we wanted to separate the proteins by SDS gel electrophoresis.
 +
 +
'''Operational sequence:'''
 +
 +
At first, we resuspended the frozen cell pellet in the adequate volume of breaking buffer (containing 1mM PMSF) to get an OD of 50.
 +
* CaDXMT1 (15 min after induction of expression): 42 µl breaking buffer (OD600: 0,42)
 +
* CaDXMT1 (20h after induction of expression): 400µl breaking buffer (OD600: 4,0)
 +
 +
The equal amount of glass beads was added, followed by 20- 30 steps of vortexing (30sek) and ice incubation (30sek).
 +
Afterwards, the protein concentration was determined with NanoDrop (absorption at 280nm)
 +
 +
* CaDXMT1 (15min): 17,2 mg/ml
 +
* CaDXMT1 (20h): 7,4 mg/ml
 +
 +
The protein crude extracts were diluted with breaking buffer, to get 10µl samples containing 30µg of protein crude extracts. The samples were mixed with 2,5µl Laemmli (non reducing) and boiled for 5 min. Afterwards, the samples were loaded on the gel, together with 6µl of prestained protein marker (PageRuler Plus) and 6µl unprestained protein marker.
 +
 +
The gel was performed at 120V, ca. 2h.
 +
 +
</div>
 +
 +
<div class ="caffeine">
 +
 +
=== Western blot analysis of isolated protein crude extract ===
 +
 +
'''Investigator:''' Roman, Saskia
 +
 +
'''Aim of the experiment:'''
 +
 +
Aim of the experiment was the detection of the expressed enzyme CaDXMT1 in the isolated protein crude extract, having been separated on SDS page before (see above).
 +
 +
The proteins were blotted on a PVDF membran for 1h with 50mA. The membran was activated before blocking by 10min incubation in 100% methanol.
 +
 +
After blotting the proteins, we performed a reversible staining of the membran with Ponceau's reagent, to make the unprestained marker visible and to be able to assign it with a pen.
 +
 +
</div>
 +
 +
<div class="limonene">
 +
 +
=== Miniprep of clones from transformation of september 8th ===
 +
 +
'''Investigator:''' Lara, David
 +
 +
'''Aim:''' Get plasmid DNA of clones that contain pSB1C3/TEF1/LS, pSB1C3/TEFF2/LS, pSB1C3/PCR1(LS).
 +
 +
LS/TEF2/pSB1C3
 +
*1: 263 ng/µl
 +
 +
LS/TEF1/pSB1C3
 +
*2(1): 144 ng/µl
 +
*2(2): 123,5 ng/µl
 +
*2(4): 214,6 ng/µl
 +
*2(5): 202,3 ng/µl
 +
*2(6): 290,2 ng/µl
 +
*2(7): 257,8 ng/µl
 +
 +
LS(PCR1)/pSB1C3
 +
*3(1): 181,4 ng/µl
 +
*3(2): 168,8 ng/µl
 +
*3(3): 208,1 ng/µl
 +
*3(4): 179,4 ng/µl
 +
*3(5): 186,2 ng/µl
 +
*3(6): 224,8 ng/µl
 +
*3(7): 186,0 ng/µl
 +
*3(8): 280,0 ng/µl
 +
*3(9): 120,3 ng/µl
 +
*3(10): 206,1 ng/µl
 +
 +
'''miniprep products are stored in a disposal bag in the middle drawer of -20°C. label: lara miniprep 11.9.'''
 +
 +
</div>
 +
 +
<div class="limonene">
 +
 +
=== Analytical digest and gel electrophoresis ===
 +