Team:TU-Delft/part3

From 2012.igem.org

(Difference between revisions)
Line 13: Line 13:
<h2>Introduction</h2>   
<h2>Introduction</h2>   
<p>By combining the olfactory receptor and the <i>FUS1pr-EGFP</i> reporter, a complete yeast olfactory system is obtained. If the corresponding ligand binds to the receptor the <i>FAR1</i> promoter is turned on and the EGFP is expressed. This EGFP signal can be read out by a fluorescence meter. If the olfactory system will be implemented as a diagnostics tool in developing countries, the EGFP reporter should be changed by a visible reporter.<br/>
<p>By combining the olfactory receptor and the <i>FUS1pr-EGFP</i> reporter, a complete yeast olfactory system is obtained. If the corresponding ligand binds to the receptor the <i>FAR1</i> promoter is turned on and the EGFP is expressed. This EGFP signal can be read out by a fluorescence meter. If the olfactory system will be implemented as a diagnostics tool in developing countries, the EGFP reporter should be changed by a visible reporter.<br/>
-
Besides the induction of the <i>FUS1</i> promoter the cells also go in growth arrest mediated by the <i>FAR1</i> promoter. However it is undesirable that the cells stop growing once they respond to a ligand. Therefor it is needed to knock out the <i>FAR1</i> promoter.</p><br/>
+
Besides the induction of the <i>FUS1</i> promoter the cells also go in growth arrest mediated by the <i>FAR1</i> promoter. However it is undesirable that the cells stop growing once they respond to a ligand. Therefore it is needed to knock out the <i>FAR1</i> promoter.</p><br/>
<h2>Parts</h2>   
<h2>Parts</h2>   
<p>The receptor constructs and the reporter constructs are combined to have one complete olfactory system. The following biobricks are created:<p><br/>
<p>The receptor constructs and the reporter constructs are combined to have one complete olfactory system. The following biobricks are created:<p><br/>
Line 23: Line 23:
<h3>Knock out <i>FAR1</i></h3>
<h3>Knock out <i>FAR1</i></h3>
<h6>Setup</h6>
<h6>Setup</h6>
-
<h6>Outcome</h6>
+
Yeast
 +
 
 +
<h6>Outcome</h6>or making a functional knockout, yeast strains BY4741; Mat a; his3D1; leu2D0; met15D0; ura3D0; YJL157c::kanMX4 and BY4741; Mat a; his3D1; leu2D0; met15D0; ura3D0; YHR005c::kanMX4 were used (Euroscarf).
 +
Also knockout cassette pUG72 is used (Euroscarf). The LoxP-Ura-LoxP is elongated using the pFx polymerase protocol. The PCR program and primer sequences in table 1 yielded a product which is put on a gel shown in figure 1. Here a band can be recognized between 2000 and 1500 nucleotides, which corresponds to the 1669 nucleotide PCR product.
 +
</p>
 +
<br/>
 +
<h6>Table 1 PCR program for elongation of knockout cassette for knocking out Far1 and Gpa1 and primers used for elongation.</h6>
 +
<table id="tbtext">
 +
<tr>
 +
<th>Repeats</th>
 +
<th>Temperature</th>
 +
<th></th>
 +
<th>Duration</th>
 +
</tr>
 +
<td rowspan="3" id="tdunderline">5x</td>
 +
<td id="tdunderline">95</td>
 +
<td id="tdunderline">Melting</td>
 +
<td id="tdunderline">2:00</td>
 +
</tr>
 +
<tr>
 +
<td id="tdunderline">51</td>
 +
<td id="tdunderline">Annealing</td>
 +
<td id="tdunderline">1:00</td>
 +
</tr>
 +
<tr>
 +
<td id="tdunderline">68</td>
 +
<td id="tdunderline">Elongation</td>
 +
<td id="tdunderline">2:00</td>
 +
</tr>
 +
<tr>
 +
<td id="tdunderline" rowspan="3">25x</td>
 +
<td id="tdunderline">95</td>
 +
<td id="tdunderline">Melting</td>
 +
<td id="tdunderline">2:00</td>
 +
</tr>
 +
<tr>
 +
<td id="tdunderline">61</td>
 +
<td id="tdunderline">Annealing</td>
 +
<td id="tdunderline">1:00</td>
 +
</tr>
 +
<tr>
 +
<td id="tdunderline">68</td>
 +
<td id="tdunderline">Elongation</td>
 +
<td id="tdunderline">2:00</td>
 +
</tr>
 +
</table >
 +
 
 +
<br/>
 +
<table id="tbtext">
 +
<tr>
 +
<td id="tdunderline"><b>GPA ko fw</b><br/> TTAGCATCACATCAATAATCCAGAGGTGTATAAATTGATATATTAAGGTAGGAAATAATGCAGCTGAAGCTTCGTACGC</td>
 +
</tr>
 +
<tr >
 +
<td id="tdunderline"><b>GPA ko rv</b><br/> TGCATCTTCGGAAACAGAATTTACGTATCTAAACACTACTTTAATTATACAGTTCCTTCAGCATAGGCCACTAGTGGATCTG</td>
 +
</tr>
 +
<tr >
 +
<td id="tdunderline"><b>FAR1 ko fw</b><br/> ACACAAAGTCTATAGATCCACTGGAAAGCTTCGTGGGCGTAAGAAGGCAATCTATTAATGCAGCTGAAGCTTCGTACGC</td>
 +
</tr>
 +
<tr >
 +
<td id="tdunderline"><b>FAR1 ko rv</b><br/> GAAAAAAAAAAAAGGAAAAGCAAAAGCCTCGAAATACGGGCCTCGATTCCCGAACTACTAGCATAGGCCACTAGTGGATCTG</td>
 +
</tr>
 +
<tr >
 +
<td id="tdunderline"><b>GPA ko fw short</b><br/> TAATCCAGAGGTGTATAAATTGATATATTAAGGTAGGAAATAATGCAGCTGAAGCTTCGTACGC</td>
 +
</tr>
 +
<tr >
 +
<td id="tdunderline"><b>GPA ko rv short</b><br/> AGAATTTACGTATCTAAACACTACTTTAATTATACAGTTCCTTCAGCATAGGCCACTAGTGGATCTG</td>
 +
</tr>
 +
<tr >
 +
<td id="tdunderline"><b>FAR1 ko fw short</b><br/> ATCCACTGGAAAGCTTCGTGGGCGTAAGAAGGCAATCTATTAATGCAGCTGAAGCTTCGTACGC</td>
 +
</tr>
 +
<tr >
 +
<td id="tdunderline"><b>FAR1 ko rv short</b><br/> AAAAGCAAAAGCCTCGAAATACGGGCCTCGATTCCCGAACTACTAGCATAGGCCACTAGTGGATCTG</td>
 +
</tr>
 +
<tr >
 +
<td id="tdunderline"><b>ATF1 ko fw</b><br/> gaaaataaaaaacggCACTTCATCAGTATCACAAATACCATCAATTTATCAGCTCTCATGCAGCTGAAGCTTCGTACGC </td>
 +
</tr>
 +
<tr >
 +
<td id="tdunderline"><b>ATF1 ko rv</b><br/> ggttatttacacgacatAATCATATTGTCGAATAATATCAGTCAAGCATCATGTGAGATCTAGCATAGGCCACTAGTGGATCTG </td>
 +
</tr>
 +
<tr >
 +
<td id="tdunderline"><b>ATF1 ko fw short</b><br/> CACTTCATCAGTATCACAAATACCATCAATTTATCAGCTCTCATGCAGCTGAAGCTTCGTACGC </td>
 +
</tr>
 +
<tr >
 +
<td id="tdunderline"><b>ATF1 ko rv short</b><br/> AATCATATTGTCGAATAATATCAGTCAAGCATCATGTGAGATCTAGCATAGGCCACTAGTGGATCTG  </td>
 +
</tr>
 +
</table>
 +
 +
<br/>
 +
<a href="http://igem.org/wiki/images/d/d6/AgaroseinTAE_1.png" rel="lightbox" >
 +
<img src="http://igem.org/wiki/images/d/d6/AgaroseinTAE_1.png"  align="center" width="250" height="300" /></a>
 +
<h6>Figure 1: 1&#37; agarose in TAE ~45 run on 80 Volts. In the picture can be seen: 1 SmartLadder, 2 Far1 short PCR product, 3 Far1 long PCR product, 4 Gpa1 short PCR product, 5 Gpa1 long PCR product, 6 Atf1 short PCR product, 7 Atf1 long PCR product.</h6>
 +
<br/>
 +
<p>Colonies 1, 2 and 3 and a wildtype colony where grown overnight on YPG.<br/>A final PCR reaction was performed on extracted genomic DNA of the grown strains, using an annealing gradient of 45, 55 and 65 C and 15 ng or 30 ng template DNA. Reactions AD, AB and CD where performed according to the conditions summarized in table 11. PCR product is put on gel and shown in figure 5. Here can be seen that colony 2 (B) shows both expected band length in the AB and CD reactions, but no bands in the AD reaction. Colony 1 (A) shows only bands in the AD reaction, so the knock-out was unsuccessful. Colony 3 (C) shows inconsistent bands in reactions AD (lane 5 and 7), BC (lane 10) and CD (lane 14 and 15), also not of the expected length.</p>
 +
<br/>
 +
<h6>Table 11 Taq PCR conditions for KO check.</h6>
 +
<table id="tbtext">
 +
<tr>
 +
<th>Repeats</th>
 +
<th>Temperature</th>
 +
<th></th>
 +
<th>Duration</th>
 +
</tr>
 +
<tr>
 +
<td></td>
 +
<td id="tdunderline">94</td>
 +
<td id="tdunderline">Melting</td>
 +
<td id="tdunderline">4:00</td>
 +
</tr>
 +
<tr>
 +
<td id="tdunderline" rowspan="3">35x</td>
 +
<td id="tdunderline">94</td>
 +
<td id="tdunderline">Melting</td>
 +
<td id="tdunderline">0:30</td>
 +
</tr>
 +
<tr>
 +
<td id="tdunderline">45/55/65</td>
 +
<td id="tdunderline">Annealing</td>
 +
<td id="tdunderline">0:40</td>
 +
</tr>
 +
<tr>
 +
<td id="tdunderline">72</td>
 +
<td id="tdunderline">Elongation</td>
 +
<td id="tdunderline">2:15</td>
 +
</tr>
 +
<tr>
 +
<td></td>
 +
<td id="tdunderline">72</td>
 +
<td id="tdunderline">Elongation</td>
 +
<td id="tdunderline">10:00</td>
 +
</tr>
 +
</table>
 +
<table id="tbtext" >
 +
<tr>
 +
<td id="tdunderline"><b>GPA1 A conf </b>CGTCCTTCTGCGTATTCTTCC</td>
 +
</tr>
 +
<tr>
 +
<td id="tdunderline"><b>GPA1 D conf </b>CCGAGTATTTACCAGGGAGAAG</td>
 +
</tr>
 +
<tr>
 +
<td id="tdunderline"><b>KO B </b>CGCCAAGGGTAGAGATCCTAAG</td>
 +
</tr>
 +
<tr>
 +
<td id="tdunderline"><b>KO C </b>CTTCACGCAGGATGACAGTTC</td>
 +
</tr>
 +
</table>
 +
<br/><br/>
 +
<a href="http://igem.org/wiki/images/4/45/AgarosegelinTAE_5.png" rel="lightbox" >
 +
<img src="http://igem.org/wiki/images/4/45/AgarosegelinTAE_5.png"  align="center" width="250" height="300" /></a>
 +
<h6>Figure 5: 1&#37; agarose gel in TAE, 40 min run on 100 V. PCR products of Genomic extracted DNA. Colony 1 (A), Colony 2 (B), and Colony 3 (C) are shown. In the picture can be seen: 1 DNA Smarladder, 2 AD reaction with 15 ng template and 45 C, 3 AD reaction with 15 ng template and 55 C, 4 AD reaction with 15 ng template and 65 C, 5 AD reaction with 30 ng template and 45 C, 6 AD reaction with 30 ng template and 55 C, 7 AD reaction with 30 ng template and 65 C, 8 AB reaction with 15 ng template and 45 C, 9 AB reaction with 15 ng template and 55 C, 10 AB reaction with 15 ng template and 65 C, 11 AB reaction with 30 ng template and 45 C, 12 AB reaction with 30 ng template and 55 C, 13 AB reaction with 30 ng template and 65 C, 14 CD reaction with 15 ng template and 45 C, 15 CD reaction with 15 ng template and 55 C, 16 CD reaction with 15 ng template and 65 C, 17 CD reaction with 30 ng template and 45 C, 18 CD reaction with 30 ng template and 55 C, 19 CD reaction with 30 ng template and 65 C, 20 smartladder.</h6>
 +
<br/>
 +
<p>We concluded that in colony 2 GPA1 has successfully been knocked out. The following test is to transform Fus1-GFP into this ?far1 ?gpa1 yeast and to see difference in fluorescence output when compared to ?far1 yeast strain when induced by pheromone alpha. Expected is that due to lack of alpha subunit of the pheromone receptor, no or less light signal is detected.
 +
<br><br>
 +
 
<h3>Fluorometer experiment</h3>
<h3>Fluorometer experiment</h3>
<h6>Setup</h6>
<h6>Setup</h6>

Revision as of 00:13, 27 September 2012

Menu

Receptor

Introduction

By combining the olfactory receptor and the FUS1pr-EGFP reporter, a complete yeast olfactory system is obtained. If the corresponding ligand binds to the receptor the FAR1 promoter is turned on and the EGFP is expressed. This EGFP signal can be read out by a fluorescence meter. If the olfactory system will be implemented as a diagnostics tool in developing countries, the EGFP reporter should be changed by a visible reporter.
Besides the induction of the FUS1 promoter the cells also go in growth arrest mediated by the FAR1 promoter. However it is undesirable that the cells stop growing once they respond to a ligand. Therefore it is needed to knock out the FAR1 promoter.


Parts

The receptor constructs and the reporter constructs are combined to have one complete olfactory system. The following biobricks are created:


BBa_K775005
BBa_K775006
BBa_K775007
BBa_K775008

Results

Knock out FAR1

Setup
Yeast
Outcome
or making a functional knockout, yeast strains BY4741; Mat a; his3D1; leu2D0; met15D0; ura3D0; YJL157c::kanMX4 and BY4741; Mat a; his3D1; leu2D0; met15D0; ura3D0; YHR005c::kanMX4 were used (Euroscarf). Also knockout cassette pUG72 is used (Euroscarf). The LoxP-Ura-LoxP is elongated using the pFx polymerase protocol. The PCR program and primer sequences in table 1 yielded a product which is put on a gel shown in figure 1. Here a band can be recognized between 2000 and 1500 nucleotides, which corresponds to the 1669 nucleotide PCR product.


Table 1 PCR program for elongation of knockout cassette for knocking out Far1 and Gpa1 and primers used for elongation.
Repeats Temperature Duration
5x 95 Melting 2:00
51 Annealing 1:00
68 Elongation 2:00
25x 95 Melting 2:00
61 Annealing 1:00
68 Elongation 2:00

GPA ko fw
TTAGCATCACATCAATAATCCAGAGGTGTATAAATTGATATATTAAGGTAGGAAATAATGCAGCTGAAGCTTCGTACGC
GPA ko rv
TGCATCTTCGGAAACAGAATTTACGTATCTAAACACTACTTTAATTATACAGTTCCTTCAGCATAGGCCACTAGTGGATCTG
FAR1 ko fw
ACACAAAGTCTATAGATCCACTGGAAAGCTTCGTGGGCGTAAGAAGGCAATCTATTAATGCAGCTGAAGCTTCGTACGC
FAR1 ko rv
GAAAAAAAAAAAAGGAAAAGCAAAAGCCTCGAAATACGGGCCTCGATTCCCGAACTACTAGCATAGGCCACTAGTGGATCTG
GPA ko fw short
TAATCCAGAGGTGTATAAATTGATATATTAAGGTAGGAAATAATGCAGCTGAAGCTTCGTACGC
GPA ko rv short
AGAATTTACGTATCTAAACACTACTTTAATTATACAGTTCCTTCAGCATAGGCCACTAGTGGATCTG
FAR1 ko fw short
ATCCACTGGAAAGCTTCGTGGGCGTAAGAAGGCAATCTATTAATGCAGCTGAAGCTTCGTACGC
FAR1 ko rv short
AAAAGCAAAAGCCTCGAAATACGGGCCTCGATTCCCGAACTACTAGCATAGGCCACTAGTGGATCTG
ATF1 ko fw
gaaaataaaaaacggCACTTCATCAGTATCACAAATACCATCAATTTATCAGCTCTCATGCAGCTGAAGCTTCGTACGC
ATF1 ko rv
ggttatttacacgacatAATCATATTGTCGAATAATATCAGTCAAGCATCATGTGAGATCTAGCATAGGCCACTAGTGGATCTG
ATF1 ko fw short
CACTTCATCAGTATCACAAATACCATCAATTTATCAGCTCTCATGCAGCTGAAGCTTCGTACGC
ATF1 ko rv short
AATCATATTGTCGAATAATATCAGTCAAGCATCATGTGAGATCTAGCATAGGCCACTAGTGGATCTG

Figure 1: 1% agarose in TAE ~45 run on 80 Volts. In the picture can be seen: 1 SmartLadder, 2 Far1 short PCR product, 3 Far1 long PCR product, 4 Gpa1 short PCR product, 5 Gpa1 long PCR product, 6 Atf1 short PCR product, 7 Atf1 long PCR product.

Colonies 1, 2 and 3 and a wildtype colony where grown overnight on YPG.
A final PCR reaction was performed on extracted genomic DNA of the grown strains, using an annealing gradient of 45, 55 and 65 C and 15 ng or 30 ng template DNA. Reactions AD, AB and CD where performed according to the conditions summarized in table 11. PCR product is put on gel and shown in figure 5. Here can be seen that colony 2 (B) shows both expected band length in the AB and CD reactions, but no bands in the AD reaction. Colony 1 (A) shows only bands in the AD reaction, so the knock-out was unsuccessful. Colony 3 (C) shows inconsistent bands in reactions AD (lane 5 and 7), BC (lane 10) and CD (lane 14 and 15), also not of the expected length.


Table 11 Taq PCR conditions for KO check.
Repeats Temperature Duration
94 Melting 4:00
35x 94 Melting 0:30
45/55/65 Annealing 0:40
72 Elongation 2:15
72 Elongation 10:00
GPA1 A conf CGTCCTTCTGCGTATTCTTCC
GPA1 D conf CCGAGTATTTACCAGGGAGAAG
KO B CGCCAAGGGTAGAGATCCTAAG
KO C CTTCACGCAGGATGACAGTTC


Figure 5: 1% agarose gel in TAE, 40 min run on 100 V. PCR products of Genomic extracted DNA. Colony 1 (A), Colony 2 (B), and Colony 3 (C) are shown. In the picture can be seen: 1 DNA Smarladder, 2 AD reaction with 15 ng template and 45 C, 3 AD reaction with 15 ng template and 55 C, 4 AD reaction with 15 ng template and 65 C, 5 AD reaction with 30 ng template and 45 C, 6 AD reaction with 30 ng template and 55 C, 7 AD reaction with 30 ng template and 65 C, 8 AB reaction with 15 ng template and 45 C, 9 AB reaction with 15 ng template and 55 C, 10 AB reaction with 15 ng template and 65 C, 11 AB reaction with 30 ng template and 45 C, 12 AB reaction with 30 ng template and 55 C, 13 AB reaction with 30 ng template and 65 C, 14 CD reaction with 15 ng template and 45 C, 15 CD reaction with 15 ng template and 55 C, 16 CD reaction with 15 ng template and 65 C, 17 CD reaction with 30 ng template and 45 C, 18 CD reaction with 30 ng template and 55 C, 19 CD reaction with 30 ng template and 65 C, 20 smartladder.

We concluded that in colony 2 GPA1 has successfully been knocked out. The following test is to transform Fus1-GFP into this ?far1 ?gpa1 yeast and to see difference in fluorescence output when compared to ?far1 yeast strain when induced by pheromone alpha. Expected is that due to lack of alpha subunit of the pheromone receptor, no or less light signal is detected.

Fluorometer experiment

Setup
With yeast strains transformed with the GPR109A receptor and output BBa_K775005 and the R17-ODR10 receptor and output BBa_K775008 a fluorometer experiment was performed. After addition of the ligands OD600 and fluorescence were measured in time.
Outcome

Conclusions

Recommendations