Team:Nanjing China Bio/index

From 2012.igem.org

(Difference between revisions)
 
(48 intermediate revisions not shown)
Line 2: Line 2:
<style type="text/css">
<style type="text/css">
-
body{ padding:0; margin:0; background:url(/wiki/images/e/e9/57_1958.jpg);}
+
body{ padding:0; margin:0; background:url(/wiki/images/c/c9/Bg.gif);}
#nd-header{ width:1000px; height:37px; background:url(https://static.igem.org/mediawiki/2012/b/be/Headerbg.jpg) repeat-x left top;overflow:hidden}
#nd-header{ width:1000px; height:37px; background:url(https://static.igem.org/mediawiki/2012/b/be/Headerbg.jpg) repeat-x left top;overflow:hidden}
-
#globalWrapper{overflow: hidden;background:url(/wiki/images/e/e9/57_1958.jpg); width:100%}
+
#globalWrapper{overflow: hidden;background:url(/wiki/images/c/c9/Bg.gif); width:100%}
#content {border: none;font-family: georgia, helvetica, arial, sans-serif;width:1000px; background:none; overflow:hidden; margin:0 auto}
#content {border: none;font-family: georgia, helvetica, arial, sans-serif;width:1000px; background:none; overflow:hidden; margin:0 auto}
#siteSub {display:none;}
#siteSub {display:none;}
Line 43: Line 43:
/* head end*/
/* head end*/
/* footer begin */
/* footer begin */
-
.h49{width:1000px; height:52px; background:url(https://static.igem.org/mediawiki/igem.org/7/72/1000_52.jpg) no-repeat; margin:0 auto;}
+
.h49{width:1000px; height:52px; background:url(/wiki/images/7/72/1000_52.jpg) no-repeat; margin:0 auto;}
.w59{width:1000px; height:53px; background:url(https://static.igem.org/mediawiki/igem.org/e/ed/1000_53.jpg) repeat-x; margin:0 auto;}
.w59{width:1000px; height:53px; background:url(https://static.igem.org/mediawiki/igem.org/e/ed/1000_53.jpg) repeat-x; margin:0 auto;}
.w26{width:100%; height:76px; background:#550303;}
.w26{width:100%; height:76px; background:#550303;}
Line 60: Line 60:
/* content begin*/
/* content begin*/
.con{width:976px; height:auto; margin:0 auto; background:url(https://static.igem.org/mediawiki/igem.org/8/81/976_727.jpg) repeat-y; padding-bottom:20px;}
.con{width:976px; height:auto; margin:0 auto; background:url(https://static.igem.org/mediawiki/igem.org/8/81/976_727.jpg) repeat-y; padding-bottom:20px;}
-
.mian{width:875px; min-height:1500px; height:auto; margin:0 auto;}
+
.mian{width:875px; height:auto; margin:0 auto;}
.w870{width:870px; height:214px; margin:0 auto; }
.w870{width:870px; height:214px; margin:0 auto; }
.h800{width:870px; height:490px; margin:0 auto; margin-top:30px;}
.h800{width:870px; height:490px; margin:0 auto; margin-top:30px;}
Line 66: Line 66:
.h6{width:530px; height:6px; background:url(https://static.igem.org/mediawiki/igem.org/6/6f/23_6.gif) repeat-x;}
.h6{width:530px; height:6px; background:url(https://static.igem.org/mediawiki/igem.org/6/6f/23_6.gif) repeat-x;}
.h44{width:530px; height:44px; border-bottom:1px solid #d8c6a1;}
.h44{width:530px; height:44px; border-bottom:1px solid #d8c6a1;}
-
.w121{width:121px; height:44px; background:url(https://static.igem.org/mediawiki/igem.org/b/ba/121_44.jpg) no-repeat; float:left;}
+
.w121{width:121px; height:44px; background:url(https://static.igem.org/mediawiki/2012/b/b5/121_44.gif) no-repeat; float:left;}
-
.more{width:46px; height:18px; background:url(https://static.igem.org/mediawiki/igem.org/0/0d/More.gif) no-repeat; float:left; margin-left:350px; margin-top:10px;}
+
.more{width:46px; height:18px; background:url(https://static.igem.org/mediawiki/igem.org/0/0d/More.gif) no-repeat; float:left; margin-left:350px; margin-top:10px; display:inline;}
 +
.more a{ display:block; cursor:pointer; width:46px; height:18px; }
.txt1{width:530px; height:360px;}
.txt1{width:530px; height:360px;}
.w365{width:400px; height:30px; color:#952d27; font-size:24px; font-weight:500; display:block; margin-top:24px;}
.w365{width:400px; height:30px; color:#952d27; font-size:24px; font-weight:500; display:block; margin-top:24px;}
-
.txt2{width:530px; height:330px; display:block; color:#734444; font-size:16px; margin-top:14px;}
+
.txt2{width:530px; height:330px; display:block; color:#734444; font-size:16px; margin-top:14px; line-height:30px}
-
.txt2 a{ font-size:18px; color:#734444; text-decoration:underline;}
+
.txt2 a{ font-size:14px; color:#734444; text-decoration:underline;}
.w301{width:301px; height:404px; float:left; border:1px solid #d9c7a1; margin-left:36px; margin-top:30px; background:url(https://static.igem.org/mediawiki/igem.org/0/0b/301_414.gif) no-repeat;}
.w301{width:301px; height:404px; float:left; border:1px solid #d9c7a1; margin-left:36px; margin-top:30px; background:url(https://static.igem.org/mediawiki/igem.org/0/0b/301_414.gif) no-repeat;}
.w274{width:274px; height:404px; margin:0 auto;}
.w274{width:274px; height:404px; margin:0 auto;}
.w2741{width:274px; height:55px; background:url(https://static.igem.org/mediawiki/igem.org/0/07/274_55.jpg) no-repeat;}
.w2741{width:274px; height:55px; background:url(https://static.igem.org/mediawiki/igem.org/0/07/274_55.jpg) no-repeat;}
-
.w2742{width:264px; height:76px; padding-left:10px; line-height:24px; font-size:14px;}
+
.w2742{width:264px; height:70px; padding-left:10px; line-height:21px; font-size:14px; overflow:hidden}
-
.w2743{width:264px; height:55px; padding-left:10px; line-height:24px; font-size:14px;}
+
.w2743{width:264px; height:55px; padding-left:10px; line-height:21px; font-size:14px; overflow:hidden}
-
.w2744{width:264px; height:79px; padding-left:10px; line-height:24px; font-size:14px; }
+
.w2744{width:264px; height:76px; padding-left:10px; line-height:21px; font-size:14px; overflow:hidden}
-
.w2745{width:264px; height:76px; padding-left:10px; line-height:24px; font-size:14px;}
+
.w2745{width:264px; height:76px; padding-left:10px; line-height:21x; font-size:14px; overflow:hidden}
-
.w2746{width:264px; height:70px; padding-left:10px; line-height:24px; font-size:14px;}
+
.w2746{width:264px; height:70px; padding-left:10px; line-height:21px; font-size:14px; overflow:hidden}
.h62{width:870px; height:6px; background:url(https://static.igem.org/mediawiki/igem.org/6/6f/23_6.gif) repeat-x; margin:0 auto;}
.h62{width:870px; height:6px; background:url(https://static.igem.org/mediawiki/igem.org/6/6f/23_6.gif) repeat-x; margin:0 auto;}
.h60{width:870px; height:60px;}
.h60{width:870px; height:60px;}
.w130{width:130px; height:60px; background:url(https://static.igem.org/mediawiki/igem.org/5/52/130_60.gif) no-repeat; float:left;}
.w130{width:130px; height:60px; background:url(https://static.igem.org/mediawiki/igem.org/5/52/130_60.gif) no-repeat; float:left;}
-
.more2{width:46px;height:18px; background:url(https://static.igem.org/mediawiki/igem.org/0/0d/More.gif) no-repeat; float:left; margin-top:20px; margin-left:670px;}
+
.more2{width:46px;height:18px; background:url(https://static.igem.org/mediawiki/igem.org/0/0d/More.gif) no-repeat; float:left; margin-top:20px; margin-left:670px; display:inline;}
 +
.more2 a{display:block; cursor:pointer; width:46px; height:18px;}
.ul1{width:870px; height:245px; margin:0 auto;}
.ul1{width:870px; height:245px; margin:0 auto;}
.ul1 li{ float:left; margin-left:4px;}
.ul1 li{ float:left; margin-left:4px;}
Line 91: Line 93:
.h63{width:870px; height:6px; background:url(https://static.igem.org/mediawiki/igem.org/6/6f/23_6.gif) repeat-x; margin:0 auto; margin-top:30px;}
.h63{width:870px; height:6px; background:url(https://static.igem.org/mediawiki/igem.org/6/6f/23_6.gif) repeat-x; margin:0 auto; margin-top:30px;}
.w527{width:530px; height:300px; float:left;}
.w527{width:530px; height:300px; float:left;}
-
.w389{width:389px; height:64px; background:url(https://static.igem.org/mediawiki/igem.org/6/6a/389_64.gif) no-repeat;}
+
.w389{width:389px; height:64px; background:url(https://static.igem.org/mediawiki/igem.org/c/cd/389_64%281%29.gif) no-repeat;}
.ul2{width:530px; height:30px;}
.ul2{width:530px; height:30px;}
.ul2 li{width:105px; height:30px; line-height:30px; text-align:center; margin-right:1px; float:left;}
.ul2 li{width:105px; height:30px; line-height:30px; text-align:center; margin-right:1px; float:left;}
Line 98: Line 100:
.w200{width:528px; height:200px; background:#fdf7e7; border:1px solid #d4c19d;}
.w200{width:528px; height:200px; background:#fdf7e7; border:1px solid #d4c19d;}
.w300{width:300px; height:300px; float:left; margin-left:20px;}
.w300{width:300px; height:300px; float:left; margin-left:20px;}
-
.w37{width:279px; height:62px; background:url(https://static.igem.org/mediawiki/igem.org/f/f1/279_62.gif);}
+
.w37{width:279px; height:62px; background:url(https://static.igem.org/mediawiki/2012/4/4f/279_63.gif);}
.h250{width:298px; height:230px; border:1px solid #d4c19d; background:#fdf7e7;}
.h250{width:298px; height:230px; border:1px solid #d4c19d; background:#fdf7e7;}
.m2721{width:272px; height:60px; margin:0 auto; margin-top:8px;}
.m2721{width:272px; height:60px; margin:0 auto; margin-top:8px;}
Line 121: Line 123:
     <div class="head">
     <div class="head">
-
           <div class="h188"><img src="https://static.igem.org/mediawiki/igem.org/1/13/Indexbanner.jpg" width="976" height="188" alt="南京IGEM"/></div>
+
           <div class="h188"><img src="https://static.igem.org/mediawiki/2012/1/13/Indexbanner.jpg" width="976" height="188" alt="南京IGEM"/></div>
           <div class="h45"></div>
           <div class="h45"></div>
           <div class="h80">
           <div class="h80">
Line 143: Line 145:
    
    
                 <div class="mian ">
                 <div class="mian ">
-
                      <div class="w870"><img src="https://static.igem.org/mediawiki/igem.org/8/8d/870_214.jpg"/></div>
+
                    <div class="w870"><img src="https://static.igem.org/mediawiki/igem.org/8/8d/870_214.jpg"/></div>
                       <div class="h800">
                       <div class="h800">
                             <div class="w530">
                             <div class="w530">
Line 149: Line 151:
                                   <div class="h44">
                                   <div class="h44">
                                         <div class="w121"></div>
                                         <div class="w121"></div>
-
                                         <div class="more"></div>
+
                                         <div class="more"><a href="/Team:Nanjing_China_Bio/projects"></a></div>
                                   </div>
                                   </div>
                                   <div class="txt1">
                                   <div class="txt1">
-
                                         <span class="w365">Salmonella selection:methods A </span>
+
                                         <span class="w365">Salmonella selection</span>
                                         <span class="txt2">
                                         <span class="txt2">
-
                                        Using lambda red recombination method to have mutations
+
                                      <i>Salmonella typhimurium</i> VNP20009 (VNP) has unique characteristics of high tumor targeting and low toxicity. It can highly colonize central parts of tumor tissuesOur project aims to decrease the influence of the bacteria on normal tissues by enhancing the bacteria's ability of tumor targeting through modifying the amino acid metabolism pathways. We also use VNP as a vector to express exogenous genes with anaerobic promoters in the upper stream to further improve the effect of tumor targeting. Thus, the bacteria could be used as an efficient method of tumor treatment.                                  
-
                                        The first step to knock out the genes of vnp20009 was to
+
...<a href="/Team:Nanjing_China_Bio/projects">learn more>></a>
-
                                        introduce pkd46 into the vnp20009 so that the three genes
+
-
                                        γ,β,andexo can be expressed. Gam inhibits the host RecBCDexonuclease
+
-
                                        v so that BET and EXO can gain access to DNA ends and to promote
+
-
                                        recombination.We then designed the PCR primers which provide the
+
-
                                        homology  to  the targeted  gene(s). Primers were 60bp in length
+
-
                                        and were used to amplify a Kanamycin cassette from pKD4 with
+
-
                                        flanking DNA to the gene targeted for deletion. For the forward
+
-
                                        primer (RF1), select 40bp from ATG backwards, then add 20bp
+
-
                                        from vector backbone (CATATGAATATCCTCCTTA). For the reverse
+
-
                                        primer (RR1), select 24bp from the last nucleotide (stop codon)
+
-
                                        of gene inwards and 16bp after stop codon (downstream. of gene).
+
-
                                        Reverse complement this sequence, then add 20bp of reverse-complemented
+
-
                                        vector backbone sequence (GTGTAGGCTGGAGCTGCTCC).To incorporate the linear
+
-
                                        DNA into the chromosome of salmonella, we electroporate the PCR product
+
-
                                        into the Salmonella harboring pKD46 by......<a>learn more>></a>
+
                                         </span>
                                         </span>
                                   </div>
                                   </div>
Line 177: Line 164:
                                   <div class="w274">
                                   <div class="w274">
                                         <div class="w2741"></div>
                                         <div class="w2741"></div>
-
                                         <div class="w2742">Tumor-Targeted:tumor-tergeting provides a high-performance manner in which we can treat we can treat cancer more ...</div>
+
                                         <div class="w2742">Tumor-Targeted: tumor-targeting provides a high-performance manner in which we can treat cancer more accurately.</div>
-
                                         <div class="w2743">Salmonella:a kind of harmful bacterium may be the light to a harmful disease.</div>
+
                                         <div class="w2743">Salmonella: a kind of harmful bacterium may be the light to a harmful disease.</div>
-
                                         <div class="w2744">Anaerobic promoter:it can lead to the expression of some antitumor agents directly inside the tumor</div>
+
                                         <div class="w2744">Anaerobic promoter: it can lead to the expression of some antitumor agents directly inside the tumor.</div>
-
                                         <div class="w2745">auxotrophy the inability of the Salmo-nella to synthesize a particular organic compound required for it's growth</div>
+
                                         <div class="w2745">Kongfu-bacteria: the bacteria we designed is just like a Kongfu-panda,using its terrific "Kongfu" to kill tumors.</div>
-
                                         <div class="w2746">auxotrophy the inability of the Salmo-nella to synthesize a particular organic compound required for it's growth</div>
+
                                         <div class="w2746">Auxotrophy:the inability of the Salmonella to synthesize a particular organic compound required for its growth.</div>
                                   </div>
                                   </div>
                             </div>
                             </div>
                       </div>
                       </div>
-
                      <div class="h62"></div>
+
                      <div class="h62"></div>
                       <div class="h60">
                       <div class="h60">
                             <div class="w130"></div>
                             <div class="w130"></div>
-
                             <div class="more2"></div>
+
                             <div class="more2"><a href='/Team:Nanjing_China_Bio/member'></a></div>
                       </div>
                       </div>
                       <ul class="ul1">
                       <ul class="ul1">
                           <li class="li1">
                           <li class="li1">
-
                           <div class="h27">An Hu</div>
+
                           <div class="h27">Xiaoxin Zhang</div>
-
                           <img src="https://static.igem.org/mediawiki/2012/9/98/140_245.jpg">
+
                           <a href="/Team:Nanjing_China_Bio/01"><img src="/wiki/images/4/4e/01.jpg" width="140" height="162" /></a>
                           <div class="h56">
                           <div class="h56">
-
                           <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
                           <span class="sh56">Xiaoxin Zhang is currently a doctor</span>
                           </div>
                           </div>
                           </li>
                           </li>
                           <li class="li1">
                           <li class="li1">
-
                           <div class="h27">An Hu</div>
+
                           <div class="h27">Hongqin Zhuang</div>
-
                           <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
+
                           <a href="/Team:Nanjing_China_Bio/02"><img src="/wiki/images/3/3f/02.jpg" width="140" height="162" /></a>
                           <div class="h56">
                           <div class="h56">
-
                           <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
                           <span class="sh56">Hongqin Zhuang, Ph.D., associate</span>
                           </div>
                           </div>
                           </li>
                           </li>
                           <li class="li1">
                           <li class="li1">
-
                           <div class="h27">An Hu</div>
+
                           <div class="h27">Jiahuang Li</div>
-
                           <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">  
+
                           <a href="/Team:Nanjing_China_Bio/03"><img src="/wiki/images/f/f9/03.jpg" width="140" height="162" /></a>
                           <div class="h56">
                           <div class="h56">
-
                             <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
                             <span class="sh56">Jiahuang Li, Ph.D. received Doctor's</span>
                           </div>
                           </div>
                           </li>
                           </li>
                           <li class="li1">
                           <li class="li1">
-
                           <div class="h27">An Hu</div>
+
                           <div class="h27">Min Lu</div>
-
                           <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
+
                           <a href="/Team:Nanjing_China_Bio/04"><img src="/wiki/images/2/2d/04.jpg" width="140" height="162" /></a>
                           <div class="h56">
                           <div class="h56">
-
                           <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
                           <span class="sh56">Min Lu, born in December, 1965</span>
                           </div>  
                           </div>  
                           </li>
                           </li>
                           <li class="li1">
                           <li class="li1">
-
                           <div class="h27">An Hu</div>
+
                           <div class="h27">Zichun Hua</div>
-
                           <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">  
+
                           <a href="/Team:Nanjing_China_Bio/05"><img src="/wiki/images/1/13/05.jpg" width="140" height="162" /></a>
                           <div class="h56">
                           <div class="h56">
-
                           <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
                           <span class="sh56">Zichun Hua, Ph.D. Changjiang</span>
                           </div>
                           </div>
                           </li>
                           </li>
                             <li class="li1">
                             <li class="li1">
                           <div class="h27">An Hu</div>
                           <div class="h27">An Hu</div>
-
                           <img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg">
+
                           <a href="/Team:Nanjing_China_Bio/06"><img src="https://static.igem.org/mediawiki/igem.org/9/98/140_245.jpg"></a>
                           <div class="h56">
                           <div class="h56">
-
                           <span class="sh56">Here is a chinese's boy name is AnHu</span>
+
                           <span class="sh56">Here is a Chinese boy named An Hu</span>
                           </div>
                           </div>
                           </li>
                           </li>
Line 239: Line 226:
                             <div class="h88"><img src="https://static.igem.org/mediawiki/igem.org/f/f5/194_88.jpg"></div>
                             <div class="h88"><img src="https://static.igem.org/mediawiki/igem.org/f/f5/194_88.jpg"></div>
                             <div class="w600">
                             <div class="w600">
-
                             Our team consists of senior and junior students from departments of Life Science, Computer  
+
                             Our team is composed of 15 undergraduates, 1 postgraduate, and 4 guide teachers. We built this team based on our common interest in iGEM and synthetic biology. We have a diverse background with students from School of Life Science, School of Computer Science and School of Journalism and Communication. This is the first year for our university to take part in iGEM competition, and we would like to compete with other teams from other famous universities, share happiness and reap friendship.                            </div>
-
                            Science and Journalism and Communication. We come together and work together for one common
+
-
                            goal.  Though there were difficulties and obstacles during the process, we didn't give up and
+
-
                            gave all our efforts.  Thanks to iGEM for giving us a chance for us to meet each other and  
+
-
                            work together and we will do our best.
+
-
                             </div>
+
                       </div>
                       </div>
                       <div class="h63"></div>
                       <div class="h63"></div>
Line 250: Line 232:
                             <div class="w389"></div>
                             <div class="w389"></div>
                             <ul class="ul2">
                             <ul class="ul2">
-
                                 <li><a class="li1">May</a></li>
+
                                 <li><a href="https://2012.igem.org/Team:Nanjing_China_Bio/notebook"class="li1">May</a></li>
-
                                 <li><a>June</a></li>
+
                                 <li><a href="https://2012.igem.org/Team:Nanjing_China_Bio/notebook6
-
                                 <li><a>July</a></li>
+
">June</a></li>
-
                                 <li><a>Auagust</a></li>
+
                                 <li><a href="https://2012.igem.org/Team:Nanjing_China_Bio/notebook7
-
                                 <li><a>September</a></li>
+
">July</a></li>
 +
                                 <li><a href="https://2012.igem.org/Team:Nanjing_China_Bio/notebook8
 +
">Auagust</a></li>
 +
                                 <li><a href="https://2012.igem.org/Team:Nanjing_China_Bio/notebook9
 +
 
 +
">September</a></li>
                             </ul>
                             </ul>
                             <div class="w200">
                             <div class="w200">
Line 268: Line 255:
                             <div class="w37"></div>
                             <div class="w37"></div>
                             <div class="h250">
                             <div class="h250">
-
                                   <div class="m2721"><img src="https://static.igem.org/mediawiki/igem.org/e/e2/272_60.gif"></div>
+
                                   <div class="m2721"><a href="http://jw.nju.edu.cn/root/" target="_blank"><img src="https://static.igem.org/mediawiki/igem.org/e/e2/272_60.gif"></a></div>
-
                                   <div class="m2722"><img src="https://static.igem.org/mediawiki/igem.org/a/ac/272_68.gif"></div>
+
                                   <div class="m2722"><a href="http://biopharm.nju.edu.cn/" target="_blank"><img src="https://static.igem.org/mediawiki/igem.org/a/ac/272_68.gif"></a></div>
-
                                   <div class="m2723"><img src="https://static.igem.org/mediawiki/igem.org/5/5f/272_69.gif"></div>
+
                                   <div class="m2723"><a href="http://biosci.nju.edu.cn/" target="_blank"><img src="https://static.igem.org/mediawiki/igem.org/5/5f/272_69.gif"></a></div>
                             </div>
                             </div>
                       </div>
                       </div>

Latest revision as of 17:41, 26 September 2012

Salmonella selection Salmonella typhimurium VNP20009 (VNP) has unique characteristics of high tumor targeting and low toxicity. It can highly colonize central parts of tumor tissues. Our project aims to decrease the influence of the bacteria on normal tissues by enhancing the bacteria's ability of tumor targeting through modifying the amino acid metabolism pathways. We also use VNP as a vector to express exogenous genes with anaerobic promoters in the upper stream to further improve the effect of tumor targeting. Thus, the bacteria could be used as an efficient method of tumor treatment. ...learn more>>
Tumor-Targeted: tumor-targeting provides a high-performance manner in which we can treat cancer more accurately.
Salmonella: a kind of harmful bacterium may be the light to a harmful disease.
Anaerobic promoter: it can lead to the expression of some antitumor agents directly inside the tumor.
Kongfu-bacteria: the bacteria we designed is just like a Kongfu-panda,using its terrific "Kongfu" to kill tumors.
Auxotrophy:the inability of the Salmonella to synthesize a particular organic compound required for its growth.
  • Xiaoxin Zhang
    Xiaoxin Zhang is currently a doctor
  • Hongqin Zhuang
    Hongqin Zhuang, Ph.D., associate
  • Jiahuang Li
    Jiahuang Li, Ph.D. received Doctor's
  • Min Lu
    Min Lu, born in December, 1965
  • Zichun Hua
    Zichun Hua, Ph.D. Changjiang
  • An Hu
    Here is a Chinese boy named An Hu
Our team is composed of 15 undergraduates, 1 postgraduate, and 4 guide teachers. We built this team based on our common interest in iGEM and synthetic biology. We have a diverse background with students from School of Life Science, School of Computer Science and School of Journalism and Communication. This is the first year for our university to take part in iGEM competition, and we would like to compete with other teams from other famous universities, share happiness and reap friendship.
5.12(all) This is our first regular meeting since we formed our iGEM team. During this meeting, we introduced ourselves to each other, and learned more about our goal. Our team consists of sophomore and junior students from different departments.
The first section was given by Kevin about the general background of iGEM and the specific requirements of the competition. The techniques that could be used in our experiments were also introduced, and it's lucky to know that we have already learned the fundamental knowledge of these techniques.