Team:Nanjing China Bio/index
From 2012.igem.org
(Difference between revisions)
Line 83: | Line 83: | ||
.h60{width:870px; height:60px;} | .h60{width:870px; height:60px;} | ||
.w130{width:130px; height:60px; background:url(https://static.igem.org/mediawiki/igem.org/5/52/130_60.gif) no-repeat; float:left;} | .w130{width:130px; height:60px; background:url(https://static.igem.org/mediawiki/igem.org/5/52/130_60.gif) no-repeat; float:left;} | ||
- | .more2{width:46px;height:18px; background:url(https://static.igem.org/mediawiki/igem.org/0/0d/More.gif) no-repeat; float:left; margin-top:20px; margin-left:670px;} | + | .more2{width:46px;height:18px; background:url(https://static.igem.org/mediawiki/igem.org/0/0d/More.gif) no-repeat; float:left; margin-top:20px; margin-left:670px; display:inline;} |
.ul1{width:870px; height:245px; margin:0 auto;} | .ul1{width:870px; height:245px; margin:0 auto;} | ||
.ul1 li{ float:left; margin-left:4px;} | .ul1 li{ float:left; margin-left:4px;} | ||
Line 190: | Line 190: | ||
<div class="more2"></div> | <div class="more2"></div> | ||
</div> | </div> | ||
- | + | <ul class="ul1"> | |
<li class="li1"> | <li class="li1"> | ||
<div class="h27">An Hu</div> | <div class="h27">An Hu</div> | ||
Line 236: | Line 236: | ||
</ul> | </ul> | ||
- | <div class="h90"> | + | <!--<div class="h90"> |
<div class="h88"><img src="https://static.igem.org/mediawiki/igem.org/f/f5/194_88.jpg"></div> | <div class="h88"><img src="https://static.igem.org/mediawiki/igem.org/f/f5/194_88.jpg"></div> | ||
<div class="w600"> | <div class="w600"> |
Revision as of 08:28, 25 September 2012
Salmonella selection:methods A
Using lambda red recombination method to have mutations
The first step to knock out the genes of vnp20009 was to
introduce pkd46 into the vnp20009 so that the three genes
γ,β,andexo can be expressed. Gam inhibits the host RecBCDexonuclease
v so that BET and EXO can gain access to DNA ends and to promote
recombination.We then designed the PCR primers which provide the
homology to the targeted gene(s). Primers were 60bp in length
and were used to amplify a Kanamycin cassette from pKD4 with
flanking DNA to the gene targeted for deletion. For the forward
primer (RF1), select 40bp from ATG backwards, then add 20bp
from vector backbone (CATATGAATATCCTCCTTA). For the reverse
primer (RR1), select 24bp from the last nucleotide (stop codon)
of gene inwards and 16bp after stop codon (downstream. of gene).
Reverse complement this sequence, then add 20bp of reverse-complemented
vector backbone sequence (GTGTAGGCTGGAGCTGCTCC).To incorporate the linear
DNA into the chromosome of salmonella, we electroporate the PCR product
into the Salmonella harboring pKD46 by......learn more>>
Tumor-Targeted:tumor-tergeting provides a high-performance manner in which we can treat we can treat cancer more ...
Salmonella:a kind of harmful bacterium may be the light to a harmful disease.
Anaerobic promoter:it can lead to the expression of some antitumor agents directly inside the tumor
auxotrophy the inability of the Salmo-nella to synthesize a particular organic compound required for it's growth
auxotrophy the inability of the Salmo-nella to synthesize a particular organic compound required for it's growth
-
An HuHere is a chinese's boy name is AnHu
-
An HuHere is a chinese's boy name is AnHu
-
An HuHere is a chinese's boy name is AnHu
-
An HuHere is a chinese's boy name is AnHu
-
An HuHere is a chinese's boy name is AnHu
-
An HuHere is a chinese's boy name is AnHu