Team:NTNU Trondheim/Notebook/August

From 2012.igem.org

(Difference between revisions)
(Tuesday 14.08.12)
m
Line 5: Line 5:
{{:Team:NTNU_Trondheim/Templates/Calendar}}
{{:Team:NTNU_Trondheim/Templates/Calendar}}
 +
 +
===Wednesday 15.08.12===
 +
----
 +
 +
The high expression plasmid containing his-tagged LldR was transferred to liquid medium.
 +
 +
K+RBS+Colicin and the negative colicin control, LuxR+DTT was transferred to new liquid medium in order to be tested. 50 µl of the old cultures was transferred to 10 ml of LB containing ampicillin.
 +
 +
Since we have read that chloramphenicol can be a problem for the lld promoter, we also decided to transfer this brick to a new backbone before further testing. Both P<sub>lld</sub> and P<sub>lld</sub>+RBS+lysis was cut with EcoRI and PstI. Linearized plasmid backbone pSB1A3 was also cut with EcoRI and PstI. Ligations will be performed tomorrow.
 +
===Tuesday 14.08.12===
===Tuesday 14.08.12===

Revision as of 16:27, 15 August 2012

NTNU IS B.A.C.K.
Bacterial Anti-Cancer-Kamikaze

Notebook/August

February
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 25
27 28 29
March
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30
April
Mon Tue Wed Thu Fri Sat Sun
1
2 3 4 5 6 7 8
9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29
30
May
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4 5 6
7 8 9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30 31
June
Mon Tue Wed Thu Fri Sat Sun
1 2 3
4 5 6 7 8 9 10
11 12 13 14 15 16 17
18 19 20 21 22 23 24
25 26 27 28 29 30 31
July
Mon Tue Wed Thu Fri Sat Sun
1
2 3 4 5 6 7 8
9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29
30 31
August
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30 31
September
Mon Tue Wed Thu Fri Sat Sun
1 2
3 4 5 6 7 8 9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30

Wednesday 15.08.12


The high expression plasmid containing his-tagged LldR was transferred to liquid medium.

K+RBS+Colicin and the negative colicin control, LuxR+DTT was transferred to new liquid medium in order to be tested. 50 µl of the old cultures was transferred to 10 ml of LB containing ampicillin.

Since we have read that chloramphenicol can be a problem for the lld promoter, we also decided to transfer this brick to a new backbone before further testing. Both Plld and Plld+RBS+lysis was cut with EcoRI and PstI. Linearized plasmid backbone pSB1A3 was also cut with EcoRI and PstI. Ligations will be performed tomorrow.


Tuesday 14.08.12


To check if the new restriction digest were ok, LuxI (BBa_C0061) and LuxR+term (BBa_C0062, BBa_B0015) were tested with gel electrophoresis.


Picture of gel electrophoresis. LuxI and LuxR+Term cut with NotI, and LuxI and LuxR+term cut with E+S and X+P, respectively.


Cut of the parts consisting the genes, LuxI (BBa_C0061) and LuxR+term (BBa_C0062, BBa_B0015), and extracted the DNA from the gel. Concentrations are listed below.

BioBrick Enzymes Concentration [ng/µl]
LuxI EcoRI+SpeI 4.2
LuxR+term XbaI+PstI 5.6


Ligation mixes were made according to protocol with the following ingredients, as well as religation of the backbones:

Backbone Insert Plasmid
K BBa_J23119 RBS+LacI+term BBa_B0030, BBa_C0012, BBa_B0015 pSB1A2
Vgb+RBS BBa_K561001, BBa_B0034 LuxR+term BBa_C0062, BBa_B0015 pSB1A2
term BBa_B0015 LuxI BBa_C0061 pSB1AK3


These were then transformed in competent DH5ɑ cells, as described in the protocol. The petri dishes (all with Ampicillin) were left in the incubator over night.


10 µl of the liquid cultures for K+RBS+colicin and LuxR+DTT was transferred to 5 ml of new liquid medium to be used in testing of the colicin biobrick. The rest of the samples were miniprepped using the Promega SV Miniprep kit. The concentrations of the samples are given below:

Biobrick Concentration [ng/µl]
K+RBS+colicin 31.1
LuxR+DTT 31.3

We also recieved the high expression plasmid for his-tagged LldR today. This was transformed to competent E.coli K-12 ER2566 cells, as E.coli Dh5α, which are the cells we normally use in transformation, are unsuited when working with expression of proteins.

Monday 13.08.12


Transferred K+RBS+Colisin (BBa_K081005 and BBa_K150009), PLuxR+HSL+RBS+Lysis (BBa_R0062, BBa_B0034 and BBa_K112808) to liquid media.

Did a restriction digest on the following biobricks, as described in the protocol.

Biobricks BioBrick no. Enzymes
Vgb+RBS BBa_K561001, BBa_B0034 SpeI+PstI, NotI
LuxR+term BBa_C0062, BBa_B0015 XbaI+PstI, NotI
RBS+LacI+term BBa_B0030, BBa_C0012, BBa_B0015 XbaI+PstI, NotI
LuxI BBa_C0061 EcoRI+SpeI, NotI
K BBa_J23119 SpeI+PstI

Did a gel electrophoresis on the mixes above (except for the konstitutive promoter BBa_J23119), but only two of them where as expected. Did a new restriction digest on the two that didn't give the correct bands: LuxI (BBa_C0061) and LuxR+term (BBa_C0062 and BBa_B0015).

Picture of gel electrophoresis with test cutting with NotI (to the left) and regular cutting (to the right) of LuxI (EcoRI+SpeI), LuxR+term (X+P), RBS+lacI+term (XbaI+PstI) and Vgb+RBS (SpeI+PstI), respectively.

Extracted DNA from gel on the part RBS+LacI+term (BBa_B0030, BBa_C0012 and BBa_B0015) and did a PCR purification on Vgb+RBS (BBa_K561001 and BBa_B0034) and the konstitutive promoter (K BBa_J23119).

The concentrations on the purified parts are as follows:

Biobricks BioBrick no. Concentration [ng/µl]
K BBa_J23119 3.0
Vgb+RBS BBa_K561001, BBa_B0034 3.6
RBS+LacI+term BBa_B0030, BBa_C0012, BBa_B0015 4.7

Friday 10.08.12


Performed miniprep on the following constructs:

  1. VGB+RBS+YFP+term (BBa_K561001, BBa_B0034, BBa_E0030 and BBa_B0015)
  2. VHB+RBS+YFP+term (BBa_K258005, BBa_B0034, BBa_E0030 and BBa_B0015)
  3. LuxI+term (BBa_C0061, BBa_B0015)

The concentrations were as follows:

Biobrick Concentration ng/uL
VGB+RBS+YFP+term 35,2
VHB+RBS+YFP+term 38,9
LuxI+term 48,2

Transformed K+RBS+colicin.

Test constructs for Vgb and Vhb (Vgb+RBS+YFP+DTT and Vhb+RBS+YFP+DTT) were transferred to liquid medium for testing on monday.

It was attempted to make LldR by PCR one more time. The following PCR mix was used:

The following primers were used:

Primer Sequence
LldR fwd atgattgttttacccagacgcctgt
LldR rev tcatgcgtttttctccctcgaat

The PCR machine was programmed according to the following table:

Step Action Temperature Duration
1 Heated lid: 103°C
2 Initial denaturation; 98°C 30 s
3 Denaturation; 98°C 10 s
4 Annealing; 45°C 10 s
5 Elongation; 72°C 24 s
6 Go to step 3, repeat 25 x
7 Final elongation; 72°C 5 min
8 Hold 4°C

Thursday 09.08.12


Performed miniprep on RBS (BBa_B0030) and plld+RBS. The concentration were as follows:

Biobrick Concentration ng/uL
RBS 41,3
plld+RBS 43,7

Did a restriction digest as described in the protocol on the following parts. On the pieces to be used as inserts, the number of base pairs are also listed.

Biobrick/Construct BioBrick Enzymes Buffer bp insert
LuxI+term BBa_C0061, BBa_B0015 XbaI+PstI 3 747
YFP+term BBa_E0030, BBa_B0015 XbaI+PstI 3 852
Lysis BBa_K112808 XbaI+PstI 3 1785
LuxI BBa_C0061 XbaI+PstI 3 618
RBS* BBa_B0030 SpeI+PstI 1 -
PluxR+HSL BBa_R0062 SpeI+PstI 1 -
RBS BBa_B0034 SpeI+PstI 1 -
pSB1A3 pSB1A3 EcoRI+PstI+DpnI 3 -
plld - EcoRI+SpeI 4 344

The parts lysis BBa_K112808, YFP+term (BBa_E0030, BBa_B0015), pSB1A3 and plld will be assembled using the 3A assembly, so made double cutting mix with these parts.

Gel electrophoresis was done with luxI+term (BBa_C0061, BBa_B0015), lysis BBa_K112808, YFP+term (BBa_E0030, BBa_B0015), LuxI BBa_C0061 and plld. The gel did not show either LuxI or LuxI+term, but cut out lysis, YFP+term and plld. Will do a gel extraction on those, and a PCR purification on pSB1A3, RBS BBa_B0034, RBS* BBa_B0030 and PLuxR+HSL BBa_R0062. This will be done as described in protocols.

Ligated together the following, as described in protocols:

Ligation # Backbone Insert
1 RBS* BBa_B0030 LacI+term BBa_C0012, BBa_B0015
2 RBS BBa_B0034 LuxR+term BBa_C0062, BBa_B0015
3 pLuxR+HSLBBa_R0062 Lysis BBa_K112808

3A assembly was used on the following parts, as described in the Protocol, by Northwestern University:

Ligation # Backbone Insert 1 Insert 2
1 pSB1A3 plld YFP+termBBa_E0030, BBa_B0015
2 pSB1A3 plld Lysis BBa_K112808

Since the restriction digest didn't give anything for LuxI BBa_C0061 and LuxI+term (BBa_C0061, BBa_B0015), will a colony from LuxI+term (BBa_C0061, BBa_B0015) be transferred to liquid media and LuxI BBa_C0061 will be transformed again.

The following was also transformed: RBS*+LacI+term (BBa_B0030, BBa_C0012 and0 BBa_B0015), RBS+LuxR+term (BBa_B0034, BBa_C0062 and BBa_B0015), pLuxR+HSL+Lysis (BBa_R0062 and BBa_K112808), pSB1A3+plld+YFP+term (BBa_E0030 and BBa_B0015) and pSB1A3+plld+Lysis (BBa_K112808). Did religations of the backbones for all of the above. Transferred 200 µl to petri dishes and inoculated in 37C over night.

Wednesday 08.08.12


Tranformed Vgb+RBS+YFP+term (BBa_K561001, BBa_B0034, BBa_E0030 and BBa_B0015) and Vhb+RBS+YFP+term (BBa_K258005, BBa_B0034, BBa_E0030 and BBa_B0015) in competent DH5ɑ cells as described in the protocol. The plasmid in both of the constructs is pSB1A2. They were left in the incubator over night.

Inspected the petri dishes with plld+RBS (lactate induced promoter and BBa_B0030) and the religation of RBS BBa_B0030, had many more colonies on the plld+RBS than the religation, which is good. Transferred a colony of the plld+RBS (lactate promoter and BBa_B0030) and a colony of RBS BBa_B0030 to liquid media, with ampicillin resistance.

LacI+term (BBa_C0012) + (BBa_B0014)was miniprepped and concentration was 216,1 ng/uL.

Cut LacI+term (BBa_C0012) and (BBa_B0014), LuxI+term (BBa_C0061 and BBa_B0015) and LuxR+term (BBa_C0062 and BBa_B0015) with XbaI and PstI, so that they can be used as inserts. RBS(BBa_B0034) was cut with Spe1 and Pst1 and will be used further as a backbone.Used the protocol with NEBuffer 2 and 3.

Did a gel electrophoresis with LuxI+term (BBa_C0061 and BBa_B0015) and LuxR+term (BBa_C0062 and BBa_B0015).

Purified RBS and LuxR+term. Resulting concentrations were 4.8 and 11.2 ng/µl, respectively. LacI+ term was also purified from gel using the gel extracion kit for Qiagen, and the concentration was 1,5 ng/uL.

Tuesday 07.08.12


Inspected the petri dishes from yesterday, LacI BBa_C0012 + terminator BBa_B0015 showed colonies, the religation of the terminator BBa_B0015 did not. Transferred a LacI BBa_C0012 + terminator BBa_B0015 colony to LB with ampicillin and inoculated at 37C with shaking.

Did a gel electrophoresis on plld, cut it out and extracted it, according to protocols. The concentration after gel extraction was: cplld = 10,6 ng/µl.

Picture of gel electrophoresis with plld. It was found at approximately 340 bp, as expected (344 bp).

Ligation was performed with plld as insert and RBS BBa_B0034 as backbone. That means that the construct has a pSB1A2 plasmid. Also did a religation of the RBS BBa_B0034 without any insert.

Transformed plld and RBS BBa_B0034 in competent DH5ɑ cells, as well as the religation of RBS BBa_B0034. They were transferred to petri dishes with ampicillin resistance and left in the incubator over night.

Miniprepped VHB+RBS+lysis (BBa_K258005, BBa_B0034 and BBa_K112808), VGB+RBS+lysis (BBa_K561001, BBa_B0034 and BBa_K112808), pllD+lysis (lactate promoter and BBa_K112808) and three parallels of pBad+YFP (BBa_K206000 and BBa_E0030)

Sample Concentration [ng/µl]
VHB+RBS+lysis 38,2
VGB+RBS+lysis 50,5
pllD+lysis 40,2
pBad+YFP #1 46,6
pBad+YFP #2 40,5
pBad+YFP #3 38,9

Monday 06.08.12


In order to start making the construct for the biobrick we are going to improve, the parts needed for the construct were cut using the restriction digest protocol [1].

RBS BBa_B0030 will be used as a backbone and was cut with EcoRI and XbaI. LacI BBa_C0012 will be an insert, and was cut with EcoRI and SpeI. The terminator BBa_B0014 will be used as a backbone and was cut with EcoRI and XbaI. In addition we will test the construct using a constitutive promoter BBa_J23119 which was cut using EcoRI and SpeI.

The inserts LacI BBa_C0012 and constitutive promoter BBa_J23119 were run on gel after the restriction digest. The problem with the constitutive promoter is that it is only 35 b.p long, and is therefore difficult to use as an insert. We tried to stop the gel early to see if we could detect the constitutive promoter, but we could not see anything at all. We therefore ran the gel further and cut the LacI BBa_C0012 out of the gel.

Gel picture of the two inserts ran on gel. Used two different ladders. To the left we used a 1kb ladder to identify the Lac I insert, and to the right we used a 50 kb ladder to identify the constitutive promoter. Expected the LacI band to be approximately 1100 bp which seems to be about right. The constitutive promoter was expected to be 35 bp, but was not detected on the gel at all.

Used the PCR purification kit and protocol from www.qiagen.com [2], on RBS BBa_B0030, pBad BBa_K206000 and terminator BBa_B0014. Did a gel extraction using the Gel Extraction kit and Protocol on LacI BBa_C0012.

Did a ligation with LacI BBa_C0012 and double terminator BBa_B0015, where the double terminator BBa_B0015 was used as a backbone. That means, the construct has a pSB1AK3 backbone and resistance Ampicillin and Kanamycin. A religation of the backbone BBa_B0015 was also performed.

The ligated LacI BBa_C0012 and double terminator BBa_B0015 was transformed in competent DH5ɑ cells, along with the religation of the backbone BBa_B0015. The petri dishes are left to inoculate through the night.

A new batch of LA-medium was made and used to make ampicillin petri dishes.

A restriction digest was done on the lld promoter, as described in the protocols. It was cut with EcoRI and SpeI, and will be an insert with RBS BBa_B0030 as backbone. This will then make the plasmid pSB1A2 the backbone.

Sunday 05.08.12


Plasmid DNA was isolated from pllD-1B and BBa_B0014 cultures were isolated by miniprep. DNA concentrations were measured as 41,2/42,5 and 53,3/52,8 ng/uL respectively (two measurements per sample).

Inspected agar plates in incubator inoculated on 3/8: VGB+RBS religation: 1 colony VHB+RBS+lysis: Good growth VHB+RBS religation: ~ 20 colonies VHB+RBS + lysis: Good growth pBAD (w/ backbone), religated: 40+ colonies pBAD +YFP +DTT: 7 colonies

Comments: Judging from the growth on the religation plates, colonies with non-insert plasmids is a possibility on all plates. pBAD is especially worrisome, as the number of colonies is lower on the insert ligation plate than on the backbone religation plate. The lysis part used in the above constructs already has an RBS, so the RBS part is redundant.

Induced one 5 mL culture (induction culture) pllD + lysis (3/8) with 210 uL ~ 1M lactate and addded 210 uL dH2O to another (control culture). Sampled 200 uL from both before induction, for OD measurements.

Inoculated 5 5 mL LB + Amp cultures with colonies from the following agar plates: VGB+RBS+Lysis (3/8) VHB+RBS+Lysis (3/8) pBAD + YFP +DTT (3/8) (3 colonies)

Inoculated 3 5 mL LB + Cm cultures from pllD + lysis agar plate.

Friday 03.08.12


Isolated plasmid DNA from the cultures of RBS* (BBa_B0030) and LacI (BBa_C0012) inoculated yesterday.

Ligated pBad (BBa_K206000) together with YFP+DTT (BBa_E0030 and BBa_B0015), and VGB+RBS (BBa_K561001 and BBa_B0034) and VHB+RBS (BBa_K258005 and BBa_B0034) with Lysis (BBa_K124017). These were then transformed into competent E. coli DH5α cells and plated out on petri dishes with Ampicillin.

Terminator BBa_B0014 and re-transformed pllD in pSB1C3 ("pllD 1-B") were transferred to liquid culture.

Ran gel on the PCR-products from yesterday.

Inoculated 2 x 5 mL, 1 x 10 mL and 1 x 25 mL LB + Cm with plld + lysis.

Thursday 02.08.12


5 µl of the PCR product from yesterday was run on gel, but it did not give any results. We looked at the primers and thought we had done something wrong, but we did not. Will try to do the PCR one more time, but with a lower annealing temperature (55°C).

The constructs containing plld ligated with the lysis device(BBa_K112808), and plld in plasmid pSB1C3 were miniprepped. The concentration were measured using nano drop.

Sample Concentration [ng/µl]
pllD + lysis 45,5
pllD in PSB1C3 42,3

Inoculated 1 colony from each of three plates containing LacI (BBa_C0012), RBS* BBa_B0030 and pllD + lysis (all inoculated 1/8), into 5 mL LB + Amp (BBa_B0030, LacI)/ LB + Cm (pllD + lysis).

Transformed the part BBa_B0014 from the distribution kit, and re-transformed pllD in pSB1C3 with DNA taken from the sample shipped to the RHIT team yesterday.

Reviewed the data from the oxygen-promoter experiment on monday. In conclusion, it appears that oxygen levels in the induced (anaerobic) cultures were not as low as desired, as growth rates were very similar between the aerobic and anaerobic cultures, while one would expect anaerobic cultures to grow slower. After correcting for OD, the fluorescence in the cultures at the end of the experiment was lower than the fluorescence measured from a control culture with no expected production of fluorescent protein. For this reason, a full analysis of the rest of the data was not performed.

Wednesday 01.08.12


Gel purification was performed on the gel piece from yesterday, the lysis device cut with X+P. The concentration is 10,1 ng/µl. The lysis device and plld were ligated together, plld (with pSB1C3) as backbone.

The ligated lysis and plld were transformed into competent E.coli DH5α cells. This was also done for the biobricks lacI repressor from E. coli (BBa_C0012) and RBS (BBa_B0030).

The petri dishes from yesterday showed colonies on the dishes with the pSB1C3+Colisin construct (pSB1C3 and BBa_K150009) and the K+RBS+Colisin construct (BBa_K081005 and BBa_K150009). One colony from each petri dish were transferred to liquid medium.

Sent a sample of the E. coli pllD promoter in pSB1C3 backbone to the iGEM team at RHIT.

PCR was performed on pBad (BBa_K206000) and DTT (BBa_B0015), the primers used, PCR-mix and programmed times are listed below.

Primer Type Sequence Tm [°C]
DTT fwd Forward CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAG 72
DTT rev Reverse CTCTAGAAGCGGCCGCGAATTCCAGAAATC 72
pBad scar fwd Forward TACTAGAGTACTAGTAGCGGCCGCTGCAGT 72
pBad fwd Forward TACTAGTAGCGGCCGCTGCAGTC 70
pBad rev Reverse GCTAGCCCAAAAAAACGGTATGGAGAAACAGTAGAGAG 72

Mix 1:

Mix 2:

This PCR mix was found here: http://francois.schweisguth.free.fr/protocols/High_fildelity_roche.pdf

Thermal timetables:

pBAD
Step Action Temperature Duration
1 Heated lid: 103°C
2 Initial denaturation; 94°C 2 min
3 Denaturation; 94°C 15 s
4 Annealing; 66°C 30 s
5 Elongation; 72°C 2 min
6 Go to step 3, repeat 10 x
7 Denaturation; 98°C 10 s
8 Elongation; 72°C 31 s
9 Go to step 7, repeat 15 x, with 5 s extra each time.
10 Final Elongation; 72°C 7 min
11 Hold 4°C
DTT
Step Action Temperature Duration
1 Heated lid: 103°C
2 Initial denaturation; 94°C 2 min
3 Denaturation; 94°C 15 s
4 Annealing; 66°C 30 s
5 Elongation; 72°C 3 min
6 Go to step 3, repeat 10 x
7 Denaturation; 98°C 10 s
8 Elongation; 72°C 31 s
9 Go to step 7, repeat 15 x, with 5 s extra each time.
10 Final Elongation; 72°C 7 min
11 Hold 4°C

</div>

Retrieved from "http://2012.igem.org/Team:NTNU_Trondheim/Notebook/August"