|
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|
|
Performed miniprep on RBS (BBa_B0030) and plld+RBS. The concentration were as follows:
Biobrick | Concentration ng/uL | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
RBS | 41,3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
plld+RBS |
Biobrick/Construct | BioBrick | Enzymes | Buffer | bp insert |
---|---|---|---|---|
LuxI+term | BBa_C0061, BBa_B0015 | XbaI+PstI | 3 | 747 |
YFP+term | BBa_E0030, BBa_B0015 | XbaI+PstI | 3 | 852 |
Lysis | BBa_K112808 | XbaI+PstI | 3 | 1785 |
LuxI | BBa_C0061 | XbaI+PstI | 3 | 618 |
RBS* | BBa_B0030 | SpeI+PstI | 1 | - |
PluxR+HSL | BBa_R0062 | SpeI+PstI | 1 | - |
RBS | BBa_B0034 | SpeI+PstI | 1 | - |
pSB1A3 | pSB1A3 | EcoRI+PstI+DpnI | 3 | - |
plld | - | EcoRI+SpeI | 4 | 344 |
The parts lysis BBa_K112808, YFP+term (BBa_E0030, BBa_B0015), pSB1A3 and plld will be assembled using the 3A assembly, so made double cutting mix with these parts.
Gel electrophoresis was done with luxI+term (BBa_C0061, BBa_B0015), lysis BBa_K112808, YFP+term (BBa_E0030, BBa_B0015), LuxI BBa_C0061 and plld. The gel did not show either LuxI or LuxI+term, but cut out lysis, YFP+term and plld. Will do a gel extraction on those, and a PCR purification on pSB1A3, RBS BBa_B0034, RBS* BBa_B0030 and PLuxR+HSL BBa_R0062. This will be done as described in protocols.
Since the restriction digest didn't give anything for LuxI and LuxI+term, will a colony from LuxI+term be transferred to liquid media and LuxI will be transformed again.
Tranformed Vgb+RBS+YFP+term (BBa_K561001, BBa_B0034, BBa_E0030 and BBa_B0015) and Vhb+RBS+YFP+term (BBa_K258005, BBa_B0034, BBa_E0030 and BBa_B0015) in competent DH5ɑ cells as described in the protocol. The plasmid in both of the constructs is pSB1A2. They were left in the incubator over night.
Inspected the petri dishes with plld+RBS (lactate induced promoter and BBa_B0030) and the religation of RBS BBa_B0030, had many more colonies on the plld+RBS than the religation, which is good. Transferred a colony of the plld+RBS (lactate promoter and BBa_B0030) and a colony of RBS BBa_B0030 to liquid media, with ampicillin resistance.
LacI+term (BBa_C0012) + (BBa_B0014)was miniprepped and concentration was 216,1 ng/uL.
Cut LacI+term (BBa_C0012) and (BBa_B0014), LuxI+term (BBa_C0061 and BBa_B0015) and LuxR+term (BBa_C0062 and BBa_B0015) with XbaI and PstI, so that they can be used as inserts. RBS(BBa_B0034) was cut with Spe1 and Pst1 and will be used further as a backbone.Used the protocol with NEBuffer 2 and 3.
Did a gel electrophoresis with LuxI+term (BBa_C0061 and BBa_B0015) and LuxR+term (BBa_C0062 and BBa_B0015).
Purified RBS and LuxR+term. Resulting concentrations were 4.8 and 11.2 ng/µl, respectively. LacI+ term was also purified from gel using the gel extracion kit for Qiagen, and the concentration was 1,5 ng/uL.
Inspected the petri dishes from yesterday, LacI BBa_C0012 + terminator BBa_B0015 showed colonies, the religation of the terminator BBa_B0015 did not. Transferred a LacI BBa_C0012 + terminator BBa_B0015 colony to LB with ampicillin and inoculated at 37C with shaking.
Did a gel electrophoresis on plld, cut it out and extracted it, according to protocols. The concentration after gel extraction was: cplld = 10,6 ng/µl.
Ligation was performed with plld as insert and RBS BBa_B0034 as backbone. That means that the construct has a pSB1A2 plasmid. Also did a religation of the RBS BBa_B0034 without any insert.
Transformed plld and RBS BBa_B0034 in competent DH5ɑ cells, as well as the religation of RBS BBa_B0034. They were transferred to petri dishes with ampicillin resistance and left in the incubator over night.
Miniprepped VHB+RBS+lysis (BBa_K258005, BBa_B0034 and BBa_K112808), VGB+RBS+lysis (BBa_K561001, BBa_B0034 and BBa_K112808), pllD+lysis (lactate promoter and BBa_K112808) and three parallels of pBad+YFP (BBa_K206000 and BBa_E0030)
Sample | Concentration [ng/µl] |
---|---|
VHB+RBS+lysis | 38,2 |
VGB+RBS+lysis | 50,5 |
pllD+lysis | 40,2 |
pBad+YFP #1 | 46,6 |
pBad+YFP #2 | 40,5 |
pBad+YFP #3 | 38,9 |
In order to start making the construct for the biobrick we are going to improve, the parts needed for the construct were cut using the restriction digest protocol [1].
RBS BBa_B0030 will be used as a backbone and was cut with EcoRI and XbaI. LacI BBa_C0012 will be an insert, and was cut with EcoRI and SpeI. The terminator BBa_B0014 will be used as a backbone and was cut with EcoRI and XbaI. In addition we will test the construct using a constitutive promoter BBa_J23119 which was cut using EcoRI and SpeI.
The inserts LacI BBa_C0012 and constitutive promoter BBa_J23119 were run on gel after the restriction digest. The problem with the constitutive promoter is that it is only 35 b.p long, and is therefore difficult to use as an insert. We tried to stop the gel early to see if we could detect the constitutive promoter, but we could not see anything at all. We therefore ran the gel further and cut the LacI BBa_C0012 out of the gel.
Used the PCR purification kit and protocol from www.qiagen.com [2], on RBS BBa_B0030, pBad BBa_K206000 and terminator BBa_B0014. Did a gel extraction using the Gel Extraction kit and Protocol on LacI BBa_C0012.
Did a ligation with LacI BBa_C0012 and double terminator BBa_B0015, where the double terminator BBa_B0015 was used as a backbone. That means, the construct has a pSB1AK3 backbone and resistance Ampicillin and Kanamycin. A religation of the backbone BBa_B0015 was also performed.
The ligated LacI BBa_C0012 and double terminator BBa_B0015 was transformed in competent DH5ɑ cells, along with the religation of the backbone BBa_B0015. The petri dishes are left to inoculate through the night.
A new batch of LA-medium was made and used to make ampicillin petri dishes.
A restriction digest was done on the lld promoter, as described in the protocols. It was cut with EcoRI and SpeI, and will be an insert with RBS BBa_B0030 as backbone. This will then make the plasmid pSB1A2 the backbone.
Plasmid DNA was isolated from pllD-1B and BBa_B0014 cultures were isolated by miniprep. DNA concentrations were measured as 41,2/42,5 and 53,3/52,8 ng/uL respectively (two measurements per sample).
Inspected agar plates in incubator inoculated on 3/8: VGB+RBS religation: 1 colony VHB+RBS+lysis: Good growth VHB+RBS religation: ~ 20 colonies VHB+RBS + lysis: Good growth pBAD (w/ backbone), religated: 40+ colonies pBAD +YFP +DTT: 7 colonies
Comments: Judging from the growth on the religation plates, colonies with non-insert plasmids is a possibility on all plates. pBAD is especially worrisome, as the number of colonies is lower on the insert ligation plate than on the backbone religation plate. The lysis part used in the above constructs already has an RBS, so the RBS part is redundant.
Induced one 5 mL culture (induction culture) pllD + lysis (3/8) with 210 uL ~ 1M lactate and addded 210 uL dH2O to another (control culture). Sampled 200 uL from both before induction, for OD measurements.
Inoculated 5 5 mL LB + Amp cultures with colonies from the following agar plates: VGB+RBS+Lysis (3/8) VHB+RBS+Lysis (3/8) pBAD + YFP +DTT (3/8) (3 colonies)
Inoculated 3 5 mL LB + Cm cultures from pllD + lysis agar plate.
Isolated plasmid DNA from the cultures of RBS* (BBa_B0030) and LacI (BBa_C0012) inoculated yesterday.
Ligated pBad (BBa_K206000) together with YFP+DTT (BBa_E0030 and BBa_B0015), and VGB+RBS (BBa_K561001 and BBa_B0034) and VHB+RBS (BBa_K258005 and BBa_B0034) with Lysis (BBa_K124017). These were then transformed into competent E. coli DH5α cells and plated out on petri dishes with Ampicillin.
Terminator BBa_B0014 and re-transformed pllD in pSB1C3 ("pllD 1-B") were transferred to liquid culture.
Ran gel on the PCR-products from yesterday.
Inoculated 2 x 5 mL, 1 x 10 mL and 1 x 25 mL LB + Cm with plld + lysis.
5 µl of the PCR product from yesterday was run on gel, but it did not give any results. We looked at the primers and thought we had done something wrong, but we did not. Will try to do the PCR one more time, but with a lower annealing temperature (55°C).
The constructs containing plld ligated with the lysis device(BBa_K112808), and plld in plasmid pSB1C3 were miniprepped. The concentration were measured using nano drop.
Sample | Concentration [ng/µl] |
---|---|
pllD + lysis | 45,5 |
pllD in PSB1C3 | 42,3 |
Inoculated 1 colony from each of three plates containing LacI (BBa_C0012), RBS* BBa_B0030 and pllD + lysis (all inoculated 1/8), into 5 mL LB + Amp (BBa_B0030, LacI)/ LB + Cm (pllD + lysis).
Transformed the part BBa_B0014 from the distribution kit, and re-transformed pllD in pSB1C3 with DNA taken from the sample shipped to the RHIT team yesterday.
Reviewed the data from the oxygen-promoter experiment on monday. In conclusion, it appears that oxygen levels in the induced (anaerobic) cultures were not as low as desired, as growth rates were very similar between the aerobic and anaerobic cultures, while one would expect anaerobic cultures to grow slower. After correcting for OD, the fluorescence in the cultures at the end of the experiment was lower than the fluorescence measured from a control culture with no expected production of fluorescent protein. For this reason, a full analysis of the rest of the data was not performed.
Gel purification was performed on the gel piece from yesterday, the lysis device cut with X+P. The concentration is 10,1 ng/µl. The lysis device and plld were ligated together, plld (with pSB1C3) as backbone.
The ligated lysis and plld were transformed into competent E.coli DH5α cells. This was also done for the biobricks lacI repressor from E. coli (BBa_C0012) and RBS (BBa_B0030).
The petri dishes from yesterday showed colonies on the dishes with the pSB1C3+Colisin construct (pSB1C3 and BBa_K150009) and the K+RBS+Colisin construct (BBa_K081005 and BBa_K150009). One colony from each petri dish were transferred to liquid medium.
Sent a sample of the E. coli pllD promoter in pSB1C3 backbone to the iGEM team at RHIT.
PCR was performed on pBad (BBa_K206000) and DTT (BBa_B0015), the primers used, PCR-mix and programmed times are listed below.
Primer | Type | Sequence | Tm [°C] |
---|---|---|---|
DTT fwd | Forward | CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAG | 72 |
DTT rev | Reverse | CTCTAGAAGCGGCCGCGAATTCCAGAAATC | 72 |
pBad scar fwd | Forward | TACTAGAGTACTAGTAGCGGCCGCTGCAGT | 72 |
pBad fwd | Forward | TACTAGTAGCGGCCGCTGCAGTC | 70 |
pBad rev | Reverse | GCTAGCCCAAAAAAACGGTATGGAGAAACAGTAGAGAG | 72 |
Mix 1:
Mix 2:
This PCR mix was found here: http://francois.schweisguth.free.fr/protocols/High_fildelity_roche.pdf
Thermal timetables:
|
|
</div>