"
Team:LMU-Munich/Bacillus BioBricks/Tags
From 2012.igem.org
| Line 23: | Line 23: | ||
<p align="justify"> | <p align="justify"> | ||
| - | The Flag-tag was the first epitope tag to be published ([http://www.nature.com/nbt/journal/v6/n10/full/nbt1088-1204.html Hopp, Prickett et al. (1988)]). It consists of eight hydrophobic amino acids: DYKDDDDK. To | + | The Flag-tag was the first epitope tag to be published ([http://www.nature.com/nbt/journal/v6/n10/full/nbt1088-1204.html Hopp, Prickett et al. (1988)]). It consists of eight hydrophobic amino acids: DYKDDDDK. To enhance senstitivity in Western blots, it is routinely used as a 3x Flag tag in ''B. subtilis'' [http://www.ncbi.nlm.nih.gov/pubmed?term=wiegert%20flag (Kaltwasser ''et al.'', 2002)]. Its sequence is: <b>DYKDHDGDYKDHDIDYKDDDDK</b>. There are a variety of monoclonal antibodies against this tag, N-terminal as well as position insensitive.</p> |
| Line 41: | Line 41: | ||
<p align="justify"> | <p align="justify"> | ||
| - | The His-tag is a metal chelating peptide ([http://www.nature.com/nbt/journal/v6/n11/full/nbt1188-1321.html Hochul,Stüber et al. (1988)]) consisting of at least 6 | + | The His-tag is a metal chelating peptide ([http://www.nature.com/nbt/journal/v6/n11/full/nbt1188-1321.html Hochul,Stüber et al. (1988)]) consisting of at least 6 histidine residues. It can be used for protein purification by metal<sup>2+</sup>ion-containing columns (nickel). There are also antibodies against this tag, or nickel/cobalt containing fluorescent probes can be used for detection. Moreover, an immobilization is possible in nickel/cobalt coated plasticware. |
| - | The | + | The amino acid sequence is:<b>HHHHHHHHHH</b></p> |
Latest revision as of 13:00, 26 October 2012
The LMU-Munich team is exuberantly happy about the great success at the World Championship Jamboree in Boston. Our project Beadzillus finished 4th and won the prize for the "Best Wiki" (with Slovenia) and "Best New Application Project".
[ more news ]
Affinity Tags 
All of our tags have been synthesized by GeneArt. They are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags.
Find out more about the design of our prefix with ribosome binding site.
prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
- 3x Flag-tag (BioBrick:BBa_K823034)
The Flag-tag was the first epitope tag to be published (Hopp, Prickett et al. (1988)). It consists of eight hydrophobic amino acids: DYKDDDDK. To enhance senstitivity in Western blots, it is routinely used as a 3x Flag tag in B. subtilis (Kaltwasser et al., 2002). Its sequence is: DYKDHDGDYKDHDIDYKDDDDK. There are a variety of monoclonal antibodies against this tag, N-terminal as well as position insensitive.
- HA - tag (BioBrick:BBa_K823035)
The HA-tag is an epitope derived from the HA-virus. There was first an antibody against it and then the epitope was characterized (Wilson, I.A. et al. (1984)). It was then furthermore used as a tag for protein purification and recognition (Field et al. (1988)). The amino acid sequence is: YPYDVPDYA.
- cMyc - tag (BioBrick:BBa_K823036)
The cMyc-tag is derived from the cMyc gene product. Antibodies were generated from the immunization with synthetic peptides from the cMyc sequence (Evan, Bishop et al.(1985)). The amino acid sequence is EQKLISEEDL.
- His - tag (BioBrick:BBa_K823037)
The His-tag is a metal chelating peptide (Hochul,Stüber et al. (1988)) consisting of at least 6 histidine residues. It can be used for protein purification by metal2+ion-containing columns (nickel). There are also antibodies against this tag, or nickel/cobalt containing fluorescent probes can be used for detection. Moreover, an immobilization is possible in nickel/cobalt coated plasticware. The amino acid sequence is:HHHHHHHHHH
- Strep - tag (BioBrick:BBa_K823038)
The Strep-tag is a mimicry peptide of biotin which binds to Streptavidin (Skerra, Schmidt (1999)). Its sequence is WSHPQFEK. It can be used for protein purification, immobilization with streptavidin or strep-tactin (Voss, Skerra (1997)) or detection with Strep-tactin or antibodies.
 |
