Team:Kyoto/MethodAndMaterial

From 2012.igem.org

(Difference between revisions)
(Strains (E.coli))
Line 184: Line 184:
</div>
</div>
<div id="kyoto-tab-material">
<div id="kyoto-tab-material">
-
===Strains (E.coli)===
+
==Strains==
-
=====JM109=====   
+
===E.coli===
-
endA, recA1, gyrA96,thi,hsdR17,(rκ-,mκ+),relA1, supE44,λ-,Δ(lac-proAB),[F',traD36,proAB,laclqZΔM15] <br>
+
'''JM109'''  endA, recA1, gyrA96,thi,hsdR17,(rκ-,mκ+),relA1, supE44,λ-,Δ(lac-proAB),[F',traD36,proAB,laclqZΔM15] <br>
-
=====BL21(DE3)=====
+
'''BL21(DE3)'''  F-, ompT, hsdSB(rB -mB - ), gal, dcm, (DE3)<br>
-
F-, ompT, hsdSB(rB -mB - ), gal, dcm, (DE3)
+
 
 +
===Plant===
 +
Arabidopsis thaliana ecotype Columbia
 +
==Primers==
 +
====Florigen====
 +
{|
 +
!Name||sequence
 +
|-
 +
|FT(RBS+)forward||gctctagagaaagaggagaaaGTCGACATGTCTATAAATATAAGAGACCCTCT
 +
|-
 +
|FT(RBS+)reverse||aaactgcagcggccgctactagtaCCTTGAGCTCCTAAAGTCTTCTTCCTC
 +
|-
 +
|FT(RBS-)forward||ggaattcgcggccgcttctagagATGTCTATAAATATAAGAGACCCTCTT
 +
|-
 +
|FT for sequence forward||TGACCATGATTACGCCAAGC
 +
|-
 +
|FT for sequence reverse||ACGGCCAGTGAATTGTAATACG
 +
|-
 +
|FT(+His)forward||TCTATAAATATAAGAGACCCTCTTATAGTAAGCAGAGTTG
 +
|-
 +
|FT(+His)reverse||ATGGTGATGGTGATGGTGCATGTCGACtttctcctctttctctagtatctcc
 +
|-
 +
|FT mutation forward||CATTCATCGTGTCGTGTTTATATTGTTTCG
 +
|-
 +
|FT mutation reverse||CCAGCAGTGGGACTTGGATTTTCGTAACAC
 +
|-
 +
|FT mutation forward2||CATTCATCGTGTCGTGTTTATATTGTTTCGACAGC
 +
|-
 +
|TUBULIN forward||AAACTCACTACCCCCAGCTTTG
 +
|-
 +
|TUBULIN reverse||CACCAGACATAGTAGCAGAAATCAAGT
 +
|-
 +
|SEP3 forward||CTAAGACTAAGGTTAGCTGATGGGTA
 +
|-
 +
|SEP3 reverse||ATGATGACGACCGTAGTGATCAA
 +
|-
 +
|FUL forward||TGCGTAACCTCCTCCAGAGAT
 +
|-
 +
|FUL reverse||GTTCTACTCGTTCGTAGTGGTAGGAC
 +
|-
 +
|AP1 forward||ACATCCGCACTAGAAAAAACCAAC
 +
|-
 +
|AP1 reverse||CTTGGTTCTGCTGATCCCACA
 +
 
===Strains (Plant)===
===Strains (Plant)===
Arabidopsis thaliana ecotype Columbia
Arabidopsis thaliana ecotype Columbia

Revision as of 23:57, 24 September 2012

  • Home
  • Project
  • Method And Material
  • Notebook
  • Consideration
  • Team
  • SiteMap

Contents

Protocol

Western blotting

Gel solution
Running gelStacking gel
1.5M Tris-HCl(pH8.8)2.5mL-
0.25M Tris-HCl(pH6.8)-3.0mL
30% Acrylamide5mL0.6mL
10% SDS0.2mL0.12mL
DW2.3mL2.3mL
TEMED15µL7µL
10% APS100µL60µL
Total10mL6mL
4x Sample buffer
1M Tris-HCl 2mL
SDS 0.8g
100% glycerol 4mL
14.7M mercaptoethanol 0.4mL
0.5M EDTA 1mL
Bromophenol blue 8.0mg
DW 2.6mL
10x electrode buffer
Tris 15.15g
Glycin 71.55g
10%SDS 50mL
DW 450mL
Total 500mL
blotting buffer
Tris 12g
Glycin 14.4g
DW 800mL
Methanol 200mL
TBST
50mM Tris
150mM NaCl
0.1% Tween-20
blocking buffer
  • TBST
  • 5% skim milk
AP color development buffer
  • 100mM Tris (pH8.5)
  • 100mM NaCl
  • 5mM MgCl2
  1. Spin down 100µL culture and suspend into sample buffer.
  2. Boil at 95°C for 10 min.
  3. Apply 10µL to polyacrylamide gel.
  4. Electrophorese at 500V, 30mA for 50 min.
  5. Transfer at 50V, 100mA for 30 min.
  6. Add blocking buffer to the membrane and incubate with shaking for 30 min. at room temperature.
  7. Add appropriate primary antibody diluted in TBST and incubate with shaking for 30 min. at RT.
  8. Wash with TBST and incubate with shaking for 10 min, two times.
  9. Add secondary antibody conjugated with AP and incubate with shaking for 30 min. at RT.
  10. Wash with TBST and incubate with shaking for 10 min, three times.
  11. Add 66µL NBT and 33µLof BCIP into color development buffer., and add the mixture to the membrane.
  12. After the coloring, wash with DW.

Verification of R9 function by GFP

Verification of R9 function by TAKEUCHI

R9(20µg/µL)0.9µL
GFP(1.2mg/mL)2.23µL
RBS16.85µL
total20µL

X5

Method:
1. Peel cuticles on parafilm by using the head of pencil.(Menasha,wI,54952)
2. Put plant cells into GFP&R9 or GFP for 5~30min.
3. Put plant cells into PBS.
4. Hoechst dyeing.

123456
R9oooxoo
cuticleooooxx
soak in GFP5min15min30min5min5min30min
Loading.....

Strains

E.coli

JM109 endA, recA1, gyrA96,thi,hsdR17,(rκ-,mκ+),relA1, supE44,λ-,Δ(lac-proAB),[F',traD36,proAB,laclqZΔM15]
BL21(DE3) F-, ompT, hsdSB(rB -mB - ), gal, dcm, (DE3)

Plant

Arabidopsis thaliana ecotype Columbia

Primers

Florigen

Namesequence
FT(RBS+)forwardgctctagagaaagaggagaaaGTCGACATGTCTATAAATATAAGAGACCCTCT
FT(RBS+)reverseaaactgcagcggccgctactagtaCCTTGAGCTCCTAAAGTCTTCTTCCTC
FT(RBS-)forwardggaattcgcggccgcttctagagATGTCTATAAATATAAGAGACCCTCTT
FT for sequence forwardTGACCATGATTACGCCAAGC
FT for sequence reverseACGGCCAGTGAATTGTAATACG
FT(+His)forwardTCTATAAATATAAGAGACCCTCTTATAGTAAGCAGAGTTG
FT(+His)reverseATGGTGATGGTGATGGTGCATGTCGACtttctcctctttctctagtatctcc
FT mutation forwardCATTCATCGTGTCGTGTTTATATTGTTTCG
FT mutation reverseCCAGCAGTGGGACTTGGATTTTCGTAACAC
FT mutation forward2CATTCATCGTGTCGTGTTTATATTGTTTCGACAGC
TUBULIN forwardAAACTCACTACCCCCAGCTTTG
TUBULIN reverseCACCAGACATAGTAGCAGAAATCAAGT
SEP3 forwardCTAAGACTAAGGTTAGCTGATGGGTA
SEP3 reverseATGATGACGACCGTAGTGATCAA
FUL forwardTGCGTAACCTCCTCCAGAGAT
FUL reverseGTTCTACTCGTTCGTAGTGGTAGGAC
AP1 forwardACATCCGCACTAGAAAAAACCAAC
AP1 reverseCTTGGTTCTGCTGATCCCACA

Strains (Plant)

Arabidopsis thaliana ecotype Columbia