Team:Cornell/project/wetlab/results/transcription

From 2012.igem.org

(Difference between revisions)
 
(9 intermediate revisions not shown)
Line 35: Line 35:
<li>
<li>
<a href="http://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a>
<a href="http://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">BioBricks</a>
-
</li>
 
-
<li>
 
-
<a href="http://2012.igem.org/Team:Cornell/project/wetlab/results/reactors">Reactors</a>
 
</li>
</li>
<li class="active">
<li class="active">
<a href="http://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a>
<a href="http://2012.igem.org/Team:Cornell/project/wetlab/results/transcription">Transcriptional Characterization</a>
 +
</li>
 +
<li>
 +
<a href="http://2012.igem.org/Team:Cornell/project/wetlab/results/currentresponse">Current Response</a>
</li>
</li>
Line 76: Line 76:
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations.  
In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations.  
<h3>Control</h3>
<h3>Control</h3>
-
In order to optimize experimental parameters, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.
+
To optimize experimental parameters and verify that fluorescence of <i>S. oneidensis</i> could be measured reliably, we began by measuring the fluorescence of mRFP with Anderson series promoters in <i>Shewanella oneidensis</i> MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in <i>S. oneidensis</i> as they do in <i>E. coli</i>.
-
<img class="inline" width="650" align="middle" src="http://2012.igem.org/wiki/images/9/9b/Fluorescence_controls.png">
+
<img class="inline" src="http://2012.igem.org/wiki/images/9/9b/Fluorescence_controls.png">
-
<br>
+
<font size="2"><b>mRFP fluorescence increases with increasing promoter strength.</b> Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after a 16-hour incubation period. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested.</font>
-
<font size="2">Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after steady OD was reached and cells were in stationary phase. <i>S. oneidensis</i> with mtrB knocked out, and three strains of <i>S. oneidensis</i> expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested. mRFP fluorescence increases with increasing promoter strength.</font>
+
</div>
</div>
</div>
</div>
Line 85: Line 84:
<div class="twelve columns">
<div class="twelve columns">
<h3>Arsenic</h3>
<h3>Arsenic</h3>
-
In order to determine if gene expression is increased in the presence of arsenic, we inoculated our growth medium with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of  mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 4.5 hours, after the cells had grown to a steady OD.
+
In order to determine if gene expression is increased in the presence of arsenic, we incubated our reporter strains with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and <i>S. oneidensis</i> &Delta;mtrB as negative controls, while <i>S. oneidensis</i> &Delta;mtrB strains with Anderson promoters (0.1, 0.4, 1.0) upstream of  mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data for three replicates was averaged over time courses of 4.5 hours, after the cells had grown to a steady OD.
-
<img class="inline" src="http://2012.igem.org/wiki/images/thumb/a/a7/FluorescenceArsenite1001.png/800px-FluorescenceArsenite1001.png">
+
<img class="inline" src="http://2012.igem.org/wiki/images/a/a7/FluorescenceArsenite1001.png">
-
<img class="inline" src="http://2012.igem.org/wiki/images/thumb/9/92/FluorescenceArsenate1001.png/800px-FluorescenceArsenate1001.png">
+
<img class="inline" src="http://2012.igem.org/wiki/images/9/92/FluorescenceArsenate1001.png">
-
<font size="2">Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font>
+
<font size="2"><b>Arsenic reporter responds positively to arsenite, but not arsenate.</b> Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.</font>
<br><br>
<br><br>
-
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Therefore, our arsenic reporters are responding to arsenite.
+
Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Our arsenic reporters are upregulating mRFP expression in response to arsenite, which suggests that mtrB transcription is also being upregulated.
-
<br/><br/>
+
<br/><br>
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.
However, our preliminary data from arsenate treatment shows no clear trend. As <i>S. oneidensis</i> has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.
-
<br/><br/>
+
<br/><br>
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.
Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.
Line 112: Line 111:
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.
Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium.
-
Trials were run using blank LB medium and JG700 as negative controls, while conjugated JG700 strains with Anderson promoters (0.1, 0.4, 1.0) upstream of  mRFP were used as positive controls.
+
Trials were run using blank LB medium and <i>S. oneidensis</i> &Delta;mtrB as negative controls, while <i>S. oneidensis</i> &Delta;mtrB strains with Anderson promoters (0.1, 0.4, 1.0) upstream of  mRFP were used as positive controls.
-
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.
+
Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data for three replicates was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD.
-
<img class="inline" src="http://2012.igem.org/wiki/images/thumb/5/56/FluorescenceSalicylate930.png/800px-FluorescenceSalicylate930.png">
+
<img class="inline" src="http://2012.igem.org/wiki/images/5/56/FluorescenceSalicylate930.png">
-
<font size="2">Preliminary data of relative fluorescence at 1, 10, 100, and 500 µM of salicylate. Relative fluorescence is reported after normalization to optical density.</font>
+
<font size="2"><b>Salicylate reporter upregulates transcription of downstream genes in response to induction with salicylate.</b> Preliminary data of relative fluorescence of salicylate reporter in <i>S. oneidensis</i> at 0, 10, 100, and 500 µM of salicylate is shown. Relative fluorescence is reported after normalization to optical density.</font>
<br><br>
<br><br>
-
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. Additionally, comparison to fluorescence from the Anderson 0.1 promoter (not shown in graph) suggests that the induced promoter activity may have similar strength to 0.1 on the Anderson series scale.
+
Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. Error bars are excluded, pending additional replicates to ensure statistical significance. However, we are confident that our salicylate reporter is functioning as expected on the transcriptional level.
-
 
+
-
<br/><br/>
+
-
 
+
-
SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. We are continuing to characterize our salicylate reporter strains.
+
</div>
</div>
</div>
</div>

Latest revision as of 01:40, 27 October 2012

Transcriptional Characterization


Fluorescence

In order to characterize promoter activity in response to arsenic and salicylate, we appended mRFP downstream of mtrB in our reporter parts. We used these constructs to test the level of promoter activity at increasing arsenic and salicylate concentrations.

Control

To optimize experimental parameters and verify that fluorescence of S. oneidensis could be measured reliably, we began by measuring the fluorescence of mRFP with Anderson series promoters in Shewanella oneidensis MR-1. After adjusting the parameters of our tests to get a consistent response from control strains, we saw increasing relative fluorescence with increasing promoter strength. This suggests that the Anderson series constitutive promoters show similar activity in S. oneidensis as they do in E. coli. mRFP fluorescence increases with increasing promoter strength. Relative fluorescence of four strains, normalized to optical density, averaged over 8 replicates after a 16-hour incubation period. S. oneidensis with mtrB knocked out, and three strains of S. oneidensis expressing mRFP with Anderson series promoters strength 0.1, 0.7, and 1.0, were tested.

Arsenic

In order to determine if gene expression is increased in the presence of arsenic, we incubated our reporter strains with varying concentrations of either arsenite or arsenate and measured fluorescence using the BioTek Instruments Synergy™ HT Multi-Mode Microplate Reader. Trials were run using blank LB medium and S. oneidensis ΔmtrB as negative controls, while S. oneidensis ΔmtrB strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data for three replicates was averaged over time courses of 4.5 hours, after the cells had grown to a steady OD. Arsenic reporter responds positively to arsenite, but not arsenate. Preliminary data of relative fluorescence at 0, 10, 50, 100, and 500 µM of (a) arsenite, and (b) arsenate. Relative fluorescence is reported after normalization to optical density.

Our preliminary data shows that as arsenite concentration is increased, relative fluorescence increases by over two-fold in both reporter strains! Our arsenic reporters are upregulating mRFP expression in response to arsenite, which suggests that mtrB transcription is also being upregulated.

However, our preliminary data from arsenate treatment shows no clear trend. As S. oneidensis has the native ability to reduce arsenates to arsenites, this may contribute to the lack of an obvious trend.

Because relative fluorescence is an average of only 3 replicates over 4.5 hour time courses, error bars are not included. We are currently continuing fluorescence assays to ensure statistical significance and to further define the dynamic range of our constructs.

Salicylate

Our fluorescence assays confirm that the salicylate reporter construct without a BamHI cut-site, SAL2, responds to salicylate in a range of 10-100 µM. As with tests characterizing response to arsenites and arsenates, we measured fluorescence while varying concentration of salicylate in LB medium. Trials were run using blank LB medium and S. oneidensis ΔmtrB as negative controls, while S. oneidensis ΔmtrB strains with Anderson promoters (0.1, 0.4, 1.0) upstream of mRFP were used as positive controls. Background fluorescence from LB was subtracted and fluorescence normalized to optical density in order to obtain relative fluorescence per cell mass. Fluorescence data for three replicates was averaged over a time course of 7.5 hours, after the cells had grown to a steady OD. Salicylate reporter upregulates transcription of downstream genes in response to induction with salicylate. Preliminary data of relative fluorescence of salicylate reporter in S. oneidensis at 0, 10, 100, and 500 µM of salicylate is shown. Relative fluorescence is reported after normalization to optical density.

Preliminary data strongly suggests that SAL2 responds to salicylate at concentrations in the order of hundreds of µM. SAL2 fluorescence is averaged over 3 replicates in addition to averaging replicate individually over a time course of 7.5 hours. Error bars are excluded, pending additional replicates to ensure statistical significance. However, we are confident that our salicylate reporter is functioning as expected on the transcriptional level.


RT-qPCR

We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows:

FOR_enzA: CAGCCTTTTACCCAAGGTGA
REV_enzA: CACGATTCGAGAGGGTGATT
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT