Team:Cornell/project/wetlab/results/qPCR

From 2012.igem.org

(Difference between revisions)
(Created page with "{{:Team:Cornell/templates/header}} <!-- paulirish.com/2008/conditional-stylesheets-vs-css-hacks-answer-neither/ --> <!--[if lt IE 7]> <html class="no-js lt-ie9 lt-ie8 lt-ie7" lan...")
 
(One intermediate revision not shown)
Line 34: Line 34:
<ul>
<ul>
<li>
<li>
-
<a href="http://2012.igem.org/Team:Cornell/project/wetlab/results/">Parts</a>
+
<a href="http://2012.igem.org/Team:Cornell/project/wetlab/results/biobricks">Parts</a>
</li>
</li>
<li>
<li>
Line 60: Line 60:
</li>
</li>
<li>
<li>
-
<a href="http://2012.igem.org/Team:Cornell/testing/project/wetlab/6">Animation</a>
+
<a href="http://2012.igem.org/Team:Cornell/project/wetlab/animation">Animation</a>
</li>
</li>
</ul>
</ul>

Latest revision as of 22:50, 18 October 2012

qPCR

RT-qPCR

We are currently using two-step RT-qPCR to confirm that our engineered Shewanella strains respond to arsenic and naphthalene. Total RNA will be isolated using the E.Z.N.A.™ Bacterial RNA Isolation Kit from Omega bio-tek; cDNA will be synthesized using the qScript™ Flex cDNA Kit from Quanta Biosciences; and we are using the ABI ViiA7 platform along with the KAPA SYBR(R) FAST qPCR Kit from KAPA Biosystems. Our primers are as follows:

FOR_enzA: CAGCCTTTTACCCAAGGTGA
REV_enzA: CACGATTCGAGAGGGTGATT
FOR_RecA: TTCCCCTCGACATTGTCATCATCGGA
REV_RecA: AAGGGCGATAAAATTGGTCAAGGCCG
3'_FOR_qPCR_mtrB: ACGCTCAATATCAAGCCACCGAGA
3'_REV_qPCR_mtrB: TGTGCGGTGTAGTCATGGCTGT