Team:Carnegie Mellon/Bio-Submitted

From 2012.igem.org

(Difference between revisions)
Line 18: Line 18:
</li>
</li>
<li>
<li>
-
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Hom-Safety">Safety</a>
+
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Hom-Acknowledgements">Acknowledgements</a>
</li>
</li>
</ul>
</ul>
</li>
</li>
-
<li class="current" style ='width: 193px'>
+
<li class="current" style ='width: 193px'>
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Bio-Overview">BioBricks</a>
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Bio-Overview">BioBricks</a>
<ul>
<ul>
Line 29: Line 29:
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Bio-Overview">Overview</a>
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Bio-Overview">Overview</a>
</li>
</li>
-
<li class="current" >
+
<li class="current">
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Bio-Submitted">Submitted Parts</a>
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Bio-Submitted">Submitted Parts</a>
-
</li>
 
-
<li>
 
-
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Bio-Properties">Properties</a>
 
</li>
</li>
</ul>
</ul>
Line 56: Line 53:
<li>
<li>
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Met-Notebook">Notebook</a>
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Met-Notebook">Notebook</a>
 +
</li>
 +
<li>
 +
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Met-Safety">Safety</a>
 +
</li>
</ul>
</ul>
</li>
</li>
Line 78: Line 79:
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Hum-Overview">Human Practices</a>
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Hum-Overview">Human Practices</a>
<ul>
<ul>
-
<li class = 'offset' style ='width: 687px'> <a href="#"></a></li>
+
<li class = 'offset' style ='width: 622px'> <a href="#"></a></li>
<li>
<li>
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Hum-Overview">Overview</a>
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Hum-Overview">Overview</a>
Line 87: Line 88:
<li>
<li>
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Hum-Circuit">Circuit Kit</a>
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Hum-Circuit">Circuit Kit</a>
-
<ul>
+
</li>
-
<li>
+
<li>
-
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Hum-Documentation">Documentation</a>
+
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Hum-Software">Software</a>
-
</li>
+
-
<li>
+
-
<a href="http://2012.igem.org/Team:Carnegie_Mellon/Hum-Software">Software</a>
+
-
</li>
+
-
</ul>
+
</li>
</li>
</ul>
</ul>
Line 100: Line 96:
</ul>
</ul>
     <br /><br /><br />
     <br /><br /><br />
-
 
<!--Main Contents -->
<!--Main Contents -->

Revision as of 13:53, 2 October 2012

Image:CMU_image6.jpeg




Submitted Parts

We have submitted three T7Lac promoter parts to the registry. The followings show the sequences of these constructs.
BBa_K613007: TAATACGACTCACTATAGGGAGAGGAATTGTGAGCGGATAACAA
(BBa_K921000) Mutant I: TAATGCGACTCACTATAGGACAATTGTGGGCGGACAACAATTCCAA
(BBa_K921001) Mutant II: TAATACGACTCACTACAGGGCGGAATTGTGAGCGGATAACAATTCCAA
(BBa_K921002) Mutant III: CAATCCGACTCACTAAAGAGAGAATTGTGAGCGGATAACAATTCCAA

Predicted strength of the hybrid T7Lac promoters

Expected promoter strength of the mutants (relative to BBa_K613007):
Mutant I: <100%
Mutant II: ~100%
Mutant III: ~50%

Expected LacI leaky expression of different mutants:
Mutant I: More than average
Mutant II: Average
Mutant III: Average

RBS used in construct is: CATATG AAGAAGGAGA TATACC

Measured strength of the hybrid T7Lac promoters

We have measured both RNA and protein expression levels of the designed T7Lac promoters using fluorogen-activated biosensors (see details in Methods & Results). These experimental results were analyzed using a mathematical model that we developed in MATLAB (see details in Model). Based on the analysis, we obtained the following properties of the new T7Lac promoters with respect to the wild-type T7Lac promoter.
Promoter Mutant I Mutant II Mutant III
Transcription Strength 97% 72% 127%
Translational Efficiency 6% 6% 94%
RNA degradation constant (assumed) 100% 100% 100%
Protein degradation constant (fit) 4% 6% 60%
Cheemeng:Need to comment on the results here.

Image:TartanFooter.jpeg