"
Team:Carnegie Mellon/Bio-Submitted
From 2012.igem.org
(Difference between revisions)
| Line 18: | Line 18: | ||
</li> | </li> | ||
<li> | <li> | ||
| - | <a href="https://2012.igem.org/Team:Carnegie_Mellon/Hom- | + | <a href="https://2012.igem.org/Team:Carnegie_Mellon/Hom-Acknowledgements">Acknowledgements</a> |
</li> | </li> | ||
</ul> | </ul> | ||
</li> | </li> | ||
| - | <li | + | <li class="current" style ='width: 193px'> |
<a href="https://2012.igem.org/Team:Carnegie_Mellon/Bio-Overview">BioBricks</a> | <a href="https://2012.igem.org/Team:Carnegie_Mellon/Bio-Overview">BioBricks</a> | ||
<ul> | <ul> | ||
| Line 29: | Line 29: | ||
<a href="https://2012.igem.org/Team:Carnegie_Mellon/Bio-Overview">Overview</a> | <a href="https://2012.igem.org/Team:Carnegie_Mellon/Bio-Overview">Overview</a> | ||
</li> | </li> | ||
| - | <li class="current" > | + | <li class="current"> |
<a href="https://2012.igem.org/Team:Carnegie_Mellon/Bio-Submitted">Submitted Parts</a> | <a href="https://2012.igem.org/Team:Carnegie_Mellon/Bio-Submitted">Submitted Parts</a> | ||
| - | |||
| - | |||
| - | |||
</li> | </li> | ||
</ul> | </ul> | ||
| Line 56: | Line 53: | ||
<li> | <li> | ||
<a href="https://2012.igem.org/Team:Carnegie_Mellon/Met-Notebook">Notebook</a> | <a href="https://2012.igem.org/Team:Carnegie_Mellon/Met-Notebook">Notebook</a> | ||
| + | </li> | ||
| + | <li> | ||
| + | <a href="https://2012.igem.org/Team:Carnegie_Mellon/Met-Safety">Safety</a> | ||
| + | </li> | ||
</ul> | </ul> | ||
</li> | </li> | ||
| Line 78: | Line 79: | ||
<a href="https://2012.igem.org/Team:Carnegie_Mellon/Hum-Overview">Human Practices</a> | <a href="https://2012.igem.org/Team:Carnegie_Mellon/Hum-Overview">Human Practices</a> | ||
<ul> | <ul> | ||
| - | <li class = 'offset' style ='width: | + | <li class = 'offset' style ='width: 622px'> <a href="#"></a></li> |
<li> | <li> | ||
<a href="https://2012.igem.org/Team:Carnegie_Mellon/Hum-Overview">Overview</a> | <a href="https://2012.igem.org/Team:Carnegie_Mellon/Hum-Overview">Overview</a> | ||
| Line 87: | Line 88: | ||
<li> | <li> | ||
<a href="https://2012.igem.org/Team:Carnegie_Mellon/Hum-Circuit">Circuit Kit</a> | <a href="https://2012.igem.org/Team:Carnegie_Mellon/Hum-Circuit">Circuit Kit</a> | ||
| - | + | </li> | |
| - | + | <li> | |
| - | + | <a href="https://2012.igem.org/Team:Carnegie_Mellon/Hum-Software">Software</a> | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
</li> | </li> | ||
</ul> | </ul> | ||
| Line 100: | Line 96: | ||
</ul> | </ul> | ||
<br /><br /><br /> | <br /><br /><br /> | ||
| - | |||
<!--Main Contents --> | <!--Main Contents --> | ||
Revision as of 13:53, 2 October 2012
Submitted Parts
We have submitted three T7Lac promoter parts to the registry. The followings show the sequences of these constructs.
BBa_K613007: TAATACGACTCACTATAGGGAGAGGAATTGTGAGCGGATAACAA
(BBa_K921000) Mutant I: TAATGCGACTCACTATAGGACAATTGTGGGCGGACAACAATTCCAA
(BBa_K921001) Mutant II: TAATACGACTCACTACAGGGCGGAATTGTGAGCGGATAACAATTCCAA
(BBa_K921002) Mutant III: CAATCCGACTCACTAAAGAGAGAATTGTGAGCGGATAACAATTCCAA
Predicted strength of the hybrid T7Lac promoters
Expected promoter strength of the mutants (relative to BBa_K613007):Mutant I: <100%
Mutant II: ~100%
Mutant III: ~50%
Expected LacI leaky expression of different mutants:
Mutant I: More than average
Mutant II: Average
Mutant III: Average
Measured strength of the hybrid T7Lac promoters
We have measured both RNA and protein expression levels of the designed T7Lac promoters using fluorogen-activated biosensors (see details in Methods & Results). These experimental results were analyzed using a mathematical model that we developed in MATLAB (see details in Model). Based on the analysis, we obtained the following properties of the new T7Lac promoters with respect to the wild-type T7Lac promoter.| Promoter | Mutant I | Mutant II | Mutant III |
|---|---|---|---|
| Transcription Strength | 97% | 72% | 127% |
| Translational Efficiency | 6% | 6% | 94% |
| RNA degradation constant (assumed) | 100% | 100% | 100% |
| Protein degradation constant (fit) | 4% | 6% | 60% |
