"

From 2012.igem.org

Revision as of 20:09, 25 June 2012 (view source) Grace.yi (Talk | contribs) ← Older edit		Revision as of 23:52, 25 June 2012 (view source) Jacobtoth (Talk | contribs) (→Site-directed Mutagenesis) Newer edit →
Line 10:		Line 10:
	-Jacob		-Jacob
		+	While teaching Ruichen and Mehul how to design mutagenesis primers, I came up with the primers for getting rid of the PstI from dszB. Here they are:
		+
		+	Primer pair 1
		+	*
		+	Forward: 5' CAACAACTTGCTACAGGAACCCGTC 3'
		+	Reverse: 5' GACGGGTTCCTGTAGCAAGTTGTTG 3'
		+	*
		+	GC content: 52.00%          Location: 24-48
		+	Melting temp: 71.8°C        Mismatched bases: 1
		+	Length: 25 bp                Mutation: Substitution
		+	5' flanking region: 12 bp    Forward primer MW: 7580.05 Da
		+	3' flanking region: 12 bp    Reverse primer MW: 7744.11 Da
	==June 21==		==June 21==

---

Revision as of 23:52, 25 June 2012

Contents 1 Site-directed Mutagenesis 2 June 21 3 June 22 4 June 23 5 June 25

Site-directed Mutagenesis

Jacob, Grace, and Ting-Chia will be working on getting rid of illegal sites within biobricks.

Marianne and Ruichen will be working on this as well (Monday Night)

I suggest that we just synthesize the dszA (4 PstI sites). Saves us time and grief. -Jacob

While teaching Ruichen and Mehul how to design mutagenesis primers, I came up with the primers for getting rid of the PstI from dszB. Here they are:

Primer pair 1

                           *
   Forward: 5' CAACAACTTGCTACAGGAACCCGTC 3'
   Reverse: 5' GACGGGTTCCTGTAGCAAGTTGTTG 3'
                           *
    GC content: 52.00%           Location: 24-48
    Melting temp: 71.8°C         Mismatched bases: 1
    Length: 25 bp                Mutation: Substitution
    5' flanking region: 12 bp    Forward primer MW: 7580.05 Da
    3' flanking region: 12 bp    Reverse primer MW: 7744.11 Da

June 21

Jacob and I are working on getting amino acid genes into biobricks. We're on our fourth (?) ligation with some of them because they haven't been working... We suspect the ligation step has been causing the trouble and we altered the protocol slightly - 3:1 insert to vector ratio (in uL) as opposed to the 2:2 used previously, and using NEB Buffer 3 as opposed to Buffer 2 (to optimize EcoR1 and PST1 activity). We also left the ligation mix sitting at room temperature beginning at 5 pm overnight. Jacob will transform the cloned vectors into competent cells (K12?) and plate them tomorrow morning (~9 am). This increases the ligation process from 1.5 hours (June 20) to 16 hours.

The genes I digested and ligated:

• Trp A
• Trp B
• Tyr A
• Met A
• Arg C

Jacob and I digested/ligated/transformed those listed above yesterday as well, but Arg C has replaced Arg E today because the Arg E cells grew several (~5) colonies! Success!

I also (re)ligated the pSB1C3 vector left over from last year (about 8 months old). It has the RFP gene cloned into it. This was to (1) amplify the number of cloned vectors, and (2) to check if our ligation protocol is effective.

Joe was digesting 2 of the dsz genes and planned to ligate tomorrow.

- Grace.yi

June 22

Jacob found one colony on the MetA plate from the cloning done previously (before the 21st). To do: inoculate a culture, miniprep, sequence! Likewise for the ArgE.

The cloned vectors from yesterday were transformed into DH5a and plated on Chlor plates.

June 23

Appears to be no colonies on any of the plates made yesterday. Will keep them in the 37° room in case colonies appear later.

June 25

No colonies on the plates made on June 22 - need to redo.