Team:Bielefeld-Germany/Results/cbc

From 2012.igem.org

Revision as of 18:22, 26 September 2012 by Juvoss (Talk | contribs)

Cellulose Binding Domain

Summary

Contents


Introduction

In the field of cheap protein-extraction cellulose binding domains (CBD) have made themselfes a name. A lot of publications have been made, concerning a cheap strategy to capture a protein from the cell-lysate with a CBD-tag. Also enhanced segregation with CBD-tagged proteins have been observed. At this project the idea is different, the binding of our self-produced proteins to cellulose via a protein-domain-tag is taking advantage of the binding capacity of binding domains not only for purification reasons (it is still a great benefit), but also as an immobilizing-protocol for our laccases.

Figure 1:Graphical sequence-alignment of BBa_K392014 and the Xyn10A gene of C.josui

To make a purification and immobilization-tag out of a protein domain, there are a lot of decisions and characterizations to get through.

Starting with the choice of the binding domain, the first limitation is accessibility. The first place to look at is, of course the Partsregistry. A promising Cellulose binding motif of the C. josui Xyn10A gene (BBa_K392014) was found and ordered for the project right from the spot. After some research later concerning the sequence of that BioBrick it turned out that the part is not the CBD of the Xylanase as it should be, but the glycosyl hydrolase domain of the protein (Figure 1). This result made the part useless for the project (complete review) and it was the only binding domain in the Partsregistry that fitted to the project.

Accessible organisms were searched via NCBI for binding-domains, -proteins and -motifs and work-groups were asked if they could help out. The results of the database research were only two chitin/carbohydate binding modules within the Bacillus halodurans genome (That stain was ordered for it's laccase BBa_K863020). One is in the Cochin chitinase gene and the other in a chitin binding protein.

Figure 2: Plasmid-map of p714 with CBDcex; Origin: Fermentation group of Bielefeld University
Figure 3: Plasmid-map of p570 with CBDclos; Origin: Fermentation group of Bielefeld University

Meanwhile the Fermentation group of our university group offered the use of two plasmids (p570 & p671), containing cellulose binding domains. The cellulose binding domain of the Cellulomonas fimi ATCC 484 exoglucanase gene (CBDcex) and the cellulose binding domain of Clostridium cellulovorans cellulose binding protein gene (cbp A) (CBDclos). The decision was made to use these two domains. Staying within the cellulose binding domain-family and leave other protein domains like carbohydrate binding domains aside would keep the results comparable. Like changing to a different binding material would change the binding capacities of both domains in the same way. Also both are bacterial CBDs and no post-translational modification and glycosylation had to be dealt with.

To get to know more about these two domains, their properties and their proteins NCBI wasconsulted and the BLAST-tool was used to identify the cellulose binding domains and ExPASy-tools were used for further measurements.

Figure 5: Predicted structure of the CBM_2-family made with Cn3D

The CBD of the Cellulomonas fimi ATCC 484 exoglucanase gene (Figure 6) is a 100 amino acid long domain, close to the C-terminal ending of the protein with a theoretical pI of 8.07 and a molecular weight of 10.3 kDa. It is classified to be stable and belongs to the Cellulose Binding Modul family 2 (pfam00553/cl02709;Figure 5). This means two tryptophane residues are involved in cellulose binding, this type of CBD is only found in bacteria. Also a CBM49 Carbohydrate binding domain is found within the protein domain, where binding studies have shown, that it binds to crystalline cellulose, which could be a possible target for immobilization.

Figure 8: Predicted structure of the CBM_3-family made with Cn3D

The CBD of the Clostridium cellulovorans cellulose binding protein gene (cbp A) on the other hand is a N-terminal domain with 92 amino acids, theoretical pI of 4.56 and is also classified as stable. It belongs to the Cellulose Binding Module family 3 (pfam00942/cl03026; Figure 8) and is part of a very large cellulose binding protein with four other carbohydrate binding modules and a lot of docking interfaces for the proteins in its amino acid sequence (Figure 7).

The Binding Assay

Aequorea victoria green fluorescent protein in action

To measure the capacity and strength of the bonding between the cellulose binding domains and different types of cellulose many different assays have been made. One of the simplest and most often used is the fusion of the CBD to a reporter-protein, especially green or red fluorescent protein (GFP/RFP) is very common. The place of the CBD is measured through the fluorescence of the fused GFP and quantification can easily been done.

Protocol:

  • Harvest the E coli-cells producing the fusion-protein of CBD and GFP and centifuge 10 minutes at top speed.
  • Re-suspend the cell-pellet in 50 mM Tris-HCl-Buffer (pH 8.0).
  • Break down cells via sonication.
  • Centrifuge at top speed for 20 minutes to get rid of the cell-debris.
  • Take the supernatant and measure the emission at 511 nm (excitation at 501 nm) (BBa_E0040)
  • Mix a definite volume of lysate with a definite volume or mass of e.g. crystalline cellulose (CC) or reactivated amorphous cellulose (RAC)
  • Wait 15 (RAC) to 30 (CC) minutes
  • Take supernatant and measure the emission at 511 nm again.
  • The difference between the first an the second measurement is the relative quantity of what has bound to the cellulose.

Cloning of the Cellulose Binding Domains

The cloning of the CBDs should fit to the cloning of our laccases, so the BioBricks were designed with a T7-promoter and the B0034 RBS to have a similar method of cultivation. After investigating the restriction-sites it showed, that at least for the characterization of the CBDs a quick in-frame assembly of the CBDs and a GFP would be possible, because neither the CBDs nor the GFP (BBa_I13522) of the Partsregistry inherits a AgeI- or NgoMIV-site, which makes Freiburg-assembly possible. To do so, primers for the constructs BBa_K863101 (CBDcex(T7)), carrying the CBDcex domain from the C. fimi exoglucanase and BBa_K863111 (CBDclos(T7)), carrying the CBDclos domain from the C.cellulovorans binding protein were designed. The protein-BLAST of the two CBDs gave an exact picture of which bases belong to the binding domains and which don't. To be sure not to disturb the folding anyway 6 to 12 bases up and downstream of the domains as conserved sequences were kept. Even if the CBDcexis an C-terminal domain both domains were made N-terminal, so the BioBricks can carriy all regulatory parts and the linked protein can easily be exchanged. This also would be nice for other people using this part.

CBDcex_T7RBS 80 TGAATTCGCGGCCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGGGT
CCGGCCGGGTGCCAGGT
CBDcex_2AS-Link_compl 56 CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCGCCGACCGTGCAGGGCGTGC
CBDclos_T7RBS 73 CCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGTCAGTTGAATTTTACAACTCTAAC
CBDclos_2ASlink_compl 63 CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCTGCAAATCCAAATTCAACATATGTATC

The listed complementary primers added, besides the Freiburg-suffix, a two amino acid Glycine-Serine-linker to the end of the CBDs. This is a very short linker, but as GFP-experts and publications described GFP and CBDs are very stable proteins and should cope with a very short linker. The benefit of a short linker is that protease activity is kept minimal.

The GFP BBa_K863121 used in the assay was an alternated version of the BBa_I13522. The primers that were made added a Freiburg-pre- and suffix to the GFP coding sequence and a His-tag to the C-terminus to get it purified for the measurements. This part BBa_K863121 (GFP_His) should be easily added to the CBDs and assembled to the fusion-proteins BBa_K863103 CBDcex(T7)+GFP_His] and BBa_K863113 CBDclos(T7)+GFP_His]).

GFP_Frei 54 TACGGAATTCGCGGCCGCTTCTAGATGGCCGGCATGCGTAAAGGAGAAGAACTT
GFP_His6_compl 74 CTGCAGCGGCCGCTACTAGTATTAACCGGTGTGATGGTGATGGTGATGTTTGTATAGTTCATCCATGCCATGTG

Since a His-tag was added to the end of the GFP, an alternated version of the BBa_I13522 had to be made to compare binding of GFP with and without CBD. Therefore a forward primer was made, to amplify the whole BBa_I13522 with the GFP_His_compl-primer to add the His-tag to the C-terminus.

GFP_FW_SV 39 acgtcacctgcgtgtagctCGTAAAGGAGAAGAACTTTT

Due to bad cleavage efficiency at the PstI restriction-site in nearly all PCR-products the cloning of the CBDs (CBDcex(T7) and CBDclos(T7))and especially the insertion of GFP_His to the CBDs took a lot more time as expected. This was because, while designing the primers, it was missed to add additional base pairs from the cleavage-site to the termini to increase the efficiency to standard. When the problem was disclosed, cloning got a lot quicker and more successful.

As the project went on and the T7-constructs didn't seem to work one suspected reason was that a stop codon (TAA) that accidentally resulted between the RBS and ATG could be the reason for that. To solve the problem a change to a constitutive promoter (BBa_J61101) was made now and then using the Freiburg-assembly. Therefore Freiburg forward primers for the CBDs were made.

CBDcex_Freiburg-Prefix 54 GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCGGTCCGGCCGGGTGCCAGGTG
CBDclos_Freiburg-Prefix 57 GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCTCATCAATGTCAGTTGAATTTTAC

The second advantage of these primers were, that the order of the fusion proteins could easily been changed, when a Freiburg suffix-primer for the GFP would be available, so it was ordered.

GFP_Freiburg_compl 61 ACGTCTGCAGCGGCCGCTACTAGTATTAACCGGTTTTGTATAGTTCATCCATGCCATGTGT
PCR-product of BBa_K863104 with S3N10-primers

Sadly the primers arrived just a few days before wiki freeze and we had no time to test that. The switching to the constitutive promoter had no obvious effect (no green colonies or culture). Changing the expression strain from E. coli KRX to E. coli BL21 didn't do a positive effect ether. Which led to the conclusion, that besides further information the problem has to be the space in between the two proteins and the CBD and GFP must hamper each other from folding correctly. To test and solve this a very long linker with three serines followed by ten asparagines should be assembled in the already existing parts via a blunt end cloning. This also is right at hand, just wasn't successful in the time which was left.

S3N10_Cex_compl 40 TTGTTGTTGTTCGAGCTCGAGCCGACCGTGCAGGGCGTGC
S3N10_Clos_compl 40 TTGTTGTTGTTCGAGCTCGAGCTGCCGCCGACCGTGCAGG
S3N10_GFP 40 CAATAACAATAACAACAACCGTAAAGGAGAAGAACTTTTC

Literature

Kavoosi et al. (2007) Strategy for selecting and characterizing linker peptides for CBM9-tagged fusion proteins expressed in Escherichia coli. Biotechnol Bioeng. Oct 15;98(3):599-610. Urbanowicz et al. (2007) A tomato endo-beta-1,4-glucanase, SlCel9C1, represents a distinct subclass with a new family of carbohydrate binding modules (CBM49). J Biol Chem. Apr 20;282(16):12066-74. Epub 2007 Feb 23. Sugimoto et al. (2012) Cellulose affinity purification of fusion proteins tagged with fungal family 1 cellulose-binding domain. Protein Expr Purif. Apr;82(2):290-6. Epub 2012 Jan 28. Hong et al. (2008) Bioseparation of recombinant cellulose-binding module-proteins by affinity adsorption on an ultra-high-capacity cellulosic adsorbent. Anal Chim Acta. Jul 28;621(2):193-9. Epub 2008 May 27.

Promega logo 180x109.gif Logo merck.jpg BioCircle.JPG Bielefeld2012 Evonik.jpg Bielefeld2012 Baxter.png Logo knauer.jpg Logo iit.jpg Bielefeld2012 BIEKUBA.jpg Logo biometra.jpg Logo bio-nrw.png Bielefeld2012 Logo ERASynbio.jpg