

(Difference between revisions)
(Fairbanks Coomassie staining solutions)
Line 585: Line 585:
| A.th_cDNA_FW_T7 || 79 || ACGTgaattcgcggccgcttctagagtaatacgactcactatagggaaagaggagaaaaATGTCACATTCCTTCTTCAA

Revision as of 23:48, 26 September 2012

This is where we are going to list all our materials, devices and equipment that we have used.



Tecan Infinite Microplate Reader

Screen of our setup of the Infinite Reader

For measuring the Laccase activity we detected the level of oxidized ABTS via optical density at 420nm. The device we were able to use was a Tecan Infinite Reader M200. The program setup was in some parts adapted to the needs of our probes (like duration of the measurement) and in some parts standardized.
Used setup for Laccase activity measurements: Temperature: 25°C; Orbital shaking before each measuring cycle (time depends on duration of each cycle); Number of flashes: 30


Matrix-assisted Laser Desorption/Ionization – Time of flight (MALDI-TOF) is a procedure to analyze large biomolecules by their mass.

Our MALDI-TOF device

Before measurement, the analyte is co-crystallized on a metal plate within a solid matrix. 3,5-dimethoxy-4-hydroxycinnamic acid (sinapinic acid) and 2,5-dihydroxybenzoic acid (DHB) are most commonly used. Desorption of the analyte is taken by a laser beam, commonly with a wavelength of 337 nm. The matrix absorbs the laser light and the upper layer explosively vaporizes, ejecting both, matrix and analyte molecules. In addition to this vaporization, the laser beam also leads to an ionization of the analytes. The mass analysis is performed by the TOF (time of flight)-analysator. The evaporated ions are accelerated in an electric field. Typical acceleration voltages for this are 10-30 kV. The velocity of an ion depends on its mass and the charge. An ion detector converts the incoming ions into an electrical signal. The advantage of this method is the rapid analysis of a relatively large mass range.

The MALDI-TOF analysis was performed with the ultrafleXtreme™ by Bruker Daltonics.

We used the MALDI-TOF Analysis to characterize the following BioBricks: ???????????

ÄKTAprime plus Chromatographiesystem

ÄKTAprime plus System by GE Healthcare

ÄKTA is a Swedish word that means true, genuine, or real. ÄKTAprime plus is a compact pumping system which can be used for a range of columns, chromatography media, and filters. This device is ease-of-use and present a high flexibility of liquid handling and minimizing the problem of sample loss.This system can record pH-value, pressure, conductivity, UV-absorption and the flowrate. Different programms are available like PrimeView™ software to evaluate the recorded data.

We used this system to purify our produced laccases with a Immobilized Metal Ion Affinity Chromatography strategy.

The Precellys® 24 homogenizer

The Precellys® 24 homogenizer by peqlab

The Precellys® 24 is an effective and efficient sample homogenisation to enable effective DNA, RNA or protein extraction. To disrup tumor tissues, hair, cartilages, bones, plant materials, yeasts, bacterium and fungi the samples are loaded in beads containing 2 ml tubes. The tubes can be supplied with steel, ceramic or glass beads. The homogenization effect takes place during a 3-dimensional figure of eight motion. This lead to strong acceleration of the used beads. The forces between the beads and the collisions induce the disruption of cell or the homogenisation of samples.

The first cell disruptions ot the iGEM-team Bielefeld were made by this system.


For the production of the different laccases we used three different variations of bioreactors. These Bioreactors includes different kinds of sonsors:

  • pO2
  • pCO2
  • pH
  • airflow
  • agitation
  • temperatur
  • antifoam/level

The process could be monitored and controlled by a bioreactor specific programm.

Infors labfors fermenter

Infors Labfors bioreactor (3 L):
  1. control panel
  2. peristaltic pump for antifoam, base and acid
  3. airflow sensor
  4. Cooler inlet and Water inlet
  5. agitator
  6. correction fluid
  7. CO2-sensor

Device specifications:

  • Vessel: 3.6; total volume
  • Speed range: 100–1200 rpm magnetic drive
  • Temperature range: ~5°C above coolant to 60°C (water jacket)
  • Pump flow rate: 0.001–1.4 mL/min (small-size tubing)
  • Special features: autoclavable fermenter
  • Standard parameters:
  • Stirrer speed, temperature, pH, pO2, antifoam/level, feed, gas

mix, gas flow

Biostat B Bioreactor (3 L) by Braun

Biostat B Bioreactor (3 L) by Braun:
  1. main switch
  2. airflow sensor
  3. thermostat
  4. peristaltic pump for antifoam, base and acid
  5. control panel
  6. agitator
  7. correction fluid
  8. CO2-sensor

Device specifications:

  • Vessel: 3,5; total volume
  • Speed range: 100–1200 rpm magnetic drive
  • Temperature range: ~5°C above coolant to 90°C (water jacket)
  • Pump flow rate: 0.001–1.4 mL/min
  • Special features: autoclavable fermenter
  • Standard parameters:
  • Stirrer speed, temperature, pH, pO2, antifoam/level, feed, gas mix, gas flow



Device specifications:

  • Vessel: 7; total volume
  • Speed range: 100–3000 rpm magnetic drive
  • Temperature range: up to 150°C
  • Pump flow rate: 50 mL/min
  • Standard parameters:
  • Stirrer speed, temperature, pH, pO2, antifoam/level, feed, gas

mix, gas flow

Media, buffer and other solutions

Ampicillin stock solution

  • Solubilize 100 mg mL-1 Ampicillin
  • Store at -20 °C

Chloramphenicol stock solution

  • Solubilize 20 mg mL-1 Chloramphenicol in 100 % Ethanol
  • Store at -20 °C

TAE buffer

For 1 L of 50 x TAE buffer you need:

  • 242.48 g Tris
  • 41.02 g Sodiumacetate
  • 18.612 g EDTA
  • Adjust pH to 7.8 with acetic acid
  • Solve in dH2O

10 mL of the stock is diluted in 1 L dH2O for the gel electrophoresis (0.5 x TAE buffer).

Briton Robinson Buffer

  • 0,1 mM acetic acid
  • 0,1 mM boric acid
  • 0,1 mM phosphoric acid
  • adjust to pH 5 with sodium hydroxide

DNA loading buffer

  • 50 % (v/v) glycerol
  • 1 mM EDTA
  • 0.1 % (w/v) bromphenol blue
  • Solve in ddH2O

LB medium

For 1 L of LB medum:

  • 10 g Trypton
  • 5 g Yeast extract
  • 10 g NaCl
  • 12 g Agar-Agar (for plates)
  • Adjust pH to 7.4

Autoinduction medium

The Autoinduction medium is based on LB-medium. Add the following components after heat sterilization of 900 mL LB medium.

  • 5 mL of a 200 g L-1 steril L-rhamnose stock solution -> final concentration 2 g L-1
  • 2.5 mL of a 200 g L-1 steril glucose stock solution -> final concentration 1 g L-1
  • if necessary add antibiotics:
Cm: 1 mL or 3 mL of a 20 μg mL-1 Cm stock solution -> final concentration 20 or 60 mg L-1
Amp: 1 mL or 3 mL of a 100 μg mL-1 Amp stock solution -> final concentration 100 or 300 mg L-1
  • fill up to 1 L with steril ddH2O

SOC medium

  • Add the following components to 900 ml of distilled H2O
    • 20 g Bacto Tryptone
    • 5 g Bacto Yeast Extract
    • 2 ml of 5 M NaCl
    • 2.5 ml of 1 M KCl
    • 10 ml of 1 M MgCl2
    • 10 ml of 1 M MgSO4
    • 20 ml of 1 M glucose
  • Adjust to 1L with distilled H2O
  • Sterilize by autoclaving

YPD media

For 1 L of YPD media:

  • 20 g Peptone
  • 10 g Yeast extract
  • 20 g Dextrose (add 50 mL sterile stock solution (40% dextrose))
  • Adjust pH to 6.5
  • For plates: add 17 g/L agar.

Yeast Nitrogen Base (YNB) 10x stock solution

  • Dissolve 69 g Yeast Nitrogen Base (without aminoacids; with ammonium sulfat) in 500 mL bidest water and filter sterilize.
  • Store at 4 °C.
  • Durable for one year.

Biotin 500x stock solution

  • Dissolve 20 mg biotin in 100 mL of 0.05 M NaOH solution and filter sterilize.
  • Store at 4 °C.
  • Durable for one year.

MD agar plates for selection of recombinant His+ clones

For 1 L MD agar plates you need:

BEDS buffer

For 1 L of BEDS buffer:

  • 1,85 g bicine-sodium salt,
  • 30 mL ethylene glycol (final concentration 3%(v/v))
  • 50 mL (v/v) dimethyl sulfoxide (DMSO)(final concentration 5%(v/v))
  • 182.17 g sorbitol
  • Adjust pH at 8,3

Dithiothreitol-Solution (DTT)

For 50mL of DTT-Solution:

  • 7.71 g Dithiothreitol

special buffers for resuspending the cell pellet

for KRX and KRX with BBa_K863015 and BBa_K863005:

  • sodium acetate 100 mM
  • adjust to pH 5

for KRX with BBa_K863010:

  • sodium acetate 20 mM
  • adjust to pH 5

for KRX with BBa_K863000: Mc Ilvaine buffer

  • solution A: 21,01 g/L citric acid
  • solution B: 35,60 g/L disodium phosphate dihydrate
  • mix 38,6 mL of solution B and 61,4 mL of solution A
  • adjust to pH 4

for KRX with BBa_K863020:

  • 1 mM CuSO4
  • 15 mM PBS mit K2HPO4
  • 100 mM NaCl
  • adjust to pH 7 and shake before use

Buffers for His-Tag affinity chromatography

  • Adjust pH to 7.4 - 7.6

Buffer for Ni-NTA-HisTag affinity chromatography

Buffer Sodium phosphate [mM] Imidazole [mM]
Binding buffer 50 20
Elution buffer 50 500

Buffer for Talon-HisTag affinity chromatography

Buffer Sodium phosphate [mM] NaCl [mM] Imidazole [mM]
Binding buffer 50 300 0
Elution buffer 50 300 150


The following amouts are for one gel. Stacking gel 5 %:

  • 775 μL H2O
  • 1.25 mL 0,25 M Tris (pH 6,8)
  • 425 μL Bis/Acrylamide (0,8 %, 30 %)
  • 50 μL 5 % SDS
  • 25 μL 10 % Ammonium persulfate
  • 3 μL TEMED

Separating gel 12 %:

  • 1.5 mL H2O
  • 2.8 mL 1 M Tris (pH 8,8)
  • 3.0 mL Bis/ Acrylamide (0,8%, 30%)
  • 150 μL 5% SDS
  • 37.5 μL 10% Ammonium persulfate
  • 5 μL TEMED

SDS running buffer

  • 25 mM Tris [pH 8,3]
  • 192 mM Glycerol
  • 0.1 % SDS

4x Laemmli-buffer

  • 250 mM Tris-HCl
  • 40 % [v/v] Glycerol
  • 20 % [v/v] 2-Mercapthoethanol
  • 80 g L-1 SDS
  • 0.04 g L-1 BPB

Colloidal Coomassie Brilliant Blue G-250 staining solution

for 1 L staining solution

  • dissolve 50 g L-1 (NH4)2SO4 in ddH2O
  • add 10 % (v/v) ethanol
  • dissolve 0.2 g L-1 Coomassie Brilliant Blue G-250
  • add 2 % (v/v) phosphoric acid
  • fill up to 1 L with ddH2O

Fairbanks Coomassie staining solutions

Solution A:

  • 25 % (v/v) ispropanol
  • 10 % (v/v) acetic acid
  • 0,5 g L-1 Coomassie Brilliant Blue R-250

Solution B:

  • 10 % (v/v) ispropanol
  • 10 % (v/v) acetic acid
  • 0,05 g L-1 Coomassie Brilliant Blue R-250

Solution C:

  • 10 % (v/v) acetic acid
  • 0,025 g L-1 Coomassie Brilliant Blue R-250

Solution D:

  • 10 % (v/v) acetic acid

Solutions for Gibson assembly

5x isothermal reaction buffer for Gibson assembly

  • 3 mL of 1 M Tris-HCl (pH 7.5)
  • 150 µL of 2 M MgCl2
  • 60 µL of 100 mM dGTP
  • 60 µL of 100 mM dATP
  • 60 µL of 100 mM dTTP
  • 60 µL of 100 mM dCTP
  • 300 µL of 1 M DTT
  • 1.5 g PEG-8000
  • 300 µL of 100 mM NAD

storage -20˚C

Hanks Buffered Saline Solution (HBSS)

  • 0.137 M NaCl
  • 5.4 mM KCl
  • 0.25 mM Na2HPO4
  • 0.44 mM KH2PO4
  • 1.3 mM CaCl2
  • 1.0 mM MgSO4
  • 4.2 mM NaHCO3


This is a list of primers we have used.

primer name length sequence
5aox1-mfalpha1-r 20 AGCTTCAGCCTCTCTTTTCT
mfalpha1-aarI-taox1-r 20 TAAGCTTGCACAAACGAACT
his4_gi537483_f 46 ACGTgaattcgcggccgcttctagagAGATCTCCTGATGACTGACT
his4_gi537483_r 41 ctgcagcggccgctactagtaGATCTATCGAATCTAAATGT
5'AOX_FW 45 ACGTgaattcgcggccgcttctagagAGATCTAACATCCAAAGACG
3'AOX_FW 45 ACGTgaattcgcggccgcttctagagCGAGTATCTATGATTGGAA
pAOX1_FW 44 ACGTgaattcgcggccgcttctagagcatccgacatccacaggtc
Ko_alpha_FW 58 ACGTgaattcgcggccgcttctagagcccgccgccaccATGAGATTTCCTTCAATTTT
Tv_lac5_FW_oS 38 acgtcacctgcgtgtagctggtatcggtcctgtcgccg
Tv_lac5_RV 39 acgtcacctgcgtgtcaagTTACTGGTCGCTCGGGTCGC
Tv_lac5.P.FW 43 gaattcgcggccgcttctagATGTCGAGGTTTCACTCTCTTCT
Pc_lac35.P.FW 43 gaattcgcggccgcttctagATGTCGAGGTTCCAGTCCCTCTT
Pc_lac35_FW_oS 38 acgtcacctgcgtgtagctgccatagggcctgtggcgg
Pc_lac35_RV 39 acgtcacctgcgtgtcaagTCAGAGGTCGCTGGGGTCAA
J23117_RBS_FW 70 aattcgcggccgcttctagagttgacagctagctcagtcctagggattgtgctagcaaagaggagaaata
J23117_RBS_RV 70 ctagtatttctcctctttgctagcacaatccctaggactgagctagctgtcaactctagaagcggccgcg
J23103_RBS_FW 70 aattcgcggccgcttctagagctgatagctagctcagtcctagggattatgctagcaaagaggagaaata
J23103_RBS_RV 70 ctagtatttctcctctttGCTAGCATAATCCCTAGGACTGAGCTAGCTATCAGctctagaagcggccgcg
J23110_RBS_FW 70 aattcgcggccgcttctagagtttacggctagctcagtcctaggtacaatgctagcaaagaggagaaata
J23110_RBS_RV 70 ctagtatttctcctctttgctagcattgtacctaggactgagctagccgtaaactctagaagcggccgcg
A.th_cDNA_FW_T7 79 ACGTgaattcgcggccgcttctagagtaatacgactcactatagggaaagaggagaaaaATGTCACATTCCTTCTTCAA

Used enzymes

Enzyme Producer
AarI Fermentas
AgeI Fermentas
DpnI Fermentas
EcoRI Fermentas
GoTaq DNA-polymerase Promega
lysozymCarl Roth
Pfu DNA-polymerase Promega
PstI Fermentas
Phusion HF DNA-polymerase Finnzymes
Shrimp alkaline phosphatase Fermentas
SpeI Fermentas
T4-DNA-Ligase Fermentas
BIOTAQ DNA-polymerase Bioline
XbaI Fermentas
T5 exonuclease NEB
taq DNA Ligase NEB
KOD Hot Start DNA Polymerase Merck Millipore

Used Kits

Function Name
Plasmid purification Fermentas GeneJET™ Plasmid Miniprep Kit
Plasmid purification Promega PureYield™ Plasmid Preps
PCR Cleanup Promega Wizard® SV Gel and PCR Clean-Up
PCR core system Promega GoTaq® PCR Core System I
Protein quantitation Roti®-Nanoquant




Polycyclic aromatic hydrocarbons

  • Naphthalin
  • Acenaphthen
  • Phenanthren
  • Anthracen

Used chemicals

Promega logo 180x109.gif Logo merck.jpg BioCircle.JPG Bielefeld2012 Evonik.jpg Bielefeld2012 Baxter.png Logo knauer.jpg Logo iit.jpg Bielefeld2012 BIEKUBA.jpg Logo biometra.jpg Logo bio-nrw.png Bielefeld2012 Logo ERASynbio.jpg