http://2012.igem.org/wiki/index.php?title=Special:Contributions/Yamatanoorochi&feed=atom&limit=50&target=Yamatanoorochi&year=&month=2012.igem.org - User contributions [en]2024-03-28T13:09:47ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/Template:Wisconsin-MadisonTemplate:Wisconsin-Madison2012-11-19T03:16:50Z<p>Yamatanoorochi: </p>
<hr />
<div><html><br />
<!--All iGEM Madison codes start from here--><br />
<!--content starts where style ends--><br />
<script src="" type="text/javascript"></script><br />
<link href="http://vtb.bme.wisc.edu/css.css" rel="stylesheet" type="text/css"><br />
<body><br />
<center><br />
<div id = "divscontainer"><br />
<br />
<center><br />
<div id = "divthehead"><a href="https://2012.igem.org/Team:Wisconsin-Madison"><img src="http://vtb.bme.wisc.edu/image/temp/iGEMHeader.png" width="960px"></a></div><br />
<div id = "divthebuttons"><br />
<br />
<!--navigation menu!--><br />
<ul class="main-menu"><br />
<br />
<li id="n_team"><h2><strong>Team</strong></h2><br />
<ul class="submenu"><br />
<li><a href="/Team:Wisconsin-Madison/teammembers">Team Members</a></li><br />
<li><a href="/Team:Wisconsin-Madison/advisors">Advisors</a></li><br />
<li><a href="/Team:Wisconsin-Madison/thanksponsors">Sponsors</a></li><br />
</ul><br />
</li><br />
<br />
<li id="n_project"><h2><strong>Projects</strong></h2><br />
<ul class="submenu"><br />
<li><a href="/Team:Wisconsin-Madison/lemon">Engineering Limonene Production in E.coli</a></li><br />
<li><a href="/Team:Wisconsin-Madison/SDF">Translational Coupling Cassette (TCC)</a></li><br />
</ul><br />
</li><br />
<br />
<li id="n_part"><h2><a href="/Team:Wisconsin-Madison/parts"><strong>Parts</strong></a></h2><br />
<ul class="submenu"><br />
<li><a href="/Team:Wisconsin-Madison/parts_1">Translational Coupling Cassette</a></li><br />
<li><a href="/Team:Wisconsin-Madison/parts_2">Negative TCC Control</a></li><br />
<li><a href="/Team:Wisconsin-Madison/parts_3">Positive TCC Control</a></li><br />
<li><a href="/Team:Wisconsin-Madison/parts_4">Codon-optomized LIMS1</a></li><br />
</ul><br />
</li><br />
<li id="n_modeling"><h2><a href="/Team:Wisconsin-Madison/modeling"><strong>Modeling</strong></a></h2><br />
<br />
</li><br />
<br />
<li id="n_note"><h2> <a href="/Team:Wisconsin-Madison/protocol"><strong>Protocol</strong></a></h2><br />
</li><br />
<br />
<li id="n_safety"><h2><a href="/Team:Wisconsin-Madison/safety"><strong>Safety</strong></a></h2><br />
<br />
</li><br />
<br />
<li id="n_humanPractice"><h2><a href="/Team:Wisconsin-Madison/hpractice"><strong>Human practice</strong></a></h2><br />
<br />
</li><br />
<br />
</ul></div>Yamatanoorochihttp://2012.igem.org/Template:Wisconsin-MadisonTemplate:Wisconsin-Madison2012-11-19T03:16:34Z<p>Yamatanoorochi: </p>
<hr />
<div><html><br />
<!--All iGEM Madison codes start from here--><br />
<!--content starts where style ends--><br />
<script src="" type="text/javascript"></script><br />
<link href="http://vtb.bme.wisc.edu/css.css" rel="stylesheet" type="text/css"><br />
<body><br />
<center><br />
<div id = "divscontainer"><br />
<br />
<center><br />
<div id = "divthehead"><a href="https://2012.igem.org/Team:Wisconsin-Madison"><img src="http://vtb.bme.wisc.edu/image/temp/iGEMHeader.png" width="960px"></a></div><br />
<div id = "divthebuttons"><br />
<br />
<!--navigation menu!--><br />
<ul class="main-menu"><br />
<br />
<li id="n_home"><br />
<h2><a href=""><strong>Home</strong></a></h2><br />
</li><br />
<br />
<li id="n_apply"><br />
<h2><a href=""><strong>Apply</strong></a></h2><br />
<ul class="submenu"><br />
<li><a href="">Involvement</a></li><br />
<li><a href="">Timeline</a></li><br />
<li><a href="">Admission</a></li><br />
</ul><br />
</li><br />
<li id="n_history"><h2><a href=""><strong>History</strong></a></h2><br />
</li><br />
<br />
<li id="n_words"><h2><a href=""><strong>Developing Synthetic Biology Solutions to Life's Problems</strong></a></h2><br />
</li><br />
<li id="n_sponsors"><br />
<h2> <a href=""><strong>Sponsors</strong></a></h2><br />
</li><br />
<br />
<li id="n_labWork"><h2><a href=""><strong>Lab work</strong></a></h2><br />
</li><br />
<li id="n_humanPractice2"><h2><a href=""><strong>Human practice</strong></a></h2><br />
</li><br />
<br />
</ul></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-MadisonTeam:Wisconsin-Madison2012-10-26T20:08:33Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div id = "divtheoverview" style="height:auto;"><br><br />
<p class = "classtheoverview"> <strong> The Translational Coupling Cassette: a tool for evaluating the translation of heterologous proteins in <i>Escherichia coli</i>. </strong></p><br />
<p align="left" class = "classtheinlinecontent2"> A powerful method for the production of novel metabolites is the expression of heterologous enzymes in a bacterial host. A common challenge when using non-native genes in metabolic engineering is determining if they are being properly expressed. To address this issue, we have constructed a BioFusion-compatible system for testing the translation of a gene of interest. This system couples the translation of the target gene to a fluorescent reporter gene; fluorescence will only be detected when the target gene is entirely translated. This construct enables synthetic biologists to quickly determine if a gene is being expressed without the need for costly antibodies or analytical instruments (e.g. mass spectrometry). Currently, we are utilizing this cassette to optimize the expression of limonene synthase, an enzyme that catalyzes the production of limonene, a monoterpene with potential as a renewable jet fuel.</p><br />
</div><br><br />
<div style="float:left; margin-left:20px;"><a href="https://static.igem.org/mediawiki/2012/0/02/IMG_1410.jpg"> <img src="https://static.igem.org/mediawiki/2012/e/e2/UWMIMG_1411.jpeg" width="640" height="427"></a></div><br />
<div style="float:right; width: 250px; margin-right: 20px;"><br />
<script src="http://widgets.twimg.com/j/2/widget.js"></script><br />
<script><br />
new TWTR.Widget({<br />
version: 2,<br />
type: 'profile',<br />
rpp: 4,<br />
interval: 6000,<br />
width: 250,<br />
height: 350,<br />
theme: {<br />
shell: {<br />
background: '#9c8bb0',<br />
color: '#ffffff'<br />
},<br />
tweets: {<br />
background: '#d8cee5',<br />
color: '#47296d',<br />
links: '#a47cd5'<br />
}<br />
},<br />
features: {<br />
scrollbar: false,<br />
loop: false,<br />
live: true,<br />
hashtags: true,<br />
timestamp: true,<br />
avatars: true,<br />
behavior: 'all'<br />
}<br />
}).render().setUser('LabBadger').start();<br />
</script><br />
<br />
</div><br />
<br><br />
<br><br />
<div style=" float:left;"><br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px"></strong><br />
<br />
</p><br /><br />
<p align="left" class="classtheinlinecontent2"></p><br />
<br /><br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px"></strong><br />
<br />
</p><br />
<br /><br />
<p align="left" class="classtheinlinecontent2"><br />
</p><br><br />
<br><br />
</div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-MadisonTeam:Wisconsin-Madison2012-10-26T20:07:59Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div id = "divtheoverview" style="height:auto;"><br><br />
<p class = "classtheoverview"> <strong> The Translational Coupling Cassette: a tool for evaluating the translation of heterologous proteins in <i>Escherichia coli</i>. </strong></p><br />
<p align="left" class = "classtheinlinecontent2"> A powerful method for the production of novel metabolites is the expression of heterologous enzymes in a bacterial host. A common challenge when using non-native genes in metabolic engineering is determining if they are being properly expressed. To address this issue, we have constructed a BioFusion-compatible system for testing the translation of a gene of interest. This system couples the translation of the target gene to a fluorescent reporter gene; fluorescence will only be detected when the target gene is entirely translated. This construct enables synthetic biologists to quickly determine if a gene is being expressed without the need for costly antibodies or analytical instruments (e.g. mass spectrometry). Currently, we are utilizing this cassette to optimize the expression of limonene synthase, an enzyme that catalyzes the production of limonene, a monoterpene with potential as a renewable jet fuel.</p><br />
</div><br><br />
<div style="float:left; margin-left:20px;"><a href="https://static.igem.org/mediawiki/2012/0/02/IMG_1410.jpg"> <img src="https://static.igem.org/mediawiki/2012/0/02/IMG_1410.jpg" width="640" height="427"></a></div><br />
<div style="float:right; width: 250px; margin-right: 20px;"><br />
<script src="http://widgets.twimg.com/j/2/widget.js"></script><br />
<script><br />
new TWTR.Widget({<br />
version: 2,<br />
type: 'profile',<br />
rpp: 4,<br />
interval: 6000,<br />
width: 250,<br />
height: 350,<br />
theme: {<br />
shell: {<br />
background: '#9c8bb0',<br />
color: '#ffffff'<br />
},<br />
tweets: {<br />
background: '#d8cee5',<br />
color: '#47296d',<br />
links: '#a47cd5'<br />
}<br />
},<br />
features: {<br />
scrollbar: false,<br />
loop: false,<br />
live: true,<br />
hashtags: true,<br />
timestamp: true,<br />
avatars: true,<br />
behavior: 'all'<br />
}<br />
}).render().setUser('LabBadger').start();<br />
</script><br />
<br />
</div><br />
<br><br />
<br><br />
<div style=" float:left;"><br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px"></strong><br />
<br />
</p><br /><br />
<p align="left" class="classtheinlinecontent2"></p><br />
<br /><br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px"></strong><br />
<br />
</p><br />
<br /><br />
<p align="left" class="classtheinlinecontent2"><br />
</p><br><br />
<br><br />
</div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-MadisonTeam:Wisconsin-Madison2012-10-26T20:07:30Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div id = "divtheoverview" style="height:auto;"><br><br />
<p class = "classtheoverview"> <strong> The Translational Coupling Cassette: a tool for evaluating the translation of heterologous proteins in <i>Escherichia coli</i>. </strong></p><br />
<p align="left" class = "classtheinlinecontent2"> A powerful method for the production of novel metabolites is the expression of heterologous enzymes in a bacterial host. A common challenge when using non-native genes in metabolic engineering is determining if they are being properly expressed. To address this issue, we have constructed a BioFusion-compatible system for testing the translation of a gene of interest. This system couples the translation of the target gene to a fluorescent reporter gene; fluorescence will only be detected when the target gene is entirely translated. This construct enables synthetic biologists to quickly determine if a gene is being expressed without the need for costly antibodies or analytical instruments (e.g. mass spectrometry). Currently, we are utilizing this cassette to optimize the expression of limonene synthase, an enzyme that catalyzes the production of limonene, a monoterpene with potential as a renewable jet fuel.</p><br />
</div><br><br />
<div style="float:left; margin-left:20px;"><a href="https://static.igem.org/mediawiki/2012/0/02/IMG_1410.jpg"> <img src="https://static.igem.org/mediawiki/2012/e/e2/UWMIMG_1411.jpeg" width="640" height="427"></a></div><br />
<div style="float:right; width: 250px; margin-right: 20px;"><br />
<script src="http://widgets.twimg.com/j/2/widget.js"></script><br />
<script><br />
new TWTR.Widget({<br />
version: 2,<br />
type: 'profile',<br />
rpp: 4,<br />
interval: 6000,<br />
width: 250,<br />
height: 350,<br />
theme: {<br />
shell: {<br />
background: '#9c8bb0',<br />
color: '#ffffff'<br />
},<br />
tweets: {<br />
background: '#d8cee5',<br />
color: '#47296d',<br />
links: '#a47cd5'<br />
}<br />
},<br />
features: {<br />
scrollbar: false,<br />
loop: false,<br />
live: true,<br />
hashtags: true,<br />
timestamp: true,<br />
avatars: true,<br />
behavior: 'all'<br />
}<br />
}).render().setUser('LabBadger').start();<br />
</script><br />
<br />
</div><br />
<br><br />
<br><br />
<div style=" float:left;"><br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px"></strong><br />
<br />
</p><br /><br />
<p align="left" class="classtheinlinecontent2"></p><br />
<br /><br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px"></strong><br />
<br />
</p><br />
<br /><br />
<p align="left" class="classtheinlinecontent2"><br />
</p><br><br />
<br><br />
</div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/File:IMG_1410.jpgFile:IMG 1410.jpg2012-10-26T20:06:01Z<p>Yamatanoorochi: </p>
<hr />
<div></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/hpracticeTeam:Wisconsin-Madison/hpractice2012-10-26T19:58:36Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Outreach: James Madison Memorial High School</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent2">This year our iGEM team decided to combine the Human Practice category in addition to helping another iGEM team. In order to do this, we began by visiting a local high school, James Madison Memorial. Over the length of a school day, we talked to all of the Advanced Placement biology classes about synthetic biology, iGEM and bioethics. </p><br />
<br />
<p align="left" class="classtheinlinecontent2"> We spurred many interesting discussions, and brainstormed feasible project ideas that these aspiring synthetic biologists could pursue in the future. After our presentation, we also informed the classes that iGEM recently opened a high school division, and instructed any interested sophomores or juniors to contact us for guidance if they were interested in starting a team. To help other iGEM teams, we also created a standardized PowerPoint for any iGEM team to use at their own local high schools to introduce synthetic biology and iGEM. This powerpoint is available to download from the following link<a href="http://dl.dropbox.com/u/27094227/HS%20presentation.pptx"> here</a>.<br />
</p><br />
<br><br />
<br />
<br />
<!-- JOKER!--><br />
<link rel="stylesheet" href="http://vtb.bme.wisc.edu/image-slideshow-5.css" type="text/css"><br />
<script type="text/javascript" src="http://vtb.bme.wisc.edu/image-slideshow-5.js"><br />
</script><br />
</head><br />
<body><br />
<div id="mainContainer"><br />
<br />
<div id="DHTMLgoodies_panel_one"><br />
<div id="DHTMLgoodies_thumbs"><br />
<div id="DHTMLgoodies_thumbs_inner"><br />
<div class="strip_of_thumbnails"><br />
<div><a id="firstThumbnailLink" href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG"></a></div><br />
<div><a href="#" onclick=<br />
"showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('https://static.igem.org/mediawiki/2012/e/e1/UWMH123.jpg',this);return false;"><br />
<img src="https://static.igem.org/mediawiki/2012/e/e1/UWMH123.jpg"></a></div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div id="DHTMLgoodies_arrows"><br />
<img id="DHTMLgoodies_leftArrow" class="leftArrow"><br />
<img id="DHTMLgoodies_rightArrow" class="rightArrow"><br />
</div><br />
<br />
</div><br />
<br />
<div id="DHTMLgoodies_largeImage"><br />
<br />
<table bgcolor="#FFFFFF" style="position:relative;"><br />
<tr><br />
<td><br />
<br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG"></a><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<div class="clear"></div><br />
</div><br />
<br />
<script type="text/javascript"><br />
initGalleryScript();<br />
</script><br />
<br />
<p align="left" class="classtheinlinecontent2"> It turned out that many of the students we spoke to were in fact interested in starting a team. We received an email from their captain explaining they had a group of approximately ten students who would be definitely interested in forming a team for next years competition. After corresponding throughout the summer and brainstorming various feasible project ideas, we invited eight of the students to our iGEM lab to demonstrate some simple synthetic biology techniques, including BioBrick cloning, and to give them a more realistic view of what a day in the life of an iGEM team is all about.</p><br />
<br />
<br />
<p align="left" class="classtheinlinecontent2">We also introduced them to the parts registry, emphasizing its helpfulness in both learning about the purpose of individual parts as well as what other teams have done with them in the past.</p><br />
<p align="left" class="classtheinlinecontent2">As their school year started, one of our team members facilitated a brainstorming session to help them start thinking about projects that would be both educational and feasible in their timeline. We continue to follow up with the progress of the team's project brainstorming, and have been a source of guidance for their planning. As most of our members will still be attending the University of Wisconsin-Madison in the spring semester, we will continue to be available for advising when they are ready to begin experimenting. Furthermore, this is a project we plan to carry on with UW-Madison's future iGEM teams, hopefully expanding to other high schools in the area.</p> <br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/hpracticeTeam:Wisconsin-Madison/hpractice2012-10-26T19:57:01Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Outreach: James Madison Memorial High School</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent2">This year our iGEM team decided to combine the Human Practice category in addition to helping another iGEM team. In order to do this, we began by visiting a local high school, James Madison Memorial. Over the length of a school day, we talked to all of the Advanced Placement biology classes about synthetic biology, iGEM and bioethics. </p><br />
<br />
<p align="left" class="classtheinlinecontent2"> We spurred many interesting discussions, and brainstormed feasible project ideas that these aspiring synthetic biologists could pursue in the future. After our presentation, we also informed the classes that iGEM recently opened a high school division, and instructed any interested sophomores or juniors to contact us for guidance if they were interested in starting a team. To help other iGEM teams, we also created a standardized PowerPoint for any iGEM team to use at their own local high schools to introduce synthetic biology and iGEM. This powerpoint is available to download from the following link<a href="http://dl.dropbox.com/u/27094227/HS%20presentation.pptx"> here</a>.<br />
</p><br />
<br><br />
<br />
<br />
<!-- JOKER!--><br />
<link rel="stylesheet" href="http://vtb.bme.wisc.edu/image-slideshow-5.css" type="text/css"><br />
<script type="text/javascript" src="http://vtb.bme.wisc.edu/image-slideshow-5.js"><br />
</script><br />
</head><br />
<body><br />
<div id="mainContainer"><br />
<br />
<div id="DHTMLgoodies_panel_one"><br />
<div id="DHTMLgoodies_thumbs"><br />
<div id="DHTMLgoodies_thumbs_inner"><br />
<div class="strip_of_thumbnails"><br />
<div><a id="firstThumbnailLink" href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG"></a></div><br />
<div><a href="#" onclick=<br />
"showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('https://static.igem.org/mediawiki/2012/thumb/e/e1/UWMH123.jpg/120px-UWMH123.jpg',this);return false;"><br />
<img src="https://static.igem.org/mediawiki/2012/e/e1/UWMH123.jpg"></a></div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div id="DHTMLgoodies_arrows"><br />
<img id="DHTMLgoodies_leftArrow" class="leftArrow"><br />
<img id="DHTMLgoodies_rightArrow" class="rightArrow"><br />
</div><br />
<br />
</div><br />
<br />
<div id="DHTMLgoodies_largeImage"><br />
<br />
<table bgcolor="#FFFFFF" style="position:relative;"><br />
<tr><br />
<td><br />
<br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG"></a><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<div class="clear"></div><br />
</div><br />
<br />
<script type="text/javascript"><br />
initGalleryScript();<br />
</script><br />
<br />
<p align="left" class="classtheinlinecontent2"> It turned out that many of the students we spoke to were in fact interested in starting a team. We received an email from their captain explaining they had a group of approximately ten students who would be definitely interested in forming a team for next years competition. After corresponding throughout the summer and brainstorming various feasible project ideas, we invited eight of the students to our iGEM lab to demonstrate some simple synthetic biology techniques, including BioBrick cloning, and to give them a more realistic view of what a day in the life of an iGEM team is all about.</p><br />
<br />
<br />
<p align="left" class="classtheinlinecontent2">We also introduced them to the parts registry, emphasizing its helpfulness in both learning about the purpose of individual parts as well as what other teams have done with them in the past.</p><br />
<p align="left" class="classtheinlinecontent2">As their school year started, one of our team members facilitated a brainstorming session to help them start thinking about projects that would be both educational and feasible in their timeline. We continue to follow up with the progress of the team's project brainstorming, and have been a source of guidance for their planning. As most of our members will still be attending the University of Wisconsin-Madison in the spring semester, we will continue to be available for advising when they are ready to begin experimenting. Furthermore, this is a project we plan to carry on with UW-Madison's future iGEM teams, hopefully expanding to other high schools in the area.</p> <br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/File:UWMH123.jpgFile:UWMH123.jpg2012-10-26T19:55:42Z<p>Yamatanoorochi: </p>
<hr />
<div></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/hpracticeTeam:Wisconsin-Madison/hpractice2012-10-26T19:38:44Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Outreach: James Madison Memorial High School</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent2">This year our iGEM team decided to combine the Human Practice category in addition to helping another iGEM team. In order to do this, we began by visiting a local high school, James Madison Memorial. Over the length of a school day, we talked to all of the Advanced Placement biology classes about synthetic biology, iGEM and bioethics. </p><br />
<br />
<p align="left" class="classtheinlinecontent2"> We spurred many interesting discussions, and brainstormed feasible project ideas that these aspiring synthetic biologists could pursue in the future. After our presentation, we also informed the classes that iGEM recently opened a high school division, and instructed any interested sophomores or juniors to contact us for guidance if they were interested in starting a team. To help other iGEM teams, we also created a standardized PowerPoint for any iGEM team to use at their own local high schools to introduce synthetic biology and iGEM. This powerpoint is available to download from the following link<a href="http://dl.dropbox.com/u/27094227/HS%20presentation.pptx"> here</a>.<br />
</p><br />
<br><br />
<br />
<br />
<!-- JOKER!--><br />
<link rel="stylesheet" href="http://vtb.bme.wisc.edu/image-slideshow-5.css" type="text/css"><br />
<script type="text/javascript" src="http://vtb.bme.wisc.edu/image-slideshow-5.js"><br />
</script><br />
</head><br />
<body><br />
<div id="mainContainer"><br />
<br />
<div id="DHTMLgoodies_panel_one"><br />
<div id="DHTMLgoodies_thumbs"><br />
<div id="DHTMLgoodies_thumbs_inner"><br />
<div class="strip_of_thumbnails"><br />
<div><a id="firstThumbnailLink" href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG"></a></div><br />
<div><a href="#" onclick=<br />
"showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG"></a></div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div id="DHTMLgoodies_arrows"><br />
<img id="DHTMLgoodies_leftArrow" class="leftArrow"><br />
<img id="DHTMLgoodies_rightArrow" class="rightArrow"><br />
</div><br />
<br />
</div><br />
<br />
<div id="DHTMLgoodies_largeImage"><br />
<br />
<table bgcolor="#FFFFFF" style="position:relative;"><br />
<tr><br />
<td><br />
<br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG"></a><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<div class="clear"></div><br />
</div><br />
<br />
<script type="text/javascript"><br />
initGalleryScript();<br />
</script><br />
<br />
<p align="left" class="classtheinlinecontent2"> It turned out that many of the students we spoke to were in fact interested in starting a team. We received an email from their captain explaining they had a group of approximately ten students who would be definitely interested in forming a team for next years competition. After corresponding throughout the summer and brainstorming various feasible project ideas, we invited eight of the students to our iGEM lab to demonstrate some simple synthetic biology techniques, including BioBrick cloning, and to give them a more realistic view of what a day in the life of an iGEM team is all about.</p><br />
<br />
<br />
<p align="left" class="classtheinlinecontent2">We also introduced them to the parts registry, emphasizing its helpfulness in both learning about the purpose of individual parts as well as what other teams have done with them in the past.</p><br />
<p align="left" class="classtheinlinecontent2">As their school year started, one of our team members facilitated a brainstorming session to help them start thinking about projects that would be both educational and feasible in their timeline. We continue to follow up with the progress of the team's project brainstorming, and have been a source of guidance for their planning. As most of our members will still be attending the University of Wisconsin-Madison in the spring semester, we will continue to be available for advising when they are ready to begin experimenting. Furthermore, this is a project we plan to carry on with UW-Madison's future iGEM teams, hopefully expanding to other high schools in the area.</p> <br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_4Team:Wisconsin-Madison/parts 42012-10-26T19:32:07Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762100" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="747px" width="960px"></iframe><br />
</div><br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_4Team:Wisconsin-Madison/parts 42012-10-26T19:31:54Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762100" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="750px" width="960px"></iframe><br />
</div><br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_3Team:Wisconsin-Madison/parts 32012-10-26T19:30:52Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762002" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="700px" width="960px"></iframe></div><br />
<br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_2Team:Wisconsin-Madison/parts 22012-10-26T19:30:30Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762001" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="815px" width="960px"></iframe></div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_2Team:Wisconsin-Madison/parts 22012-10-26T19:30:19Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762001" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="805px" width="960px"></iframe></div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_1Team:Wisconsin-Madison/parts 12012-10-04T02:45:10Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762000" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="1865px" width="960px"></iframe></div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_2Team:Wisconsin-Madison/parts 22012-10-04T02:44:52Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762001" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="792px" width="960px"></iframe></div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_3Team:Wisconsin-Madison/parts 32012-10-04T02:44:32Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762002" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="691px" width="960px"></iframe></div><br />
<br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_4Team:Wisconsin-Madison/parts 42012-10-04T02:44:04Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762100" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="757px" width="960px"></iframe><br />
</div><br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_4Team:Wisconsin-Madison/parts 42012-10-04T02:42:08Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762100" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="550px" width="960px"></iframe><br />
</div><br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_4Team:Wisconsin-Madison/parts 42012-10-04T02:41:57Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762100" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="500px" width="960px"></iframe><br />
</div><br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_4Team:Wisconsin-Madison/parts 42012-10-04T02:41:46Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762100" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="450px" width="960px"></iframe><br />
</div><br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_3Team:Wisconsin-Madison/parts 32012-10-04T02:41:28Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762002" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="510px" width="960px"></iframe></div><br />
<br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_3Team:Wisconsin-Madison/parts 32012-10-04T02:41:17Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762002" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="580px" width="960px"></iframe></div><br />
<br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_2Team:Wisconsin-Madison/parts 22012-10-04T02:40:56Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762001" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="620px" width="960px"></iframe></div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_2Team:Wisconsin-Madison/parts 22012-10-04T02:40:44Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762001" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="670px" width="960px"></iframe></div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_2Team:Wisconsin-Madison/parts 22012-10-04T02:40:35Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762001" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="720px" width="960px"></iframe></div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_1Team:Wisconsin-Madison/parts 12012-10-04T02:40:13Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762000" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="1650px" width="960px"></iframe></div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/parts_1Team:Wisconsin-Madison/parts 12012-10-04T02:39:59Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<div style="margin-top:-100px; margin-left:-2px;"><br />
<iframe seamless="seamless" src="http://partsregistry.org/wiki/index.php?title=Part:BBa_K762000" style="border:0px #FFFFFF none;" name="myiFrame" scrolling="no" frameborder="0" marginheight="0px" marginwidth="0px" height="1700px" width="960px"></iframe></div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner" style="top:-330px"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/advisorsTeam:Wisconsin-Madison/advisors2012-10-03T21:21:40Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}} <html> <!--end of the navigation menubar!--> </div> <br />
<br />
<br />
<br />
<div id = "divthecontent"> <br />
<br />
<br />
<br />
<br> <br> <br />
<br />
<p align="left" class="classtheinlinecontent2"><strong style="font-size:20px; color: rgb(183, 1, 1);">11 <a href="https://2012.igem.org/Team:Wisconsin-Madison/teammembers">LabBadgers</a> with the help of 3 <a href="https://2012.igem.org/Team:Wisconsin-Madison/advisors">advisors</a> and 5 <a href="https://2012.igem.org/Team:Wisconsin-Madison/thanksponsors">sponsors</a><br />
<br />
<br />
</strong></p> <br />
<br />
<br />
<br />
<!--start of the team roster!--><br />
<br />
<br />
<div id = "divaguy"> <br> <br><br />
<br />
<!--wrapper text starts!--> <br />
<br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/5/55/UWMsophia.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <br />
<br />
<br />
<!--wrapper text ends!--> <p class="classtheinlinecontent"> This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. </p> </div> <div style="height:auto;" id = "divaguy"> <br> <br><br />
<br />
<br />
<br />
<!--wrapper text starts!--> <div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/b/ba/UWMMATTC.jpg" width="300px;"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic;">Matt Copeland, PhD</strong><br> I grew up in a van down by the river, sustaining myself primarily on a diet of government cheese. When I wasn't reeling from diet-induced vitamin deficiencies I managed to complete college and get a B.A. in Biochemistry from McDaniel College (Westminster, MD). I then moved to Wisconsin to get closer to the source of my government cheese and attend graduate school in the Department of Biochemistry at the University of Wisconsin-Madison. For my thesis, I studied the swarming motility of enteric bacteria, completing my PhD under the guidance of Dr. Douglas Weibel in February 2012. I thought these little microbes were pretty gnarly and wanted to engineer them to do novel things, like save the planet or make a bigger, better cheese, so I pursued a post-doctoral position with Dr. Brian Pfleger in the Department of Chemical and Biological Engineering. I began my postdoc in May 2012 and eagerly agreed to be one of the iGEM advisors for this year's UW team. When I'm not mentoring or seeking my next morsel of cheesy sustenance, I'm working on developing novel transcription factors for the regulation of metabolic pathways in <i>E. coli</i>. </p> </div> <br />
<br />
<br />
<br />
<br />
<div style="height:auto;" id = "divaguy"> <br> <br> <!--wrapper text starts!--> <br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="http://www.engr.wisc.edu/cmsimages/Pfleger_Brian-500w.jpg" width="320"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic">Brian F. Pfleger, PhD </strong> is from the Department of Chemical and Biological Engineering of University of Wisconsin Madison. His lab's current interest is using synthetic biology to engineer sustainable chemical processes and to improve human health. He believes synthetic biology is an emerging biotechnology field that combines elements of engineering, mathematics, biochemistry, and biology to synthesize novel systems from characterized biological components. His research lab integrates these scientific disciplines to engineer chemical production platforms in microorganisms. The lab’s work strives to characterize new biological components, synthesize novel activities and novel molecules from cataloged components, and provide tools to analyze biological systems. His long term vision of the chemical industry involves the use of modern biotechnology, and specifically synthetic biology, to engineer systems where the spectrum of fuels, chemicals, and pharmaceuticals we use can be produced from renewable sources such as biomass or CO2.</p><br> <p align="left" class="classtheinlinecontent">In addition to his full time research laboratory, he advises a team of undergraduates that competes in the international Genetically Engineered Machines competition. He has advised a team of UW-Madison students each year since 2008. In that time, he has introduced synthetic biology to 31 undergraduates, 10 of which are now pursuing graduate degrees in science and/or medicine.</p> </p> </div> <!--end of the team roster!--> </div> <!--div close the content!--> <div id = "divthelowbanner"> <img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div> </center> </div> <!--close div container!--> </html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/advisorsTeam:Wisconsin-Madison/advisors2012-10-03T21:21:16Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}} <html> <!--end of the navigation menubar!--> </div> <br />
<br />
<br />
<br />
<div id = "divthecontent"> <br />
<br />
<br />
<br />
<br> <br> <br />
<br />
<p align="left" class="classtheinlinecontent2"><strong style="font-size:20px; color: rgb(183, 1, 1);">11 <a href="https://2012.igem.org/Team:Wisconsin-Madison/teammembers">LabBadgers</a> with the help of 3 <a href="https://2012.igem.org/Team:Wisconsin-Madison/advisors">advisors</a> and 5 <a href="https://2012.igem.org/Team:Wisconsin-Madison/thanksponsors">sponsors</a><br />
<br />
<br />
</strong></p> <br />
<br />
<br />
<br />
<!--start of the team roster!--><br />
<br />
<br />
<div id = "divaguy"> <br> <br><br />
<br />
<!--wrapper text starts!--> <br />
<br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/5/55/UWMsophia.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <br />
<br />
<br />
<!--wrapper text ends!--> <p class="classtheinlinecontent"> This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. </p> </div> <div style="height:auto;" id = "divaguy"> <br> <br><br />
<br />
<br />
<br />
<!--wrapper text starts!--> <div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/b/ba/UWMMATTC.jpg" width="300px;"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic;">Matt Copeland, PhD</strong><br> I grew up in a van down by the river, sustaining myself primarily on a diet of government cheese. When I wasn't reeling from diet-induced vitamin deficiencies I managed to complete college and get a B.A. in Biochemistry from McDaniel College (Westminster, MD). I then moved to Wisconsin to get closer to the source of my government cheese and attend graduate school in the Department of Biochemistry at the University of Wisconsin-Madison. For my thesis, I studied the swarming motility of enteric bacteria, completing my PhD under the guidance of Dr. Douglas Weibel in February 2012. I thought these little microbes were pretty gnarly and wanted to engineer them to do novel things, like save the planet or make a bigger, better cheese, so I pursued a post-doctoral position with Dr. Brian Pfleger in the Department of Chemical and Biological Engineering. I began my postdoc in May 2012 and eagerly agreed to be one of the iGEM advisors for this year's UW team. When I'm not mentoring or seeking my next morsel of cheesy sustenance, I'm working on developing novel transcription factors for the regulation of metabolic pathways in <i>E. coli</i>. </p> </div> <br />
<br />
<br />
<br />
<br />
<div style="height:auto;" id = "divaguy"> <br> <br> <!--wrapper text starts!--> <br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="http://www.engr.wisc.edu/cmsimages/Pfleger_Brian-500w.jpg" width="320"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic">Brian F. Pfleger, PhD </strong> is from the Department of Chemical and Biological Engineering of University of Wisconsin Madison. His lab's current interest is using synthetic biology to engineer sustainable chemical processes and to improve human health. He believes synthetic biology is an emerging biotechnology field that combines elements of engineering, mathematics, biochemistry, and biology to synthesize novel systems from characterized biological components. His research lab integrates these scientific disciplines to engineer chemical production platforms in microorganisms. The lab’s work strives to characterize new biological components, synthesize novel activities and novel molecules from cataloged components, and provide tools to analyze biological systems. His long term vision of the chemical industry involves the use of modern biotechnology, and specifically synthetic biology, to engineer systems where the spectrum of fuels, chemicals, and pharmaceuticals we use can be produced from renewable sources such as biomass or CO2.</p> <p align="left" class="classtheinlinecontent">In addition to his full time research laboratory, he advises a team of undergraduates that competes in the international Genetically Engineered Machines competition. He has advised a team of UW-Madison students each year since 2008. In that time, he has introduced synthetic biology to 31 undergraduates, 10 of which are now pursuing graduate degrees in science and/or medicine.</p> </p> </div> <!--end of the team roster!--> </div> <!--div close the content!--> <div id = "divthelowbanner"> <img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div> </center> </div> <!--close div container!--> </html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/advisorsTeam:Wisconsin-Madison/advisors2012-10-03T21:20:57Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}} <html> <!--end of the navigation menubar!--> </div> <br />
<br />
<br />
<br />
<div id = "divthecontent"> <br />
<br />
<br />
<br />
<br> <br> <br />
<br />
<p align="left" class="classtheinlinecontent2"><strong style="font-size:20px; color: rgb(183, 1, 1);">11 <a href="https://2012.igem.org/Team:Wisconsin-Madison/teammembers">LabBadgers</a> with the help of 3 <a href="https://2012.igem.org/Team:Wisconsin-Madison/advisors">advisors</a> and 5 <a href="https://2012.igem.org/Team:Wisconsin-Madison/thanksponsors">sponsors</a><br />
<br />
<br />
</strong></p> <br />
<br />
<br />
<br />
<!--start of the team roster!--><br />
<br />
<br />
<div id = "divaguy"> <br> <br><br />
<br />
<!--wrapper text starts!--> <br />
<br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/5/55/UWMsophia.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <br />
<br />
<br />
<!--wrapper text ends!--> <p class="classtheinlinecontent"> This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. </p> </div> <div style="height:auto;" id = "divaguy"> <br> <br><br />
<br />
<br />
<br />
<!--wrapper text starts!--> <div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/b/ba/UWMMATTC.jpg" width="300px;"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic;">Matt Copeland, PhD</strong><br> I grew up in a van down by the river, sustaining myself primarily on a diet of government cheese. When I wasn't reeling from diet-induced vitamin deficiencies I managed to complete college and get a B.A. in Biochemistry from McDaniel College (Westminster, MD). I then moved to Wisconsin to get closer to the source of my government cheese and attend graduate school in the Department of Biochemistry at the University of Wisconsin-Madison. For my thesis, I studied the swarming motility of enteric bacteria, completing my PhD under the guidance of Dr. Douglas Weibel in February 2012. I thought these little microbes were pretty gnarly and wanted to engineer them to do novel things, like save the planet or make a bigger, better cheese, so I pursued a post-doctoral position with Dr. Brian Pfleger in the Department of Chemical and Biological Engineering. I began my postdoc in May 2012 and eagerly agreed to be one of the iGEM advisors for this year's UW team. When I'm not mentoring or seeking my next morsel of cheesy sustenance, I'm working on developing novel transcription factors for the regulation of metabolic pathways in <i>E. coli</i>. </p> </div> <br />
<br />
<br />
<br />
<br />
<div style="height:auto;" id = "divaguy"> <br> <br> <!--wrapper text starts!--> <br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="http://www.engr.wisc.edu/cmsimages/Pfleger_Brian-500w.jpg" width="350"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic">Brian F. Pfleger, PhD </strong> is from the Department of Chemical and Biological Engineering of University of Wisconsin Madison. His lab's current interest is using synthetic biology to engineer sustainable chemical processes and to improve human health. He believes synthetic biology is an emerging biotechnology field that combines elements of engineering, mathematics, biochemistry, and biology to synthesize novel systems from characterized biological components. His research lab integrates these scientific disciplines to engineer chemical production platforms in microorganisms. The lab’s work strives to characterize new biological components, synthesize novel activities and novel molecules from cataloged components, and provide tools to analyze biological systems. His long term vision of the chemical industry involves the use of modern biotechnology, and specifically synthetic biology, to engineer systems where the spectrum of fuels, chemicals, and pharmaceuticals we use can be produced from renewable sources such as biomass or CO2.</p> <p align="left" class="classtheinlinecontent">In addition to his full time research laboratory, he advises a team of undergraduates that competes in the international Genetically Engineered Machines competition. He has advised a team of UW-Madison students each year since 2008. In that time, he has introduced synthetic biology to 31 undergraduates, 10 of which are now pursuing graduate degrees in science and/or medicine.</p> </p> </div> <!--end of the team roster!--> </div> <!--div close the content!--> <div id = "divthelowbanner"> <img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div> </center> </div> <!--close div container!--> </html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/advisorsTeam:Wisconsin-Madison/advisors2012-10-03T21:19:49Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}} <html> <!--end of the navigation menubar!--> </div> <br />
<br />
<br />
<br />
<div id = "divthecontent"> <br />
<br />
<br />
<br />
<br> <br> <br />
<br />
<p align="left" class="classtheinlinecontent2"><strong style="font-size:20px; color: rgb(183, 1, 1);">11 <a href="https://2012.igem.org/Team:Wisconsin-Madison/teammembers">LabBadgers</a> with the help of 3 <a href="https://2012.igem.org/Team:Wisconsin-Madison/advisors">advisors</a> and 5 <a href="https://2012.igem.org/Team:Wisconsin-Madison/thanksponsors">sponsors</a><br />
<br />
<br />
</strong></p> <br />
<br />
<br />
<br />
<!--start of the team roster!--><br />
<br />
<br />
<div id = "divaguy"> <br> <br><br />
<br />
<!--wrapper text starts!--> <br />
<br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/5/55/UWMsophia.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <br />
<br />
<br />
<!--wrapper text ends!--> <p class="classtheinlinecontent"> This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. </p> </div> <div style="height:auto;" id = "divaguy"> <br> <br><br />
<br />
<br />
<br />
<!--wrapper text starts!--> <div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/b/ba/UWMMATTC.jpg" width="300px;"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic;">Matt Copeland, PhD</strong><br> I grew up in a van down by the river, sustaining myself primarily on a diet of government cheese. When I wasn't reeling from diet-induced vitamin deficiencies I managed to complete college and get a B.A. in Biochemistry from McDaniel College (Westminster, MD). I then moved to Wisconsin to get closer to the source of my government cheese and attend graduate school in the Department of Biochemistry at the University of Wisconsin-Madison. For my thesis, I studied the swarming motility of enteric bacteria, completing my PhD under the guidance of Dr. Douglas Weibel in February 2012. I thought these little microbes were pretty gnarly and wanted to engineer them to do novel things, like save the planet or make a bigger, better cheese, so I pursued a post-doctoral position with Dr. Brian Pfleger in the Department of Chemical and Biological Engineering. I began my postdoc in May 2012 and eagerly agreed to be one of the iGEM advisors for this year's UW team. When I'm not mentoring or seeking my next morsel of cheesy sustenance, I'm working on developing novel transcription factors for the regulation of metabolic pathways in <i>E. coli</i>. </p> </div> <br />
<br />
<br />
<br />
<br />
<div style="height:auto;" id = "divaguy"> <br> <br> <!--wrapper text starts!--> <br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="http://www.engr.wisc.edu/cmsimages/Pfleger_Brian-500w.jpg" height="250"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic">Brian F. Pfleger, PhD </strong> is from the Department of Chemical and Biological Engineering of University of Wisconsin Madison. His lab's current interest is using synthetic biology to engineer sustainable chemical processes and to improve human health. He believes synthetic biology is an emerging biotechnology field that combines elements of engineering, mathematics, biochemistry, and biology to synthesize novel systems from characterized biological components. His research lab integrates these scientific disciplines to engineer chemical production platforms in microorganisms. The lab’s work strives to characterize new biological components, synthesize novel activities and novel molecules from cataloged components, and provide tools to analyze biological systems. His long term vision of the chemical industry involves the use of modern biotechnology, and specifically synthetic biology, to engineer systems where the spectrum of fuels, chemicals, and pharmaceuticals we use can be produced from renewable sources such as biomass or CO2.</p> <p align="left" class="classtheinlinecontent">In addition to his full time research laboratory, he advises a team of undergraduates that competes in the international Genetically Engineered Machines competition. He has advised a team of UW-Madison students each year since 2008. In that time, he has introduced synthetic biology to 31 undergraduates, 10 of which are now pursuing graduate degrees in science and/or medicine.</p> </p> </div> <!--end of the team roster!--> </div> <!--div close the content!--> <div id = "divthelowbanner"> <img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div> </center> </div> <!--close div container!--> </html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/teammembersTeam:Wisconsin-Madison/teammembers2012-10-03T21:19:03Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2"><strong style="font-size:20px; color: rgb(183, 1, 1);">11 <a href="https://2012.igem.org/Team:Wisconsin-Madison/teammembers">LabBadgers</a> with the help of 3 <a href="https://2012.igem.org/Team:Wisconsin-Madison/advisors">advisors</a> and 5 <a href="https://2012.igem.org/Team:Wisconsin-Madison/thanksponsors">sponsors</a></strong></p><br />
<br />
<!--start of the team roster!--><br />
<br />
<div id = "divaguy"><br />
<br><br />
<br><br />
<!--start text wrapper for Ryan!--><br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/2/2b/UWMryan.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<!-- ends text wrapper for Ryan!--><br />
<p align="left" class="classtheinlinecontent"><br />
<strong style="font-style:italic"> Ryan</strong> is a senior in the chemical engineering department at UW-Madison. Originally he was interested in industrial research, but synthetic biology soon stole his heart. When not in the lab, Ryan can be spotted in many places on campus. He spends late nights in the concrete canoe lab, mixing and sanding concrete repeatedly. He also is a tour guide and tutors for organic chemistry. Ryan intends to go to grad school after his last year at Madison, hopefully to pursue his passion for synthetic biology.<br />
</p><br />
</div><br />
<br />
<br />
<div id = "divaguy"><br />
<br><br />
<br><br />
<!-- start of Mike's text wrapper!--><br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/1/17/UWMmike.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<!-- ends Mike's text warpper!--><br />
<p align="left" class="classtheinlinecontent"><br />
<strong style="font-style:italic">Michael</strong> is a sophomore in the biochemistry department with both math and physics minors. After working in labs at the Mayo Clinic during high school, and receiving an award at the International Science and Engineering Fair for his immunology research done there, Michael jumped straight into research upon arriving at the UW. Michael has for many years had a passion for synthetic biology and the potential in holds. In his spare time Michael can be found fencing, larping, role-playing, reading, or otherwise being a nerd. Michael plans to go to grad school, pursuing a PhD with every plan of returning to synthetic biology in his future.<br />
</p><br />
</div><br />
<br />
<br />
<div id = "divaguy"><br />
<br><br />
<br><br />
<br />
<!--text wrapper for Chris!--><br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/0/07/UWMchris.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<!-- ends text wrapper for Chris!--><br />
<p align="left" class="classtheinlinecontent"><br />
<strong style="font-style:italic">Chris</strong> is a senior in Microbiology, minoring in Business Entrepreneurship, and is interested in biofuels, biorefining, and the future of the energy economy. He has done research in materials science, pharmaceutical discovery, and unconventional yeast metabolism. When not pondering the fate of humanity, Chris enjoys swimming, water polo, and sailing big boats.<br />
</p><br />
</div><br />
<br />
<br />
<div id = "divaguy"><br />
<br><br />
<br><br />
<br />
<!--start text wrapper for charles!--><br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/6/6e/UWMcharles.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<!--ends text wrapper for charles!--><br />
<p align="left" class="classtheinlinecontent"><br />
<strong style="font-style:italic">Charles</strong> Johnson is a Junior in the department of Chemical and Biological Engineering at UW-Madison. He is interested in studying the many different ways synthetic biology can be used to help the world, from medical applications to biofuels. When Charlie is not in the lab he wants follow in his family's footsteps by helping those less fortunate than him, his older brother and grandmother dedicated their lives to teaching in the inner city of Chicago, while his parents have been representing people who could not afford lawyers for 30 plus years, and his younger brother works in a group home helping abused and neglected children get a safe place to live and learn.<br />
</p><br />
</div><br />
<br />
<br />
<div id = "divaguy"><br />
<br><br />
<br><br />
<br />
<!--start text wrapper for Eric!--><br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/2/2b/UWMEric.png" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<!-- ends text wrapper for Eric!--><br />
<br />
<p align="left" class="classtheinlinecontent"><br />
<strong style="font-style:italic">Eric</strong> was on the 2011 UW-Madison iGEM team, and returned this year as a mentor. He is interested in developing novel, robust genetic systems and circuits. He spent much of his undergraduate career developing systems for engineering cyanobacteria, and is leaving us in the fall to begin the PhD program at UC Davis in the Microbiology Graduate Group. When he's not busy tweeting as @LabBadger or finding new, dreadful music, he's usually out riding his rusty bike through alleys full of broken glass.<br />
</p><br />
</div><br />
<br />
<br />
<div id = "divaguy"><br />
<br><br />
<br><br />
<br />
<!--text wrapper for Menuka!--><br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/a/af/UWMMenuka.JPG" height="200px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<!-- ends text wrapper for Menuka!--><br />
<p align="left" class="classtheinlinecontent"><br />
<strong style="font-style:italic">Menuka</strong> Samaranayake is a senior at the University of Wisconsin-Madison and is double-majoring in Microbiology and Political Science. This is Menuka's first foray into the huge, exciting world of conducting research, and he feels that this opportunity of competing in iGEM has been an invaluable experience. Menuka has no idea what his career goals are, but would at some point work in the government. In his spare time, he likes to chill with cats<br />
</p><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<div id = "divaguy"><br />
<br><br />
<br><br />
<br />
<!--wrapper text starts!--><br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/thumb/2/2e/UWMKlaus.png/600px-UWMKlaus.png" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<!--wrapper text ends!--><br />
<p align="left" class="classtheinlinecontent"><br />
Klaus Lovendahl graduated from UW-Madison and now works with Prof. Jennifer Reed. He currently works on computational modeling of <i> Shewanella </i> and biofuel production in cyanobacteria. His novel Gravity's Rainbow won the National Book Award in 1974.<br />
</p><br />
</div><br />
<br />
<br />
<div id = "divaguy"><br />
<br><br />
<br><br />
<br />
<!--wrapper text starts!--><br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/a/a6/UWMyishen.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<!--wrapper text ends!--><br />
<p align="left" class="classtheinlinecontent"><br />
<strong style="font-style:italic">Yishen</strong> is a sophomore in Biomedical Engineering department of University of Wisconsin Madison. He decided to study biology: genetic engineering in specific around middle school. After finishing up his high school education in China, he traveled to the U.S. and became a student of University of Wisconsin in 2011. </p><br />
<p align="left" class="classtheinlinecontent">He wishes that in the future, he could become a better scientist at synthetic biology and genetic engineering so that he could convert his idea as much as possible into reality. In his spare time, Yishen like spending his time exercising Chinese kung fu, on the hope of better physical condition and a more peaceful state of mind. <br />
</p><br />
</div><br />
<br />
<br />
<div id = "divaguy"><br />
<br><br />
<br><br />
<br />
<!--wrapper text starts!--><br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/6/62/UWMdanielle.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<!--wrapper text ends!--><br />
<strong>Danielle</strong><br />
<p align="left" class="classtheinlinecontent"><br />
I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. <br />
</p><br />
</div><br />
<br />
<br />
<div id = "divaguy"><br />
<br><br />
<br><br />
<br />
<!--wrapper text starts!--><br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/8/86/UWMchelsea.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<!--wrapper text ends!--><br />
<p align="left" class="classtheinlinecontent"><br />
<strong style="font-style:italic">Chelsea</strong> is a senior majoring in Microbiology and will also be receiving a certificate in Environmental Studies. Her research has focused on characterizing a close relative of a oney bee pathogen, <i> Paenibacillus alvei </i> and the pathogen itself <i> Paenibacillus larvae </i>. In addition to environmental microbiology, Chelsea is interested in the gut microbiota, food microbiology, and biotechnology. In the winter she can be found on the ski slopes as a volunteer ski patroller. She enjoys yoga, cooking, and puppies. <br />
</p><br />
</div><br />
<div id = "divaguy"><br />
<br><br />
<br><br />
<!--wrapper text starts!--><br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/1/1d/UWMShashank.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<!--wrapper text ends!--><br />
<p align="left" class="classtheinlinecontent"><br />
<strong style="font-style:italic">Shashank</strong> is in senior year of under-graduate degree at the Department of Biotechnology in the Indian Institute of Technology (IIT) Guwahati. He did in-silico <a href="https://2012.igem.org/Team:Wisconsin-Madison/modeling">modeling and optimization</a> of the Limonene production pathway in E.Coli. He also had a great time in the wet lab with the team. He finds excitement in analyzing the way biological systems work. The robustness and precision of decision control and processes in nature is fascinating. He see’s possibilities in re-engineering such systems or applying the underlying fundamentals to solve scientific challenges in the future, which sums up the background on which he targets post-graduation studies.<br />
</p><br />
<br />
</div><br />
<br />
<!--end of the team roster!--> <br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/advisorsTeam:Wisconsin-Madison/advisors2012-10-03T21:18:05Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}} <html> <!--end of the navigation menubar!--> </div> <br />
<br />
<br />
<br />
<div id = "divthecontent"> <br />
<br />
<br />
<br />
<br> <br> <br />
<br />
<p align="left" class="classtheinlinecontent2"><strong style="font-size:20px; color: rgb(183, 1, 1);">11 <a href="https://2012.igem.org/Team:Wisconsin-Madison/teammembers">LabBadgers</a> with the help of 3 <a href="https://2012.igem.org/Team:Wisconsin-Madison/advisors">advisors</a> and 5 <a href="https://2012.igem.org/Team:Wisconsin-Madison/thanksponsors">sponsors</a><br />
<br />
<br />
</strong></p> <br />
<br />
<br />
<br />
<!--start of the team roster!--><br />
<br />
<br />
<div id = "divaguy"> <br> <br><br />
<br />
<!--wrapper text starts!--> <br />
<br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/5/55/UWMsophia.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <br />
<br />
<br />
<!--wrapper text ends!--> <p class="classtheinlinecontent"> This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. </p> </div> <div style="height:auto;" id = "divaguy"> <br> <br><br />
<br />
<br />
<br />
<!--wrapper text starts!--> <div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/b/ba/UWMMATTC.jpg" width="300px;"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic;">Matt Copeland, PhD</strong><br> I grew up in a van down by the river, sustaining myself primarily on a diet of government cheese. When I wasn't reeling from diet-induced vitamin deficiencies I managed to complete college and get a B.A. in Biochemistry from McDaniel College (Westminster, MD). I then moved to Wisconsin to get closer to the source of my government cheese and attend graduate school in the Department of Biochemistry at the University of Wisconsin-Madison. For my thesis, I studied the swarming motility of enteric bacteria, completing my PhD under the guidance of Dr. Douglas Weibel in February 2012. I thought these little microbes were pretty gnarly and wanted to engineer them to do novel things, like save the planet or make a bigger, better cheese, so I pursued a post-doctoral position with Dr. Brian Pfleger in the Department of Chemical and Biological Engineering. I began my postdoc in May 2012 and eagerly agreed to be one of the iGEM advisors for this year's UW team. When I'm not mentoring or seeking my next morsel of cheesy sustenance, I'm working on developing novel transcription factors for the regulation of metabolic pathways in <i>E. coli</i>. </p> </div> <br />
<br />
<br />
<br />
<br />
<div style="height:auto;" id = "divaguy"> <br> <br> <!--wrapper text starts!--> <br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/a/ad/UWMBrian.png" height="250"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic">Brian F. Pfleger, PhD </strong> is from the Department of Chemical and Biological Engineering of University of Wisconsin Madison. His lab's current interest is using synthetic biology to engineer sustainable chemical processes and to improve human health. He believes synthetic biology is an emerging biotechnology field that combines elements of engineering, mathematics, biochemistry, and biology to synthesize novel systems from characterized biological components. His research lab integrates these scientific disciplines to engineer chemical production platforms in microorganisms. The lab’s work strives to characterize new biological components, synthesize novel activities and novel molecules from cataloged components, and provide tools to analyze biological systems. His long term vision of the chemical industry involves the use of modern biotechnology, and specifically synthetic biology, to engineer systems where the spectrum of fuels, chemicals, and pharmaceuticals we use can be produced from renewable sources such as biomass or CO2.</p> <p align="left" class="classtheinlinecontent">In addition to his full time research laboratory, he advises a team of undergraduates that competes in the international Genetically Engineered Machines competition. He has advised a team of UW-Madison students each year since 2008. In that time, he has introduced synthetic biology to 31 undergraduates, 10 of which are now pursuing graduate degrees in science and/or medicine.</p> </p> </div> <!--end of the team roster!--> </div> <!--div close the content!--> <div id = "divthelowbanner"> <img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div> </center> </div> <!--close div container!--> </html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/advisorsTeam:Wisconsin-Madison/advisors2012-10-03T21:17:53Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}} <html> <!--end of the navigation menubar!--> </div> <br />
<br />
<br />
<br />
<div id = "divthecontent"> <br />
<br />
<br />
<br />
<br> <br> <br />
<br />
<p align="left" class="classtheinlinecontent2"><strong style="font-size:20px; color: rgb(183, 1, 1);">11 <a href="https://2012.igem.org/Team:Wisconsin-Madison/teammembers">labbagers</a> with the help of 3 <a href="https://2012.igem.org/Team:Wisconsin-Madison/advisors">advisors</a> and 5 <a href="https://2012.igem.org/Team:Wisconsin-Madison/thanksponsors">sponsors</a><br />
<br />
<br />
</strong></p> <br />
<br />
<br />
<br />
<!--start of the team roster!--><br />
<br />
<br />
<div id = "divaguy"> <br> <br><br />
<br />
<!--wrapper text starts!--> <br />
<br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/5/55/UWMsophia.jpg" height="250px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <br />
<br />
<br />
<!--wrapper text ends!--> <p class="classtheinlinecontent"> This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. This is filler text because I do not have a description of this person yet. </p> </div> <div style="height:auto;" id = "divaguy"> <br> <br><br />
<br />
<br />
<br />
<!--wrapper text starts!--> <div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/b/ba/UWMMATTC.jpg" width="344px;"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic;">Matt Copeland, PhD</strong><br> I grew up in a van down by the river, sustaining myself primarily on a diet of government cheese. When I wasn't reeling from diet-induced vitamin deficiencies I managed to complete college and get a B.A. in Biochemistry from McDaniel College (Westminster, MD). I then moved to Wisconsin to get closer to the source of my government cheese and attend graduate school in the Department of Biochemistry at the University of Wisconsin-Madison. For my thesis, I studied the swarming motility of enteric bacteria, completing my PhD under the guidance of Dr. Douglas Weibel in February 2012. I thought these little microbes were pretty gnarly and wanted to engineer them to do novel things, like save the planet or make a bigger, better cheese, so I pursued a post-doctoral position with Dr. Brian Pfleger in the Department of Chemical and Biological Engineering. I began my postdoc in May 2012 and eagerly agreed to be one of the iGEM advisors for this year's UW team. When I'm not mentoring or seeking my next morsel of cheesy sustenance, I'm working on developing novel transcription factors for the regulation of metabolic pathways in <i>E. coli</i>. </p> </div> <br />
<br />
<br />
<br />
<br />
<div style="height:auto;" id = "divaguy"> <br> <br> <!--wrapper text starts!--> <br />
<br />
<br />
<br />
<div style="float:left;clear:left;height:20px;width:346px"><img src="https://static.igem.org/mediawiki/2012/a/ad/UWMBrian.png" height="250"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:346px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><div style="float:left;clear:left;height:20px;width:345px"></div><div style="float:right;clear:right;height:20px;width:0px"></div><br />
<div style="float:left;clear:left;height:20px;width:Infinitypx"></div><div style="float:right;clear:right;height:20px;width:0px"></div> <!--wrapper text ends!--> <p align="left" class="classtheinlinecontent"><strong style="font-style:italic">Brian F. Pfleger, PhD </strong> is from the Department of Chemical and Biological Engineering of University of Wisconsin Madison. His lab's current interest is using synthetic biology to engineer sustainable chemical processes and to improve human health. He believes synthetic biology is an emerging biotechnology field that combines elements of engineering, mathematics, biochemistry, and biology to synthesize novel systems from characterized biological components. His research lab integrates these scientific disciplines to engineer chemical production platforms in microorganisms. The lab’s work strives to characterize new biological components, synthesize novel activities and novel molecules from cataloged components, and provide tools to analyze biological systems. His long term vision of the chemical industry involves the use of modern biotechnology, and specifically synthetic biology, to engineer systems where the spectrum of fuels, chemicals, and pharmaceuticals we use can be produced from renewable sources such as biomass or CO2.</p> <p align="left" class="classtheinlinecontent">In addition to his full time research laboratory, he advises a team of undergraduates that competes in the international Genetically Engineered Machines competition. He has advised a team of UW-Madison students each year since 2008. In that time, he has introduced synthetic biology to 31 undergraduates, 10 of which are now pursuing graduate degrees in science and/or medicine.</p> </p> </div> <!--end of the team roster!--> </div> <!--div close the content!--> <div id = "divthelowbanner"> <img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div> </center> </div> <!--close div container!--> </html></div>Yamatanoorochihttp://2012.igem.org/File:UWMKlaus.pngFile:UWMKlaus.png2012-10-03T21:16:43Z<p>Yamatanoorochi: uploaded a new version of &quot;File:UWMKlaus.png&quot;</p>
<hr />
<div></div>Yamatanoorochihttp://2012.igem.org/File:UWMMATTC.jpgFile:UWMMATTC.jpg2012-10-03T21:16:11Z<p>Yamatanoorochi: </p>
<hr />
<div></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/hpracticeTeam:Wisconsin-Madison/hpractice2012-10-03T21:14:47Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Outreach: James Madison Memorial High School</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent2">This year our iGEM team decided to combine the Human Practice requirement with helping another iGEM team. In order to do this, we started by visiting a local high school, James Madison Memorial. Over the length of a school day, we talked to all of the AP biology classes about synthetic biology as well as bioethics. </p><br />
<br />
<p align="left" class="classtheinlinecontent2"> We spurred many interesting discussions, as well as brainstormed ideas that some synthetic biologists could try to pursue in the future. After this presentation, we also informed the classes that iGEM just recently opened a high school division, and if any of the juniors were interested in joining a team they should contact us. We made a standardized PowerPoint to give to any high school class, and that should be available to any iGEM team and can be found on our wiki.<br />
</p><br />
<br><br />
<br />
<br />
<!-- JOKER!--><br />
<link rel="stylesheet" href="http://vtb.bme.wisc.edu/image-slideshow-5.css" type="text/css"><br />
<script type="text/javascript" src="http://vtb.bme.wisc.edu/image-slideshow-5.js"><br />
</script><br />
</head><br />
<body><br />
<div id="mainContainer"><br />
<br />
<div id="DHTMLgoodies_panel_one"><br />
<div id="DHTMLgoodies_thumbs"><br />
<div id="DHTMLgoodies_thumbs_inner"><br />
<div class="strip_of_thumbnails"><br />
<div><a id="firstThumbnailLink" href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG"></a></div><br />
<div><a href="#" onclick=<br />
"showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG"></a></div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div id="DHTMLgoodies_arrows"><br />
<img id="DHTMLgoodies_leftArrow" class="leftArrow"><br />
<img id="DHTMLgoodies_rightArrow" class="rightArrow"><br />
</div><br />
<br />
</div><br />
<br />
<div id="DHTMLgoodies_largeImage"><br />
<br />
<table bgcolor="#FFFFFF" style="position:relative;"><br />
<tr><br />
<td><br />
<br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG"></a><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<div class="clear"></div><br />
</div><br />
<br />
<script type="text/javascript"><br />
initGalleryScript();<br />
</script><br />
<br />
<p align="left" class="classtheinlinecontent2"> Shortly afterwards, we received an email from their captain saying that they had a group of approximately ten students who would be definitely interested in forming a team their following year. Throughout the summer, we emailed them back and forth, suggesting possible ways to kick off their team. Near the middle of the summer, we had 8 of them come into our lab and demonstrated some simple synthetic biology techniques. During this time, we also gave them a crash course on BioBrick cloning, and the timeline that goes along with it.</p><br />
<br />
<br />
<p align="left" class="classtheinlinecontent2">In addition we also introduced them to the parts registry, and emphasized its helpfulness in both learning about what specific parts do and what teams have done in the past.</p><br />
<p align="left" class="classtheinlinecontent2">As their school year started, one of our members facilitated a brainstorming session to help them start thinking about projects that would be both educational and feasible in their timeline. Recently, we have helped them find an advisor to help them figure out the logistics of starting a competitive team for this upcoming year. We continually try to check up on them and ensure that they are brainstorming, and think about their project, and will hopefully be able to advise them in the spring once they start experimenting. In addition, here is a public link to our powerpoint that any team can use if they desired to go and talk to a local high school: <a href="http://dl.dropbox.com/u/27094227/HS%20presentation.pptx">Public Link</a></p><br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/hpracticeTeam:Wisconsin-Madison/hpractice2012-10-03T21:14:15Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Outreach: James Madison Memorial High School</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent2">This year our iGEM team decided to combine the Human Practice requirement with helping another iGEM team. In order to do this, we started by visiting a local high school, James Madison Memorial. Over the length of a school day, we talked to all of the AP biology classes about synthetic biology as well as bioethics. </p><br />
<br />
<p align="left" class="classtheinlinecontent2"> We spurred many interesting discussions, as well as brainstormed ideas that some synthetic biologists could try to pursue in the future. After this presentation, we also informed the classes that iGEM just recently opened a high school division, and if any of the juniors were interested in joining a team they should contact us. We made a standardized PowerPoint to give to any high school class, and that should be available to any iGEM team and can be found on our wiki.<br />
</p><br />
<br><br />
<br />
<br />
<!-- JOKER!--><br />
<link rel="stylesheet" href="http://vtb.bme.wisc.edu/image-slideshow-5.css" type="text/css"><br />
<script type="text/javascript" src="http://vtb.bme.wisc.edu/image-slideshow-5.js"><br />
</script><br />
</head><br />
<body><br />
<div id="mainContainer"><br />
<br />
<div id="DHTMLgoodies_panel_one"><br />
<div id="DHTMLgoodies_thumbs"><br />
<div id="DHTMLgoodies_thumbs_inner"><br />
<div class="strip_of_thumbnails"><br />
<div><a id="firstThumbnailLink" href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG"></a></div><br />
<div><a href="#" onclick=<br />
"showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG"></a></div><br />
<div><a href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG"></a></div><br />
<br />
</div><br />
</div><br />
</div><br />
<br />
<div id="DHTMLgoodies_arrows"><br />
<img id="DHTMLgoodies_leftArrow" class="leftArrow"><br />
<img id="DHTMLgoodies_rightArrow" class="rightArrow"><br />
</div><br />
<br />
</div><br />
<br />
<div id="DHTMLgoodies_largeImage"><br />
<br />
<table bgcolor="#FFFFFF" style="position:relative;"><br />
<tr><br />
<td><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/b/b7/UWMGC1.png"></a><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<div class="clear"></div><br />
</div><br />
<br />
<script type="text/javascript"><br />
initGalleryScript();<br />
</script><br />
<br />
<p align="left" class="classtheinlinecontent2"> Shortly afterwards, we received an email from their captain saying that they had a group of approximately ten students who would be definitely interested in forming a team their following year. Throughout the summer, we emailed them back and forth, suggesting possible ways to kick off their team. Near the middle of the summer, we had 8 of them come into our lab and demonstrated some simple synthetic biology techniques. During this time, we also gave them a crash course on BioBrick cloning, and the timeline that goes along with it.</p><br />
<br />
<br />
<p align="left" class="classtheinlinecontent2">In addition we also introduced them to the parts registry, and emphasized its helpfulness in both learning about what specific parts do and what teams have done in the past.</p><br />
<p align="left" class="classtheinlinecontent2">As their school year started, one of our members facilitated a brainstorming session to help them start thinking about projects that would be both educational and feasible in their timeline. Recently, we have helped them find an advisor to help them figure out the logistics of starting a competitive team for this upcoming year. We continually try to check up on them and ensure that they are brainstorming, and think about their project, and will hopefully be able to advise them in the spring once they start experimenting. In addition, here is a public link to our powerpoint that any team can use if they desired to go and talk to a local high school: <a href="http://dl.dropbox.com/u/27094227/HS%20presentation.pptx">Public Link</a></p><br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/hpracticeTeam:Wisconsin-Madison/hpractice2012-10-03T21:12:46Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Outreach: James Madison Memorial High School</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent2">This year our iGEM team decided to combine the Human Practice requirement with helping another iGEM team. In order to do this, we started by visiting a local high school, James Madison Memorial. Over the length of a school day, we talked to all of the AP biology classes about synthetic biology as well as bioethics. </p><br />
<br />
<p align="left" class="classtheinlinecontent2"> We spurred many interesting discussions, as well as brainstormed ideas that some synthetic biologists could try to pursue in the future. After this presentation, we also informed the classes that iGEM just recently opened a high school division, and if any of the juniors were interested in joining a team they should contact us. We made a standardized PowerPoint to give to any high school class, and that should be available to any iGEM team and can be found on our wiki.<br />
</p><br />
<br><br />
<br />
<br />
<!-- JOKER!--><br />
<link rel="stylesheet" href="http://vtb.bme.wisc.edu/image-slideshow-5.css" type="text/css"><br />
<script type="text/javascript" src="http://vtb.bme.wisc.edu/image-slideshow-5.js"><br />
</script><br />
</head><br />
<body><br />
<div id="mainContainer"><br />
<br />
<div id="DHTMLgoodies_panel_one"><br />
<div id="DHTMLgoodies_thumbs"><br />
<div id="DHTMLgoodies_thumbs_inner"><br />
<div class="strip_of_thumbnails"><br />
<div><a id="firstThumbnailLink" href="#" onclick="showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG"></a></div><br />
<div><a href="#" onclick=<br />
"showPreview('http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG"></a></div><br />
<div><a href="#" onclick="http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG"></a></div><br />
<div><a href="#" onclick="http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG',this);return false;"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG"></a></div><br />
<br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<div id="DHTMLgoodies_arrows"><br />
<img id="DHTMLgoodies_leftArrow" class="leftArrow"><br />
<img id="DHTMLgoodies_rightArrow" class="rightArrow"><br />
</div><br />
<br />
</div><br />
<br />
<div id="DHTMLgoodies_largeImage"><br />
<br />
<table bgcolor="#FFFFFF" style="position:relative;"><br />
<tr><br />
<td><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/b/b7/UWMGC1.png"></a><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<div class="clear"></div><br />
</div><br />
<br />
<script type="text/javascript"><br />
initGalleryScript();<br />
</script><br />
<br />
<p align="left" class="classtheinlinecontent2"> Shortly afterwards, we received an email from their captain saying that they had a group of approximately ten students who would be definitely interested in forming a team their following year. Throughout the summer, we emailed them back and forth, suggesting possible ways to kick off their team. Near the middle of the summer, we had 8 of them come into our lab and demonstrated some simple synthetic biology techniques. During this time, we also gave them a crash course on BioBrick cloning, and the timeline that goes along with it.</p><br />
<br />
<br />
<p align="left" class="classtheinlinecontent2">In addition we also introduced them to the parts registry, and emphasized its helpfulness in both learning about what specific parts do and what teams have done in the past.</p><br />
<p align="left" class="classtheinlinecontent2">As their school year started, one of our members facilitated a brainstorming session to help them start thinking about projects that would be both educational and feasible in their timeline. Recently, we have helped them find an advisor to help them figure out the logistics of starting a competitive team for this upcoming year. We continually try to check up on them and ensure that they are brainstorming, and think about their project, and will hopefully be able to advise them in the spring once they start experimenting. In addition, here is a public link to our powerpoint that any team can use if they desired to go and talk to a local high school: <a href="http://dl.dropbox.com/u/27094227/HS%20presentation.pptx">Public Link</a></p><br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/hpracticeTeam:Wisconsin-Madison/hpractice2012-10-03T21:06:20Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Outreach: James Madison Memorial High School</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent2">This year our iGEM team decided to combine the Human Practice requirement with helping another iGEM team. In order to do this, we started by visiting a local high school, James Madison Memorial. Over the length of a school day, we talked to all of the AP biology classes about synthetic biology as well as bioethics. </p><br><br />
<br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0491.JPG" width="600"><br><br><br />
<br />
<br />
<p align="left" class="classtheinlinecontent2"> We spurred many interesting discussions, as well as brainstormed ideas that some synthetic biologists could try to pursue in the future. After this presentation, we also informed the classes that iGEM just recently opened a high school division, and if any of the juniors were interested in joining a team they should contact us. We made a standardized PowerPoint to give to any high school class, and that should be available to any iGEM team and can be found on our wiki.<br />
</p><br />
<br><br />
<br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_0476.JPG" width="600"><br><br><br />
<br />
<br />
<p align="left" class="classtheinlinecontent2"> Shortly afterwards, we received an email from their captain saying that they had a group of approximately ten students who would be definitely interested in forming a team their following year. Throughout the summer, we emailed them back and forth, suggesting possible ways to kick off their team. Near the middle of the summer, we had 8 of them come into our lab and demonstrated some simple synthetic biology techniques. During this time, we also gave them a crash course on BioBrick cloning, and the timeline that goes along with it.</p><br><br />
<br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1451.JPG" width="600"><br><br><br />
<br />
<br />
<p align="left" class="classtheinlinecontent2">In addition we also introduced them to the parts registry, and emphasized its helpfulness in both learning about what specific parts do and what teams have done in the past.</p><br />
<p align="left" class="classtheinlinecontent2">As their school year started, one of our members facilitated a brainstorming session to help them start thinking about projects that would be both educational and feasible in their timeline. Recently, we have helped them find an advisor to help them figure out the logistics of starting a competitive team for this upcoming year. We continually try to check up on them and ensure that they are brainstorming, and think about their project, and will hopefully be able to advise them in the spring once they start experimenting. In addition, here is a public link to our powerpoint that any team can use if they desired to go and talk to a local high school: <a href="http://dl.dropbox.com/u/27094227/HS%20presentation.pptx">Public Link</a></p><br />
<br />
<br><br />
<br />
<img src="http://vtb.bme.wisc.edu/image/temp/IMG_1453.JPG" width="600"><br><br><br />
<br><br />
<br><br />
<br />
<br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/lemonTeam:Wisconsin-Madison/lemon2012-10-03T20:52:47Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Engineering a limonene production pathway of E.coli</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">Why</span> Produce Limonene?</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">The goal of this project is to engineer Escherichia coli to produce limonene. Limonene is a 10-carbon monoterpene and is found naturally in the oils of citrus fruits. It is used as a cleaning agent, solvent, food additive, and even new medical applications. Limonene also possesses the chemical properties of an ideal biofuel, specifically as a jet fuel due to its low freezing point, combustibility, and high energy density. Currently, industrial production is restricted to direct extraction from citrus fruits. This prevents collection in quantities large enough to be useful as a biofuel. Other organisms, such as E. coli, could be used to produce limonene more effectively and efficiently.</p><br />
<br /><br />
<br><br />
<br><br />
<img src="https://static.igem.org/mediawiki/2012/6/62/Mevalonate_Pathway.png" width="800px"><br />
<br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">The</span> Mevalonate Pathway</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">The mevalonate pathway is a series of enzymes used to take Acetyl-CoA to 3-isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) through several chemical reactions. IPP and DMAPP are the building blocks for a family of molecules called Isoprenoids which are a group of organic molecules with a wide array of functions. It was used in the Jay Keasling’s lab to create an antimalarial drug precursor, amorphadiene, much cheaper and faster than was previously possible.</p><br />
<br><br />
<br><br />
<br><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/c/c0/Mevalonate_Pathway_and_more.png" width="800px"><br />
<br />
<br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">In this research, a strain of E. coli will be bioengineered to produce limonene by inserting the genes for the necessary biochemical pathways. Our strain contains the genes coding for the Mevalonate pathway, a synthesized Geranyl Diphosphate Synthase (GPPS) gene, and a synthesized and codon optimized Limonene Synthase gene. The plasmid, pBba5c, contains the genes for the mevalonate pathway in an operon under a lac inducible promoter. During our research we used the Gibson cloning method to replace the ispA gene with the GPPS gene into the pBba5c plasmid. This created pBba5c-GPPS for better theoretical production of Limonene. This strain would theoretically be able to produce Limonene using common media.</p><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">The</span> Production Assay</strong></p><br /><br />
<br />
<br />
<p align="left" class="classtheinlinecontent2">5 mL cultures of each strain (listed below) were grown overnight at 37°C in LB, then normalized to an OD600 of 1 and diluted 1:100 into 40 mL cultures. They were then grown up to an OD600 of 0.2 and the promoters in the pBba5C vector were induced with 1 mM IPTG. 10 mL of dodecane were used to overlay the culture. This overlay was used as an organic layer for the limonene to diffuse into. These cultures were then grown for 18 hours, centrifuged, and 1mL of the dodecane overlay was diluted in ethyl acetate and sampled in a GC/MS. </p><br />
<br><br />
<br><br />
<br />
<table align="center" width="600" border="1"><br />
<tr><br />
<td>Strain</td> <td>Purpose</td><br />
</tr><br />
<tr><br />
<td>pBba5c + J23102-RFP</td> <td>J23102 promoter only as a negative control</td><br />
</tr><br />
<tr><br />
<td>pBba5c + J23102-LimS1</td> <td>Production strain</td><br />
</tr><br />
<tr><br />
<td>pBba5c + J23102-CO_LimS</td> <td>Production Strain</td><br />
</tr><br />
<tr><br />
<td>pBba5c + pTRC-ADS</td> <td>pTRC-ADS is the amorphadiene synthase</td><br />
</tr><br />
<tr><br />
<td>pBba5c-GPPS + J23102-RFP</td> <td>Negative control</td><br />
</tr><br />
<tr><br />
<td>pBba5c-GPPS + J23102-LimS1</td> <td>Production strain</td><br />
</tr><br />
<tr><br />
<td>pBba5c-GPPS + J23102-CO_LimS</td> <td>Production strain</td><br />
</tr><br />
<tr><br />
<td>pBba5c-GPPS + J23102-pTRC-ADS</td> <td>Testing the GPPS-ispA swap with gibson</td><br />
</tr><br />
</table><br />
<br><br />
<br><br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/c/c7/UWMlimoneneRetent.png"><img src="https://static.igem.org/mediawiki/2012/c/c7/UWMlimoneneRetent.png" width="800px"></a><br />
<br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">As seen in this GC/MS data, limonene was not produced. There was a small peak located where limonene was supposed to be, but unfortunately that peak also showed up in the empty promoter strain as well. In order to troubleshoot the lack of production, we tried to produce amorphadiene, which shares the same precursor molecules as limonene up until the GPP step of the pathway. The ispA gene synthesizes Farnesyl Pyrophosphate (FPP), the precursor to amorphadiene. Both the pBbA5c with the ispA and with the GPPS were used to troubleshoot the mevalonate pathway by attempting to generate amorphadiene. In the GC/MS data, both strains created amorphadiene when amorphadiene synthase was included in the bacterial strain. Thus, the mevalonate pathway seems to be functioning correctly. However, the pBba5C-GPPS strain with the amorphadiene synthase should not create amorphadiene because ispA has been replaced with GPPS. There was still an amorphadiene peak found in the GC/MS data, but this is because the E. coli genome naturally contains the ispA gene. The amorphadiene peak associated with the pBbA5c-GPPS was much smaller than the peak generated by the pBbA5c-ispA construct. This implies that ispA was replaced correctly (also confirmed by sequencing data), but does not prove that the GPPS is working as anticipated.</p><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">The</span> Conclusion</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">As stated in the last section, the data shows that the mevalonate pathway is functioning correctly. This means that something is either wrong with the limonene synthase gene or the GPPS. Neither the codon optimized nor the classic versions of limonene synthase are producing limonene. To further troubleshoot the production strains, a growth curve was run to determine if cell viability was being affected by the synthetic pathway.</p><br />
<br><br />
<br><br />
<br><br />
<br><br />
<!-- JOKER!--><br />
<link rel="stylesheet" href="http://vtb.bme.wisc.edu/image-slideshow-5.css" type="text/css"><br />
<script type="text/javascript" src="http://vtb.bme.wisc.edu/image-slideshow-5.js"><br />
</script><br />
</head><br />
<body><br />
<div id="mainContainer"><br />
<br />
<div id="DHTMLgoodies_panel_one"><br />
<div id="DHTMLgoodies_thumbs"><br />
<div id="DHTMLgoodies_thumbs_inner"><br />
<div class="strip_of_thumbnails"><br />
<div><a id="firstThumbnailLink" href="#" onclick="showPreview('https://static.igem.org/mediawiki/2012/b/b7/UWMGC1.png',this);return false;"><br />
<img src="https://static.igem.org/mediawiki/2012/thumb/b/b7/UWMGC1.png/120px-UWMGC1.png"></a></div><br />
<div><a href="#" onclick=<br />
"showPreview('https://static.igem.org/mediawiki/2012/c/c2/UWMGC2.png',this);return false;"><br />
<img src="https://static.igem.org/mediawiki/2012/thumb/c/c2/UWMGC2.png/120px-UWMGC2.png"></a></div><br />
<div><a href="#" onclick="showPreview('https://static.igem.org/mediawiki/2012/4/4a/UWMGC3.png',this);return false;"><br />
<img src="https://static.igem.org/mediawiki/2012/thumb/4/4a/UWMGC3.png/120px-UWMGC3.png"></a></div><br />
<div><a href="#" onclick="showPreview('https://static.igem.org/mediawiki/2012/6/60/UWMGC4.png',this);return false;"><br />
<img src="https://static.igem.org/mediawiki/2012/thumb/6/60/UWMGC4.png/120px-UWMGC4.png"></a></div><br />
<div><a href="#" onclick="showPreview('https://static.igem.org/mediawiki/2012/e/e1/UWMGC4.5.png',this);return false;"><br />
<img src="https://static.igem.org/mediawiki/2012/thumb/e/e1/UWMGC4.5.png/120px-UWMGC4.5.png"></a></div><br />
<div><a href="#" onclick="showPreview('https://static.igem.org/mediawiki/2012/b/b6/UWMGC5.png',this);return false;"><br />
<img src="https://static.igem.org/mediawiki/2012/thumb/b/b6/UWMGC5.png/120px-UWMGC5.png"></a></div><br />
<br />
</div><br />
<br />
</div><br />
</div><br />
<br />
<div id="DHTMLgoodies_arrows"><br />
<img id="DHTMLgoodies_leftArrow" class="leftArrow"><br />
<img id="DHTMLgoodies_rightArrow" class="rightArrow"><br />
</div><br />
<br />
</div><br />
<br />
<div id="DHTMLgoodies_largeImage"><br />
<br />
<table bgcolor="#FFFFFF" style="position:relative;"><br />
<tr><br />
<td><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/b/b7/UWMGC1.png"></a><br />
</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<div class="clear"></div><br />
</div><br />
<br />
<script type="text/javascript"><br />
initGalleryScript();<br />
</script><br />
<br />
<br />
<p align="left" class="classtheinlinecontent2"><br />
These growth curves present two important conclusions. The classic limonene synthase shows a growth defect in comparison to the synthesized codon-optimized limonene synthase. More dramatically, the pBbA5c with ispA greatly inhibits cell growth. A possible explanation for this is the toxicity of the FPP to the cell as the pBbA5c-GPPS did not inhibit cell growth in comparison to the pBbA5c-ispA. Since ispA is native to E. coli, it should be translated more efficiently than the other enzymes in the mevalonate pathway, including GPPS. To further interpret this growth curve data it would be beneficial to insert GPPS and ispA into the Translation Coupling Cassette (TCC) and compare their translational efficiency. The rationale for the focus on GPPS is due to the fact that we now know the codon-optimized limonene synthase is being translated because of our TCC data (See TCC page for further explanation). However, even though limonene synthase is being translated, it may not be functioning correctly. This leads us to the in vitro assays described on the TCC project page. With additional TCC data and in vitro assays, we would hope to determine why no limonene is being produced. <br />
</p><br />
<p align="left" class="classtheinlinecontent" font-size:20px;><strong>Reference: </strong></p><br />
<div style="position:relative;" align="left" class="classtheinlinecontent"><br />
<ul>“Engineering a mevalonate pathway in Escherichia coli for production of terpenoids”</ul><br />
<ul>Keasling et al., 2003</ul><br />
<br><br />
<ul>“Engineering microbial biofuel tolerance and export using efflux pumps”</ul><br />
<ul> Dunlop et al., 2011</ul><br />
<br><br />
<br />
<ul>“Biosynthesis of plant isoprenoids: perspectives for microbial engineering”</ul> <br />
<ul>Keasling et al., 2009</ul><br />
<br />
<ul>“Monoterpene biosynthesis in lemon”<br />
</ul><br />
<ul>Lücker et al., 2002</ul><br />
<br><br />
</div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"> <img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/SDFTeam:Wisconsin-Madison/SDF2012-10-03T20:50:30Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Translational Coupling – an explanation</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">Why</span> are we using translational coupling?</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">In the beginning of the summer our team’s initial goal was to produce limonene. After trying several different methods for the in vivo production using E. coli host strains we were unable to detect limonene. We hypothesized that a lack of fully translated limonene synthase was the culprit. The limonene synthase gene is not native to E. coli, which can cause problems with translation due to differing codon usage. To remedy this, we created a codon optimized limonene synthase and repeated the initial methods of limonene production. Again, we were unable to detect limonene. To test our initial hypothesis, we adopted a translational coupling cassette to determine if the limonene synthase gene was being fully translated.</p><br />
<br /><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">How</span> the translational coupling cassette works</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">The translational coupling cassette is designed to determine if a target gene is being fully translated. This is achieved by fusing a DNA sequence to the 5’ end of the open reading frame that forms an RNA hairpin structure following transcription. Embedded in this mRNA hairpin is a His-tag and a stop codon for the target gene followed by a ribosome binding site for a downstream reporter gene. In our construct, the reporter gene is red fluorescent protein BBa_E1010. If the upstream gene of interest is not being properly translated, the hairpin will remain intact and block the translation of the rfp reporter gene by occluding the RBS (Figure 1). However, if the 5’ gene of interest is being properly translated, the engineered hairpin is designed so that ribosomal helicase activity is sufficient to break the hairpin apart, enabling both complete translation of the gene of the target gene and allows access to the RBS of the reporter gene (Figure 2). This permits loading of a ribosome and translation of the reporter gene. This system allows a user to indirectly determine if their gene of interest is being fully translated; complete translation will yield a detectable amount of RFP – the reporter gene. </p><br />
<br><br />
<br /><br />
<a href="https://static.igem.org/mediawiki/2012/e/e0/TCC_all_in_one.png"><img src="https://static.igem.org/mediawiki/2012/e/e0/TCC_all_in_one.png" width="900"></a><br><br />
<br><br><br />
<br><br />
<br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">Assays</span> for the translational coupling cassette</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">Two primary assays used to characterize the fluorescence produced by the RFP reporter from the translational coupling cassette (TCC).The first was performed using a Typhoon Imager (GE Healthcare). This instrument excites a sample with a laser (532 nm) and detects the emitted fluorescent signal via a photomultiplier tube (PMT). We spotted droplets of our various strains on selective media plates which contained exactly 20mL of agar solution. The droplets were absorbed into the agar and the plates were incubated overnight before being imaged on the Typhoon Imager. Below is a list of the different constructs we imaged using this method.</p><br />
<br />
<br><br />
<br><br />
<table align="center" width="600" border="1"><br />
<tr><br />
<td>Construct</td><br />
<td>Purpose</td><br />
</tr><br />
<tr><br />
<td>TCC</td><br />
<td>Negative control for fluorescence</td><br />
</tr><br />
<tr><br />
<td>J23102-E0040-TCC</td><br />
<td>Positive control – test for translation of the target gene without the use of the TCC</td><br />
</tr><br />
<tr><br />
<td>J23102-Limonene synthase(Lims1)-TCC</td><br />
<td>Testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-Lims1-Stop codon(Stop)-TCC</td><br />
<td>Negative control for testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-Codon optimized(CO)-Lims1-TCC</td><br />
<td>Testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-CO-Lims1-Stop-TCC</td><br />
<td>Negative control for test of translation</td><br />
</tr><br />
<tr><br />
<td>J23102-E0840</td><br />
<td>Testing the amount of RFP signal and ensuring that we account for GFP fluorescence bleed-through into the RFP channel in our positive control construct</td><br />
</tr><br />
</table><br />
<p align="center">J23102 is a constitutive promoter; TCC stands for translational coupling cassette; E0040 is a GFP open reading frame; E0840 is a composite part containing an ribosome binding site, E0040 ORF, and a terminator. </p><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">The J23102+E0040+TCC was used as a positive control to test the functionality of the translational coupling cassette. We used a green fluorescent protein (E0040) as our positive control because it was ideal to see if we were getting translation of a target gene without the use of the coupling cassette. Additionally, this part is well characterized and routinely used by many iGEM teams, suggesting it should not have any issues being fully translated. However, there was one drawback to using the GFP as our target gene; when scanning our samples in the Typhoon Imager, we noticed that the GFP only construct (J23100 + E0040) produced low levels of fluorescence intensity in the red fluorescent channel. This is not an uncommon problem when using fluorophores, particularly fluorescent proteins, and is due to bleed-through of the GFP fluorescent signal into the RFP emission channel. Thus, some of the red fluorescence signal produced by our positive control construct (J23102+E0040+TCC) was due to the GFP. This required us to account for the bleed-through to determine if the RFP signal from our GFP-TCC-RFP construct was really from the RFP reporter gene or was just bleed-through from the GFP. Figure below demonstrates that the signal intensity from the GFP-TCC-RFP construct is well above the signal produced from the GFP only strain, suggesting that our translational coupling cassette is working as intended. </p><br />
<br><br />
<br><br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/5/59/TCCBAR1.png"><img src="https://static.igem.org/mediawiki/2012/5/59/TCCBAR1.png" width="800"></a><br><br />
<br><br><br />
<br><br />
<br><br />
<br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/d/dc/TCCBAR2.png"><img src="https://static.igem.org/mediawiki/2012/d/dc/TCCBAR2.png" width="800"></a><br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">The codon optimized limonene synthase, with a stop codon located in the middle of the gene, was used as our negative control for the cassette. If translation is stopped partway through the target gene, the helicase activity on the ribosome will not break the hairpin and RFP will not be generated.</p><br />
<i> -Typhoon graphic (Matt) </i><br />
<p align="left" class="classtheinlinecontent2">From this data, three things can be determined. First, the positive control is producing RFP, meaning the hairpin is being broken by the ribosome. Second, the construct containing a stop codon midway through the target gene is not generating RFP. This demonstrates that the hairpin stays intact when successful translation of the target gene does not occur. Third, the codon-optimized limonene synthase is being translated, and the non-codon optimized is not. The fluorescence produced by the codon-optimized construct is much lower than the positive control, but we cannot definitively explain this. </p><br />
<br />
<p align="left" class="classtheinlinecontent2">The second assay used to quantify fluorescence was done by using a 96-well plate reader. Optical densities and fluorescence were taken over a 24 period, and used to determine if our target gene was being translated. The same strains used in the Typhoon were tested using this method. Fluorescence was divided by optical density because all of the strains did not grow at the same rate. This allowed the normalization of fluorescence, and thus the quantification and comparison of it between strains. </p><br />
<br><br />
<br><br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/a/ac/UWMPLATEREADCHARLES.png"><img src="https://static.igem.org/mediawiki/2012/a/ac/UWMPLATEREADCHARLES.png" width="631" height="1644"></a><br />
<img src="https://static.igem.org/mediawiki/2012/0/00/UWMPLATEREADCHARLESCAP.png" width="400"><br />
<br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">This plot backs up the conclusions drawn from the Typhoon images. The translational coupling cassette produces RFP. The codon optimized limonene synthase seems to be translating more efficiently than the non-codon optimized version. In fact, the limonene synthase may not be translating at all. However, we still have not been able to detect any amount of limonene in our GC/MS assays. We were able to make amorphadiene, so we know that the mevalonate pathway works correctly up until the GPP synthase gene. From this point onwards, all we know is that the limonene synthase (now codon optimized) is being translated. From here, we would require more time and materials to fully troubleshoot why no limonene is being produced. We do have a few hypotheses, based on observations and information about this pathway. First, limonene synthase may be forming an inclusion body in the cell. Second, it is a possibility that GPP is not being produced, and we would require standards (which are quite expensive) and a new protocol to detect for it on the GC/MS. If we had these standards, we would also be able to try to purify limonene synthase using our TCC his-tagged version. This purified enzyme could then be doped with GPP, and hopefully create limonene. If this was the case, we would know that GPP is not being produced, or something is happening to the limonene synthase between translation and the active synthesis of limonene. Third, many of the molecules and enzymes in the mevalonate pathway can be toxic to Escherichia coli cells at high levels, including limonene.</p><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">How</span> to clone using the Translational Coupling Cassette</strong></p><br /><br />
<p align="left" class="classtheinlinecontent2">In order to use the translational coupling cassette, the target gene must be PCR amplified using BioFusion primers. If the gene is amplified using standard BioBrick primers, an open reading frame shift will occur, a premature stop codon will be formed, and the hairpin may not break. In addition to using BioFusion primers, the stop codon must also be taken out of the target gene being amplified for the same reason. If a stop codon prematurely stops translation, then the hairpin may not break and the response gene (RFP) will not be translated. As an example:</p><br />
<br><br />
<blockquote><br />
<p align="left" class="classtheinlinecontent">We cloned in the E0040 gene (GFP) into the TCC as the target gene. The first and last 30 base pairs of the E0840 ribosome binding site plus open reading frame (GFP) are as follows:</p><br />
</blockquote><br />
<br><br />
<div align="center" class="classtheinlinecontent"><br />
<ul>atgcgtaaaggagaagaacttttc</ul><br />
<ul>catggcatggatgaactatacaaataataa</ul><br />
<br><br />
<ul>The forward and reverse primers (respectively) would then have to be:<br><br />
</ul><br />
<ul><br />
5’ 3’<br />
</ul><br />
<ul>CCCCGAATTCGCGGCCGCTTCTAGAatgcgtaaaggagaagaacttttc</ul><br />
<ul><br />
5’ 3’<br />
</ul><br />
<ul>CCGCTACTAGTtttgtatagttcatccatgccatg</ul><br><br />
<br />
<ul>This PCR fragment would then have to be cut with EcoR1 and Spe1, while the translational coupling cassette should be cut with EcoR1 and Xba1.</ul><br />
<br><br />
</div><br />
<p align="left" class="classtheinlinecontent"><strong>Reference: </strong></p><br />
<div align="left" class="classtheinlinecontent"><br />
<ul>Chiral discrimination of limonene by use of beta-cyclodextrin-coated quartz-crystal-microbalances (QCMs) and data evaluation by artificial neuronal networks.</ul><br />
<ul>Fietzek et al., 2001</ul><br />
<br><br />
<ul>A translation-coupling DNA cassette for monitoring protein translation in bacteria</ul><br />
<ul>Pfleger et al., 2012</ul><br />
<br><br />
<br />
</div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/SDFTeam:Wisconsin-Madison/SDF2012-10-03T20:48:10Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Translational Coupling – an explanation</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">Why</span> are we using translational coupling?</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">In the beginning of the summer our team’s initial goal was to produce limonene. After trying several different methods for the in vivo production using E. coli host strains we were unable to detect limonene. We hypothesized that a lack of fully translated limonene synthase was the culprit. The limonene synthase gene is not native to E. coli, which can cause problems with translation due to differing codon usage. To remedy this, we created a codon optimized limonene synthase and repeated the initial methods of limonene production. Again, we were unable to detect limonene. To test our initial hypothesis, we adopted a translational coupling cassette to determine if the limonene synthase gene was being fully translated.</p><br />
<br /><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">How</span> the translational coupling cassette works</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">The translational coupling cassette is designed to determine if a target gene is being fully translated. This is achieved by fusing a DNA sequence to the 5’ end of the open reading frame that forms an RNA hairpin structure following transcription. Embedded in this mRNA hairpin is a His-tag and a stop codon for the target gene followed by a ribosome binding site for a downstream reporter gene. In our construct, the reporter gene is red fluorescent protein BBa_E1010. If the upstream gene of interest is not being properly translated, the hairpin will remain intact and block the translation of the rfp reporter gene by occluding the RBS (Figure 1). However, if the 5’ gene of interest is being properly translated, the engineered hairpin is designed so that ribosomal helicase activity is sufficient to break the hairpin apart, enabling both complete translation of the gene of the target gene and allows access to the RBS of the reporter gene (Figure 2). This permits loading of a ribosome and translation of the reporter gene. This system allows a user to indirectly determine if their gene of interest is being fully translated; complete translation will yield a detectable amount of RFP – the reporter gene. </p><br />
<br><br />
<br /><br />
<a href="https://static.igem.org/mediawiki/2012/e/e0/TCC_all_in_one.png"><img src="https://static.igem.org/mediawiki/2012/e/e0/TCC_all_in_one.png" width="900"></a><br><br />
<br><br><br />
<br><br />
<br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">Assays</span> for the translational coupling cassette</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">Two primary assays used to characterize the fluorescence produced by the RFP reporter from the translational coupling cassette (TCC).The first was performed using a Typhoon Imager (GE Healthcare). This instrument excites a sample with a laser (532 nm) and detects the emitted fluorescent signal via a photomultiplier tube (PMT). We spotted droplets of our various strains on selective media plates which contained exactly 20mL of agar solution. The droplets were absorbed into the agar and the plates were incubated overnight before being imaged on the Typhoon Imager. Below is a list of the different constructs we imaged using this method.</p><br />
<br />
<br><br />
<br><br />
<table align="center" width="600" border="1"><br />
<tr><br />
<td>Construct</td><br />
<td>Purpose</td><br />
</tr><br />
<tr><br />
<td>TCC</td><br />
<td>Negative control for fluorescence</td><br />
</tr><br />
<tr><br />
<td>J23102-E0040-TCC</td><br />
<td>Positive control – test for translation of the target gene without the use of the TCC</td><br />
</tr><br />
<tr><br />
<td>J23102-Limonene synthase(Lims1)-TCC</td><br />
<td>Testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-Lims1-Stop codon(Stop)-TCC</td><br />
<td>Negative control for testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-Codon optimized(CO)-Lims1-TCC</td><br />
<td>Testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-CO-Lims1-Stop-TCC</td><br />
<td>Negative control for test of translation</td><br />
</tr><br />
<tr><br />
<td>J23102-E0840</td><br />
<td>Testing the amount of RFP signal and ensuring that we account for GFP fluorescence bleed-through into the RFP channel in our positive control construct</td><br />
</tr><br />
</table><br />
<br><br />
<br><br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/c/c7/UWMlimoneneRetent.png"><img src="https://static.igem.org/mediawiki/2012/c/c7/UWMlimoneneRetent.png" width="800"></a><br />
<br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">The J23102+E0040+TCC was used as a positive control to test the functionality of the translational coupling cassette. We used a green fluorescent protein (E0040) as our positive control because it was ideal to see if we were getting translation of a target gene without the use of the coupling cassette. Additionally, this part is well characterized and routinely used by many iGEM teams, suggesting it should not have any issues being fully translated. However, there was one drawback to using the GFP as our target gene; when scanning our samples in the Typhoon Imager, we noticed that the GFP only construct (J23100 + E0040) produced low levels of fluorescence intensity in the red fluorescent channel. This is not an uncommon problem when using fluorophores, particularly fluorescent proteins, and is due to bleed-through of the GFP fluorescent signal into the RFP emission channel. Thus, some of the red fluorescence signal produced by our positive control construct (J23102+E0040+TCC) was due to the GFP. This required us to account for the bleed-through to determine if the RFP signal from our GFP-TCC-RFP construct was really from the RFP reporter gene or was just bleed-through from the GFP. Figure below demonstrates that the signal intensity from the GFP-TCC-RFP construct is well above the signal produced from the GFP only strain, suggesting that our translational coupling cassette is working as intended. </p><br />
<br><br />
<br><br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/5/59/TCCBAR1.png"><img src="https://static.igem.org/mediawiki/2012/5/59/TCCBAR1.png" width="800"></a><br><br />
<br><br><br />
<br><br />
<br><br />
<br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/d/dc/TCCBAR2.png"><img src="https://static.igem.org/mediawiki/2012/d/dc/TCCBAR2.png" width="800"></a><br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">The codon optimized limonene synthase, with a stop codon located in the middle of the gene, was used as our negative control for the cassette. If translation is stopped partway through the target gene, the helicase activity on the ribosome will not break the hairpin and RFP will not be generated.</p><br />
<br />
<p align="left" class="classtheinlinecontent2">From this data, three things can be determined. First, the positive control is producing RFP, meaning the hairpin is being broken by the ribosome. Second, the construct containing a stop codon midway through the target gene is not generating RFP. This demonstrates that the hairpin stays intact when successful translation of the target gene does not occur. Third, the codon-optimized limonene synthase is being translated, and the non-codon optimized is not. The fluorescence produced by the codon-optimized construct is much lower than the positive control, but we cannot definitively explain this. </p><br />
<br />
<p align="left" class="classtheinlinecontent2">The second assay used to quantify fluorescence was done by using a 96-well plate reader. Optical densities and fluorescence were taken over a 24 period, and used to determine if our target gene was being translated. The same strains used in the Typhoon were tested using this method. Fluorescence was divided by optical density because all of the strains did not grow at the same rate. This allowed the normalization of fluorescence, and thus the quantification and comparison of it between strains. </p><br />
<br><br />
<br><br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/a/ac/UWMPLATEREADCHARLES.png"><img src="https://static.igem.org/mediawiki/2012/a/ac/UWMPLATEREADCHARLES.png" width="631" height="1644"></a><br />
<img src="https://static.igem.org/mediawiki/2012/0/00/UWMPLATEREADCHARLESCAP.png" width="400"><br />
<br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">This plot backs up the conclusions drawn from the Typhoon images. The translational coupling cassette produces RFP. The codon optimized limonene synthase seems to be translating more efficiently than the non-codon optimized version. In fact, the limonene synthase may not be translating at all. However, we still have not been able to detect any amount of limonene in our GC/MS assays. We were able to make amorphadiene, so we know that the mevalonate pathway works correctly up until the GPP synthase gene. From this point onwards, all we know is that the limonene synthase (now codon optimized) is being translated. From here, we would require more time and materials to fully troubleshoot why no limonene is being produced. We do have a few hypotheses, based on observations and information about this pathway. First, limonene synthase may be forming an inclusion body in the cell. Second, it is a possibility that GPP is not being produced, and we would require standards (which are quite expensive) and a new protocol to detect for it on the GC/MS. If we had these standards, we would also be able to try to purify limonene synthase using our TCC his-tagged version. This purified enzyme could then be doped with GPP, and hopefully create limonene. If this was the case, we would know that GPP is not being produced, or something is happening to the limonene synthase between translation and the active synthesis of limonene. Third, many of the molecules and enzymes in the mevalonate pathway can be toxic to Escherichia coli cells at high levels, including limonene.</p><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">How</span> to clone using the Translational Coupling Cassette</strong></p><br /><br />
<p align="left" class="classtheinlinecontent2">In order to use the translational coupling cassette, the target gene must be PCR amplified using BioFusion primers. If the gene is amplified using standard BioBrick primers, an open reading frame shift will occur, a premature stop codon will be formed, and the hairpin may not break. In addition to using BioFusion primers, the stop codon must also be taken out of the target gene being amplified for the same reason. If a stop codon prematurely stops translation, then the hairpin may not break and the response gene (RFP) will not be translated. As an example:</p><br />
<br><br />
<blockquote><br />
<p align="left" class="classtheinlinecontent">We cloned in the E0040 gene (GFP) into the TCC as the target gene. The first and last 30 base pairs of the E0840 ribosome binding site plus open reading frame (GFP) are as follows:</p><br />
</blockquote><br />
<br><br />
<div align="center" class="classtheinlinecontent"><br />
<ul>atgcgtaaaggagaagaacttttc</ul><br />
<ul>catggcatggatgaactatacaaataataa</ul><br />
<br><br />
<ul>The forward and reverse primers (respectively) would then have to be:<br><br />
</ul><br />
<ul><br />
5’ 3’<br />
</ul><br />
<ul>CCCCGAATTCGCGGCCGCTTCTAGAatgcgtaaaggagaagaacttttc</ul><br />
<ul><br />
5’ 3’<br />
</ul><br />
<ul>CCGCTACTAGTtttgtatagttcatccatgccatg</ul><br><br />
<br />
<ul>This PCR fragment would then have to be cut with EcoR1 and Spe1, while the translational coupling cassette should be cut with EcoR1 and Xba1.</ul><br />
<br><br />
</div><br />
<p align="left" class="classtheinlinecontent"><strong>Reference: </strong></p><br />
<div align="left" class="classtheinlinecontent"><br />
<ul>Chiral discrimination of limonene by use of beta-cyclodextrin-coated quartz-crystal-microbalances (QCMs) and data evaluation by artificial neuronal networks.</ul><br />
<ul>Fietzek et al., 2001</ul><br />
<br><br />
<ul>A translation-coupling DNA cassette for monitoring protein translation in bacteria</ul><br />
<ul>Pfleger et al., 2012</ul><br />
<br><br />
<br />
</div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/File:UWMlimoneneRetent.pngFile:UWMlimoneneRetent.png2012-10-03T20:46:05Z<p>Yamatanoorochi: </p>
<hr />
<div></div>Yamatanoorochihttp://2012.igem.org/File:UWMCapture.JPGFile:UWMCapture.JPG2012-10-03T20:35:32Z<p>Yamatanoorochi: </p>
<hr />
<div></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/SDFTeam:Wisconsin-Madison/SDF2012-10-03T19:59:38Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Translational Coupling – an explanation</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">Why</span> are we using translational coupling?</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">In the beginning of the summer our team’s initial goal was to produce limonene. After trying several different methods for the in vivo production using E. coli host strains we were unable to detect limonene. We hypothesized that a lack of fully translated limonene synthase was the culprit. The limonene synthase gene is not native to E. coli, which can cause problems with translation due to differing codon usage. To remedy this, we created a codon optimized limonene synthase and repeated the initial methods of limonene production. Again, we were unable to detect limonene. To test our initial hypothesis, we adopted a translational coupling cassette to determine if the limonene synthase gene was being fully translated.</p><br />
<br /><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">How</span> the translational coupling cassette works</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">The translational coupling cassette is designed to determine if a target gene is being fully translated. This is achieved by fusing a DNA sequence to the 5’ end of the open reading frame that forms an RNA hairpin structure following transcription. Embedded in this mRNA hairpin is a His-tag and a stop codon for the target gene followed by a ribosome binding site for a downstream reporter gene. In our construct, the reporter gene is red fluorescent protein BBa_E1010. If the upstream gene of interest is not being properly translated, the hairpin will remain intact and block the translation of the rfp reporter gene by occluding the RBS (Figure 1). However, if the 5’ gene of interest is being properly translated, the engineered hairpin is designed so that ribosomal helicase activity is sufficient to break the hairpin apart, enabling both complete translation of the gene of the target gene and allows access to the RBS of the reporter gene (Figure 2). This permits loading of a ribosome and translation of the reporter gene. This system allows a user to indirectly determine if their gene of interest is being fully translated; complete translation will yield a detectable amount of RFP – the reporter gene. </p><br />
<br><br />
<br /><br />
<a href="https://static.igem.org/mediawiki/2012/e/e0/TCC_all_in_one.png"><img src="https://static.igem.org/mediawiki/2012/e/e0/TCC_all_in_one.png" width="900"></a><br><br />
<br><br><br />
<br><br />
<br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">Assays</span> for the translational coupling cassette</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">Two primary assays used to characterize the fluorescence produced by the RFP reporter from the translational coupling cassette (TCC).The first was performed using a Typhoon Imager (GE Healthcare). This instrument excites a sample with a laser (532 nm) and detects the emitted fluorescent signal via a photomultiplier tube (PMT). We spotted droplets of our various strains on selective media plates which contained exactly 20mL of agar solution. The droplets were absorbed into the agar and the plates were incubated overnight before being imaged on the Typhoon Imager. Below is a list of the different constructs we imaged using this method.</p><br />
<br />
<br><br />
<br><br />
<table align="center" width="600" border="1"><br />
<tr><br />
<td>Construct</td><br />
<td>Purpose</td><br />
</tr><br />
<tr><br />
<td>TCC</td><br />
<td>Negative control for fluorescence</td><br />
</tr><br />
<tr><br />
<td>J23102-E0040-TCC</td><br />
<td>Positive control – test for translation of the target gene without the use of the TCC</td><br />
</tr><br />
<tr><br />
<td>J23102-Limonene synthase(Lims1)-TCC</td><br />
<td>Testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-Lims1-Stop codon(Stop)-TCC</td><br />
<td>Negative control for testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-Codon optimized(CO)-Lims1-TCC</td><br />
<td>Testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-CO-Lims1-Stop-TCC</td><br />
<td>Negative control for test of translation</td><br />
</tr><br />
<tr><br />
<td>J23102-E0840</td><br />
<td>Testing the amount of RFP signal and ensuring that we account for GFP fluorescence bleed-through into the RFP channel in our positive control construct</td><br />
</tr><br />
</table><br />
<p align="center">J23102 is a constitutive promoter; TCC stands for translational coupling cassette; E0040 is a GFP open reading frame; E0840 is a composite part containing an ribosome binding site, E0040 ORF, and a terminator. </p><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">The J23102+E0040+TCC was used as a positive control to test the functionality of the translational coupling cassette. We used a green fluorescent protein (E0040) as our positive control because it was ideal to see if we were getting translation of a target gene without the use of the coupling cassette. Additionally, this part is well characterized and routinely used by many iGEM teams, suggesting it should not have any issues being fully translated. However, there was one drawback to using the GFP as our target gene; when scanning our samples in the Typhoon Imager, we noticed that the GFP only construct (J23100 + E0040) produced low levels of fluorescence intensity in the red fluorescent channel. This is not an uncommon problem when using fluorophores, particularly fluorescent proteins, and is due to bleed-through of the GFP fluorescent signal into the RFP emission channel. Thus, some of the red fluorescence signal produced by our positive control construct (J23102+E0040+TCC) was due to the GFP. This required us to account for the bleed-through to determine if the RFP signal from our GFP-TCC-RFP construct was really from the RFP reporter gene or was just bleed-through from the GFP. Figure below demonstrates that the signal intensity from the GFP-TCC-RFP construct is well above the signal produced from the GFP only strain, suggesting that our translational coupling cassette is working as intended. </p><br />
<br><br />
<br><br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/5/59/TCCBAR1.png"><img src="https://static.igem.org/mediawiki/2012/5/59/TCCBAR1.png" width="800"></a><br><br />
<br><br><br />
<br><br />
<br><br />
<br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/d/dc/TCCBAR2.png"><img src="https://static.igem.org/mediawiki/2012/d/dc/TCCBAR2.png" width="800"></a><br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">The codon optimized limonene synthase, with a stop codon located in the middle of the gene, was used as our negative control for the cassette. If translation is stopped partway through the target gene, the helicase activity on the ribosome will not break the hairpin and RFP will not be generated.</p><br />
<i> -Typhoon graphic (Matt) </i><br />
<p align="left" class="classtheinlinecontent2">From this data, three things can be determined. First, the positive control is producing RFP, meaning the hairpin is being broken by the ribosome. Second, the construct containing a stop codon midway through the target gene is not generating RFP. This demonstrates that the hairpin stays intact when successful translation of the target gene does not occur. Third, the codon-optimized limonene synthase is being translated, and the non-codon optimized is not. The fluorescence produced by the codon-optimized construct is much lower than the positive control, but we cannot definitively explain this. </p><br />
<br />
<p align="left" class="classtheinlinecontent2">The second assay used to quantify fluorescence was done by using a 96-well plate reader. Optical densities and fluorescence were taken over a 24 period, and used to determine if our target gene was being translated. The same strains used in the Typhoon were tested using this method. Fluorescence was divided by optical density because all of the strains did not grow at the same rate. This allowed the normalization of fluorescence, and thus the quantification and comparison of it between strains. </p><br />
<br><br />
<br><br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/a/ac/UWMPLATEREADCHARLES.png"><img src="https://static.igem.org/mediawiki/2012/a/ac/UWMPLATEREADCHARLES.png" width="631" height="1644"></a><br />
<img src="https://static.igem.org/mediawiki/2012/0/00/UWMPLATEREADCHARLESCAP.png" width="400"><br />
<br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">This plot backs up the conclusions drawn from the Typhoon images. The translational coupling cassette produces RFP. The codon optimized limonene synthase seems to be translating more efficiently than the non-codon optimized version. In fact, the limonene synthase may not be translating at all. However, we still have not been able to detect any amount of limonene in our GC/MS assays. We were able to make amorphadiene, so we know that the mevalonate pathway works correctly up until the GPP synthase gene. From this point onwards, all we know is that the limonene synthase (now codon optimized) is being translated. From here, we would require more time and materials to fully troubleshoot why no limonene is being produced. We do have a few hypotheses, based on observations and information about this pathway. First, limonene synthase may be forming an inclusion body in the cell. Second, it is a possibility that GPP is not being produced, and we would require standards (which are quite expensive) and a new protocol to detect for it on the GC/MS. If we had these standards, we would also be able to try to purify limonene synthase using our TCC his-tagged version. This purified enzyme could then be doped with GPP, and hopefully create limonene. If this was the case, we would know that GPP is not being produced, or something is happening to the limonene synthase between translation and the active synthesis of limonene. Third, many of the molecules and enzymes in the mevalonate pathway can be toxic to Escherichia coli cells at high levels, including limonene.</p><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">How</span> to clone using the Translational Coupling Cassette</strong></p><br /><br />
<p align="left" class="classtheinlinecontent2">In order to use the translational coupling cassette, the target gene must be PCR amplified using BioFusion primers. If the gene is amplified using standard BioBrick primers, an open reading frame shift will occur, a premature stop codon will be formed, and the hairpin may not break. In addition to using BioFusion primers, the stop codon must also be taken out of the target gene being amplified for the same reason. If a stop codon prematurely stops translation, then the hairpin may not break and the response gene (RFP) will not be translated. As an example:</p><br />
<br><br />
<blockquote><br />
<p align="left" class="classtheinlinecontent">We cloned in the E0040 gene (GFP) into the TCC as the target gene. The first and last 30 base pairs of the E0840 ribosome binding site plus open reading frame (GFP) are as follows:</p><br />
</blockquote><br />
<br><br />
<div align="center" class="classtheinlinecontent"><br />
<ul>atgcgtaaaggagaagaacttttc</ul><br />
<ul>catggcatggatgaactatacaaataataa</ul><br />
<br><br />
<ul>The forward and reverse primers (respectively) would then have to be:<br><br />
</ul><br />
<ul><br />
5’ 3’<br />
</ul><br />
<ul>CCCCGAATTCGCGGCCGCTTCTAGAatgcgtaaaggagaagaacttttc</ul><br />
<ul><br />
5’ 3’<br />
</ul><br />
<ul>CCGCTACTAGTtttgtatagttcatccatgccatg</ul><br><br />
<br />
<ul>This PCR fragment would then have to be cut with EcoR1 and Spe1, while the translational coupling cassette should be cut with EcoR1 and Xba1.</ul><br />
<br><br />
</div><br />
<p align="left" class="classtheinlinecontent"><strong>Reference: </strong></p><br />
<div align="left" class="classtheinlinecontent"><br />
<ul>Chiral discrimination of limonene by use of beta-cyclodextrin-coated quartz-crystal-microbalances (QCMs) and data evaluation by artificial neuronal networks.</ul><br />
<ul>Fietzek et al., 2001</ul><br />
<br><br />
<ul>A translation-coupling DNA cassette for monitoring protein translation in bacteria</ul><br />
<ul>Pfleger et al., 2012</ul><br />
<br><br />
<br />
</div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/Team:Wisconsin-Madison/SDFTeam:Wisconsin-Madison/SDF2012-10-03T19:55:31Z<p>Yamatanoorochi: </p>
<hr />
<div>{{Template:Wisconsin-Madison}}<br />
<html><br />
<br />
<br />
<!--end of the navigation menubar!--><br />
<br />
<br />
</div><br />
<div id = "divthecontent"><br />
<br><br />
<p align="left" class="classtheinlinecontent"><strong style="font-size:25px; color: rgb(183, 1, 1);">Translational Coupling – an explanation</strong></p><br />
</br><br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">Why</span> are we using translational coupling?</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">In the beginning of the summer our team’s initial goal was to produce limonene. After trying several different methods for the in vivo production using E. coli host strains we were unable to detect limonene. We hypothesized that a lack of fully translated limonene synthase was the culprit. The limonene synthase gene is not native to E. coli, which can cause problems with translation due to differing codon usage. To remedy this, we created a codon optimized limonene synthase and repeated the initial methods of limonene production. Again, we were unable to detect limonene. To test our initial hypothesis, we adopted a translational coupling cassette to determine if the limonene synthase gene was being fully translated.</p><br />
<br /><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">How</span> the translational coupling cassette works</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">The translational coupling cassette is designed to determine if a target gene is being fully translated. This is achieved by fusing a DNA sequence to the 5’ end of the open reading frame that forms an RNA hairpin structure following transcription. Embedded in this mRNA hairpin is a His-tag and a stop codon for the target gene followed by a ribosome binding site for a downstream reporter gene. In our construct, the reporter gene is red fluorescent protein BBa_E1010. If the upstream gene of interest is not being properly translated, the hairpin will remain intact and block the translation of the rfp reporter gene by occluding the RBS (Figure 1). However, if the 5’ gene of interest is being properly translated, the engineered hairpin is designed so that ribosomal helicase activity is sufficient to break the hairpin apart, enabling both complete translation of the gene of the target gene and allows access to the RBS of the reporter gene (Figure 2). This permits loading of a ribosome and translation of the reporter gene. This system allows a user to indirectly determine if their gene of interest is being fully translated; complete translation will yield a detectable amount of RFP – the reporter gene. </p><br />
<br><br />
<br /><br />
<a href="https://static.igem.org/mediawiki/2012/e/e0/TCC_all_in_one.png"><img src="https://static.igem.org/mediawiki/2012/e/e0/TCC_all_in_one.png" width="900"></a><br><br />
<br><br><br />
<br><br />
<br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">Assays</span> for the translational coupling cassette</strong></p><br /><br />
<br />
<p align="left" class="classtheinlinecontent2">Two primary assays used to characterize the fluorescence produced by the RFP reporter from the translational coupling cassette (TCC).The first was performed using a Typhoon Imager (GE Healthcare). This instrument excites a sample with a laser (532 nm) and detects the emitted fluorescent signal via a photomultiplier tube (PMT). We spotted droplets of our various strains on selective media plates which contained exactly 20mL of agar solution. The droplets were absorbed into the agar and the plates were incubated overnight before being imaged on the Typhoon Imager. Below is a list of the different constructs we imaged using this method.</p><br />
<br />
<br><br />
<br><br />
<table align="center" width="600" border="1"><br />
<tr><br />
<td>Construct</td><br />
<td>Purpose</td><br />
</tr><br />
<tr><br />
<td>TCC</td><br />
<td>Negative control for fluorescence</td><br />
</tr><br />
<tr><br />
<td>J23102-E0040-TCC</td><br />
<td>Positive control – test for translation of the target gene without the use of the TCC</td><br />
</tr><br />
<tr><br />
<td>J23102-Limonene synthase(Lims1)-TCC</td><br />
<td>Testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-Lims1-Stop codon(Stop)-TCC</td><br />
<td>Negative control for testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-Codon optimized(CO)-Lims1-TCC</td><br />
<td>Testing translation</td><br />
</tr><br />
<tr><br />
<td>J23102-CO-Lims1-Stop-TCC</td><br />
<td>Negative control for test of translation</td><br />
</tr><br />
<tr><br />
<td>J23102-E0840</td><br />
<td>Testing the amount of RFP signal and ensuring that we account for GFP fluorescence bleed-through into the RFP channel in our positive control construct</td><br />
</tr><br />
</table><br />
<p align="center">J23102 is a constitutive promoter; TCC stands for translational coupling cassette; E0040 is a GFP open reading frame; E0840 is a composite part containing an ribosome binding site, E0040 ORF, and a terminator. </p><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">The J23102+E0040+TCC was used as a positive control to test the functionality of the translational coupling cassette. We used a green fluorescent protein (E0040) as our positive control because it was ideal to see if we were getting translation of a target gene without the use of the coupling cassette. Additionally, this part is well characterized and routinely used by many iGEM teams, suggesting it should not have any issues being fully translated. However, there was one drawback to using the GFP as our target gene; when scanning our samples in the Typhoon Imager, we noticed that the GFP only construct (J23100 + E0040) produced low levels of fluorescence intensity in the red fluorescent channel. This is not an uncommon problem when using fluorophores, particularly fluorescent proteins, and is due to bleed-through of the GFP fluorescent signal into the RFP emission channel. Thus, some of the red fluorescence signal produced by our positive control construct (J23102+E0040+TCC) was due to the GFP. This required us to account for the bleed-through to determine if the RFP signal from our GFP-TCC-RFP construct was really from the RFP reporter gene or was just bleed-through from the GFP. Figure below demonstrates that the signal intensity from the GFP-TCC-RFP construct is well above the signal produced from the GFP only strain, suggesting that our translational coupling cassette is working as intended. </p><br />
<br><br />
<br><br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/5/59/TCCBAR1.png"><img src="https://static.igem.org/mediawiki/2012/5/59/TCCBAR1.png" width="800"></a><br><br />
<br><br><br />
<br><br />
<br><br />
<br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/d/dc/TCCBAR2.png"><img src="https://static.igem.org/mediawiki/2012/d/dc/TCCBAR2.png" width="800"></a><br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">The codon optimized limonene synthase, with a stop codon located in the middle of the gene, was used as our negative control for the cassette. If translation is stopped partway through the target gene, the helicase activity on the ribosome will not break the hairpin and RFP will not be generated.</p><br />
<i> -Typhoon graphic (Matt) </i><br />
<p align="left" class="classtheinlinecontent2">From this data, three things can be determined. First, the positive control is producing RFP, meaning the hairpin is being broken by the ribosome. Second, the construct containing a stop codon midway through the target gene is not generating RFP. This demonstrates that the hairpin stays intact when successful translation of the target gene does not occur. Third, the codon-optimized limonene synthase is being translated, and the non-codon optimized is not. The fluorescence produced by the codon-optimized construct is much lower than the positive control, but we cannot definitively explain this. </p><br />
<br />
<p align="left" class="classtheinlinecontent2">The second assay used to quantify fluorescence was done by using a 96-well plate reader. Optical densities and fluorescence were taken over a 24 period, and used to determine if our target gene was being translated. The same strains used in the Typhoon were tested using this method. Fluorescence was divided by optical density because all of the strains did not grow at the same rate. This allowed the normalization of fluorescence, and thus the quantification and comparison of it between strains. </p><br />
<br><br />
<br><br />
<br><br />
<a href="https://static.igem.org/mediawiki/2012/a/ac/UWMPLATEREADCHARLES.png"><img src="https://static.igem.org/mediawiki/2012/a/ac/UWMPLATEREADCHARLES.png" width="631" height="1644"></a><br />
<img src="https://static.igem.org/mediawiki/2012/0/00/UWMPLATEREADCHARLESCAP.png" width="562" height="322"><br />
<br><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent2">This plot backs up the conclusions drawn from the Typhoon images. The translational coupling cassette produces RFP. The codon optimized limonene synthase seems to be translating more efficiently than the non-codon optimized version. In fact, the limonene synthase may not be translating at all. However, we still have not been able to detect any amount of limonene in our GC/MS assays. We were able to make amorphadiene, so we know that the mevalonate pathway works correctly up until the GPP synthase gene. From this point onwards, all we know is that the limonene synthase (now codon optimized) is being translated. From here, we would require more time and materials to fully troubleshoot why no limonene is being produced. We do have a few hypotheses, based on observations and information about this pathway. First, limonene synthase may be forming an inclusion body in the cell. Second, it is a possibility that GPP is not being produced, and we would require standards (which are quite expensive) and a new protocol to detect for it on the GC/MS. If we had these standards, we would also be able to try to purify limonene synthase using our TCC his-tagged version. This purified enzyme could then be doped with GPP, and hopefully create limonene. If this was the case, we would know that GPP is not being produced, or something is happening to the limonene synthase between translation and the active synthesis of limonene. Third, many of the molecules and enzymes in the mevalonate pathway can be toxic to Escherichia coli cells at high levels, including limonene.</p><br />
<br><br />
<br><br />
<br />
<p align="left" class="classtheinlinecontent"><strong><span style="font-size:24px">How</span> to clone using the Translational Coupling Cassette</strong></p><br /><br />
<p align="left" class="classtheinlinecontent2">In order to use the translational coupling cassette, the target gene must be PCR amplified using BioFusion primers. If the gene is amplified using standard BioBrick primers, an open reading frame shift will occur, a premature stop codon will be formed, and the hairpin may not break. In addition to using BioFusion primers, the stop codon must also be taken out of the target gene being amplified for the same reason. If a stop codon prematurely stops translation, then the hairpin may not break and the response gene (RFP) will not be translated. As an example:</p><br />
<br><br />
<blockquote><br />
<p align="left" class="classtheinlinecontent">We cloned in the E0040 gene (GFP) into the TCC as the target gene. The first and last 30 base pairs of the E0840 ribosome binding site plus open reading frame (GFP) are as follows:</p><br />
</blockquote><br />
<br><br />
<div align="center" class="classtheinlinecontent"><br />
<ul>atgcgtaaaggagaagaacttttc</ul><br />
<ul>catggcatggatgaactatacaaataataa</ul><br />
<br><br />
<ul>The forward and reverse primers (respectively) would then have to be:<br><br />
</ul><br />
<ul><br />
5’ 3’<br />
</ul><br />
<ul>CCCCGAATTCGCGGCCGCTTCTAGAatgcgtaaaggagaagaacttttc</ul><br />
<ul><br />
5’ 3’<br />
</ul><br />
<ul>CCGCTACTAGTtttgtatagttcatccatgccatg</ul><br><br />
<br />
<ul>This PCR fragment would then have to be cut with EcoR1 and Spe1, while the translational coupling cassette should be cut with EcoR1 and Xba1.</ul><br />
<br><br />
</div><br />
<p align="left" class="classtheinlinecontent"><strong>Reference: </strong></p><br />
<div align="left" class="classtheinlinecontent"><br />
<ul>Chiral discrimination of limonene by use of beta-cyclodextrin-coated quartz-crystal-microbalances (QCMs) and data evaluation by artificial neuronal networks.</ul><br />
<ul>Fietzek et al., 2001</ul><br />
<br><br />
<ul>A translation-coupling DNA cassette for monitoring protein translation in bacteria</ul><br />
<ul>Pfleger et al., 2012</ul><br />
<br><br />
<br />
</div><br />
</div><br />
<!--div close the content!--><br />
<br />
<div id = "divthelowbanner"><br />
<img src="http://vtb.bme.wisc.edu/image/temp/iGEMFooter2.png" width="960"></div><br />
<br />
</center><br />
<br />
</div> <!--close div container!--><br />
<br />
</html></div>Yamatanoorochihttp://2012.igem.org/File:UWMPLATEREADCHARLESCAP.pngFile:UWMPLATEREADCHARLESCAP.png2012-10-03T19:54:58Z<p>Yamatanoorochi: </p>
<hr />
<div></div>Yamatanoorochihttp://2012.igem.org/File:UWMPLATEREADCHARLES.pngFile:UWMPLATEREADCHARLES.png2012-10-03T19:50:58Z<p>Yamatanoorochi: </p>
<hr />
<div></div>Yamatanoorochi