http://2012.igem.org/wiki/index.php?title=Special:Contributions/Smile&feed=atom&limit=50&target=Smile&year=&month=2012.igem.org - User contributions [en]2024-03-28T12:40:51ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/File:PZCH.pngFile:PZCH.png2012-10-27T03:06:19Z<p>Smile: </p>
<hr />
<div></div>Smilehttp://2012.igem.org/File:PZCM.pngFile:PZCM.png2012-10-27T03:04:53Z<p>Smile: </p>
<hr />
<div></div>Smilehttp://2012.igem.org/File:FB.pngFile:FB.png2012-10-27T02:54:17Z<p>Smile: </p>
<hr />
<div></div>Smilehttp://2012.igem.org/File:FA.pngFile:FA.png2012-10-27T02:53:23Z<p>Smile: </p>
<hr />
<div></div>Smilehttp://2012.igem.org/File:D0.pngFile:D0.png2012-10-27T02:52:12Z<p>Smile: </p>
<hr />
<div></div>Smilehttp://2012.igem.org/Team:ZJU-China/humanpractice.htmTeam:ZJU-China/humanpractice.htm2012-09-26T22:22:16Z<p>Smile: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" class="cufon-active cufon-ready"><head><meta http-equiv="Content-Type" content="text/html; charset=UTF-8"><br />
<br />
<title>HUMAN PRACTICE</title><br />
<meta name="description" content=""><br />
<meta name="keywords" content=""><br />
<link rel="shortcut icon" type="image/vnd.microsoft.icon" href=""><br />
<link href="http://www.jiajunlu.com/igem/style.css" rel="stylesheet" type="text/css"><br />
<br />
<style type="text/css"><br />
body /* UltraGlobal Environment (origin item) */<br />
{<br />
background-color: #F8F8F8;<br />
}<br />
#blank ,<br />
#blank *<br />
{<br />
background-color: transparent;<br />
background-image: url("");<br />
border-style: none;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
<br />
#globalWrapper /* Global Environment (origin item) */<br />
{<br />
background-color: transparent;<br />
background-attachment: fixed;<br />
background-position: 50% 0;<br />
background-repeat: no-repeat;<br />
background-image: url("");<br />
overflow: hidden;<br />
}<br />
<br />
/* Remove Top Item (origin item) */<br />
#top-section<br />
{<br />
height: 0px;<br />
width: 100%;<br />
}<br />
#p-logo {<br />
display: none;<br />
}<br />
#top<br />
{<br />
display: none;<br />
}<br />
h1.firstHeading<br />
{<br />
display: none;<br />
}<br />
<br />
/* Inner Environment (origin item) */<br />
#content<br />
{<br />
background-color: transparent;<br />
background-image: url("https://static.igem.org/mediawiki/2012/e/e5/Zju_back.jpg");<br />
background-attachment: scroll;<br />
background-position: 50% 0;<br />
background-repeat: repeat-y;<br />
overflow: hidden;<br />
border-style: none;<br />
width: 100%;<br />
}<br />
#footer-box<br />
{<br />
background-color: #F8F8F8;<br />
background-image: none;<br />
border-style: none;<br />
margin-top: 100px;<br />
}<br />
#catlinks<br />
{<br />
display: none;<br />
}<br />
#content a,<br />
#content a:hover<br />
{<br />
color: black;<br />
display: inline;<br />
}<br />
#content a:link,<br />
#content a:visited<br />
{<br />
text-decoration: none;<br />
}<br />
#content a:hover,<br />
#content a:active<br />
{<br />
text-decoration: underline;<br />
}<br />
<br />
/* Bottom Environment (origin item) */<br />
#footer-box a,<br />
#footer-box a:hover<br />
{<br />
color: #e8e7b9;<br />
text-decoration: none;<br />
display: inline;<br />
}<br />
<br />
ul<br />
{<br />
list-style-image: none;<br />
list-style-type: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
li<br />
{<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
p<br />
{<br />
font-family: Arial, sans-serif;<br />
color: black;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
/* Common Environment */<br />
.center<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
}<br />
.floatL<br />
{<br />
float: left;<br />
clear: left;<br />
}<br />
.floatR<br />
{<br />
float: right;<br />
clear: right;<br />
}<br />
.floatC<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
float: none;<br />
clear: both;<br />
}<br />
.blank<br />
{<br />
filter: Alpha(Opacity=0%);<br />
-moz-opacity: 0;<br />
opacity: 0;<br />
}<br />
.hidden<br />
{<br />
display: none;<br />
}<br />
.show<br />
{<br />
display: block;<br />
}<br />
.show-text<br />
{<br />
display: inline;<br />
}<br />
.button img<br />
{<br />
display: block;<br />
}<br />
<br />
ul.horizontal > li<br />
{<br />
display: block;<br />
float: left;<br />
clear: none;<br />
overflow: hidden;<br />
}<br />
ul.vertical > li<br />
{<br />
display: block;<br />
float: left;<br />
clear: both;<br />
overflow: hidden;<br />
}<br />
<br />
#search-controls<br />
{<br />
display: none;<br />
}<br />
<br />
#footer-box<br />
{<br />
display: none;<br />
}<br />
<br />
#banner {<br />
position: relative;<br />
width: 500px;<br />
height: 330px;<br />
overflow: hidden;<br />
}<br />
<br />
#banner_list img {<br />
border: 0px;<br />
}<br />
<br />
#banner_bg {<br />
position: absolute;<br />
bottom: 20px;<br />
background-color: #000;<br />
height: 44px;<br />
filter: Alpha(Opacity = 1);<br />
opacity: 0.01;<br />
z-index: 1000;<br />
cursor: pointer;<br />
width: 500px;<br />
}<br />
<br />
#banner_info {<br />
position: absolute;<br />
bottom: 20px;<br />
left: 1px;<br />
height: 44px;<br />
color: #fff;<br />
z-index: 1001;<br />
cursor: pointer<br />
}<br />
<br />
#banner_text {<br />
position: absolute;<br />
width: 120px;<br />
z-index: 1002;<br />
right: 3px;<br />
bottom: 3px;<br />
}<br />
<br />
#banner ul {<br />
position: absolute;<br />
list-style-type: none;<br />
filter: Alpha(Opacity = 80);<br />
opacity: 0.8;<br />
border: 1px solid #fff;<br />
z-index: 1002;<br />
margin: 0;<br />
padding: 0;<br />
bottom: 3px;<br />
right: 5px;<br />
}<br />
<br />
#banner ul li {<br />
padding: 0px 8px;<br />
float: left;<br />
display: block;<br />
color: #FFF;<br />
border: #e5eaff 1px solid;<br />
background: #6f4f67;<br />
cursor: pointer<br />
<br />
#banner1 {<br />
position: relative;<br />
left: 10%;<br />
width: 561px;<br />
height: 485px;<br />
border: 1px solid #666;<br />
overflow: hidden;<br />
}<br />
<br />
#banner_list1 img {<br />
border: 0px;<br />
}<br />
<br />
#banner_info1 {<br />
position: absolute;<br />
bottom: 20px;<br />
left: 5px;<br />
height: 44px;<br />
color: #fff;<br />
z-index: 1001;<br />
cursor: pointer<br />
}<br />
<br />
#banner1 ul {<br />
position: absolute;<br />
list-style-type: none;<br />
filter: Alpha(Opacity = 80);<br />
opacity: 0.8;<br />
border: 1px solid #fff;<br />
z-index: 1002;<br />
margin: 0;<br />
padding: 0;<br />
bottom: 3px;<br />
right: 5px;<br />
}<br />
<br />
#banner1 ul li {<br />
padding: 0px 8px;<br />
float: left;<br />
display: block;<br />
color: #FFF;<br />
border: #e5eaff 1px solid;<br />
background: #6f4f67;<br />
cursor: pointer<br />
}<br />
<br />
#banner1 ul li.on {<br />
background: #900<br />
}<br />
<br />
#banner_list1 a {<br />
position: absolute;<br />
}<br />
<br />
#banner2 {<br />
position: relative;<br />
left: 10%;<br />
width: 561px;<br />
height: 485px;<br />
border: 1px solid #666;<br />
overflow: hidden;<br />
}<br />
<br />
#banner_list2 img {<br />
border: 0px;<br />
}<br />
<br />
#banner_info2 {<br />
position: absolute;<br />
bottom: 20px;<br />
left: 5px;<br />
height: 44px;<br />
color: #fff;<br />
z-index: 1001;<br />
cursor: pointer<br />
}<br />
<br />
#banner2 ul {<br />
position: absolute;<br />
list-style-type: none;<br />
filter: Alpha(Opacity = 80);<br />
opacity: 0.8;<br />
border: 1px solid #fff;<br />
z-index: 1002;<br />
margin: 0;<br />
padding: 0;<br />
bottom: 3px;<br />
right: 5px;<br />
}<br />
<br />
#banner2 ul li {<br />
padding: 0px 8px;<br />
float: left;<br />
display: block;<br />
color: #FFF;<br />
border: #e5eaff 1px solid;<br />
background: #6f4f67;<br />
cursor: pointer<br />
}<br />
<br />
#banner2 ul li.on {<br />
background: #900<br />
}<br />
<br />
#banner_list2 a {<br />
position: absolute;<br />
}<br />
<br />
}<br />
<br />
</style><br />
<br />
<script src="http://www.jiajunlu.com/igem/cufon-yui.js" type="text/javascript"></script><style type="text/css">cufon{text-indent:0!important;}@media screen,projection{cufon{display:inline!important;display:inline-block!important;position:relative!important;vertical-align:middle!important;font-size:1px!important;line-height:1px!important;}cufon cufontext{display:-moz-inline-box!important;display:inline-block!important;width:0!important;height:0!important;overflow:hidden!important;text-indent:-10000in!important;}cufon canvas{position:relative!important;}}@media print{cufon{padding:0!important;}cufon canvas{display:none!important;}}</style><br />
<script src="http://www.jiajunlu.com/igem/gotham.js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
Cufon.replace('h3');<br />
<br />
<br />
</script><br />
<link rel="stylesheet" href="http://www.jiajunlu.com/igem/slide.css" type="text/css" media="screen"><br />
<link rel="stylesheet" href="http://www.jiajunlu.com/igem/accordion.css" type="text/css" media="screen"><br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
<br />
//Hide (Collapse) the toggle containers on load<br />
$(".acc_container").hide(); <br />
//Switch the "Open" and "Close" state per click then slide up/down (depending on open/close state)<br />
$("h2.acc_trigger").click(function(){<br />
$(this).toggleClass("active").next().slideToggle("slow");<br />
<br />
return false; //Prevent the browser jump to the link anchor<br />
});<br />
<br />
});<br />
</script><br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/my.js"></script><br />
<script src="http://www.jiajunlu.com/igem/slide.js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
function movetotop(){<br />
$("html, body").animate({ scrollTop: 0 }, "slow");<br />
return false;<br />
}<br />
$(function() {<br />
var offset = $("#logo").offset();<br />
var topPadding = 15;<br />
$(window).scroll(function() {<br />
if ($(window).scrollTop() > offset.top) {<br />
$("#logo").stop().animate({<br />
marginTop: $(window).scrollTop() - offset.top + topPadding<br />
});<br />
} else {<br />
$("#logo").stop().animate({<br />
marginTop: 0<br />
});<br />
};<br />
});<br />
});<br />
</script><br />
</head><br />
<body class="work"><br />
<br />
<div class="wrapper"><br />
<div class="container"><br />
<div class="content"><br />
<div id="columnLeft"><br />
<div id="logo" style="margin-top: 0px; " onclick="movetotop()"><br />
<a><img src="https://static.igem.org/mediawiki/2012/1/12/Zju_logo.png"></a><br />
<!-- end #logo --></div><br />
<!-- end #columnLeft" --></div><br />
<div id="columnRight"><br />
<div id="header"><br />
<div id="menu"><br />
<ul id="menu"><br />
<li class="1"><a href="https://2012.igem.org/Team:ZJU-China"><img src="http://www.jiajunlu.com/igem/home_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="2"><a href="https://2012.igem.org/Team:ZJU-China/aboutus.htm"><img src="http://www.jiajunlu.com/igem/aboutus_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="3"><a href="https://2012.igem.org/Team:ZJU-China/project.htm"><img src="http://www.jiajunlu.com/igem/project_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="4"><a href="https://2012.igem.org/Team:ZJU-China/models.htm"><img src="http://www.jiajunlu.com/igem/Zju_models_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="5"><a href="https://2012.igem.org/Team:ZJU-China/notebook.htm"><img src="http://www.jiajunlu.com/igem/notebook_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="6"><a href="https://2012.igem.org/Team:ZJU-China/humanpractice.htm"><img src="http://www.jiajunlu.com/igem/humanpractice_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="7"><a href="https://2012.igem.org/Team:ZJU-China/safty.htm"><img src="http://www.jiajunlu.com/igem/safty_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="8"><a href="https://2012.igem.org/Team:ZJU-China/achievement.htm"><img src="http://www.jiajunlu.com/igem/achievement_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="8"><a href="https://2012.igem.org"><img src="http://www.jiajunlu.com/igem/Zju_igem_btn.gif"></a></li><br />
<br />
</ul><br />
<!-- end #menu --></div><br />
<!-- end #header --></div><br />
<br />
<div id="main"><br />
<h2 class="acc_trigger">01 <strong>AT A GLANCE</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<p align="justify">This year, ZJU-China brainstormed so many fascinating ideas about human practice. Actually, thinking about creative human practices becomes the most effective way to bring joy and laughter to our discussions as well as our lab life. In fact, though all the brilliant ideas from our HP creative idea workshop, we discover the true inner beauty of iGEM, which is, being ethical, being versatile, and being creative.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">This year, ZJU-China aims to be different. So, don’t hesitate to join our journey with a view of fantastic iGEM human practices.</p><br />
<br />
<br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">02 <strong>EXPERIENCE A REAL IGEM</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div class="projectNav"><br />
<p align="justify">This year, ZJU-China made full use of our Synthetic Biology Club. We recruited 60 members throughout the campus. They are coming from different majors. We have members from mathematics, computer science, biotechnology, agriculture, food science, clinical medicine, bioinformatics, Polymer materials science and engineering, Plant protection, Geographic Information Systems, Optical Engineering, Accounting, Business, Electrical Engineering and Automation, Energy and Environmental Engineering, Tea Science, Chemistry. And all of them participate in our annual experiencing iGEM activity, namely, ZJU Jamboree. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">This year, ZJU-China did a few lectures to widespread the value of iGEM, participated in some scientific activities to display our projects and gain funding ourselves, put special highlight on our high school friends, provided opportunities to others who are interested in experience a real iGEM lab life.</p><br />
<p align="justify">&nbsp;</p><br />
<br />
<div class="projectNavFloat"><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/hp_s2_1.htm">1.Synthetic Biology Club</a><br />
<br><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/hp_s2_2.htm">2.ZJU Jamboree</a><br />
<br />
</div><!-- end .projectNavFloat --> <br />
<div class="projectNavFloat"><br />
<br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/hp_s2_3.htm">3.Lectures</a><br />
<br><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/hp_s2_4.htm">4.Other Scientific Activities</a><br />
<br />
</div><!-- end .projectNavFloat --><br />
<br class="clearfloat"><br />
</div><!-- end .projectNav --><br />
<br />
<iframe src="" frameborder="0" name="brainFrame" width="100%" height="500px"> </iframe> <br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">03 <strong>EXPLORE A NEW IGEM</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div class="projectNav"><br />
<p align="justify">This year, ZJU-China had tremendous interesting ideas about human practice and actually did research about it. With the spirit of share and fun, here comes our HP creative idea workshop, aiming to provide brilliant and workable thoughts about iGEM human practice for future teams, and trying to develop insights of a real effective human practice. Needless to say, we even try some ideas of our workshop. Well, it went well!</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Let’s take a look at what we tried this year! ZJU-China held a special event called "Scaffold in your eyes" in campus, and attracted a lot of attention. ZJU-China created a cute love story to illustrate our main idea of project, then we made an animation of this story, "a love story between Syn & Bio", in which we even create our own song. It is so interesting and so fun, definitely worth seeing! Additionally, ZJU-China thought ethical thinking is also crucial, and apart from the safety sheet we undergraduate researchers have to think about, we left the question directly to our freshmen in their first English Speech Contest.</p><br />
<script type="text/javascript"><br />
var t = n = 0, count;<br />
$(document).ready(function(){ <br />
counta=$("#banner_list a").length;<br />
$("#banner_list a:not(:first-child)").hide();<br />
$("#banner_info").html($("#banner_list a:first-child").find("img").attr('alt'));<br />
$("#banner_info").click(function(){window.open($("#banner_list a:first-child").attr('href'), "_blank")});<br />
$("#banner li").click(function() {<br />
var i = $(this).text() - 1;//1,2,3,4<br />
n = i;<br />
if (i >= counta) return;<br />
$("#banner_info").html($("#banner_list a").eq(i).find("img").attr('alt'));<br />
$("#banner_info").unbind().click(function(){window.open($("#banner_list a").eq(i).attr('href'), "_blank")})<br />
$("#banner_list a").filter(":visible").fadeOut(500).parent().children().eq(i).fadeIn(1000);<br />
document.getElementById("banner").style.background="";<br />
$(this).toggleClass("on");<br />
$(this).siblings().removeAttr("class");<br />
});<br />
<br />
})<br />
<br />
<br />
</script><br />
<div id="banner"><br />
<div id="banner_bg"></div><br />
<div id="banner_info"></div><br />
<ul><br />
<li class="on">1</li><br />
<li>2</li><br />
<li>3</li><br />
<li>4</li><br />
<li>5</li><br />
</ul><br />
<div id="banner_list"><a href="#" target="_blank"><img<br />
src="https://static.igem.org/mediawiki/igem.org/a/ad/Zju_newigem1.JPG" width="500px"<br />
title="" alt="" /></a><br />
<a href="#" target="_blank"><img<br />
src="https://static.igem.org/mediawiki/igem.org/c/ce/Zju_newigem2.JPG"<br />
title="" alt="" width="500px" /></a> <a href="#"<br />
target="_blank"><img<br />
src="https://static.igem.org/mediawiki/igem.org/f/fd/Zju_newigem3.JPG" width="500px"<br />
title="" alt="" /></a><br />
<a href="#" target="_blank"><img<br />
src="https://static.igem.org/mediawiki/igem.org/a/a3/Zju_newigem4.JPG" width="500px"<br />
alt="" title="" /></a><br />
<a href="#" target="_blank"><img<br />
src="https://static.igem.org/mediawiki/igem.org/a/a6/Zju_newigem5.JPG" width="500px"<br />
alt="" title="" /></a><br />
</div><br />
</div><br />
<br />
<p align="justify">&nbsp;</p><br />
<br />
<div class="projectNavFloat"><br />
<a target="brainFramei" href="https://2012.igem.org/Team:ZJU-China/hp_s3_1.htm">1.HP creative idea workshop</a><br />
<br><br />
<a target="brainFramei" href="https://2012.igem.org/Team:ZJU-China/hp_s3_2.htm">2.Card game: Methane Killer</a><br><br />
<a target="brainFramei" href="https://2012.igem.org/Team:ZJU-China/hp_s3_3.htm">3.Scaffold in your eyes</a><br />
</div><!-- end .projectNavFloat --> <br />
<div class="projectNavFloat"><br />
<br />
<br />
<br />
<a target="brainFramei" href="https://2012.igem.org/Team:ZJU-China/hp_s3_4.htm">4.A love story between Syn & Bio</a><br />
<br><br />
<a target="brainFramei" href="https://2012.igem.org/Team:ZJU-China/hp_s3_5.htm">5.English Speech Contest</a><br />
</div><!-- end .projectNavFloat --><br />
<br class="clearfloat"><br />
</div><!-- end .projectNav --><br />
<br />
<iframe src="" frameborder="0" name="brainFramei" width="100%" height="500px"> </iframe> <br />
</div><!-- end .acc_container --><br />
<br />
<br />
<h2 class="acc_trigger">04 <strong>COLLABRATIONS</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div class="projectNav"><br />
<br />
<br />
<div class="projectNavFloat"><br />
<a target="brainFramej" href="https://2012.igem.org/Team:ZJU-China/hp_s4_1.htm">1.Dr. Yuhua Hu's visit</a><br />
<br><br />
<a target="brainFramej" href="https://2012.igem.org/Team:ZJU-China/hp_s4_2.htm">2.Peking_U visiting our team</a><br />
<br />
</div><!-- end .projectNavFloat --> <br />
<div class="projectNavFloat"><br />
<br />
<a target="brainFramej" href="https://2012.igem.org/Team:ZJU-China/hp_s4_3.htm">3.Terrific trip to UIUC</a><br />
<br />
</div><!-- end .projectNavFloat --><br />
<br class="clearfloat"><br />
</div><!-- end .projectNav --><br />
<br />
<iframe src="" frameborder="0" name="brainFramej" width="100%" height="500px"> </iframe> <br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">05 <strong>FUTURE WORK</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<h2>Research about Human Practice</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">We are going to enrich the content of HP creative idea workshop by conducting a research focusing on the effectiveness and creativeness of human practice. By doing this, we’re trying to figure out the relation between humanity and science. People used to think science is a pretty serious stuff with lots of data and critical analysis (But it is only one aspect of being a scientist). Actually iGEM Human Practice provide us a good opportunity to combine a great number of other fields to science, and create amazing new things to introduce science concept to the society. And it is such an amazement that during the past few years, iGEMers from all over the world contribute their effort to explore this perspective. We find it extremely interesting to do research on this topic. We hope to summarize the previous iGEM project human practices, seek other successful cases which add different elements to science projects, and conclude the true inner beauty of Human practice and project outreach. By doing this, we intend to provide a whole picture of science and humanity in iGEM, and wish to inspire other iGEM team in some sense.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>Ethic thinking and love project</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">From the experience of English speech contest, we find it necessary to create a chance for undergraduates to really think about new technology in biology as well as ethics in biosafety. And we’re thinking of organizing an English essay competition concerning about biosafety. It will certainly inspire our young biologists or even the general public, and provide a good chance for them to get to know about synthetic biology instead of receiving other’s opinions passively. </p><br />
<p align="justify">&nbsp;</p><br />
<h2>Collaborations with UIUC</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Since our projects has a certain similarity, ZJU-China focusing on the improvement of the discrete RNA scaffold by adding riboswitch in order to make our own scaffold, while UIUC pay more attention on finding a new pathway by changing the scaffold’s RNA binding sites. We find it possible to discuss and collaborate with each other. We can help in modeling and they share experience in doing protein experiment with us. And ZJU-China also wants to explore more about biosafety in outreach with UIUC team.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>Collaborations with Edinburgh University</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Dr. Yuhua Hu from Edinburgh did a detailed interview about teamwork in iGEM project with almost every member in our 2012 iGEM ZJU-China team. We are very glad to share our stories with Dr.Yuhua Hu and participate in her research. There’s going to be another two interviews with all of our members around November.</p><br />
<p align="justify">&nbsp;</p><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">06 <strong>SCAFFOLD IN SYN AND BIO'S LOVE</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<!--Content Goes Here--><br />
<embed src="http://www.jiajunlu.com/igem/plzzzzz.wmv" width="600" height="500" /></embed><br />
</div><!-- end .acc_container --><br />
<br />
<!-- end #main --></div><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<!-- end #columnRight --></div> <br />
<!-- end .content --></div><br />
<!-- end .container --></div> <br />
</div><!-- end .wrapper --><br />
<div><img src="https://static.igem.org/mediawiki/igem.org/d/d9/Zju_foot.png" width="100%"></div><br />
<div id="footer"><br />
<div id="footerImg"><br />
</div><!-- end footerImg --><br />
<!-- end #footer --></div> <br />
<script type="text/javascript"> Cufon.now(); </script><br />
</body></html></div>Smilehttp://2012.igem.org/Team:ZJU-China/project_s1_2.htmTeam:ZJU-China/project s1 2.htm2012-09-26T21:31:43Z<p>Smile: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" class="cufon-active cufon-ready"><head><meta http-equiv="Content-Type" content="text/html; charset=UTF-8"><br />
<br />
<title>HOME</title><br />
<br />
<link href="http://www.jiajunlu.com/igem/style.css" rel="stylesheet" type="text/css"><br />
<link rel="stylesheet" href="http://www.jiajunlu.com/igem/slide.css" type="text/css" media="screen"><br />
<br />
<style type="text/css"><br />
body /* UltraGlobal Environment (origin item) */<br />
{<br />
background-color: #F8F8F8;<br />
}<br />
#blank ,<br />
#blank *<br />
{<br />
background-color: transparent;<br />
background-image: url("");<br />
border-style: none;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
<br />
#globalWrapper /* Global Environment (origin item) */<br />
{<br />
background-color: #F8F8F8;<br />
background-attachment: fixed;<br />
background-position: 50% 0;<br />
background-repeat: no-repeat;<br />
background-image: url("");<br />
overflow: hidden;<br />
}<br />
<br />
/* Remove Top Item (origin item) */<br />
#top-section<br />
{<br />
display: none;<br />
}<br />
#top<br />
{<br />
display: none;<br />
}<br />
h1.firstHeading<br />
{<br />
display: none;<br />
}<br />
<br />
/* Inner Environment (origin item) */<br />
#content<br />
{<br />
background-color: transparent;<br />
background-image: url("");<br />
background-attachment: scroll;<br />
background-position: 50% 0;<br />
background-repeat: repeat-y;<br />
overflow: hidden;<br />
border-style: none;<br />
width: 715px;<br />
}<br />
#bodyContent<br />
{<br />
z-index: 0;<br />
}<br />
#footer-box<br />
{<br />
background-color: transparent;<br />
background-image: none;<br />
border-style: none;<br />
z-index: 0;<br />
}<br />
#catlinks<br />
{<br />
display: none;<br />
}<br />
#content a,<br />
#content a:hover<br />
{<br />
color: #fff350;<br />
display: inline;<br />
}<br />
#content a:link,<br />
#content a:visited,<br />
#content a:hover,<br />
#content a:active<br />
{<br />
text-decoration: none;<br />
}<br />
<br />
/* Bottom Environment (origin item) */<br />
#footer-box a,<br />
#footer-box a:hover<br />
{<br />
color: #e8e7b9;<br />
text-decoration: none;<br />
display: inline;<br />
}<br />
ul,li<br />
{<br />
margin: 0;<br />
padding: 0;<br />
list-style-image: none;<br />
list-style-type: none;<br />
}<br />
table<br />
{<br />
border-collapse:collapse;<br />
background-color: transparent;<br />
color: #ffffff;<br />
text-align: justify;<br />
}<br />
h3<br />
{<br />
padding: 20px 30px 10px;<br />
}<br />
<br />
p<br />
{<br />
font-family: Arial, sans-serif;<br />
}<br />
<br />
/* Common Environment */<br />
.center<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
}<br />
.floatL<br />
{<br />
float: left;<br />
clear: left;<br />
}<br />
.floatR<br />
{<br />
float: right;<br />
clear: right;<br />
}<br />
.floatC<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
float: none;<br />
clear: both;<br />
}<br />
.blank<br />
{<br />
filter: Alpha(Opacity=0%);<br />
-moz-opacity: 0;<br />
opacity: 0;<br />
}<br />
.hidden<br />
{<br />
display: none;<br />
}<br />
.show<br />
{<br />
display: block;<br />
}<br />
.show-text<br />
{<br />
display: inline;<br />
}<br />
.button img<br />
{<br />
display: block;<br />
}<br />
<br />
#footer-box<br />
{<br />
display: none;<br />
}<br />
<br />
</script> <br />
<br />
<br />
<script src="http://www.jiajunlu.com/igem/cufon-yui.js" type="text/javascript"></script><style type="text/css">cufon{text-indent:0!important;}@media screen,projection{cufon{display:inline!important;display:inline-block!important;position:relative!important;vertical-align:middle!important;font-size:1px!important;line-height:1px!important;}cufon cufontext{display:-moz-inline-box!important;display:inline-block!important;width:0!important;height:0!important;overflow:hidden!important;text-indent:-10000in!important;}cufon canvas{position:relative!important;}}@media print{cufon{padding:0!important;}cufon canvas{display:none!important;}}</style><br />
<script src="http://www.jiajunlu.com/igem/gotham.js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
Cufon.replace('h1,h2,h3,h5');<br />
</script><br />
<br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/jquery-1.3.2.min.js"></script><br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/my.js"></script><br />
<script src="http://www.jiajunlu.com/igem/slide.js" type="text/javascript"></script><br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/validation_login.js"></script><br />
<br />
<script type="text/javascript"><br />
<br />
function movetotop(){<br />
$("html, body").animate({ scrollTop: 0 }, "slow");<br />
return false;<br />
}<br />
<br />
$(function() {<br />
var offset = $("#logo").offset();<br />
var topPadding = 15;<br />
$(window).scroll(function() {<br />
if ($(window).scrollTop() > offset.top) {<br />
$("#logo").stop().animate({<br />
marginTop: $(window).scrollTop() - offset.top + topPadding<br />
});<br />
} else {<br />
$("#logo").stop().animate({<br />
marginTop: 0<br />
});<br />
};<br />
});<br />
});<br />
</script><br />
</head><br />
<br />
<br />
<body class="home"><br />
<br />
<h2>Design</h2><br />
<br />
<br />
<p align="justify">&nbsp;</p><br />
<p align="justify">We thought to add another aptamer onto the scaffold and construct an interaction between it and the MS2 aptamer, such that it could disrupt the binding of MS2 protein and the MS2 aptamer.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">We thought about the well-known theophylline aptamer. The aptamer is a single RNA hairpin that binds theophylline in an inner loop region with high affinity. Previous studies have shown mutations in the loop region were tolerated as long as the loop structure was preserved. This allowed us to mutate the loop of the theophylline aptamer to create an interaction between the theophylline aptamer and the MS2 aptamer. The interaction inhibits the binding function of MS2 aptamer in the absence of theophylline. However, when theophylline is added, the fold of the loop is changed and thus the interaction will disappear, leading to the binding of MS2 aptamer and corresponding protein.</p><br />
<p align="justify">&nbsp;</p> <br />
<img src="https://static.igem.org/mediawiki/igem.org/9/9f/Mechanism_ZJU.jpg" width="600px" /><br />
<p align="justify">Fig.1 The control mechanism of the theophylline aptamer.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Since the reformed scaffolds consist of three aptamers, just like clovers, we call them 'clover'. </p><br />
<p align="justify">&nbsp;</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/c/cb/Clover_ZJU.jpg" width="600px" /><br />
<p align="justify">Fig.2 Our designed scaffolds are named 'clover'.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Three versions of 'clover' were designed.</p><br />
<p align="justify">&nbsp;</p> <br />
<img src="https://static.igem.org/mediawiki/igem.org/9/90/Aptamer_ZJU.png" width="600px" /><br />
<p align="justify">Fig.3 Three version of clovers. Version one and version two have adjacent MS2 and theophylline aptamer, while vesion three has separated ones. Version one has an interaction between the loop of theophylline aptamer and the loop of MS2 aptamer, while version two and version three have an interaction between the loop of theophylline aptamer and the stem of MS2 aptamer.</p><br />
<p align="justify">&nbsp;</p><br />
<h3>Original scaffold D0:</h3><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The base sequence of original scaffold D0:</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">GGGAGGACTCCCACAGTCACTGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGTTCGCACTTCTCTCGTATTCGATTCCC</p><br />
<p align="justify">&nbsp;</p> <br />
<img src="https://static.igem.org/mediawiki/igem.org/0/07/Riboscaffold_0.png" width="300px" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/9/99/Zju_riboscaffold_d0.png" width="300px" /><br />
<embed src="https://static.igem.org/mediawiki/igem.org/0/0a/D0_roll.swf" width="600" height="500" /></embed><br />
<br />
<p align="justify">Fig.4 The secondary (left) and the tertiary(right) structure of D0.</p><br />
<p align="justify">&nbsp;</p><br />
<h3>Clover version 1</h3><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The interaction is between the loop of theophylline aptamer and the loop of the MS2 aptamer.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">And the theophylline aptamer is just beside the MS2 apatamer.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The base sequence of clover version 1:</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">GGGGUCCUCGGUGAUACCAGCAUagugacuAUGCCCUUGGCAGCACCGAGGAGGACTCCCACagtcactGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGTTCGCACTTCTCTCGTATTCGCCCC</p><br />
<p align="justify">&nbsp;</p> <br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/8/84/Riboscaffold_1.png" width="300px" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/2/24/Zju_model1_1.png" width="300px" /><br />
<p>&nbsp;</p><br />
<embed src="https://static.igem.org/mediawiki/igem.org/5/5c/Clover1_roll.swf" width="600" height="500" /></embed><br />
<p align="justify">Fig.5 The secondary (left) and the tertiary (right) structure of clover version 1.</p><br />
<p align="justify">&nbsp;</p><br />
<h3>Clover version 2</h3><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The interaction is between the loop of the theophylline aptamer and the stem of the MS2 apatamer. And the theophylline aptamer is just beside the MS2 apatamer.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The base sequence of clover version 2:</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">GGGGUCCUCGGUGAUACCAGCugacuguggCCCUUGGCAGCACCGAGGAGGACTCccacagtcaCTGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGTTCGCACTTCTCTCGTATTCGCCCC</p><br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/9/9c/Riboscaffold_2.png" width="300px" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/f/ff/Zju_model1_3.png" width="300px" /><br />
<p>&nbsp;</p><br />
<embed src="https://static.igem.org/mediawiki/igem.org/7/71/Clover2_roll.swf" width="600" height="500" /></embed><br />
<p align="justify">&nbsp;</p> <br />
<p align="justify">Fig.6 The secondary (left) and the tertiary (right) structure of clover version 2.</p><br />
<p align="justify">&nbsp;</p><br />
<h3>Clover version 3</h3><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The interaction is between the loop of the theophylline aptamer and the stem of the MS2 apatamer. Although the theophylline and the MS2 apatamer is separated by the PP7 aptamer in the base sequence, they are closed according to the three- dimensional structure prediction.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The base sequence of clover version 3:</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">GGGGUCCUCGGUGAUACCAGCugacuguggCCCUUGGCAGCACCGAGGACUGGGCACAGAAGAUAUGGCUUCGUGCCCAGUCGAAUACGAGGAAGUGUUCGCACUUCACCUGGGACUCccacagucaCUGGGGAGUCCCAGGUUCUCGUAUUCGCCCC</p><br />
<p align="justify">&nbsp;</p> <br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/4/41/Riboscaffold_3.png" width="300px" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/f/f9/Zju_model1_4.png" width="300px" /><br />
<p>&nbsp;</p><br />
<embed src="https://static.igem.org/mediawiki/igem.org/6/6c/Clover3_roll.swf" width="600" height="500" /></embed><br />
<br />
<p align="justify">Fig.7 The secondary (left) and the tertiary (right) structure of clover version 3. Although the theophyline and MS2 aptamers are separated as the secondary structure showed, in the tertiary structure, the theophyline aptamer obviously fold towards the MS2 aptamer.</p><br />
<p align="justify">&nbsp;</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/f/f9/Zju_model1_4.png" width="300px" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/0/05/Zju_model1_5.png" width="300px" /><br />
<p>&nbsp;</p><br />
<embed src="https://static.igem.org/mediawiki/igem.org/6/6c/Clover3_roll.swf" width="300" height="250" /></embed><br />
<embed src="https://static.igem.org/mediawiki/igem.org/7/7f/Clover3m_roll.swf" width="300" height="250" /></embed><br />
<p>&nbsp;</p><br />
<p align="justify">Fig.8 A contrast between clover version 3 and a scaffold including a theophyline aptamer without a complementary site with MS2 aptamer. It can be easily noticed that in clover version 3, the theophyline aptamer obviously fold towards the MS2 aptamer, which indicates the interaction between the complementary sites in the theophyline and MS2 aptamers. In contrast, the scaffold without complementary sites in the two aptamers shows no approach of the theophyline aptamer to the MS2 aptamer.</p><br />
<p align="justify">&nbsp;</p><br />
<br />
<br />
<h3>References:</h3><br />
<p align="justify">1. Thodey, K. & Smolke, C.D. Bringing It Together with RNA. Science 333, 412-413 (2011).</p><br />
<p align="justify">2. Delebecque, C.J., Lindner, A.B., Silver, P.A. & Aldaye, F.A. Organization of Intracellular Reactions with Rationally Designed RNA Assemblies. Science 333, 470-474 (2011).</p><br />
<p align="justify">3. Qi, L., Lucks, J.B., Liu, C.C., Mutalik, V.K. & Arkin, A.P. Engineering naturally occurring trans-acting non-coding RNAs to sense molecular signals. Nucleic Acids Res 40, 5775-5786 (2012).</p><br />
<br />
<br />
</body></html></div>Smilehttp://2012.igem.org/Team:ZJU-China/aboutus.htmTeam:ZJU-China/aboutus.htm2012-09-26T20:09:32Z<p>Smile: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" class="cufon-active cufon-ready"><head><meta http-equiv="Content-Type" content="text/html; charset=UTF-8"><br />
<br />
<link rel="stylesheet" href="http://www.jiajunlu.com/Jiajun Lu_files/jemdoc.css" type="text/css"><br />
<br />
<title>ABOUT US</title><br />
<meta name="description" content=""><br />
<meta name="keywords" content=""><br />
<link rel="shortcut icon" type="image/vnd.microsoft.icon" href=""><br />
<link href="http://www.jiajunlu.com/igem/style.css" rel="stylesheet" type="text/css"><br />
<br />
<style type="text/css"><br />
body /* UltraGlobal Environment (origin item) */<br />
{<br />
background-color: #F8F8F8;<br />
}<br />
#blank ,<br />
#blank *<br />
{<br />
background-color: transparent;<br />
background-image: url("");<br />
border-style: none;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
<br />
#globalWrapper /* Global Environment (origin item) */<br />
{<br />
background-color: transparent;<br />
background-attachment: fixed;<br />
background-position: 50% 0;<br />
background-repeat: no-repeat;<br />
background-image: url("");<br />
overflow: hidden;<br />
}<br />
<br />
/* Remove Top Item (origin item) */<br />
#top-section<br />
{<br />
height: 0px;<br />
width: 100%;<br />
}<br />
#p-logo {<br />
display: none;<br />
}<br />
#top<br />
{<br />
display: none;<br />
}<br />
h1.firstHeading<br />
{<br />
display: none;<br />
}<br />
<br />
/* Inner Environment (origin item) */<br />
#content<br />
{<br />
background-color: transparent;<br />
background-image: url("https://static.igem.org/mediawiki/2012/e/e5/Zju_back.jpg");<br />
background-attachment: scroll;<br />
background-position: 50% 0;<br />
background-repeat: repeat-y;<br />
overflow: hidden;<br />
border-style: none;<br />
width: 100%;<br />
}<br />
#footer-box<br />
{<br />
background-color: #F8F8F8;<br />
background-image: none;<br />
border-style: none;<br />
margin-top: 100px;<br />
}<br />
#catlinks<br />
{<br />
display: none;<br />
}<br />
#content a,<br />
#content a:hover<br />
{<br />
color: black;<br />
display: inline;<br />
}<br />
#content a:link,<br />
#content a:visited<br />
{<br />
text-decoration: none;<br />
}<br />
#content a:hover,<br />
#content a:active<br />
{<br />
text-decoration: underline;<br />
}<br />
<br />
/* Bottom Environment (origin item) */<br />
#footer-box a,<br />
#footer-box a:hover<br />
{<br />
color: #e8e7b9;<br />
text-decoration: none;<br />
display: inline;<br />
}<br />
<br />
ul<br />
{<br />
list-style-image: none;<br />
list-style-type: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
li<br />
{<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
p<br />
{<br />
font-family: Arial, sans-serif;<br />
color: black;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
/* Common Environment */<br />
.center<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
}<br />
.floatL<br />
{<br />
float: left;<br />
clear: left;<br />
}<br />
.floatR<br />
{<br />
float: right;<br />
clear: right;<br />
}<br />
.floatC<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
float: none;<br />
clear: both;<br />
}<br />
.blank<br />
{<br />
filter: Alpha(Opacity=0%);<br />
-moz-opacity: 0;<br />
opacity: 0;<br />
}<br />
.hidden<br />
{<br />
display: none;<br />
}<br />
.show<br />
{<br />
display: block;<br />
}<br />
.show-text<br />
{<br />
display: inline;<br />
}<br />
.button img<br />
{<br />
display: block;<br />
}<br />
<br />
ul.horizontal > li<br />
{<br />
display: block;<br />
float: left;<br />
clear: none;<br />
overflow: hidden;<br />
}<br />
ul.vertical > li<br />
{<br />
display: block;<br />
float: left;<br />
clear: both;<br />
overflow: hidden;<br />
}<br />
<br />
#search-controls<br />
{<br />
display: none;<br />
}<br />
<br />
#footer-box<br />
{<br />
display: none;<br />
}<br />
<br />
#banner {<br />
position: relative;<br />
left: 10%;<br />
width: 600px;<br />
height: 600px;<br />
border: 1px solid #666;<br />
overflow: hidden;<br />
}<br />
<br />
#banner_list img {<br />
border: 0px;<br />
}<br />
<br />
#banner_bg {<br />
position: absolute;<br />
bottom: 20px;<br />
background-color: #000;<br />
height: 44px;<br />
filter: Alpha(Opacity = 50);<br />
opacity: 0.5;<br />
z-index: 1000;<br />
cursor: pointer;<br />
width: 561px;<br />
}<br />
<br />
#banner_info {<br />
position: absolute;<br />
bottom: 20px;<br />
left: 5px;<br />
height: 44px;<br />
color: #fff;<br />
z-index: 1001;<br />
cursor: pointer<br />
}<br />
<br />
#banner_text {<br />
position: absolute;<br />
width: 120px;<br />
z-index: 1002;<br />
right: 3px;<br />
bottom: 3px;<br />
}<br />
<br />
#banner ul {<br />
position: absolute;<br />
list-style-type: none;<br />
filter: Alpha(Opacity = 80);<br />
opacity: 0.8;<br />
border: 1px solid #fff;<br />
z-index: 1002;<br />
margin: 0;<br />
padding: 0;<br />
bottom: 3px;<br />
right: 5px;<br />
}<br />
<br />
#banner ul li {<br />
padding: 0px 8px;<br />
float: left;<br />
display: block;<br />
color: #FFF;<br />
border: #e5eaff 1px solid;<br />
background: #6f4f67;<br />
cursor: pointer<br />
}<br />
<br />
<br />
</style><br />
<br />
<script src="http://www.jiajunlu.com/igem/cufon-yui.js" type="text/javascript"></script><style type="text/css">cufon{text-indent:0!important;}@media screen,projection{cufon{display:inline!important;display:inline-block!important;position:relative!important;vertical-align:middle!important;font-size:1px!important;line-height:1px!important;}cufon cufontext{display:-moz-inline-box!important;display:inline-block!important;width:0!important;height:0!important;overflow:hidden!important;text-indent:-10000in!important;}cufon canvas{position:relative!important;}}@media print{cufon{padding:0!important;}cufon canvas{display:none!important;}}</style><br />
<script src="http://www.jiajunlu.com/igem/gotham.js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
Cufon.replace('h3');<br />
<br />
<br />
</script><br />
<link rel="stylesheet" href="http://www.jiajunlu.com/igem/slide.css" type="text/css" media="screen"><br />
<link rel="stylesheet" href="http://www.jiajunlu.com/igem/accordion.css" type="text/css" media="screen"><br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
<br />
//Hide (Collapse) the toggle containers on load<br />
$(".acc_container").hide(); <br />
//Switch the "Open" and "Close" state per click then slide up/down (depending on open/close state)<br />
$("h2.acc_trigger").click(function(){<br />
$(this).toggleClass("active").next().slideToggle("slow");<br />
<br />
return false; //Prevent the browser jump to the link anchor<br />
});<br />
<br />
});<br />
</script><br />
<br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/my.js"></script><br />
<script src="http://www.jiajunlu.com/igem/slide.js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
function movetotop(){<br />
$("html, body").animate({ scrollTop: 0 }, "slow");<br />
return false;<br />
}<br />
$(function() {<br />
var offset = $("#logo").offset();<br />
var topPadding = 15;<br />
$(window).scroll(function() {<br />
if ($(window).scrollTop() > offset.top) {<br />
$("#logo").stop().animate({<br />
marginTop: $(window).scrollTop() - offset.top + topPadding<br />
});<br />
} else {<br />
$("#logo").stop().animate({<br />
marginTop: 0<br />
});<br />
};<br />
});<br />
});<br />
</script><br />
<br />
</head><br />
<br />
<body class="work"><br />
<br />
<div class="wrapper"><br />
<div class="container"><br />
<div class="content"><br />
<div id="columnLeft"><br />
<div id="logo" style="margin-top: 0px; " onclick="movetotop()"><br />
<a><img src="https://static.igem.org/mediawiki/2012/1/12/Zju_logo.png"></a><br />
<!-- end #logo --></div><br />
<!-- end #columnLeft" --></div><br />
<div id="columnRight"><br />
<div id="header"><br />
<div id="menu"><br />
<ul id="menu"><br />
<li class="1"><a href="https://2012.igem.org/Team:ZJU-China"><img src="http://www.jiajunlu.com/igem/home_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="2"><a href="https://2012.igem.org/Team:ZJU-China/aboutus.htm"><img src="http://www.jiajunlu.com/igem/aboutus_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="3"><a href="https://2012.igem.org/Team:ZJU-China/project.htm"><img src="http://www.jiajunlu.com/igem/project_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="4"><a href="https://2012.igem.org/Team:ZJU-China/models.htm"><img src="http://www.jiajunlu.com/igem/Zju_models_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="5"><a href="https://2012.igem.org/Team:ZJU-China/notebook.htm"><img src="http://www.jiajunlu.com/igem/notebook_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="6"><a href="https://2012.igem.org/Team:ZJU-China/humanpractice.htm"><img src="http://www.jiajunlu.com/igem/humanpractice_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="7"><a href="https://2012.igem.org/Team:ZJU-China/safty.htm"><img src="http://www.jiajunlu.com/igem/safty_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="8"><a href="https://2012.igem.org/Team:ZJU-China/achievement.htm"><img src="http://www.jiajunlu.com/igem/achievement_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="8"><a href="https://2012.igem.org"><img src="http://www.jiajunlu.com/igem/Zju_igem_btn.gif"></a></li><br />
<br />
</ul><br />
<!-- end #menu --></div><br />
<!-- end #header --></div><br />
<br />
<div id="main"><br />
<br />
<h2 class="acc_trigger">01 <strong>ABOUT ZJU</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<div style="height:800px;overflow:scroll;"> <br />
<!--Content Goes Here--><br />
<h2>The University Motto: Seeking the Truth and Pioneering New Trails.</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The history of Zhejiang University goes back to 115 years ago. As a truly comprehensive institution with a full range of disciplines, Zhejiang University covers lots of subjects and aims at providing an outstanding education that will enable its students to build a future of professional, intellectual and personal success, capable of leadership in different areas, whether it be political, economic or academic. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">We have five campuses. The names are: Yuquan, Xixi, Huajiachi, Zhijiang, and Zijingang. These names are all "water" related. In English, they mean spring, stream, pool, river, and port. Each campus has its own beauty. Yuquan is charming, Xixi is elegant, Huajiachi is simple, Zhijiang is ancient and Zijingang is modern.<br />
For more information, click <a herf="http://www.zju.edu.cn">http://www.zju.edu.cn</a></p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Here we want to show you a set of amazing photos shot by Gang Cheng, an alumnus of Zhejiang University.</p><br />
<br />
<script type="text/javascript"><br />
var t = n = 0, count;<br />
$(document).ready(function(){ <br />
counta=$("#banner_list a").length;<br />
$("#banner_list a:not(:first-child)").hide();<br />
$("#banner_info").html($("#banner_list a:first-child").find("img").attr('alt'));<br />
$("#banner_info").click(function(){window.open($("#banner_list a:first-child").attr('href'), "_blank")});<br />
$("#banner li").click(function() {<br />
var i = $(this).text() - 1;//1,2,3,4<br />
n = i;<br />
if (i >= counta) return;<br />
$("#banner_info").html($("#banner_list a").eq(i).find("img").attr('alt'));<br />
$("#banner_info").unbind().click(function(){window.open($("#banner_list a").eq(i).attr('href'), "_blank")})<br />
$("#banner_list a").filter(":visible").fadeOut(500).parent().children().eq(i).fadeIn(1000);<br />
document.getElementById("banner").style.background="";<br />
$(this).toggleClass("on");<br />
$(this).siblings().removeAttr("class");<br />
});<br />
<br />
})<br />
<br />
<br />
</script><br />
<div id="banner"><br />
<div id="banner_bg"></div><br />
<div id="banner_info"></div><br />
<ul><br />
<li class="on">1</li><br />
<li>2</li><br />
<li>3</li><br />
<li>4</li><br />
<li>5</li><br />
<li>6</li><br />
<li>7</li><br />
<li>8</li><br />
</ul><br />
<div id="banner_list"><a href="#" target="_blank"><img<br />
src="http://www.jiajunlu.com/igem/zju_about1.jpg" width="600px"<br />
title="" alt="The gate of Yuquan and BG Tree" /></a><br />
<a href="#" target="_blank"><img<br />
src="http://www.jiajunlu.com/igem/zju_about2.jpg"<br />
title="" alt="Chairman Mao with Gesture Like Calling a Taxi" width="600px" hight="600px" /></a> <a href="#"<br />
target="_blank"><img<br />
src="http://www.jiajunlu.com/igem/zju_about3.jpg" width="600px"<br />
title="" alt="One of Libraries" /></a><br />
<a href="#" target="_blank"><img<br />
src="http://www.jiajunlu.com/igem/zju_about4.jpg" width="600px" hight="600px"<br />
alt="Lovely President Chu Kochen" title="" /></a><br />
<a href="#" target="_blank"><img<br />
src="http://www.jiajunlu.com/igem/zju_about5.jpg" width="600px"<br />
alt="Lovers' Slope" title="" /></a><br />
<a href="#" target="_blank"><img<br />
src="http://www.jiajunlu.com/igem/zju_about6.jpg" width="600px"<br />
alt="Square of Yongqian" title="" /></a><br />
<a href="#" target="_blank"><img<br />
src="http://www.jiajunlu.com/igem/zju_about7.jpg" width="600px"<br />
alt="One of Teaching Buildings of Long History" title="" /></a><br />
<a href="#" target="_blank"><img<br />
src="http://www.jiajunlu.com/igem/zju_about8.jpg" width="600px"<br />
alt="The Modern Zijingang" title="" /></a></div><br />
</div><br />
<br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">02 <strong>TEAM</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<div style="height:800px;overflow:scroll;"> <br />
<!--Content Goes Here--><br />
<p align="justify">Our team, ZJU-China, consists of 9 undergraduates and 3 advisers. On the lakeside of the beautiful West Lake, we gather together, brainstorming heatedly, doing experiment carefully, thinking about life and future, going out for movie and feast. We love life, also love iGEM. </p><br />
<h2>Undergraduates</h2><br />
<p><br />
<img src="https://static.igem.org/mediawiki/igem.org/c/c9/Zju_chentianqi.jpg" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/7/70/Zju_guoxinyi.jpg" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/5/56/Zju_liuhuachun.jpg" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/3/3b/Zju_meiqian.jpg" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/6/6b/Zju_yanyan.jpg" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/c/ce/Zju_yujianing.jpg" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/a/a0/Zju_zhangjiahui.jpg" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/3/31/Zju_liuxiao.jpg" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/0/0c/Zju_lvjiajun.jpg" /><br />
</p><br />
<p>&nbsp;</p><br />
<h2>Instructor & Advisers</h2><br />
<p><br />
<img src="https://static.igem.org/mediawiki/igem.org/8/86/Zju_chenming.jpg" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/8/87/Zju_lanxiang.jpg" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d8/Zju_lixin.jpg" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/9/93/Zju_xiaomu.jpg" /><br />
</p><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">03 <strong>ATTRIBUTION</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<p align="justify">All the work of our projects has been done by undergraduate students of ZJU-China team.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Tianqi Chen, the team leader, is in charge of Basic Scaffold and Biosynthesis of IAA, drew the big picture shown in vedio “scaffold in Syn and Bio’s Love”, searched for fund, designed the wiki.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Qian Mei constructed the molecular model and was involved in financial affairs.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Yan Yan was in charge of financial affairs, Riboscaffold and construction of parts, sang a song of the vedio, dealt with customs to get the parts delivered.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Huachun Liu was in charge of the whole experiment, mainly Basic Scaffold and Biosynthesis of IAA, and construction of parts, dealt with customs to get the parts delivered.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Jianing Yu constructed Scaffold or Non-scaffold and Binding Analysis. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Xinyi Guo was in charge of Human Practice and many creative ideas. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Xiao Liu was in charge of scaffold Library.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Jiajun Lv was in charge of editing wiki.</p><br />
<p align="justify">&nbsp;</p><br />
</div><!-- end .acc_container --> <br />
<br />
<h2 class="acc_trigger">04 <strong>ACKNOWLEDGE</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<p align="justify">We can't complete the project without the guidance and support of the people as follows:</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Dr. Camille Delebecque from Harvard Medical School, for his patient instructions and kindness of providing us plasmids</p><br />
<p align="justify">Dr. Gairik Sachdeva and Manager Buhl Kathleen from Prof. Pamela Silver Lab, Harvard Medical School for sending us plasmids</p><br />
<p align="justify">People in Prof. Ariel Lindner Lab, Université René Descartes for sending us plasmids </p><br />
<p align="justify">Ming Ding and Room 413 in Zhejiang University Biology Lab Center, for use of lab space and material support</p><br />
<p align="justify">Xiang Lan, Xin Li, Mu Xiao, graduate student and vice-professor advisors</p><br />
<p align="justify">Prof. Xiaohang Yang in Room 1305, for helpful suggestions and use of Olympus fluoview fv1000 confocal laser scanning microscope </p><br />
<p align="justify">Fan Zhang, for patient guidance of how to operate confocal laser scanning microscope</p><br />
<p align="justify">Prof. Jianzhong Shao, for helpful suggestions and use of Synergy Hybrid reader </p><br />
<p align="justify">Lvyun Zhu, for patient guidance of how to operate Synergy Hybrid reader</p><br />
<p align="justify">Weiren Dong, for generous support of reagent and protocol of TA colone</p><br />
<p align="justify">Yulong Li, for patient guidance of how to operate fluorescence microscope</p><br />
<p align="justify">Gang Cheng, for amazing photos about ZJU planet</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Zhejiang University Education Fundation, for financial support</p><br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">05 <strong>CONTACT US</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<p align="justify">If you have any interests, please feel free to contact us. We’re looking forward for fun in science and friendship in between.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">public mailbox:zjusbclub@gmail.com</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">SBC (synthetic biology club in Zhejiang University) websites:</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">http://www.cls.zju.edu.cn/binfo/sbc/</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Renren : iGEM~ZJU2012</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">http://page.renren.com/601236243?id=601236243&ref=opensearch_normal</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Renren: 合成生物学研究会</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">http://page.renren.com/601409290?id=601409290&ref=opensearch_normal</p><br />
</div><!-- end .acc_container --><br />
<!-- end #main --></div><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<!-- end #columnRight --></div><br />
<!-- end .content --></div><br />
<!-- end .container --></div><br />
</div><!-- end .wrapper --><br />
<div><img src="https://static.igem.org/mediawiki/igem.org/d/d9/Zju_foot.png" width="100%"></div><br />
<div id="footer"><br />
<div id="footerImg"><br />
</div><!-- end footerImg --><br />
<!-- end #footer --></div> <br />
<script type="text/javascript"> Cufon.now(); </script><br />
</body></html></div>Smilehttp://2012.igem.org/Team:ZJU-China/project.htmTeam:ZJU-China/project.htm2012-09-26T18:50:41Z<p>Smile: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" class="cufon-active cufon-ready"><head><meta http-equiv="Content-Type" content="text/html; charset=UTF-8"><br />
<br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/ASCIIMathMLwFallback.js"></script> <br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/ASCIIMathTeXImg.js"></script><br />
<br />
<title>PROJECT</title><br />
<meta name="description" content=""><br />
<meta name="keywords" content=""><br />
<link rel="shortcut icon" type="image/vnd.microsoft.icon" href=""><br />
<link href="http://www.jiajunlu.com/igem/style.css" rel="stylesheet" type="text/css"><br />
<br />
<style type="text/css"><br />
body /* UltraGlobal Environment (origin item) */<br />
{<br />
background-color: #F8F8F8;<br />
}<br />
#blank ,<br />
#blank *<br />
{<br />
background-color: transparent;<br />
background-image: url("");<br />
border-style: none;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
<br />
#globalWrapper /* Global Environment (origin item) */<br />
{<br />
background-color: transparent;<br />
background-attachment: fixed;<br />
background-position: 50% 0;<br />
background-repeat: no-repeat;<br />
background-image: url("");<br />
overflow: hidden;<br />
}<br />
<br />
/* Remove Top Item (origin item) */<br />
#top-section<br />
{<br />
height: 0px;<br />
width: 100%;<br />
}<br />
#p-logo {<br />
display: none;<br />
}<br />
#top<br />
{<br />
display: none;<br />
}<br />
h1.firstHeading<br />
{<br />
display: none;<br />
}<br />
<br />
/* Inner Environment (origin item) */<br />
#content<br />
{<br />
background-color: transparent;<br />
background-image: url("https://static.igem.org/mediawiki/2012/e/e5/Zju_back.jpg");<br />
background-attachment: scroll;<br />
background-position: 50% 0;<br />
background-repeat: repeat-y;<br />
overflow: hidden;<br />
border-style: none;<br />
width: 100%;<br />
}<br />
#footer-box<br />
{<br />
background-color: #F8F8F8;<br />
background-image: none;<br />
border-style: none;<br />
margin-top: 100px;<br />
}<br />
#catlinks<br />
{<br />
display: none;<br />
}<br />
#content a,<br />
#content a:hover<br />
{<br />
color: black;<br />
display: inline;<br />
}<br />
#content a:link,<br />
#content a:visited<br />
{<br />
text-decoration: none;<br />
}<br />
#content a:hover,<br />
#content a:active<br />
{<br />
text-decoration: underline;<br />
}<br />
<br />
/* Bottom Environment (origin item) */<br />
#footer-box a,<br />
#footer-box a:hover<br />
{<br />
color: #e8e7b9;<br />
text-decoration: none;<br />
display: inline;<br />
}<br />
<br />
ul<br />
{<br />
list-style-image: none;<br />
list-style-type: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
li<br />
{<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
p<br />
{<br />
font-family: Arial, sans-serif;<br />
color: black;<br />
margin: 0;<br />
padding: 0;<br />
align: justify;<br />
}<br />
<br />
/* Common Environment */<br />
.center<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
}<br />
.floatL<br />
{<br />
float: left;<br />
clear: left;<br />
}<br />
.floatR<br />
{<br />
float: right;<br />
clear: right;<br />
}<br />
.floatC<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
float: none;<br />
clear: both;<br />
}<br />
.blank<br />
{<br />
filter: Alpha(Opacity=0%);<br />
-moz-opacity: 0;<br />
opacity: 0;<br />
}<br />
.hidden<br />
{<br />
display: none;<br />
}<br />
.show<br />
{<br />
display: block;<br />
}<br />
.show-text<br />
{<br />
display: inline;<br />
}<br />
.button img<br />
{<br />
display: block;<br />
}<br />
<br />
ul.horizontal > li<br />
{<br />
display: block;<br />
float: left;<br />
clear: none;<br />
overflow: hidden;<br />
}<br />
ul.vertical > li<br />
{<br />
display: block;<br />
float: left;<br />
clear: both;<br />
overflow: hidden;<br />
}<br />
<br />
#search-controls<br />
{<br />
display: none;<br />
}<br />
<br />
#footer-box<br />
{<br />
display: none;<br />
}<br />
<br />
</style><br />
<br />
<script src="http://www.jiajunlu.com/igem/cufon-yui.js" type="text/javascript"></script><style type="text/css">cufon{text-indent:0!important;}@media screen,projection{cufon{display:inline!important;display:inline-block!important;position:relative!important;vertical-align:middle!important;font-size:1px!important;line-height:1px!important;}cufon cufontext{display:-moz-inline-box!important;display:inline-block!important;width:0!important;height:0!important;overflow:hidden!important;text-indent:-10000in!important;}cufon canvas{position:relative!important;}}@media print{cufon{padding:0!important;}cufon canvas{display:none!important;}}</style><br />
<script src="http://www.jiajunlu.com/igem/gotham.js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
Cufon.replace('h3');<br />
<br />
<br />
</script><br />
<link rel="stylesheet" href="http://www.jiajunlu.com/igem/slide.css" type="text/css" media="screen"><br />
<link rel="stylesheet" href="http://www.jiajunlu.com/igem/accordion.css" type="text/css" media="screen"><br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
<br />
//Hide (Collapse) the toggle containers on load<br />
$(".acc_container").hide(); <br />
//Switch the "Open" and "Close" state per click then slide up/down (depending on open/close state)<br />
$("h2.acc_trigger").click(function(){<br />
$(this).toggleClass("active").next().slideToggle("slow");<br />
<br />
return false; //Prevent the browser jump to the link anchor<br />
});<br />
<br />
});<br />
</script><br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/my.js"></script><br />
<script src="http://www.jiajunlu.com/igem/slide.js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
function movetotop(){<br />
$("html, body").animate({ scrollTop: 0 }, "slow");<br />
return false;<br />
}<br />
$(function() {<br />
var offset = $("#logo").offset();<br />
var topPadding = 15;<br />
$(window).scroll(function() {<br />
if ($(window).scrollTop() > offset.top) {<br />
$("#logo").stop().animate({<br />
marginTop: $(window).scrollTop() - offset.top + topPadding<br />
});<br />
} else {<br />
$("#logo").stop().animate({<br />
marginTop: 0<br />
});<br />
};<br />
});<br />
});<br />
</script><br />
</head><br />
<body class="work"><br />
<br />
<div class="wrapper"><br />
<div class="container"><br />
<div class="content"><br />
<div id="columnLeft"><br />
<div id="logo" style="margin-top: 0px; " onclick="movetotop()"><br />
<a><img src="https://static.igem.org/mediawiki/2012/1/12/Zju_logo.png"></a><br />
<!-- end #logo --></div><br />
<!-- end #columnLeft" --></div><br />
<div id="columnRight"><br />
<div id="header"><br />
<div id="menu"><br />
<ul id="menu"><br />
<li class="1"><a href="https://2012.igem.org/Team:ZJU-China"><img src="http://www.jiajunlu.com/igem/home_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="2"><a href="https://2012.igem.org/Team:ZJU-China/aboutus.htm"><img src="http://www.jiajunlu.com/igem/aboutus_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="3"><a href="https://2012.igem.org/Team:ZJU-China/project.htm"><img src="http://www.jiajunlu.com/igem/project_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="4"><a href="https://2012.igem.org/Team:ZJU-China/models.htm"><img src="http://www.jiajunlu.com/igem/Zju_models_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="5"><a href="https://2012.igem.org/Team:ZJU-China/notebook.htm"><img src="http://www.jiajunlu.com/igem/notebook_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="6"><a href="https://2012.igem.org/Team:ZJU-China/humanpractice.htm"><img src="http://www.jiajunlu.com/igem/humanpractice_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="7"><a href="https://2012.igem.org/Team:ZJU-China/safty.htm"><img src="http://www.jiajunlu.com/igem/safty_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="8"><a href="https://2012.igem.org/Team:ZJU-China/achievement.htm"><img src="http://www.jiajunlu.com/igem/achievement_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="8"><a href="https://2012.igem.org"><img src="http://www.jiajunlu.com/igem/Zju_igem_btn.gif"></a></li><br />
<br />
</ul><br />
<!-- end #menu --></div><br />
<!-- end #header --></div><br />
<br />
<div id="main"><br />
<br />
<h2 class="acc_trigger">01 <strong>ABSTRACT</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<p align="justify">In cells, engineered multi-enzyme pathways are common and are often physically and spatially organized, thus leading to the high output efficiency. But engineered synthetic pathways utilizing non-homologous enzymes often suffer from low efficiency of production caused by relative lack of spatial organization. RNA scaffold is designed to co-localize enzymes through interactions between binding domains on the scaffold and target peptides fused to each enzyme in engineered biological pathways in vivo. The scaffold allows efficient channeling of substrates to products over several enzymatic steps by limiting the diffusion of intermediates thus providing a bright future for solving the problem.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">ZJU-China aims to design and realize tunable RNA scaffolds to accelerate biological pathways and control them on and off. In order to achieve the object, we added an aptamer structure on RNA scaffold as a switch to regulate biological pathways by micromolecular ligands. Then we can control the all-or-none binding relationship between the enzymes and the scaffold by the absence and the presence of a special ligand. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">We demonstrated RNA scaffold do make the split GFPs get closer and fluoresce. As was expected, the riboscaffold with a theophylline aptamer can be regulated by theophylline in the range of 0-0.5mM IPTG. A scaffold library was also desired. By changing the sequence of MS2 aptamer binding site, we made the fluorescent decreased. The mutations with different arm length decrease the fluorescent intensity of split GPF by extending the distance between two split GFP parts FA and FB. It provides a series of half-on scaffolds. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Besides, we aimed to find some application for RNA scaffold to make the production of the multi-enzyme pathways more efficient. We have been working on the pathway of the production of IAA from tryptophan and the result will be gained soon later. </p><br />
<p align="justify">&nbsp;</p><br />
<br />
<br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">02 <strong>BACKGROUND</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<p align="justify">In cells, engineered multi-enzyme pathways are common and are often physically and spatially organized, thus leading to the high output efficiency. But engineered synthetic pathways utilizing non-homologous enzymes often suffer from low efficienty of production caused by relative lack of spatial organization. Thus important issue lies in the method to increase the efficiency of the multi-enzyme pathways. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Protein scaffolds can be designed to make enzymes closed through interactions between binding domains on the scaffold and target peptides fused to each enzyme. However, protein scaffold is usually large, has limit binding sites, and is hard to be engineered in architecture. DNA can be designed to self-assemble in vitro into many and varied nanostructures. However, DNA scaffold is hard to be controlled and might cause some potential problems in vivo. By contrast, RNA scaffold shows great advantages. For instance, RNA is more flexible, whose structures are varied, thus leading to their ease to splice. RNA scaffold is able to be controlled and has a satisfactory regulating efficiency. RNA scaffold works fast, because it doesn’t need translation like protein scaffold. Camille J. Delebecque and his colleagues have designed and assembled RNA structures and used them to speed up the reaction of hydrogen production. And that is what our project based on.</p><br />
<p align="justify">&nbsp;</p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b7/Zju_Backround_syn_and_bio.png" width="700px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Fig.1 The function of binding enzymes together of RNA scaffold illustrated by comic. The yellow girl is called “Syn”, the blue boy “Bio”. They represent non-homologous enzymes utilized in engineered synthetic pathways. Usually, they are far away from each other in E.coli, due to lack of spatial organization. But when RNA scaffold designed comes into E.coli, enzymes can be co-localized through interaction between binding domains on scaffold and target peptides fused each enzymes. That is to say, Syn and Bio can live together!</p><br />
<p align="justify">&nbsp;</p><br />
<br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">03 <strong>S0: BASIC RNA SCAFFOLD</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<h2>Backround</h2><br />
<p align="justify">Camille J. Delebecque and his colleagues have designed and assembled RNA structures and used them as scaffolds for the spatial organization of bacterial metabolism (Fig.1). Scaffold D0 consists of PP7 and MS2 aptamer domains that bind PP7 and MS2 fusion proteins. As told above, our project is based on the existing scaffold D0. In order to make sure that we can do further work on it, we planned to repeat the work about scaffold D0. </p><br />
<p align="justify">&nbsp;</p><br />
<h2>Design</h2><br />
<p align="justify">&nbsp;</p><br />
<img src="https://static.igem.org/mediawiki/2012/d/dc/ZJU_PROJECT_S0_Scaffold_d.jpg" width="600px" /><br />
<p>&nbsp;</p><br />
<p align="justify">Fig.1 How RNA scaffold works. FA and FB represent two halves of EGFP. FA and MS2 are connected with a linker of 30bp. FB and PP7 did the same. The purple scaffold is scaffold D0. MS2 and PP7 can specifically bind to two stem-loops on scaffold, thus FA and FB get closer and fluoresce under excitation of 480nm.</p><br />
<p>&nbsp;</p><br />
<h2>Materials and Methods</h2><br />
<p>&nbsp;</p><br />
<h3>1. Plasmids and Strains</h3><br />
<p align="justify">pCJDFA and pCJDFB respectively comprising the gene of half split EGFP (fragment A and fragment B) and MS2 or PP7 protein were constructed by overlap extension PCR. (See the Overlap PCR protocal) Genes MS2, PP7 and pCJDD0 are provided by Dr. Camille J. Delebecque. pEGFP is provided by Prof. Jianzhong Shao. </p><br />
<p>&nbsp;</p><br />
<p align="justify">Information of pCJDFA, pCJDFB and pCJDD0 are as the followings:</p><br />
<h5>1). pCJDFA: FA-MS2 cloned into T7 duet expression vectors pACYCDuet-1 Spr</h5><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/ZJU_PROJECT_S0_PCJDFA.png" width="600px" /><br />
<p>&nbsp;</p><br />
<h5>2) pCJDFB (FB-PP7 cloned into T7 duet expression vector pCOLADuet-1) Kanr</h5><br />
<img src="https://static.igem.org/mediawiki/2012/8/82/ZJU_PROJECT_S0_PCJDFB.png" width="600px" /><br />
<p>&nbsp;</p><br />
<h5>3) pCJDD0 (Scaffold D0 cloned into T7 duet expression vector PETDuet) Ampr</h5><br />
<p><h5>4) BL21-star(DE3)</h5> <br />
<p align="justify">cells were used to co-express plasmids. The most important feature of BL21-star(DE3) is that it carries a mutated rne gene (rne131) which encodes a truncated RNase E enzyme that lacks the ability to degrade mRNA, resulting in an increase in mRNA stability.</p><br />
<br />
<h3>2. Transformation and induction</h3><br />
<p>&nbsp;</p><br />
<p align="justify">Three groups of transformation were conducted. The first is BL21-star(DE3) transformed only with pCJDD0, the second with pCJDFA+pCJDFB, and the third with pCJDFA+pCJDFB+pCJDD0. </p><br />
<p>&nbsp;</p><br />
<p align="justify">Pick the single colony to cultivate in 3mL liquid LB with relative resistances. And when OD reached 0.4, induce with 0.2mM IPTG for 2h at 25 degree.</p><br />
<p>&nbsp;</p><br />
<p align="justify">Wash the bacteria twice with equivalent PBS. Then test the Fluorescence intensity (FI) and OD with Biotek Synergy Hybrid Reader.<br />
<p>&nbsp;</p><br />
<p align="justify">Data was shown in Fig.3. The fluorescence of different expression systems are pictured by Olympus fluoview fv1000 confocal laser scanning microscope ( Fig.2)<p><br />
<br />
<br />
<p align="justify">They were transformed with the pCJDD0 (plasmid with scaffold D0) into BL21-star-(DE3). </p><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">04 <strong>S1: RIBOSCAFFOLD</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<div class="projectNav"><br />
<div class="projectNavFloat"><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_1.htm">Summary</a><br />
<br><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_2.htm">Design</a><br />
</div><!-- end .projectNavFloat --> <br />
<div class="projectNavFloat"><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_4.htm">Preparation:Characterize previous parts</a><br />
<br><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_3.htm">Characterization</a><br />
<br />
</div><!-- end .projectNavFloat --><br />
<br class="clearfloat"><br />
</div><!-- end .projectNav --><br />
<br />
<iframe src="" frameborder="0" name="brainFrame" width="100%" height="500px"> </iframe> <br />
<br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">05 <strong>S2: SCAFFOLD LIBRARY</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<div style="height:800px;overflow:scroll;"> <br />
<br />
<p>Several mutations of RNA scaffold D0 have been designed and made. They show quite different characterizes and functions. With the experiment, more RNA scaffold mutations are characterized. Concept Library of RNA Scaffold is suggested.</p><br />
<p>&nbsp;</p><br />
<p>What is the Library of RNA Scaffold for? Evolution! The variable of RNA structures accommodates a wide application prospect. Though the point mutation reduced uncertainty of selection and the blindness, trying to find a suitable construction is vast project. Various experimental methods, selection and modeling should be used in this part. By analyzing existing mutations, derivation can be made to construct and find an enhanced RNA scaffold. We called this process evolution. </p><br />
<p>&nbsp;</p><br />
<p>The Library may contain changes of self, self-assemble, RNA-RNA interaction, RNA-protein interaction. Some examples are show below.</p><br />
<p>&nbsp;</p><br />
<p>1. Mutating arm length: changing the arm length of RNA scaffold D0. As the mechanism of D0 is reducing the distance of two key enzyme of the pathway, in other words, the output and reaction efficiency is depend on the local concentration. The two aptamer binding site in our project is on two hairpin arms witch are designed in the same length. The change of the arm length provides feasibility of distance-efficiency research. We used split GFP experiments. We made some mutations with different arm length, the result of D0M4 and D0M 5 split GFP experiment shows the light decreasing lend by split GFP FA-FB distance. The difference (PD0M4=0.079, PD0M5=0.025) suggests that the mutating arm length scaffold doesn’t provide an on/off switch but a definability one. It characterized the D0 in another way.</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/da/Zju_library_Fig1a.jpg" width="500px" /><br />
<p>fig 1a. D0 is the original scaffold. D0 a-d were mutated to the scaffold with different aptamer arm length. </p><br />
<img src="hthttps://static.igem.org/mediawiki/igem.org/f/f7/Zju_library_fig1b.jpg" width="500px" /><br />
<p>fig 1b. The result of arm length mutating. Both D0M4 and D0M5 scaffold half-on GEP.</p><br />
<p>&nbsp;</p><br />
<p>1.1 Mutating aptamer binding site: Mutating the PP7 and MS2 binding sites prevented protein scaffolding. Preventing protein scaffolding lead to the key enzyme dissociation and the decrease of enzyme local concentration. By chancing the sequence of MS2 aptamer binding site, the fluorescent light decreased. D0M3 in our project is the molecular with mutated aptamer binding site. Split GFP experiment shows that there is a significant difference between D0 an D0M3(P≦0.05, fig2.c). Camille J. Delebecque has done the same work for the H2 biosynthesis pathway.</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/a/ad/Zju_library_Fig2a.jpg" width="500px" /><br />
<p>fig2a. MS2 and PP7 bind to the scaffold and make GFP work. </p><br />
<img src="https://static.igem.org/mediawiki/igem.org/9/98/Zju_library_Fig2b.jpg" width="500px" /><br />
<p>fig2b. By mutating aptamer binding site, scaffolding is stop. </p><br />
<img src="https://static.igem.org/mediawiki/igem.org/3/33/Zju_library_fig2c.jpg" width="500px" /><br />
<p>fig2c. significant difference between D0 an D0M3</p><br />
<p>&nbsp;</p><br />
<p>1.2 Assemblage: adding extra sequence for self-, RNA-, protein-assemblage. The added sequence may be a riboswitch, RNA or protein binding site, self-assemble structure. Regulation molecular search is also wanted synchronously. </p><br />
<p>&nbsp;</p><br />
<p>Applications and outlook</p><br />
<p>&nbsp;</p><br />
<p>1.3 sRNA regulation: Simple an direct RNA-RNA interaction change the object RNA scaffold structure. As a Foundation regulation, it substantially enhances the possibilities of forthcoming experiment. </p> <br />
<img src="https://static.igem.org/mediawiki/igem.org/e/ec/Zju_library_Fig3.jpg" width="600px" /><br />
<p>fig3 The designed scaffold has a interaction to regulatory sRNA. Same mechanism, regulatory molecule can be changed to mRNA a. Turn off the scaffold by the competitive binding with aptamer binding site (green) b. The RNA scaffold has a secondary structural switch controls accessibility of sRNA-binding sites(blue) witch can change the arm length. Output regulated by arm length change. c. both methods were used. d. bind an release the object molecular.)</p><br />
<p>&nbsp;</p><br />
<p>1.4 Protein expression (mRNA) regulation: RNA scaffold as a free molecular in cell can specific bind mRNA and protein. Binding molecular changes the structure of scaffold to release or combine something. So that oncogene and virogene can be found and controlled by the drug from RNA scaffold. The problem of cancer therapeutic drug side effecting may solved by it. </p><br />
<p>&nbsp;</p><br />
<p>1.5 Self quenching(Self regulation): Adding self binding site, a balance of “on” and “off” scaffolds is built. The relationship between the binding site size, CG bases, binding form and the rate binding molecular is urgently modeled. Forming dimerization and trimerization, the concentration of working scaffold could be regulated.</p> \<br />
<p>&nbsp;</p><br />
<p>1.6 Polo-scaffold: Scaffold with intermolecular binding component. These scaffolds bind each other or bind through mediate molecular. And this binding mode has been proved both in vitro and vivo. The aggregation of molecular also makes artificial organelle achievable. </p><br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/2/2f/Zju_library_Fig4a.jpg" width="600px" /><br />
<p>fig4a Dimerization and trimerization. Protein binding site is sealed off by the scaffolds themselves. Too much scaffold molecular lend to the self regulation.<br />
<img src="https://static.igem.org/mediawiki/igem.org/b/be/Zju_library_Fig4b.jpg" width="600px" /><br />
<p>fig4b Dimerization and trimerization. Protein binding site is sealed off by the scaffolds themselves. Too much scaffold molecular lend to the self regulation.</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/8/8d/Zju_library_Fig4c.jpg" width="600px" /><br />
<p>fig4 c. Polo-scaffold be made by head-tail binding and.</p><br />
<p>&nbsp;</p><br />
<p>Several RNA scaffold mutations are constructed and characterize, but they are the tip of the iceberg. There is still plenty to do in this part. The charms of library are the selection and combination. It introduces a new concept of biobrick combination mode.</p><br />
<br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<br />
<h2 class="acc_trigger">06 <strong>S3: BIOSYNTHESIS OF IAA</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<p align="justify">&nbsp;</p><br />
<p align="justify">In previous work, FA and FB are used to indicate the efficiency of riboscaffold. In order to further prove the function of riboscaffold, we plan to substitute FA, FB with functional enzymes or protein substrates like ferredoxin in hydrogen producing pathway respectively. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Considering the availability of material and abundant parts distributed by iGEM, we search the 2012 kit plate1-5 to find optimal pathways. After a pre-selection, six pathways are on candidate list. For sake of experimental feasibility, we perform a further selection based on several caritas as follows:</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">1. Product is easy to detect and measure;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">2. Substrate is easy to get;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">3. Product is beneficial to human;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">4. The length of amino acid sequence of enzyme is optimal to be fusion protein;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">5. Two proteins involved in the basic pathway.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Candidate list:</p><br />
<p align="justify">&nbsp;</p><br />
<h2>1. Salicylate pathway</h2><br />
<h2>(Group: iGEM2006_MIT)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_1.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The characterization method of gas chromatography is difficult to perform. First, what can be analyzed is methyl salicylate production, that is to say, another enzyme should be co-transformed to E.coli too, which will increase cell’s burden and reduce the ratio of successful co-transformation. Second, it is not convenient for us to borrow the relative machine.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>2. Pyocyanin pathway</h2><br />
<h2>(Group: iGEM2007_Glasgow)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_2.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Through there are exactly two enzymes involved in this pathway, but the source of material, phenazine-1-carboxylic acid (PCA), is not mentioned. And it not easy to measure the amount of pyocyanin. </p><br />
<p align="justify">&nbsp;</p><br />
<h2>3. Lycopene pathway</h2><br />
<h2>(Group: iGEM2009_Cambridge) </h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_3.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Lycopene is visible red and its substrate, FPP, is colorless. So measurement is quite feasible. But there are at least three proteins in this pathway, which will increase the burden of cell. But in future work, we could have a try.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>4. Holo-&alpha;-phycoerythrocyanin pathway</h2><br />
<h2>(Group: iGEM2004_UTAustin)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_4.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Heme is metabolic product of E.coli and Holo-α-phycoerythrocyanin is blue. But at least 5 proteins should be expressed in E.coli.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>5. BPA degradation pathway</h2><br />
<h2>(Group: iGEM2008_University_of_Alberta)</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Bisphenol A is degraded by BisdA and BisdB. But BPA is toxic to cells.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>6. IAM pathway</h2><br />
<h2>(Group: iGEM2011_Imperial)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_5.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Five pathways described above all have some drawbacks, finally, only one pathway left, IAM pathway. The two-step IAM pathway generates indole-3-acetic acid (IAA) from the precursor tryptophan. IAA tryptophan monooxygenase (IaaM) catalyses the oxidative carboxylation of L-tryptophan to indole-3-acetamide, which is hydrolysed to IAA and ammonia by indoleacetamide hydrolase (IaaH). </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Final Decision: </p><br />
<p align="justify">&nbsp;</p><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_6.jpg" width="600px" /><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<br />
<br />
<h2 class="acc_trigger">07 <strong>PARTS</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<h2>1 Summary</h2><br />
<p>This is a summary of the parts that we have submitted to the <a href="http://partsregistry.org/Main_Page">Registry of Standard Biological Parts</a>. These parts include: </p><br />
<p>ncRNA scaffold generator: <a href="http://partsregistry.org/Part:BBa_K738000">BBa_K738000</a>, <a href="http://partsregistry.org/Part:BBa_K738002">BBa_K738002</a> </p><br />
<p>protein coding domains: <a href="http://partsregistry.org/Part:BBa_K738004">BBa_K738004</a> , <a href="http://partsregistry.org/Part:BBa_K738005">BBa_K738005</a> , <a href="http://partsregistry.org/Part:BBa_K738006">BBa_K738006</a> , <a href="http://partsregistry.org/Part:BBa_K738007">BBa_K738007</a> </p><br />
<p>These parts have all been well characterized. Please visit the Registry of Standard Biological Parts for more information.</p><br />
<h2>2 List</h2><br />
<br />
<table border="1"><br />
<tr><br />
<td>?</td><br />
<td>?</td><br />
<td>Name</td><br />
<td>Type</td><br />
<td>Description</td><br />
<td>Designer</td><br />
<td>Length</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738000">BBa_K738000</a></td><br />
<td>Generator</td><br />
<td>RNA Scaffold generator</td><br />
<td>Huachun Liu</td><br />
<td>171</td><br />
</tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/igem.org/f/f1/Zju_redheart.jpg" /></td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738002">BBa_K738002</a></td><br />
<td>Generator</td><br />
<td>Theophyline riboswitch regulated RNA Scoffold(clover version 2)</td><br />
<td>Huachun Liu</td><br />
<td>209</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738004">BBa_K738004</a></td><br />
<td>Generator</td><br />
<td>FA-2X-MS2;Split GFP N-terminal domain fused with MS2 protein</td><br />
<td>Huachun Liu</td><br />
<td>1284</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738005">BBa_K738005</a></td><br />
<td>Coding</td><br />
<td>FB-2X-PP7;Split GFP C-terminal domain fused with PP7 protein</td><br />
<td>Huachun Liu</td><br />
<td>654</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738006">BBa_K738006</a></td><br />
<td>Coding</td><br />
<td>FA: Split GFP N-terminal domain</td><br />
<td>Huachun Liu</td><br />
<td>480</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738007">BBa_K738007</a></td><br />
<td>Coding</td><br />
<td>FB, Split GFP C-terminal domain</td><br />
<td>Huachun Liu</td><br />
<td>255</td><br />
</tr><br />
</table><br />
<br />
<br />
<h2>3 Future work</h2><br />
<h3>Theophylline responded RNA riboscaffold</h3><br />
<p>We have designed two RNA riboscaffold responded to theophylline. Unfortunately, we only managed to submit one of them (BBa_K738002) to the Registry of Biological Parts in time (that means before September 26). </p><br />
<p>We have started the work of constructing a second theophylline responded RNA riboscaffold clover vision 3(but not finished). Clover vision 3 is different with BBa_K738002 in 3D structure, which may lead to results that are far away from that of BBa_K738002.</p><br />
<p>Please visit <a href="http://partsregistry.org/Part:BBa_K738002">here</a> for more information.</p><br />
<h3>Library</h3><br />
<p>We plan to develop a RNA scaffold library that offers more tunable responses. We’ve got several members in this library by now and our ultimate goal is acquiring a series of members which span a large acceleration rate range from about 10% to 90%. Thus, researchers may be able to choose a member in the library to acquire the targeted acceleration rate easily.</p><br />
<h3>Pathway of producing IAA</h3><br />
<p>Accelerating production of IAA with RNA scaffold has been proved to be efficient. Two enzymes, IaaH (BBa_K515000) and IaaM (BBa_K515001), are related to the process. We’ve fused IaaH and IaaM with MS2 and PP7 respectively to get IaaM-2X-MS2 and IaaH-2X-PP7, which are able to bind on RNA scaffold. We plan to make and submit this two protein as parts later. Thus, we’d like to regulate the biosynthesis process efficiency with RNA riboscaffold. We plan to submit BBa_K738014 and BBa_738015 later.</p><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<br />
<h2 class="acc_trigger">08 <strong>RESULTS</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<p>&nbsp;</p><br />
<h2>S0: BASIC RNA SCAFFOLD</h2><br />
<p>&nbsp;</p><br />
<p>Contrasted to the fluorescence intensity (FI) of the E.coli which only express FA-MS2 and FB-PP7 fusion proteins, the fluorescence intensity of the E.coli with scaffold D0 was obviously increased. Thus, it was possible for us to carry out our development and reformation of RNA scaffold.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/5/53/ZJU_PROJECT_S0_Confocal.jpg" width="600px" /><br />
<p>&nbsp;</p><br />
<p>Fig.2 FI of Split GFPs without or with RNA scaffold. A. BL21*(DE3) transformed with pCJDFA and pCJDFB. B. BL21*(DE3) transformed with pCJDFA, pCJDFB and pCJDD0. The contrast of FI obviously shown that RNA scaffold D0 could bind split GFPs together, so that split GFPs could fluoresce. (Pictures were obtained with Olympus fluoview fv1000 confocal laser scanning microscope, using a 60X objective.)</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/3/32/ZJU_PROJECT_S0_FI.png" width="600px" /><br />
<p>Fig.3 FI/OD of different transformation groups. There exist significant differences among three groups. And as expected, split GFPs with scaffold D0 together can fluoresce stronger than those without scaffold. </p><br />
<br />
<h3>Reference:</h3><br />
<p align="justify">1. Thodey, K. & Smolke, C.D. Bringing It Together with RNA. Science 333, 412-413 (2011).</p><br />
<p align="justify">2. Delebecque, C.J., Lindner, A.B., Silver, P.A. & Aldaye, F.A. Organization of Intracellular Reactions with Rationally Designed RNA Assemblies. Science 333, 470-474 (2011).</p><br />
<br />
<p>&nbsp;</p><br />
<h2>S1: RIBOSCAFFOLD</h2><br />
<p align="justify">&nbsp;</p><br />
<h3>Scaffold</h3><br />
<p align="justify">&nbsp;</p> <br />
<img src="https://static.igem.org/mediawiki/igem.org/5/5b/Riboscaffold_fig_12.jpg" width="700px" /><br />
<p align="justify">Fig.12 Fluorescence microscopy. The (BL21*DE3) of the E. coli were transformed with FA+FB, FA+FB+ original RNA scaffold D0, and FA+FB+ our designed RNA scaffold clover 2(0.5 mM theophylline adding). As expected, strains without RNA scaffold did not fluoresce. Upon the existence of RNA scaffold, many of the cells emitted fluorescence indicating a substantial amount of split GFP combination is permitted because of the function of RNA scaffold. The brightfield images in the right column depict all bacterial cells. The GFP images in the left column depict bacterial cells which emitted fluorescence. </p><br />
<p align="justify">&nbsp;</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/df/Riboscaffold_fig_13.jpg" width="700px" /><br />
<p align="justify">Fig.13 Biotek Synergy H1 Hybrid Reader controlled experiments. The BL21*DE3 of the E. coli were transformed with figure showing plasmids. (0.5 mM theophylline was adding in strains containing clover 2). </p><br />
<p align="justify">`luminescence \quad efficiency \quad of \quad clover 2=\frac{\frac{FI}{OD(FA+FB+clover 2)}-\frac{FI}{OD(FA+FB)}}{\frac{FI}{OD(FA+FB)}}=\frac{53425-23779}{23779}=125\%`</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">`luminescence \quad efficiency \quad of \quad D0=\frac{\frac{FI}{OD(FA+FB+clover 2)}-\frac{FI}{OD(FA+FB)}}{\frac{FI}{OD(FA+FB)}}=\frac{38288-23779}{23779}=61\%`</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The original intention of our designing RNA scaffold clover 2 is to create a regulatory scaffold which can tune its conformation thus have various functions. To our surprise, clover version 2, when adding optimal Theophylline concentration 0.5mM, happens to be a more powerful scaffold which helps two halves of GFP’s combination and give out light strongly.</p><br />
<br />
<p align="justify">One possible reason is in clover version 2, distance between MS2 aptamer and PP7 aptamer is closer than in D0 (showing in Fig.4 and Fig.6), so that when binding phage coat proteins, FA and FB on clover version 2 were set closer than on D0. We submit the inference that when RNA scaffold binds enzymes, clover version 2 draws two enzymes nearer than D0 thus has more ability to accelerate the enzymatic reaction.</p><br />
<br />
<br />
<h3>late and control by Theophylline</h3><br />
<p align="justify">When the concentration of Theophylline is in the range from 0mM to 0.5mM, the concentration of Theophylline and the resulting fluorescence intensity are directly proportional. </p><br />
<p align="justify">Theophylline concentration beyond certain extent will be hazardous to cells and how it affects cells depends on strain type. The study by NYMU Taipei 2010 alerted adding more than 4mM of Theophylline would cause E. coli to die. In our experiments, we find that after adding more than 0.5mM, the Theophylline spectrum curve would be invalid. As a result, we pick up data with concentrations below 0.5mM to analyze as the E. coli cell would be unstable or the regulation of the Theophylline aptamer would not be accurate. </p><br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/2/20/Screen_Shot_2012-09-26_at_%E4%B8%8B%E5%8D%885.27.52.png" width="700px" /><br />
<br />
<p align="justify">Fig.14 origin data of clover 2 regulatory tests. First line of each form is different treatments of Theophylline concentration and data in table cells are fluorescence intensity/ OD.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/2/25/Riboscaffold_fig_15_上.jpg" width="700px" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/2/2d/Riboscaffold_fig_15_下.jpg" width="700px" /><br />
<br />
<p align="justify">Fig.15 7 tests of fluorescence/ OD change over theophylline concentration. There’s evident positive correlation in between.</p><br />
<br />
<p align="justify">Then we build several SAS models to analyze data with SAS software GLM procedure between 0-0.5mM Theophylline concentrations of treatments, choosing” clover version 2: different treatments versus blocks” test 5-7 to run a SAS model.</p><br />
<p align="justify">ANOVA result P-value shows that Theophylline concentrations have significant impact on fluorescence intensity of clover version 2 and almost no impact on D0. That is to say, our designed RNA scaffold clover version 2 can be regulated and controlled by Theophylline within 0-0.5mM not for random errors or common phenomenon in RNA scaffolds.</p><br />
<br />
<p align="justify">If you want more details about SAS source programs and software computational results, please click here <a href="https://2012.igem.org/Team:ZJU-China/sourcecode1.htm">[code]</a>. </p><br />
<p>&nbsp;</p><br />
<h2>S2: SCAFFOLD LIBRARY</h2><br />
<p>&nbsp;</p><br />
<h2>S3: BIOSYNTHESIS OF IAA</h2><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">09 <strong>APPLICATIONS</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<h2>1. RNA aptamers take place of fluorescent proteins </h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Some RNA aptamers can bind fluorophores, such as 4-hydroxybenzlidene imidazolinone (HBI), 3,5-dimethoxy-4-hydroxybenzylidene imidazolinone (DMHBI), 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI), resembling the fluorophore in GFP, and then these RNA-fluorophore complexes enable to emit different colors of fluorescence comparable in brightness with fluorescent proteins. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">These RNA-fluorophore complexes could be used to tag RNAs in living cells to reveal the intracellular dynamics of RNA, including RNA-RNA and RNA-protein interactions.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Jeremy S. Paige, Karen Y. Wu, Samie R. Jaffrey, RNA Mimics of Green Fluorescent Protein science, 2011 vol 333, 642-646]</p><br />
<p align="justify">&nbsp;</p><br />
<h2>2. kinetic investigation of RNA hybridizations and foldings</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">By introducing fluorophores like 1-ethynylpyrene into the 2-position of RNA adenosine, through an intermolecular interaction of the pyrene residues in twofold labelled RNA, single and double strands can be distinguished by their fluorescence spectrum changes.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">With this fluorescence shift, one can distinguish between single-stranded and double-stranded RNA during thermal denaturation. This behavior could be used for the time resolved investigation of RNA hybridizations and folding by fluorescence spectroscopy.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Josef Wachtveitlb, Joachim W. Engels, ect. RNA as scaffold for pyrene excited complexes, Bioorganic & Medicinal Chemistry 16 (2008) 19-26]</p><br />
<p align="justify">&nbsp;</p><br />
<h2>3. Medicine & health</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">To date, many groups have successfully identifi ed aptamers with a variety of functions, including inhibitory and decoy-like aptamers, regulatable aptamers, multivalent/agonistic aptamers, and aptamers that act as delivery vehicles. Each of these classes of aptamers has potential applications in therapeutics and/or diagnostics.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Inhibitory aptamers:The most extensively characterized inhibitory aptamer is the RNA aptamer that targets VEGF. This aptamer was approved by the FDA in December 2004, for the treatment of wet age-related macular degeneration (AMD)</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Decoy-like aptamers:By mimicking the target sequence of the proteins, aptamers can act as decoys to inhibit binding of transcriptional factors such as HIV-tat, NF-κB, and E2F to their cognate sequences on DNA and thus prevent transcription of target genes and may result in powerful therapeutics for treating many human pathologies</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Multivalent aptamers: A bivalent aptamer targeting HIV has also been described and consists of 2 separate RNA aptamers that bind to 2 distinct stem-loop structures within the HIV 5′UTR: the HIV-1 TAR element and the dimerization initiation site. Similarly, bivalent aptamers targeting thrombin have been engineered as a way to increase the avidity of the aptamer for its target and enhance the anticoagulation effect</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Aptamers as delivery tools: Several groups have reported linking siRNAs to aptamers as a way to specifi cally deliver siRNAs to target cells. Aptamers are also being utilized to deliver toxins, radioisotopes, and chemotherapeutic agents encapsulated in nanoparticles.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Kristina W. Thiel and Paloma H. Giangrande, Therapeutic Applications of DNA and RNA Aptamers. Oligonucleotides, 2009, Volume 19, Number 3, 209-222]</p><br />
<p align="justify">&nbsp;</p><br />
<h2>4. Regular of gene expression</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Aptamers are small oligonucleic acid molecules that can be selected in vitro against nearly any target of choice. And they often show remarkable binding affinity and specificity, and consequently have a huge potential for application. One of their usages is to play a role in activating gene expression.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Some RNA aptamers can specifically bind some transcriptional regulator. For example, people have selected one RNA aptamer that can bind TetR, which usually binds on operator sequence and repress gene expression. So once the RNA aptamer binds to the transcriptional regulator, the targeting gene-expression is activated.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Anke Hunsicker, Markus Steber, ect. An RNA Aptamer that Induces Transcription, Chemistry & Biology, 2009,Volume 16, Issue 2, 173–180] </p><br />
<p align="justify">&nbsp;</p><br />
</div><br />
</div><!-- end .acc_container --><br />
<!-- end #main --></div><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<!-- end #columnRight --></div><br />
<!-- end .content --></div><br />
<!-- end .container --></div><br />
</div><!-- end .wrapper --><br />
<div><img src="https://static.igem.org/mediawiki/igem.org/d/d9/Zju_foot.png" width="100%"></div><br />
<div id="footer"><br />
<div id="footerImg"><br />
</div><!-- end footerImg --><br />
<!-- end #footer --></div> <br />
<script type="text/javascript"> Cufon.now(); </script><br />
</body></html></div>Smilehttp://2012.igem.org/Team:ZJU-China/project.htmTeam:ZJU-China/project.htm2012-09-26T18:45:53Z<p>Smile: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" class="cufon-active cufon-ready"><head><meta http-equiv="Content-Type" content="text/html; charset=UTF-8"><br />
<br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/ASCIIMathMLwFallback.js"></script> <br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/ASCIIMathTeXImg.js"></script><br />
<br />
<title>PROJECT</title><br />
<meta name="description" content=""><br />
<meta name="keywords" content=""><br />
<link rel="shortcut icon" type="image/vnd.microsoft.icon" href=""><br />
<link href="http://www.jiajunlu.com/igem/style.css" rel="stylesheet" type="text/css"><br />
<br />
<style type="text/css"><br />
body /* UltraGlobal Environment (origin item) */<br />
{<br />
background-color: #F8F8F8;<br />
}<br />
#blank ,<br />
#blank *<br />
{<br />
background-color: transparent;<br />
background-image: url("");<br />
border-style: none;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
<br />
#globalWrapper /* Global Environment (origin item) */<br />
{<br />
background-color: transparent;<br />
background-attachment: fixed;<br />
background-position: 50% 0;<br />
background-repeat: no-repeat;<br />
background-image: url("");<br />
overflow: hidden;<br />
}<br />
<br />
/* Remove Top Item (origin item) */<br />
#top-section<br />
{<br />
height: 0px;<br />
width: 100%;<br />
}<br />
#p-logo {<br />
display: none;<br />
}<br />
#top<br />
{<br />
display: none;<br />
}<br />
h1.firstHeading<br />
{<br />
display: none;<br />
}<br />
<br />
/* Inner Environment (origin item) */<br />
#content<br />
{<br />
background-color: transparent;<br />
background-image: url("https://static.igem.org/mediawiki/2012/e/e5/Zju_back.jpg");<br />
background-attachment: scroll;<br />
background-position: 50% 0;<br />
background-repeat: repeat-y;<br />
overflow: hidden;<br />
border-style: none;<br />
width: 100%;<br />
}<br />
#footer-box<br />
{<br />
background-color: #F8F8F8;<br />
background-image: none;<br />
border-style: none;<br />
margin-top: 100px;<br />
}<br />
#catlinks<br />
{<br />
display: none;<br />
}<br />
#content a,<br />
#content a:hover<br />
{<br />
color: black;<br />
display: inline;<br />
}<br />
#content a:link,<br />
#content a:visited<br />
{<br />
text-decoration: none;<br />
}<br />
#content a:hover,<br />
#content a:active<br />
{<br />
text-decoration: underline;<br />
}<br />
<br />
/* Bottom Environment (origin item) */<br />
#footer-box a,<br />
#footer-box a:hover<br />
{<br />
color: #e8e7b9;<br />
text-decoration: none;<br />
display: inline;<br />
}<br />
<br />
ul<br />
{<br />
list-style-image: none;<br />
list-style-type: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
li<br />
{<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
p<br />
{<br />
font-family: Arial, sans-serif;<br />
color: black;<br />
margin: 0;<br />
padding: 0;<br />
align: justify;<br />
}<br />
<br />
/* Common Environment */<br />
.center<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
}<br />
.floatL<br />
{<br />
float: left;<br />
clear: left;<br />
}<br />
.floatR<br />
{<br />
float: right;<br />
clear: right;<br />
}<br />
.floatC<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
float: none;<br />
clear: both;<br />
}<br />
.blank<br />
{<br />
filter: Alpha(Opacity=0%);<br />
-moz-opacity: 0;<br />
opacity: 0;<br />
}<br />
.hidden<br />
{<br />
display: none;<br />
}<br />
.show<br />
{<br />
display: block;<br />
}<br />
.show-text<br />
{<br />
display: inline;<br />
}<br />
.button img<br />
{<br />
display: block;<br />
}<br />
<br />
ul.horizontal > li<br />
{<br />
display: block;<br />
float: left;<br />
clear: none;<br />
overflow: hidden;<br />
}<br />
ul.vertical > li<br />
{<br />
display: block;<br />
float: left;<br />
clear: both;<br />
overflow: hidden;<br />
}<br />
<br />
#search-controls<br />
{<br />
display: none;<br />
}<br />
<br />
#footer-box<br />
{<br />
display: none;<br />
}<br />
<br />
</style><br />
<br />
<script src="http://www.jiajunlu.com/igem/cufon-yui.js" type="text/javascript"></script><style type="text/css">cufon{text-indent:0!important;}@media screen,projection{cufon{display:inline!important;display:inline-block!important;position:relative!important;vertical-align:middle!important;font-size:1px!important;line-height:1px!important;}cufon cufontext{display:-moz-inline-box!important;display:inline-block!important;width:0!important;height:0!important;overflow:hidden!important;text-indent:-10000in!important;}cufon canvas{position:relative!important;}}@media print{cufon{padding:0!important;}cufon canvas{display:none!important;}}</style><br />
<script src="http://www.jiajunlu.com/igem/gotham.js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
Cufon.replace('h3');<br />
<br />
<br />
</script><br />
<link rel="stylesheet" href="http://www.jiajunlu.com/igem/slide.css" type="text/css" media="screen"><br />
<link rel="stylesheet" href="http://www.jiajunlu.com/igem/accordion.css" type="text/css" media="screen"><br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
<br />
//Hide (Collapse) the toggle containers on load<br />
$(".acc_container").hide(); <br />
//Switch the "Open" and "Close" state per click then slide up/down (depending on open/close state)<br />
$("h2.acc_trigger").click(function(){<br />
$(this).toggleClass("active").next().slideToggle("slow");<br />
<br />
return false; //Prevent the browser jump to the link anchor<br />
});<br />
<br />
});<br />
</script><br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/my.js"></script><br />
<script src="http://www.jiajunlu.com/igem/slide.js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
function movetotop(){<br />
$("html, body").animate({ scrollTop: 0 }, "slow");<br />
return false;<br />
}<br />
$(function() {<br />
var offset = $("#logo").offset();<br />
var topPadding = 15;<br />
$(window).scroll(function() {<br />
if ($(window).scrollTop() > offset.top) {<br />
$("#logo").stop().animate({<br />
marginTop: $(window).scrollTop() - offset.top + topPadding<br />
});<br />
} else {<br />
$("#logo").stop().animate({<br />
marginTop: 0<br />
});<br />
};<br />
});<br />
});<br />
</script><br />
</head><br />
<body class="work"><br />
<br />
<div class="wrapper"><br />
<div class="container"><br />
<div class="content"><br />
<div id="columnLeft"><br />
<div id="logo" style="margin-top: 0px; " onclick="movetotop()"><br />
<a><img src="https://static.igem.org/mediawiki/2012/1/12/Zju_logo.png"></a><br />
<!-- end #logo --></div><br />
<!-- end #columnLeft" --></div><br />
<div id="columnRight"><br />
<div id="header"><br />
<div id="menu"><br />
<ul id="menu"><br />
<li class="1"><a href="https://2012.igem.org/Team:ZJU-China"><img src="http://www.jiajunlu.com/igem/home_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="2"><a href="https://2012.igem.org/Team:ZJU-China/aboutus.htm"><img src="http://www.jiajunlu.com/igem/aboutus_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="3"><a href="https://2012.igem.org/Team:ZJU-China/project.htm"><img src="http://www.jiajunlu.com/igem/project_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="4"><a href="https://2012.igem.org/Team:ZJU-China/models.htm"><img src="http://www.jiajunlu.com/igem/Zju_models_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="5"><a href="https://2012.igem.org/Team:ZJU-China/notebook.htm"><img src="http://www.jiajunlu.com/igem/notebook_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="6"><a href="https://2012.igem.org/Team:ZJU-China/humanpractice.htm"><img src="http://www.jiajunlu.com/igem/humanpractice_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="7"><a href="https://2012.igem.org/Team:ZJU-China/safty.htm"><img src="http://www.jiajunlu.com/igem/safty_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="8"><a href="https://2012.igem.org/Team:ZJU-China/achievement.htm"><img src="http://www.jiajunlu.com/igem/achievement_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="8"><a href="https://2012.igem.org"><img src="http://www.jiajunlu.com/igem/Zju_igem_btn.gif"></a></li><br />
<br />
</ul><br />
<!-- end #menu --></div><br />
<!-- end #header --></div><br />
<br />
<div id="main"><br />
<br />
<h2 class="acc_trigger">01 <strong>ABSTRACT</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<p align="justify">In cells, engineered multi-enzyme pathways are common and are often physically and spatially organized, thus leading to the high output efficiency. But engineered synthetic pathways utilizing non-homologous enzymes often suffer from low efficiency of production caused by relative lack of spatial organization. RNA scaffold is designed to co-localize enzymes through interactions between binding domains on the scaffold and target peptides fused to each enzyme in engineered biological pathways in vivo. The scaffold allows efficient channeling of substrates to products over several enzymatic steps by limiting the diffusion of intermediates thus providing a bright future for solving the problem.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">ZJU-China aims to design and realize tunable RNA scaffolds to accelerate biological pathways and control them on and off. In order to achieve the object, we added an aptamer structure on RNA scaffold as a switch to regulate biological pathways by micromolecular ligands. Then we can control the all-or-none binding relationship between the enzymes and the scaffold by the absence and the presence of a special ligand. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">We demonstrated RNA scaffold do make the split GFPs get closer and fluoresce. As was expected, the riboscaffold with a theophylline aptamer can be regulated by theophylline in the range of 0-0.5mM IPTG. A scaffold library was also desired. By changing the sequence of MS2 aptamer binding site, we made the fluorescent decreased. The mutations with different arm length decrease the fluorescent intensity of split GPF by extending the distance between two split GFP parts FA and FB. It provides a series of half-on scaffolds. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Besides, we aimed to find some application for RNA scaffold to make the production of the multi-enzyme pathways more efficient. We have been working on the pathway of the production of IAA from tryptophan and the result will be gained soon later. </p><br />
<p align="justify">&nbsp;</p><br />
<br />
<br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">02 <strong>BACKGROUND</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<p align="justify">In cells, engineered multi-enzyme pathways are common and are often physically and spatially organized, thus leading to the high output efficiency. But engineered synthetic pathways utilizing non-homologous enzymes often suffer from low efficienty of production caused by relative lack of spatial organization. Thus important issue lies in the method to increase the efficiency of the multi-enzyme pathways. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Protein scaffolds can be designed to make enzymes closed through interactions between binding domains on the scaffold and target peptides fused to each enzyme. However, protein scaffold is usually large, has limit binding sites, and is hard to be engineered in architecture. DNA can be designed to self-assemble in vitro into many and varied nanostructures. However, DNA scaffold is hard to be controlled and might cause some potential problems in vivo. By contrast, RNA scaffold shows great advantages. For instance, RNA is more flexible, whose structures are varied, thus leading to their ease to splice. RNA scaffold is able to be controlled and has a satisfactory regulating efficiency. RNA scaffold works fast, because it doesn’t need translation like protein scaffold. Camille J. Delebecque and his colleagues have designed and assembled RNA structures and used them to speed up the reaction of hydrogen production. And that is what our project based on.</p><br />
<p align="justify">&nbsp;</p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b7/Zju_Backround_syn_and_bio.png" width="700px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Fig.1 The function of binding enzymes together of RNA scaffold illustrated by comic. The yellow girl is called “Syn”, the blue boy “Bio”. They represent non-homologous enzymes utilized in engineered synthetic pathways. Usually, they are far away from each other in E.coli, due to lack of spatial organization. But when RNA scaffold designed comes into E.coli, enzymes can be co-localized through interaction between binding domains on scaffold and target peptides fused each enzymes. That is to say, Syn and Bio can live together!</p><br />
<p align="justify">&nbsp;</p><br />
<br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">03 <strong>S0: BASIC RNA SCAFFOLD</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<h2>Backround</h2><br />
<p align="justify">Camille J. Delebecque and his colleagues have designed and assembled RNA structures and used them as scaffolds for the spatial organization of bacterial metabolism (Fig.1). Scaffold D0 consists of PP7 and MS2 aptamer domains that bind PP7 and MS2 fusion proteins. As told above, our project is based on the existing scaffold D0. In order to make sure that we can do further work on it, we planned to repeat the work about scaffold D0. </p><br />
<p align="justify">&nbsp;</p><br />
<h2>Design</h2><br />
<p align="justify">&nbsp;</p><br />
<img src="https://static.igem.org/mediawiki/2012/d/dc/ZJU_PROJECT_S0_Scaffold_d.jpg" width="600px" /><br />
<p>&nbsp;</p><br />
<p align="justify">Fig.1 How RNA scaffold works. FA and FB represent two halves of EGFP. FA and MS2 are connected with a linker of 30bp. FB and PP7 did the same. The purple scaffold is scaffold D0. MS2 and PP7 can specifically bind to two stem-loops on scaffold, thus FA and FB get closer and fluoresce under excitation of 480nm.</p><br />
<p>&nbsp;</p><br />
<h2>Materials and Methods</h2><br />
<p>&nbsp;</p><br />
<h3>1. Plasmids and Strains</h3><br />
<p align="justify">pCJDFA and pCJDFB respectively comprising the gene of half split EGFP (fragment A and fragment B) and MS2 or PP7 protein were constructed by overlap extension PCR. (See the Overlap PCR protocal) Genes MS2, PP7 and pCJDD0 are provided by Dr. Camille J. Delebecque. pEGFP is provided by Prof. Jianzhong Shao. </p><br />
<p>&nbsp;</p><br />
<p align="justify">Information of pCJDFA, pCJDFB and pCJDD0 are as the followings:</p><br />
<h5>1). pCJDFA: FA-MS2 cloned into T7 duet expression vectors pACYCDuet-1 Spr</h5><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/ZJU_PROJECT_S0_PCJDFA.png" width="600px" /><br />
<p>&nbsp;</p><br />
<h5>2) pCJDFB (FB-PP7 cloned into T7 duet expression vector pCOLADuet-1) Kanr</h5><br />
<img src="https://static.igem.org/mediawiki/2012/8/82/ZJU_PROJECT_S0_PCJDFB.png" width="600px" /><br />
<p>&nbsp;</p><br />
<h5>3) pCJDD0 (Scaffold D0 cloned into T7 duet expression vector PETDuet) Ampr</h5><br />
<p><h5>4) BL21-star(DE3)</h5> <br />
<p align="justify">cells were used to co-express plasmids. The most important feature of BL21-star(DE3) is that it carries a mutated rne gene (rne131) which encodes a truncated RNase E enzyme that lacks the ability to degrade mRNA, resulting in an increase in mRNA stability.</p><br />
<br />
<h3>2. Transformation and induction</h3><br />
<p>&nbsp;</p><br />
<p align="justify">Three groups of transformation were conducted. The first is BL21-star(DE3) transformed only with pCJDD0, the second with pCJDFA+pCJDFB, and the third with pCJDFA+pCJDFB+pCJDD0. </p><br />
<p>&nbsp;</p><br />
<p align="justify">Pick the single colony to cultivate in 3mL liquid LB with relative resistances. And when OD reached 0.4, induce with 0.2mM IPTG for 2h at 25 degree.</p><br />
<p>&nbsp;</p><br />
<p align="justify">Wash the bacteria twice with equivalent PBS. Then test the Fluorescence intensity (FI) and OD with Biotek Synergy Hybrid Reader.<br />
<p>&nbsp;</p><br />
<p align="justify">Data was shown in Fig.3. The fluorescence of different expression systems are pictured by Olympus fluoview fv1000 confocal laser scanning microscope ( Fig.2)<p><br />
<br />
<br />
<p align="justify">They were transformed with the pCJDD0 (plasmid with scaffold D0) into BL21-star-(DE3). </p><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">04 <strong>S1: RIBOSCAFFOLD</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<div class="projectNav"><br />
<div class="projectNavFloat"><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_1.htm">Summary</a><br />
<br><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_2.htm">Design</a><br />
</div><!-- end .projectNavFloat --> <br />
<div class="projectNavFloat"><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_4.htm">Preparation:Characterize previous parts</a><br />
<br><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_3.htm">Characterization</a><br />
<br />
</div><!-- end .projectNavFloat --><br />
<br class="clearfloat"><br />
</div><!-- end .projectNav --><br />
<br />
<iframe src="" frameborder="0" name="brainFrame" width="100%" height="500px"> </iframe> <br />
<br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">05 <strong>S2: SCAFFOLD LIBRARY</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<div style="height:800px;overflow:scroll;"> <br />
<br />
<p>Several mutations of RNA scaffold D0 have been designed and made. They show quite different characterizes and functions. With the experiment, more RNA scaffold mutations are characterized. Concept Library of RNA Scaffold is suggested.</p><br />
<p>&nbsp;</p><br />
<p>What is the Library of RNA Scaffold for? Evolution! The variable of RNA structures accommodates a wide application prospect. Though the point mutation reduced uncertainty of selection and the blindness, trying to find a suitable construction is vast project. Various experimental methods, selection and modeling should be used in this part. By analyzing existing mutations, derivation can be made to construct and find an enhanced RNA scaffold. We called this process evolution. </p><br />
<p>&nbsp;</p><br />
<p>The Library may contain changes of self, self-assemble, RNA-RNA interaction, RNA-protein interaction. Some examples are show below.</p><br />
<p>&nbsp;</p><br />
<p>1. Mutating arm length: changing the arm length of RNA scaffold D0. As the mechanism of D0 is reducing the distance of two key enzyme of the pathway, in other words, the output and reaction efficiency is depend on the local concentration. The two aptamer binding site in our project is on two hairpin arms witch are designed in the same length. The change of the arm length provides feasibility of distance-efficiency research. We used split GFP experiments. We made some mutations with different arm length, the result of D0M4 and D0M 5 split GFP experiment shows the light decreasing lend by split GFP FA-FB distance. The difference (PD0M4=0.079, PD0M5=0.025) suggests that the mutating arm length scaffold doesn’t provide an on/off switch but a definability one. It characterized the D0 in another way.</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/da/Zju_library_Fig1a.jpg" width="500px" /><br />
<p>fig 1a. D0 is the original scaffold. D0 a-d were mutated to the scaffold with different aptamer arm length. </p><br />
<img src="hthttps://static.igem.org/mediawiki/igem.org/f/f7/Zju_library_fig1b.jpg" width="500px" /><br />
<p>fig 1b. The result of arm length mutating. Both D0M4 and D0M5 scaffold half-on GEP.</p><br />
<p>&nbsp;</p><br />
<p>1.1 Mutating aptamer binding site: Mutating the PP7 and MS2 binding sites prevented protein scaffolding. Preventing protein scaffolding lead to the key enzyme dissociation and the decrease of enzyme local concentration. By chancing the sequence of MS2 aptamer binding site, the fluorescent light decreased. D0M3 in our project is the molecular with mutated aptamer binding site. Split GFP experiment shows that there is a significant difference between D0 an D0M3(P≦0.05, fig2.c). Camille J. Delebecque has done the same work for the H2 biosynthesis pathway.</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/a/ad/Zju_library_Fig2a.jpg" width="500px" /><br />
<p>fig2a. MS2 and PP7 bind to the scaffold and make GFP work. </p><br />
<img src="https://static.igem.org/mediawiki/igem.org/9/98/Zju_library_Fig2b.jpg" width="500px" /><br />
<p>fig2b. By mutating aptamer binding site, scaffolding is stop. </p><br />
<img src="https://static.igem.org/mediawiki/igem.org/3/33/Zju_library_fig2c.jpg" width="500px" /><br />
<p>fig2c. significant difference between D0 an D0M3</p><br />
<p>&nbsp;</p><br />
<p>1.2 Assemblage: adding extra sequence for self-, RNA-, protein-assemblage. The added sequence may be a riboswitch, RNA or protein binding site, self-assemble structure. Regulation molecular search is also wanted synchronously. </p><br />
<p>&nbsp;</p><br />
<p>Applications and outlook</p><br />
<p>&nbsp;</p><br />
<p>1.3 sRNA regulation: Simple an direct RNA-RNA interaction change the object RNA scaffold structure. As a Foundation regulation, it substantially enhances the possibilities of forthcoming experiment. </p> <br />
<img src="https://static.igem.org/mediawiki/igem.org/e/ec/Zju_library_Fig3.jpg" width="600px" /><br />
<p>fig3 The designed scaffold has a interaction to regulatory sRNA. Same mechanism, regulatory molecule can be changed to mRNA a. Turn off the scaffold by the competitive binding with aptamer binding site (green) b. The RNA scaffold has a secondary structural switch controls accessibility of sRNA-binding sites(blue) witch can change the arm length. Output regulated by arm length change. c. both methods were used. d. bind an release the object molecular.)</p><br />
<p>&nbsp;</p><br />
<p>1.4 Protein expression (mRNA) regulation: RNA scaffold as a free molecular in cell can specific bind mRNA and protein. Binding molecular changes the structure of scaffold to release or combine something. So that oncogene and virogene can be found and controlled by the drug from RNA scaffold. The problem of cancer therapeutic drug side effecting may solved by it. </p><br />
<p>&nbsp;</p><br />
<p>1.5 Self quenching(Self regulation): Adding self binding site, a balance of “on” and “off” scaffolds is built. The relationship between the binding site size, CG bases, binding form and the rate binding molecular is urgently modeled. Forming dimerization and trimerization, the concentration of working scaffold could be regulated.</p> \<br />
<p>&nbsp;</p><br />
<p>1.6 Polo-scaffold: Scaffold with intermolecular binding component. These scaffolds bind each other or bind through mediate molecular. And this binding mode has been proved both in vitro and vivo. The aggregation of molecular also makes artificial organelle achievable. </p><br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/2/2f/Zju_library_Fig4a.jpg" width="600px" /><br />
<p>fig4a Dimerization and trimerization. Protein binding site is sealed off by the scaffolds themselves. Too much scaffold molecular lend to the self regulation.<br />
<img src="https://static.igem.org/mediawiki/igem.org/b/be/Zju_library_Fig4b.jpg" width="600px" /><br />
<p>fig4b Dimerization and trimerization. Protein binding site is sealed off by the scaffolds themselves. Too much scaffold molecular lend to the self regulation.</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/8/8d/Zju_library_Fig4c.jpg" width="600px" /><br />
<p>fig4 c. Polo-scaffold be made by head-tail binding and.</p><br />
<p>&nbsp;</p><br />
<p>Several RNA scaffold mutations are constructed and characterize, but they are the tip of the iceberg. There is still plenty to do in this part. The charms of library are the selection and combination. It introduces a new concept of biobrick combination mode.</p><br />
<br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<br />
<h2 class="acc_trigger">06 <strong>S3: BIOSYNTHESIS OF IAA</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<p align="justify">&nbsp;</p><br />
<p align="justify">In previous work, FA and FB are used to indicate the efficiency of riboscaffold. In order to further prove the function of riboscaffold, we plan to substitute FA, FB with functional enzymes or protein substrates like ferredoxin in hydrogen producing pathway respectively. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Considering the availability of material and abundant parts distributed by iGEM, we search the 2012 kit plate1-5 to find optimal pathways. After a pre-selection, six pathways are on candidate list. For sake of experimental feasibility, we perform a further selection based on several caritas as follows:</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">1. Product is easy to detect and measure;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">2. Substrate is easy to get;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">3. Product is beneficial to human;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">4. The length of amino acid sequence of enzyme is optimal to be fusion protein;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">5. Two proteins involved in the basic pathway.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Candidate list:</p><br />
<p align="justify">&nbsp;</p><br />
<h2>1. Salicylate pathway</h2><br />
<h2>(Group: iGEM2006_MIT)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_1.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The characterization method of gas chromatography is difficult to perform. First, what can be analyzed is methyl salicylate production, that is to say, another enzyme should be co-transformed to E.coli too, which will increase cell’s burden and reduce the ratio of successful co-transformation. Second, it is not convenient for us to borrow the relative machine.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>2. Pyocyanin pathway</h2><br />
<h2>(Group: iGEM2007_Glasgow)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_2.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Through there are exactly two enzymes involved in this pathway, but the source of material, phenazine-1-carboxylic acid (PCA), is not mentioned. And it not easy to measure the amount of pyocyanin. </p><br />
<p align="justify">&nbsp;</p><br />
<h2>3. Lycopene pathway</h2><br />
<h2>(Group: iGEM2009_Cambridge) </h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_3.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Lycopene is visible red and its substrate, FPP, is colorless. So measurement is quite feasible. But there are at least three proteins in this pathway, which will increase the burden of cell. But in future work, we could have a try.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>4. Holo-&alpha;-phycoerythrocyanin pathway</h2><br />
<h2>(Group: iGEM2004_UTAustin)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_4.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Heme is metabolic product of E.coli and Holo-α-phycoerythrocyanin is blue. But at least 5 proteins should be expressed in E.coli.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>5. BPA degradation pathway</h2><br />
<h2>(Group: iGEM2008_University_of_Alberta)</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Bisphenol A is degraded by BisdA and BisdB. But BPA is toxic to cells.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>6. IAM pathway</h2><br />
<h2>(Group: iGEM2011_Imperial)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_5.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Five pathways described above all have some drawbacks, finally, only one pathway left, IAM pathway. The two-step IAM pathway generates indole-3-acetic acid (IAA) from the precursor tryptophan. IAA tryptophan monooxygenase (IaaM) catalyses the oxidative carboxylation of L-tryptophan to indole-3-acetamide, which is hydrolysed to IAA and ammonia by indoleacetamide hydrolase (IaaH). </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Final Decision: </p><br />
<p align="justify">&nbsp;</p><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_6.jpg" width="600px" /><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<br />
<br />
<h2 class="acc_trigger">07 <strong>PARTS</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<h2>01 Summary</h2><br />
<p>This is a summary of the parts that we have submitted to the <a href="http://partsregistry.org/Main_Page">Registry of Standard Biological Parts</a>. These parts include: </p><br />
<p>ncRNA scaffold generator: <a href="http://partsregistry.org/Part:BBa_K738000">BBa_K738000</a>, <a href="http://partsregistry.org/Part:BBa_K738002">BBa_K738002</a> </p><br />
<p>protein coding domains: <a href="http://partsregistry.org/Part:BBa_K738004">BBa_K738004</a> , <a href="http://partsregistry.org/Part:BBa_K738005">BBa_K738005</a> , <a href="http://partsregistry.org/Part:BBa_K738006">BBa_K738006</a> , <a href="http://partsregistry.org/Part:BBa_K738007">BBa_K738007</a> </p><br />
<p>These parts have all been well characterized. Please visit the Registry of Standard Biological Parts for more information.</p><br />
<h2>02 List</h2><br />
<br />
<table border="1"><br />
<tr><br />
<td>?</td><br />
<td>?</td><br />
<td>Name</td><br />
<td>Type</td><br />
<td>Description</td><br />
<td>Designer</td><br />
<td>Length</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738000">BBa_K738000</a></td><br />
<td>Generator</td><br />
<td>RNA Scaffold generator</td><br />
<td>Huachun Liu</td><br />
<td>171</td><br />
</tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/igem.org/f/f1/Zju_redheart.jpg" /></td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738002">BBa_K738002</a></td><br />
<td>Generator</td><br />
<td>Theophyline riboswitch regulated RNA Scoffold(clover version 2)</td><br />
<td>Huachun Liu</td><br />
<td>209</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738004">BBa_K738004</a></td><br />
<td>Generator</td><br />
<td>FA-2X-MS2;Split GFP N-terminal domain fused with MS2 protein</td><br />
<td>Huachun Liu</td><br />
<td>1284</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738005">BBa_K738005</a></td><br />
<td>Coding</td><br />
<td>FB-2X-PP7;Split GFP C-terminal domain fused with PP7 protein</td><br />
<td>Huachun Liu</td><br />
<td>654</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738006">BBa_K738006</a></td><br />
<td>Coding</td><br />
<td>FA: Split GFP N-terminal domain</td><br />
<td>Huachun Liu</td><br />
<td>480</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738007">BBa_K738007</a></td><br />
<td>Coding</td><br />
<td>FB, Split GFP C-terminal domain</td><br />
<td>Huachun Liu</td><br />
<td>255</td><br />
</tr><br />
</table><br />
<br />
<br />
<h2>03 Future work</h2><br />
<h3>Theophylline responded RNA riboscaffold</h3><br />
<p>We have designed two RNA riboscaffold responded to theophylline. Unfortunately, we only managed to submit one of them (K738002) to the Registry of Biological Parts in time (that means before September 26). </p><br />
<p>We have started the work of constructing a second theophylline responded RNA riboscaffold clover vision 3(but not finished). Clover vision 3 is different with K738002 in 3D structure, which may lead to results that are far away from that of K738002.</p><br />
<p>Please visit <a href="http://partsregistry.org/Part:BBa_K738002">here</a> for more information.</p><br />
<h3>Library</h3><br />
<p>We plan to develop a RNA scaffold library that offers more tunable responses. We’ve got several members in this library by now and our ultimate goal is acquiring a series of members which span a large acceleration rate range from about 10% to 90%. Thus, researchers may be able to choose a member in the library to acquire the targeted acceleration rate easily.</p><br />
<h3>Pathway of producing IAA</h3><br />
<p>Accelerating production of IAA with RNA scaffold has been proved to be efficient. Two enzymes, IaaH (BBa_K515000) and IaaM (BBa_K515001), are related to the process. We’ve fused IaaH and IaaM with MS2 and PP7 respectively to get IaaM-2X-MS2 and IaaH-2X-PP7, which are able to bind on RNA scaffold. We plan to make and submit this two protein as parts later. Thus, we’d like to regulate the biosynthesis process efficiency with RNA riboscaffold. We plan to submit BBa_K738014 and BBa_738015 later.</p><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<br />
<h2 class="acc_trigger">08 <strong>RESULTS</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<p>&nbsp;</p><br />
<h2>S0: BASIC RNA SCAFFOLD</h2><br />
<p>&nbsp;</p><br />
<p>Contrasted to the fluorescence intensity (FI) of the E.coli which only express FA-MS2 and FB-PP7 fusion proteins, the fluorescence intensity of the E.coli with scaffold D0 was obviously increased. Thus, it was possible for us to carry out our development and reformation of RNA scaffold.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/5/53/ZJU_PROJECT_S0_Confocal.jpg" width="600px" /><br />
<p>&nbsp;</p><br />
<p>Fig.2 FI of Split GFPs without or with RNA scaffold. A. BL21*(DE3) transformed with pCJDFA and pCJDFB. B. BL21*(DE3) transformed with pCJDFA, pCJDFB and pCJDD0. The contrast of FI obviously shown that RNA scaffold D0 could bind split GFPs together, so that split GFPs could fluoresce. (Pictures were obtained with Olympus fluoview fv1000 confocal laser scanning microscope, using a 60X objective.)</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/3/32/ZJU_PROJECT_S0_FI.png" width="600px" /><br />
<p>Fig.3 FI/OD of different transformation groups. There exist significant differences among three groups. And as expected, split GFPs with scaffold D0 together can fluoresce stronger than those without scaffold. </p><br />
<br />
<h3>Reference:</h3><br />
<p align="justify">1. Thodey, K. & Smolke, C.D. Bringing It Together with RNA. Science 333, 412-413 (2011).</p><br />
<p align="justify">2. Delebecque, C.J., Lindner, A.B., Silver, P.A. & Aldaye, F.A. Organization of Intracellular Reactions with Rationally Designed RNA Assemblies. Science 333, 470-474 (2011).</p><br />
<br />
<p>&nbsp;</p><br />
<h2>S1: RIBOSCAFFOLD</h2><br />
<p align="justify">&nbsp;</p><br />
<h3>Scaffold</h3><br />
<p align="justify">&nbsp;</p> <br />
<img src="https://static.igem.org/mediawiki/igem.org/5/5b/Riboscaffold_fig_12.jpg" width="700px" /><br />
<p align="justify">Fig.12 Fluorescence microscopy. The (BL21*DE3) of the E. coli were transformed with FA+FB, FA+FB+ original RNA scaffold D0, and FA+FB+ our designed RNA scaffold clover 2(0.5 mM theophylline adding). As expected, strains without RNA scaffold did not fluoresce. Upon the existence of RNA scaffold, many of the cells emitted fluorescence indicating a substantial amount of split GFP combination is permitted because of the function of RNA scaffold. The brightfield images in the right column depict all bacterial cells. The GFP images in the left column depict bacterial cells which emitted fluorescence. </p><br />
<p align="justify">&nbsp;</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/df/Riboscaffold_fig_13.jpg" width="700px" /><br />
<p align="justify">Fig.13 Biotek Synergy H1 Hybrid Reader controlled experiments. The BL21*DE3 of the E. coli were transformed with figure showing plasmids. (0.5 mM theophylline was adding in strains containing clover 2). </p><br />
<p align="justify">`luminescence \quad efficiency \quad of \quad clover 2=\frac{\frac{FI}{OD(FA+FB+clover 2)}-\frac{FI}{OD(FA+FB)}}{\frac{FI}{OD(FA+FB)}}=\frac{53425-23779}{23779}=125\%`</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">`luminescence \quad efficiency \quad of \quad D0=\frac{\frac{FI}{OD(FA+FB+clover 2)}-\frac{FI}{OD(FA+FB)}}{\frac{FI}{OD(FA+FB)}}=\frac{38288-23779}{23779}=61\%`</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The original intention of our designing RNA scaffold clover 2 is to create a regulatory scaffold which can tune its conformation thus have various functions. To our surprise, clover version 2, when adding optimal Theophylline concentration 0.5mM, happens to be a more powerful scaffold which helps two halves of GFP’s combination and give out light strongly.</p><br />
<br />
<p align="justify">One possible reason is in clover version 2, distance between MS2 aptamer and PP7 aptamer is closer than in D0 (showing in Fig.4 and Fig.6), so that when binding phage coat proteins, FA and FB on clover version 2 were set closer than on D0. We submit the inference that when RNA scaffold binds enzymes, clover version 2 draws two enzymes nearer than D0 thus has more ability to accelerate the enzymatic reaction.</p><br />
<br />
<br />
<h3>late and control by Theophylline</h3><br />
<p align="justify">When the concentration of Theophylline is in the range from 0mM to 0.5mM, the concentration of Theophylline and the resulting fluorescence intensity are directly proportional. </p><br />
<p align="justify">Theophylline concentration beyond certain extent will be hazardous to cells and how it affects cells depends on strain type. The study by NYMU Taipei 2010 alerted adding more than 4mM of Theophylline would cause E. coli to die. In our experiments, we find that after adding more than 0.5mM, the Theophylline spectrum curve would be invalid. As a result, we pick up data with concentrations below 0.5mM to analyze as the E. coli cell would be unstable or the regulation of the Theophylline aptamer would not be accurate. </p><br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/2/20/Screen_Shot_2012-09-26_at_%E4%B8%8B%E5%8D%885.27.52.png" width="700px" /><br />
<br />
<p align="justify">Fig.14 origin data of clover 2 regulatory tests. First line of each form is different treatments of Theophylline concentration and data in table cells are fluorescence intensity/ OD.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/2/25/Riboscaffold_fig_15_上.jpg" width="700px" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/2/2d/Riboscaffold_fig_15_下.jpg" width="700px" /><br />
<br />
<p align="justify">Fig.15 7 tests of fluorescence/ OD change over theophylline concentration. There’s evident positive correlation in between.</p><br />
<br />
<p align="justify">Then we build several SAS models to analyze data with SAS software GLM procedure between 0-0.5mM Theophylline concentrations of treatments, choosing” clover version 2: different treatments versus blocks” test 5-7 to run a SAS model.</p><br />
<p align="justify">ANOVA result P-value shows that Theophylline concentrations have significant impact on fluorescence intensity of clover version 2 and almost no impact on D0. That is to say, our designed RNA scaffold clover version 2 can be regulated and controlled by Theophylline within 0-0.5mM not for random errors or common phenomenon in RNA scaffolds.</p><br />
<br />
<p align="justify">If you want more details about SAS source programs and software computational results, please click here <a href="https://2012.igem.org/Team:ZJU-China/sourcecode1.htm">[code]</a>. </p><br />
<p>&nbsp;</p><br />
<h2>S2: SCAFFOLD LIBRARY</h2><br />
<p>&nbsp;</p><br />
<h2>S3: BIOSYNTHESIS OF IAA</h2><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">09 <strong>APPLICATIONS</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<h2>1. RNA aptamers take place of fluorescent proteins </h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Some RNA aptamers can bind fluorophores, such as 4-hydroxybenzlidene imidazolinone (HBI), 3,5-dimethoxy-4-hydroxybenzylidene imidazolinone (DMHBI), 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI), resembling the fluorophore in GFP, and then these RNA-fluorophore complexes enable to emit different colors of fluorescence comparable in brightness with fluorescent proteins. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">These RNA-fluorophore complexes could be used to tag RNAs in living cells to reveal the intracellular dynamics of RNA, including RNA-RNA and RNA-protein interactions.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Jeremy S. Paige, Karen Y. Wu, Samie R. Jaffrey, RNA Mimics of Green Fluorescent Protein science, 2011 vol 333, 642-646]</p><br />
<p align="justify">&nbsp;</p><br />
<h2>2. kinetic investigation of RNA hybridizations and foldings</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">By introducing fluorophores like 1-ethynylpyrene into the 2-position of RNA adenosine, through an intermolecular interaction of the pyrene residues in twofold labelled RNA, single and double strands can be distinguished by their fluorescence spectrum changes.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">With this fluorescence shift, one can distinguish between single-stranded and double-stranded RNA during thermal denaturation. This behavior could be used for the time resolved investigation of RNA hybridizations and folding by fluorescence spectroscopy.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Josef Wachtveitlb, Joachim W. Engels, ect. RNA as scaffold for pyrene excited complexes, Bioorganic & Medicinal Chemistry 16 (2008) 19-26]</p><br />
<p align="justify">&nbsp;</p><br />
<h2>3. Medicine & health</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">To date, many groups have successfully identifi ed aptamers with a variety of functions, including inhibitory and decoy-like aptamers, regulatable aptamers, multivalent/agonistic aptamers, and aptamers that act as delivery vehicles. Each of these classes of aptamers has potential applications in therapeutics and/or diagnostics.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Inhibitory aptamers:The most extensively characterized inhibitory aptamer is the RNA aptamer that targets VEGF. This aptamer was approved by the FDA in December 2004, for the treatment of wet age-related macular degeneration (AMD)</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Decoy-like aptamers:By mimicking the target sequence of the proteins, aptamers can act as decoys to inhibit binding of transcriptional factors such as HIV-tat, NF-κB, and E2F to their cognate sequences on DNA and thus prevent transcription of target genes and may result in powerful therapeutics for treating many human pathologies</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Multivalent aptamers: A bivalent aptamer targeting HIV has also been described and consists of 2 separate RNA aptamers that bind to 2 distinct stem-loop structures within the HIV 5′UTR: the HIV-1 TAR element and the dimerization initiation site. Similarly, bivalent aptamers targeting thrombin have been engineered as a way to increase the avidity of the aptamer for its target and enhance the anticoagulation effect</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Aptamers as delivery tools: Several groups have reported linking siRNAs to aptamers as a way to specifi cally deliver siRNAs to target cells. Aptamers are also being utilized to deliver toxins, radioisotopes, and chemotherapeutic agents encapsulated in nanoparticles.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Kristina W. Thiel and Paloma H. Giangrande, Therapeutic Applications of DNA and RNA Aptamers. Oligonucleotides, 2009, Volume 19, Number 3, 209-222]</p><br />
<p align="justify">&nbsp;</p><br />
<h2>4. Regular of gene expression</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Aptamers are small oligonucleic acid molecules that can be selected in vitro against nearly any target of choice. And they often show remarkable binding affinity and specificity, and consequently have a huge potential for application. One of their usages is to play a role in activating gene expression.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Some RNA aptamers can specifically bind some transcriptional regulator. For example, people have selected one RNA aptamer that can bind TetR, which usually binds on operator sequence and repress gene expression. So once the RNA aptamer binds to the transcriptional regulator, the targeting gene-expression is activated.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Anke Hunsicker, Markus Steber, ect. An RNA Aptamer that Induces Transcription, Chemistry & Biology, 2009,Volume 16, Issue 2, 173–180] </p><br />
<p align="justify">&nbsp;</p><br />
</div><br />
</div><!-- end .acc_container --><br />
<!-- end #main --></div><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<!-- end #columnRight --></div><br />
<!-- end .content --></div><br />
<!-- end .container --></div><br />
</div><!-- end .wrapper --><br />
<div><img src="https://static.igem.org/mediawiki/igem.org/d/d9/Zju_foot.png" width="100%"></div><br />
<div id="footer"><br />
<div id="footerImg"><br />
</div><!-- end footerImg --><br />
<!-- end #footer --></div> <br />
<script type="text/javascript"> Cufon.now(); </script><br />
</body></html></div>Smilehttp://2012.igem.org/Team:ZJU-China/project.htmTeam:ZJU-China/project.htm2012-09-26T18:40:16Z<p>Smile: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" class="cufon-active cufon-ready"><head><meta http-equiv="Content-Type" content="text/html; charset=UTF-8"><br />
<br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/ASCIIMathMLwFallback.js"></script> <br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/ASCIIMathTeXImg.js"></script><br />
<br />
<title>PROJECT</title><br />
<meta name="description" content=""><br />
<meta name="keywords" content=""><br />
<link rel="shortcut icon" type="image/vnd.microsoft.icon" href=""><br />
<link href="http://www.jiajunlu.com/igem/style.css" rel="stylesheet" type="text/css"><br />
<br />
<style type="text/css"><br />
body /* UltraGlobal Environment (origin item) */<br />
{<br />
background-color: #F8F8F8;<br />
}<br />
#blank ,<br />
#blank *<br />
{<br />
background-color: transparent;<br />
background-image: url("");<br />
border-style: none;<br />
margin: 0 auto;<br />
padding: 0;<br />
}<br />
<br />
#globalWrapper /* Global Environment (origin item) */<br />
{<br />
background-color: transparent;<br />
background-attachment: fixed;<br />
background-position: 50% 0;<br />
background-repeat: no-repeat;<br />
background-image: url("");<br />
overflow: hidden;<br />
}<br />
<br />
/* Remove Top Item (origin item) */<br />
#top-section<br />
{<br />
height: 0px;<br />
width: 100%;<br />
}<br />
#p-logo {<br />
display: none;<br />
}<br />
#top<br />
{<br />
display: none;<br />
}<br />
h1.firstHeading<br />
{<br />
display: none;<br />
}<br />
<br />
/* Inner Environment (origin item) */<br />
#content<br />
{<br />
background-color: transparent;<br />
background-image: url("https://static.igem.org/mediawiki/2012/e/e5/Zju_back.jpg");<br />
background-attachment: scroll;<br />
background-position: 50% 0;<br />
background-repeat: repeat-y;<br />
overflow: hidden;<br />
border-style: none;<br />
width: 100%;<br />
}<br />
#footer-box<br />
{<br />
background-color: #F8F8F8;<br />
background-image: none;<br />
border-style: none;<br />
margin-top: 100px;<br />
}<br />
#catlinks<br />
{<br />
display: none;<br />
}<br />
#content a,<br />
#content a:hover<br />
{<br />
color: black;<br />
display: inline;<br />
}<br />
#content a:link,<br />
#content a:visited<br />
{<br />
text-decoration: none;<br />
}<br />
#content a:hover,<br />
#content a:active<br />
{<br />
text-decoration: underline;<br />
}<br />
<br />
/* Bottom Environment (origin item) */<br />
#footer-box a,<br />
#footer-box a:hover<br />
{<br />
color: #e8e7b9;<br />
text-decoration: none;<br />
display: inline;<br />
}<br />
<br />
ul<br />
{<br />
list-style-image: none;<br />
list-style-type: none;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
li<br />
{<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
p<br />
{<br />
font-family: Arial, sans-serif;<br />
color: black;<br />
margin: 0;<br />
padding: 0;<br />
align: justify;<br />
}<br />
<br />
/* Common Environment */<br />
.center<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
}<br />
.floatL<br />
{<br />
float: left;<br />
clear: left;<br />
}<br />
.floatR<br />
{<br />
float: right;<br />
clear: right;<br />
}<br />
.floatC<br />
{<br />
text-align: center;<br />
margin: 0 auto;<br />
float: none;<br />
clear: both;<br />
}<br />
.blank<br />
{<br />
filter: Alpha(Opacity=0%);<br />
-moz-opacity: 0;<br />
opacity: 0;<br />
}<br />
.hidden<br />
{<br />
display: none;<br />
}<br />
.show<br />
{<br />
display: block;<br />
}<br />
.show-text<br />
{<br />
display: inline;<br />
}<br />
.button img<br />
{<br />
display: block;<br />
}<br />
<br />
ul.horizontal > li<br />
{<br />
display: block;<br />
float: left;<br />
clear: none;<br />
overflow: hidden;<br />
}<br />
ul.vertical > li<br />
{<br />
display: block;<br />
float: left;<br />
clear: both;<br />
overflow: hidden;<br />
}<br />
<br />
#search-controls<br />
{<br />
display: none;<br />
}<br />
<br />
#footer-box<br />
{<br />
display: none;<br />
}<br />
<br />
</style><br />
<br />
<script src="http://www.jiajunlu.com/igem/cufon-yui.js" type="text/javascript"></script><style type="text/css">cufon{text-indent:0!important;}@media screen,projection{cufon{display:inline!important;display:inline-block!important;position:relative!important;vertical-align:middle!important;font-size:1px!important;line-height:1px!important;}cufon cufontext{display:-moz-inline-box!important;display:inline-block!important;width:0!important;height:0!important;overflow:hidden!important;text-indent:-10000in!important;}cufon canvas{position:relative!important;}}@media print{cufon{padding:0!important;}cufon canvas{display:none!important;}}</style><br />
<script src="http://www.jiajunlu.com/igem/gotham.js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
Cufon.replace('h3');<br />
<br />
<br />
</script><br />
<link rel="stylesheet" href="http://www.jiajunlu.com/igem/slide.css" type="text/css" media="screen"><br />
<link rel="stylesheet" href="http://www.jiajunlu.com/igem/accordion.css" type="text/css" media="screen"><br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/jquery.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
<br />
//Hide (Collapse) the toggle containers on load<br />
$(".acc_container").hide(); <br />
//Switch the "Open" and "Close" state per click then slide up/down (depending on open/close state)<br />
$("h2.acc_trigger").click(function(){<br />
$(this).toggleClass("active").next().slideToggle("slow");<br />
<br />
return false; //Prevent the browser jump to the link anchor<br />
});<br />
<br />
});<br />
</script><br />
<script type="text/javascript" src="http://www.jiajunlu.com/igem/my.js"></script><br />
<script src="http://www.jiajunlu.com/igem/slide.js" type="text/javascript"></script><br />
<script type="text/javascript"><br />
function movetotop(){<br />
$("html, body").animate({ scrollTop: 0 }, "slow");<br />
return false;<br />
}<br />
$(function() {<br />
var offset = $("#logo").offset();<br />
var topPadding = 15;<br />
$(window).scroll(function() {<br />
if ($(window).scrollTop() > offset.top) {<br />
$("#logo").stop().animate({<br />
marginTop: $(window).scrollTop() - offset.top + topPadding<br />
});<br />
} else {<br />
$("#logo").stop().animate({<br />
marginTop: 0<br />
});<br />
};<br />
});<br />
});<br />
</script><br />
</head><br />
<body class="work"><br />
<br />
<div class="wrapper"><br />
<div class="container"><br />
<div class="content"><br />
<div id="columnLeft"><br />
<div id="logo" style="margin-top: 0px; " onclick="movetotop()"><br />
<a><img src="https://static.igem.org/mediawiki/2012/1/12/Zju_logo.png"></a><br />
<!-- end #logo --></div><br />
<!-- end #columnLeft" --></div><br />
<div id="columnRight"><br />
<div id="header"><br />
<div id="menu"><br />
<ul id="menu"><br />
<li class="1"><a href="https://2012.igem.org/Team:ZJU-China"><img src="http://www.jiajunlu.com/igem/home_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="2"><a href="https://2012.igem.org/Team:ZJU-China/aboutus.htm"><img src="http://www.jiajunlu.com/igem/aboutus_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="3"><a href="https://2012.igem.org/Team:ZJU-China/project.htm"><img src="http://www.jiajunlu.com/igem/project_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="4"><a href="https://2012.igem.org/Team:ZJU-China/models.htm"><img src="http://www.jiajunlu.com/igem/Zju_models_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="5"><a href="https://2012.igem.org/Team:ZJU-China/notebook.htm"><img src="http://www.jiajunlu.com/igem/notebook_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="6"><a href="https://2012.igem.org/Team:ZJU-China/humanpractice.htm"><img src="http://www.jiajunlu.com/igem/humanpractice_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="7"><a href="https://2012.igem.org/Team:ZJU-China/safty.htm"><img src="http://www.jiajunlu.com/igem/safty_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="8"><a href="https://2012.igem.org/Team:ZJU-China/achievement.htm"><img src="http://www.jiajunlu.com/igem/achievement_btn.gif"></a></li><br />
<li class="divline"></li><br />
<li class="8"><a href="https://2012.igem.org"><img src="http://www.jiajunlu.com/igem/Zju_igem_btn.gif"></a></li><br />
<br />
</ul><br />
<!-- end #menu --></div><br />
<!-- end #header --></div><br />
<br />
<div id="main"><br />
<br />
<h2 class="acc_trigger">01 <strong>ABSTRACT</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<p align="justify">In cells, engineered multi-enzyme pathways are common and are often physically and spatially organized, thus leading to the high output efficiency. But engineered synthetic pathways utilizing non-homologous enzymes often suffer from low efficiency of production caused by relative lack of spatial organization. RNA scaffold is designed to co-localize enzymes through interactions between binding domains on the scaffold and target peptides fused to each enzyme in engineered biological pathways in vivo. The scaffold allows efficient channeling of substrates to products over several enzymatic steps by limiting the diffusion of intermediates thus providing a bright future for solving the problem.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">ZJU-China aims to design and realize tunable RNA scaffolds to accelerate biological pathways and control them on and off. In order to achieve the object, we added an aptamer structure on RNA scaffold as a switch to regulate biological pathways by micromolecular ligands. Then we can control the all-or-none binding relationship between the enzymes and the scaffold by the absence and the presence of a special ligand. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">We demonstrated RNA scaffold do make the split GFPs get closer and fluoresce. As was expected, the riboscaffold with a theophylline aptamer can be regulated by theophylline in the range of 0-0.5mM IPTG. A scaffold library was also desired. By changing the sequence of MS2 aptamer binding site, we made the fluorescent decreased. The mutations with different arm length decrease the fluorescent intensity of split GPF by extending the distance between two split GFP parts FA and FB. It provides a series of half-on scaffolds. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Besides, we aimed to find some application for RNA scaffold to make the production of the multi-enzyme pathways more efficient. We have been working on the pathway of the production of IAA from tryptophan and the result will be gained soon later. </p><br />
<p align="justify">&nbsp;</p><br />
<br />
<br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">02 <strong>BACKGROUND</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<p align="justify">In cells, engineered multi-enzyme pathways are common and are often physically and spatially organized, thus leading to the high output efficiency. But engineered synthetic pathways utilizing non-homologous enzymes often suffer from low efficienty of production caused by relative lack of spatial organization. Thus important issue lies in the method to increase the efficiency of the multi-enzyme pathways. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Protein scaffolds can be designed to make enzymes closed through interactions between binding domains on the scaffold and target peptides fused to each enzyme. However, protein scaffold is usually large, has limit binding sites, and is hard to be engineered in architecture. DNA can be designed to self-assemble in vitro into many and varied nanostructures. However, DNA scaffold is hard to be controlled and might cause some potential problems in vivo. By contrast, RNA scaffold shows great advantages. For instance, RNA is more flexible, whose structures are varied, thus leading to their ease to splice. RNA scaffold is able to be controlled and has a satisfactory regulating efficiency. RNA scaffold works fast, because it doesn’t need translation like protein scaffold. Camille J. Delebecque and his colleagues have designed and assembled RNA structures and used them to speed up the reaction of hydrogen production. And that is what our project based on.</p><br />
<p align="justify">&nbsp;</p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b7/Zju_Backround_syn_and_bio.png" width="700px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Fig.1 The function of binding enzymes together of RNA scaffold illustrated by comic. The yellow girl is called “Syn”, the blue boy “Bio”. They represent non-homologous enzymes utilized in engineered synthetic pathways. Usually, they are far away from each other in E.coli, due to lack of spatial organization. But when RNA scaffold designed comes into E.coli, enzymes can be co-localized through interaction between binding domains on scaffold and target peptides fused each enzymes. That is to say, Syn and Bio can live together!</p><br />
<p align="justify">&nbsp;</p><br />
<br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">03 <strong>S0: BASIC RNA SCAFFOLD</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<h2>Backround</h2><br />
<p align="justify">Camille J. Delebecque and his colleagues have designed and assembled RNA structures and used them as scaffolds for the spatial organization of bacterial metabolism (Fig.1). Scaffold D0 consists of PP7 and MS2 aptamer domains that bind PP7 and MS2 fusion proteins. As told above, our project is based on the existing scaffold D0. In order to make sure that we can do further work on it, we planned to repeat the work about scaffold D0. </p><br />
<p align="justify">&nbsp;</p><br />
<h2>Design</h2><br />
<p align="justify">&nbsp;</p><br />
<img src="https://static.igem.org/mediawiki/2012/d/dc/ZJU_PROJECT_S0_Scaffold_d.jpg" width="600px" /><br />
<p>&nbsp;</p><br />
<p align="justify">Fig.1 How RNA scaffold works. FA and FB represent two halves of EGFP. FA and MS2 are connected with a linker of 30bp. FB and PP7 did the same. The purple scaffold is scaffold D0. MS2 and PP7 can specifically bind to two stem-loops on scaffold, thus FA and FB get closer and fluoresce under excitation of 480nm.</p><br />
<p>&nbsp;</p><br />
<h2>Materials and Methods</h2><br />
<p>&nbsp;</p><br />
<h3>1. Plasmids and Strains</h3><br />
<p align="justify">pCJDFA and pCJDFB respectively comprising the gene of half split EGFP (fragment A and fragment B) and MS2 or PP7 protein were constructed by overlap extension PCR. (See the Overlap PCR protocal) Genes MS2, PP7 and pCJDD0 are provided by Dr. Camille J. Delebecque. pEGFP is provided by Prof. Jianzhong Shao. </p><br />
<p>&nbsp;</p><br />
<p align="justify">Information of pCJDFA, pCJDFB and pCJDD0 are as the followings:</p><br />
<h5>1). pCJDFA: FA-MS2 cloned into T7 duet expression vectors pACYCDuet-1 Spr</h5><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/ZJU_PROJECT_S0_PCJDFA.png" width="600px" /><br />
<p>&nbsp;</p><br />
<h5>2) pCJDFB (FB-PP7 cloned into T7 duet expression vector pCOLADuet-1) Kanr</h5><br />
<img src="https://static.igem.org/mediawiki/2012/8/82/ZJU_PROJECT_S0_PCJDFB.png" width="600px" /><br />
<p>&nbsp;</p><br />
<h5>3) pCJDD0 (Scaffold D0 cloned into T7 duet expression vector PETDuet) Ampr</h5><br />
<p><h5>4) BL21-star(DE3)</h5> <br />
<p align="justify">cells were used to co-express plasmids. The most important feature of BL21-star(DE3) is that it carries a mutated rne gene (rne131) which encodes a truncated RNase E enzyme that lacks the ability to degrade mRNA, resulting in an increase in mRNA stability.</p><br />
<br />
<h3>2. Transformation and induction</h3><br />
<p>&nbsp;</p><br />
<p align="justify">Three groups of transformation were conducted. The first is BL21-star(DE3) transformed only with pCJDD0, the second with pCJDFA+pCJDFB, and the third with pCJDFA+pCJDFB+pCJDD0. </p><br />
<p>&nbsp;</p><br />
<p align="justify">Pick the single colony to cultivate in 3mL liquid LB with relative resistances. And when OD reached 0.4, induce with 0.2mM IPTG for 2h at 25 degree.</p><br />
<p>&nbsp;</p><br />
<p align="justify">Wash the bacteria twice with equivalent PBS. Then test the Fluorescence intensity (FI) and OD with Biotek Synergy Hybrid Reader.<br />
<p>&nbsp;</p><br />
<p align="justify">Data was shown in Fig.3. The fluorescence of different expression systems are pictured by Olympus fluoview fv1000 confocal laser scanning microscope ( Fig.2)<p><br />
<br />
<br />
<p align="justify">They were transformed with the pCJDD0 (plasmid with scaffold D0) into BL21-star-(DE3). </p><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">04 <strong>S1: RIBOSCAFFOLD</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<div class="projectNav"><br />
<div class="projectNavFloat"><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_1.htm">Summary</a><br />
<br><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_2.htm">Design</a><br />
</div><!-- end .projectNavFloat --> <br />
<div class="projectNavFloat"><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_4.htm">Preparation:Characterize previous parts</a><br />
<br><br />
<a target="brainFrame" href="https://2012.igem.org/Team:ZJU-China/project_s1_3.htm">Characterization</a><br />
<br />
</div><!-- end .projectNavFloat --><br />
<br class="clearfloat"><br />
</div><!-- end .projectNav --><br />
<br />
<iframe src="" frameborder="0" name="brainFrame" width="100%" height="500px"> </iframe> <br />
<br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">05 <strong>S2: SCAFFOLD LIBRARY</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<br />
<div style="height:800px;overflow:scroll;"> <br />
<br />
<p>Several mutations of RNA scaffold D0 have been designed and made. They show quite different characterizes and functions. With the experiment, more RNA scaffold mutations are characterized. Concept Library of RNA Scaffold is suggested.</p><br />
<p>&nbsp;</p><br />
<p>What is the Library of RNA Scaffold for? Evolution! The variable of RNA structures accommodates a wide application prospect. Though the point mutation reduced uncertainty of selection and the blindness, trying to find a suitable construction is vast project. Various experimental methods, selection and modeling should be used in this part. By analyzing existing mutations, derivation can be made to construct and find an enhanced RNA scaffold. We called this process evolution. </p><br />
<p>&nbsp;</p><br />
<p>The Library may contain changes of self, self-assemble, RNA-RNA interaction, RNA-protein interaction. Some examples are show below.</p><br />
<p>&nbsp;</p><br />
<p>1. Mutating arm length: changing the arm length of RNA scaffold D0. As the mechanism of D0 is reducing the distance of two key enzyme of the pathway, in other words, the output and reaction efficiency is depend on the local concentration. The two aptamer binding site in our project is on two hairpin arms witch are designed in the same length. The change of the arm length provides feasibility of distance-efficiency research. We used split GFP experiments. We made some mutations with different arm length, the result of D0M4 and D0M 5 split GFP experiment shows the light decreasing lend by split GFP FA-FB distance. The difference (PD0M4=0.079, PD0M5=0.025) suggests that the mutating arm length scaffold doesn’t provide an on/off switch but a definability one. It characterized the D0 in another way.</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/da/Zju_library_Fig1a.jpg" width="500px" /><br />
<p>fig 1a. D0 is the original scaffold. D0 a-d were mutated to the scaffold with different aptamer arm length. </p><br />
<img src="hthttps://static.igem.org/mediawiki/igem.org/f/f7/Zju_library_fig1b.jpg" width="500px" /><br />
<p>fig 1b. The result of arm length mutating. Both D0M4 and D0M5 scaffold half-on GEP.</p><br />
<p>&nbsp;</p><br />
<p>1.1 Mutating aptamer binding site: Mutating the PP7 and MS2 binding sites prevented protein scaffolding. Preventing protein scaffolding lead to the key enzyme dissociation and the decrease of enzyme local concentration. By chancing the sequence of MS2 aptamer binding site, the fluorescent light decreased. D0M3 in our project is the molecular with mutated aptamer binding site. Split GFP experiment shows that there is a significant difference between D0 an D0M3(P≦0.05, fig2.c). Camille J. Delebecque has done the same work for the H2 biosynthesis pathway.</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/a/ad/Zju_library_Fig2a.jpg" width="500px" /><br />
<p>fig2a. MS2 and PP7 bind to the scaffold and make GFP work. </p><br />
<img src="https://static.igem.org/mediawiki/igem.org/9/98/Zju_library_Fig2b.jpg" width="500px" /><br />
<p>fig2b. By mutating aptamer binding site, scaffolding is stop. </p><br />
<img src="https://static.igem.org/mediawiki/igem.org/3/33/Zju_library_fig2c.jpg" width="500px" /><br />
<p>fig2c. significant difference between D0 an D0M3</p><br />
<p>&nbsp;</p><br />
<p>1.2 Assemblage: adding extra sequence for self-, RNA-, protein-assemblage. The added sequence may be a riboswitch, RNA or protein binding site, self-assemble structure. Regulation molecular search is also wanted synchronously. </p><br />
<p>&nbsp;</p><br />
<p>Applications and outlook</p><br />
<p>&nbsp;</p><br />
<p>1.3 sRNA regulation: Simple an direct RNA-RNA interaction change the object RNA scaffold structure. As a Foundation regulation, it substantially enhances the possibilities of forthcoming experiment. </p> <br />
<img src="https://static.igem.org/mediawiki/igem.org/e/ec/Zju_library_Fig3.jpg" width="600px" /><br />
<p>fig3 The designed scaffold has a interaction to regulatory sRNA. Same mechanism, regulatory molecule can be changed to mRNA a. Turn off the scaffold by the competitive binding with aptamer binding site (green) b. The RNA scaffold has a secondary structural switch controls accessibility of sRNA-binding sites(blue) witch can change the arm length. Output regulated by arm length change. c. both methods were used. d. bind an release the object molecular.)</p><br />
<p>&nbsp;</p><br />
<p>1.4 Protein expression (mRNA) regulation: RNA scaffold as a free molecular in cell can specific bind mRNA and protein. Binding molecular changes the structure of scaffold to release or combine something. So that oncogene and virogene can be found and controlled by the drug from RNA scaffold. The problem of cancer therapeutic drug side effecting may solved by it. </p><br />
<p>&nbsp;</p><br />
<p>1.5 Self quenching(Self regulation): Adding self binding site, a balance of “on” and “off” scaffolds is built. The relationship between the binding site size, CG bases, binding form and the rate binding molecular is urgently modeled. Forming dimerization and trimerization, the concentration of working scaffold could be regulated.</p> \<br />
<p>&nbsp;</p><br />
<p>1.6 Polo-scaffold: Scaffold with intermolecular binding component. These scaffolds bind each other or bind through mediate molecular. And this binding mode has been proved both in vitro and vivo. The aggregation of molecular also makes artificial organelle achievable. </p><br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/2/2f/Zju_library_Fig4a.jpg" width="600px" /><br />
<p>fig4a Dimerization and trimerization. Protein binding site is sealed off by the scaffolds themselves. Too much scaffold molecular lend to the self regulation.<br />
<img src="https://static.igem.org/mediawiki/igem.org/b/be/Zju_library_Fig4b.jpg" width="600px" /><br />
<p>fig4b Dimerization and trimerization. Protein binding site is sealed off by the scaffolds themselves. Too much scaffold molecular lend to the self regulation.</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/8/8d/Zju_library_Fig4c.jpg" width="600px" /><br />
<p>fig4 c. Polo-scaffold be made by head-tail binding and.</p><br />
<p>&nbsp;</p><br />
<p>Several RNA scaffold mutations are constructed and characterize, but they are the tip of the iceberg. There is still plenty to do in this part. The charms of library are the selection and combination. It introduces a new concept of biobrick combination mode.</p><br />
<br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<br />
<h2 class="acc_trigger">06 <strong>S3: BIOSYNTHESIS OF IAA</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<p align="justify">&nbsp;</p><br />
<p align="justify">In previous work, FA and FB are used to indicate the efficiency of riboscaffold. In order to further prove the function of riboscaffold, we plan to substitute FA, FB with functional enzymes or protein substrates like ferredoxin in hydrogen producing pathway respectively. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Considering the availability of material and abundant parts distributed by iGEM, we search the 2012 kit plate1-5 to find optimal pathways. After a pre-selection, six pathways are on candidate list. For sake of experimental feasibility, we perform a further selection based on several caritas as follows:</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">1. Product is easy to detect and measure;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">2. Substrate is easy to get;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">3. Product is beneficial to human;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">4. The length of amino acid sequence of enzyme is optimal to be fusion protein;</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">5. Two proteins involved in the basic pathway.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Candidate list:</p><br />
<p align="justify">&nbsp;</p><br />
<h2>1. Salicylate pathway</h2><br />
<h2>(Group: iGEM2006_MIT)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_1.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The characterization method of gas chromatography is difficult to perform. First, what can be analyzed is methyl salicylate production, that is to say, another enzyme should be co-transformed to E.coli too, which will increase cell’s burden and reduce the ratio of successful co-transformation. Second, it is not convenient for us to borrow the relative machine.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>2. Pyocyanin pathway</h2><br />
<h2>(Group: iGEM2007_Glasgow)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_2.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Through there are exactly two enzymes involved in this pathway, but the source of material, phenazine-1-carboxylic acid (PCA), is not mentioned. And it not easy to measure the amount of pyocyanin. </p><br />
<p align="justify">&nbsp;</p><br />
<h2>3. Lycopene pathway</h2><br />
<h2>(Group: iGEM2009_Cambridge) </h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_3.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Lycopene is visible red and its substrate, FPP, is colorless. So measurement is quite feasible. But there are at least three proteins in this pathway, which will increase the burden of cell. But in future work, we could have a try.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>4. Holo-&alpha;-phycoerythrocyanin pathway</h2><br />
<h2>(Group: iGEM2004_UTAustin)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_4.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Heme is metabolic product of E.coli and Holo-α-phycoerythrocyanin is blue. But at least 5 proteins should be expressed in E.coli.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>5. BPA degradation pathway</h2><br />
<h2>(Group: iGEM2008_University_of_Alberta)</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Bisphenol A is degraded by BisdA and BisdB. But BPA is toxic to cells.</p><br />
<p align="justify">&nbsp;</p><br />
<h2>6. IAM pathway</h2><br />
<h2>(Group: iGEM2011_Imperial)</h2><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_5.jpg" width="600px" /><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Assessment: </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Five pathways described above all have some drawbacks, finally, only one pathway left, IAM pathway. The two-step IAM pathway generates indole-3-acetic acid (IAA) from the precursor tryptophan. IAA tryptophan monooxygenase (IaaM) catalyses the oxidative carboxylation of L-tryptophan to indole-3-acetamide, which is hydrolysed to IAA and ammonia by indoleacetamide hydrolase (IaaH). </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Final Decision: </p><br />
<p align="justify">&nbsp;</p><br />
<img src="http://www.jiajunlu.com/igem/zju_iaa_6.jpg" width="600px" /><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<br />
<br />
<h2 class="acc_trigger">07 <strong>PARTS</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<h2>01 Summary</h2><br />
<p>This is a summary of the parts that we have submitted to the <a href="http://partsregistry.org/Main_Page">Registry of Standard Biological Parts</a>. These parts include: </p><br />
<p>ncRNA scaffold generator: <a href="http://partsregistry.org/Part:BBa_K738000">BBa_K738000</a>, <a href="http://partsregistry.org/Part:BBa_K738002">BBa_K738002</a> </p><br />
<p>protein coding domains: <a href="http://partsregistry.org/Part:BBa_K738004">BBa_K738004</a> , <a href="http://partsregistry.org/Part:BBa_K738005">BBa_K738005</a> , <a href="http://partsregistry.org/Part:BBa_K738006">BBa_K738006</a> , <a href="http://partsregistry.org/Part:BBa_K738007">BBa_K738007</a> </p><br />
<p>These parts have all been well characterized. Please visit the Registry of Standard Biological Parts for more information.</p><br />
<h2>02 List</h2><br />
<br />
<table border="1"><br />
<tr><br />
<td>?</td><br />
<td>?</td><br />
<td>Name</td><br />
<td>Type</td><br />
<td>Description</td><br />
<td>Designer</td><br />
<td>Length</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738000">BBa_K738000</a></td><br />
<td>Generator</td><br />
<td>RNA Scaffold generator</td><br />
<td>Huachun Liu</td><br />
<td>171</td><br />
</tr><br />
<tr><br />
<td><img src="https://static.igem.org/mediawiki/igem.org/f/f1/Zju_redheart.jpg" /></td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738002">BBa_K738002</a></td><br />
<td>Generator</td><br />
<td>Theophyline riboswitch regulated RNA Scoffold(clover version 2)</td><br />
<td>Huachun Liu</td><br />
<td>209</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738004">BBa_K738004</a></td><br />
<td>Generator</td><br />
<td>FA-2X-MS2;Split GFP N-terminal domain fused with MS2 protein</td><br />
<td>Huachun Liu</td><br />
<td>1284</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>W</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738005">BBa_K738005</a></td><br />
<td>Coding</td><br />
<td>FB-2X-PP7;Split GFP C-terminal domain fused with PP7 protein</td><br />
<td>Huachun Liu</td><br />
<td>654</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738006">BBa_K738006</a></td><br />
<td>Coding</td><br />
<td>FA: Split GFP N-terminal domain</td><br />
<td>Huachun Liu</td><br />
<td>480</td><br />
</tr><br />
<tr><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
<td><a href="http://partsregistry.org/Part:BBa_K738007">BBa_K738007</a></td><br />
<td>Coding</td><br />
<td>FB, Split GFP C-terminal domain</td><br />
<td>Huachun Liu</td><br />
<td>255</td><br />
</tr><br />
</table><br />
<br />
<br />
<h2>03 Future work</h2><br />
<h3>Theophylline responded RNA riboscaffold</h3><br />
<p>We have designed two RNA riboscaffold responded to theophylline. Unfortunately, we only managed to submit one of them (K738002) to the Registry of Biological Parts in time (that means before September 26). </p><br />
<p>We have started the work of constructing a second theophylline responded RNA riboscaffold K738001 (but not finished). K738001 is different with K738002 in 3D structure, which may lead to results that are far away from that of K738002.</p><br />
<p>Please visit <a href="http://partsregistry.org/Part:BBa_K738002">here</a> for more information.</p><br />
<h3>Library</h3><br />
<p>We plan to develop a RNA scaffold library that offers more tunable responses. We’ve got several members in this library by now and our ultimate goal is acquiring a series of members which span a large acceleration rate range from about 10% to 90%. Thus, researchers may be able to choose a member in the library to acquire the targeted acceleration rate easily.</p><br />
<h3>Pathway of producing IAA</h3><br />
<p>Accelerating production of IAA with RNA scaffold has been proved to be efficient. Two enzymes, IaaH (BBa_K515000) and IaaM (BBa_K515001), are related to the process. We’ve fused IaaH and IaaM with MS2 and PP7 respectively to get IaaM-2X-MS2 and IaaH-2X-PP7, which are able to bind on RNA scaffold. We plan to make and submit this two protein as parts later. Thus, we’d like to regulate the biosynthesis process efficiency with RNA riboscaffold. We plan to submit BBa_K738014 and BBa_738015 later.</p><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<br />
<h2 class="acc_trigger">08 <strong>RESULTS</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<p>&nbsp;</p><br />
<h2>S0: BASIC RNA SCAFFOLD</h2><br />
<p>&nbsp;</p><br />
<p>Contrasted to the fluorescence intensity (FI) of the E.coli which only express FA-MS2 and FB-PP7 fusion proteins, the fluorescence intensity of the E.coli with scaffold D0 was obviously increased. Thus, it was possible for us to carry out our development and reformation of RNA scaffold.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/5/53/ZJU_PROJECT_S0_Confocal.jpg" width="600px" /><br />
<p>&nbsp;</p><br />
<p>Fig.2 FI of Split GFPs without or with RNA scaffold. A. BL21*(DE3) transformed with pCJDFA and pCJDFB. B. BL21*(DE3) transformed with pCJDFA, pCJDFB and pCJDD0. The contrast of FI obviously shown that RNA scaffold D0 could bind split GFPs together, so that split GFPs could fluoresce. (Pictures were obtained with Olympus fluoview fv1000 confocal laser scanning microscope, using a 60X objective.)</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/3/32/ZJU_PROJECT_S0_FI.png" width="600px" /><br />
<p>Fig.3 FI/OD of different transformation groups. There exist significant differences among three groups. And as expected, split GFPs with scaffold D0 together can fluoresce stronger than those without scaffold. </p><br />
<br />
<h3>Reference:</h3><br />
<p align="justify">1. Thodey, K. & Smolke, C.D. Bringing It Together with RNA. Science 333, 412-413 (2011).</p><br />
<p align="justify">2. Delebecque, C.J., Lindner, A.B., Silver, P.A. & Aldaye, F.A. Organization of Intracellular Reactions with Rationally Designed RNA Assemblies. Science 333, 470-474 (2011).</p><br />
<br />
<p>&nbsp;</p><br />
<h2>S1: RIBOSCAFFOLD</h2><br />
<p align="justify">&nbsp;</p><br />
<h3>Scaffold</h3><br />
<p align="justify">&nbsp;</p> <br />
<img src="https://static.igem.org/mediawiki/igem.org/5/5b/Riboscaffold_fig_12.jpg" width="700px" /><br />
<p align="justify">Fig.12 Fluorescence microscopy. The (BL21*DE3) of the E. coli were transformed with FA+FB, FA+FB+ original RNA scaffold D0, and FA+FB+ our designed RNA scaffold clover 2(0.5 mM theophylline adding). As expected, strains without RNA scaffold did not fluoresce. Upon the existence of RNA scaffold, many of the cells emitted fluorescence indicating a substantial amount of split GFP combination is permitted because of the function of RNA scaffold. The brightfield images in the right column depict all bacterial cells. The GFP images in the left column depict bacterial cells which emitted fluorescence. </p><br />
<p align="justify">&nbsp;</p><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/df/Riboscaffold_fig_13.jpg" width="700px" /><br />
<p align="justify">Fig.13 Biotek Synergy H1 Hybrid Reader controlled experiments. The BL21*DE3 of the E. coli were transformed with figure showing plasmids. (0.5 mM theophylline was adding in strains containing clover 2). </p><br />
<p align="justify">`luminescence \quad efficiency \quad of \quad clover 2=\frac{\frac{FI}{OD(FA+FB+clover 2)}-\frac{FI}{OD(FA+FB)}}{\frac{FI}{OD(FA+FB)}}=\frac{53425-23779}{23779}=125\%`</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">`luminescence \quad efficiency \quad of \quad D0=\frac{\frac{FI}{OD(FA+FB+clover 2)}-\frac{FI}{OD(FA+FB)}}{\frac{FI}{OD(FA+FB)}}=\frac{38288-23779}{23779}=61\%`</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">The original intention of our designing RNA scaffold clover 2 is to create a regulatory scaffold which can tune its conformation thus have various functions. To our surprise, clover version 2, when adding optimal Theophylline concentration 0.5mM, happens to be a more powerful scaffold which helps two halves of GFP’s combination and give out light strongly.</p><br />
<br />
<p align="justify">One possible reason is in clover version 2, distance between MS2 aptamer and PP7 aptamer is closer than in D0 (showing in Fig.4 and Fig.6), so that when binding phage coat proteins, FA and FB on clover version 2 were set closer than on D0. We submit the inference that when RNA scaffold binds enzymes, clover version 2 draws two enzymes nearer than D0 thus has more ability to accelerate the enzymatic reaction.</p><br />
<br />
<br />
<h3>late and control by Theophylline</h3><br />
<p align="justify">When the concentration of Theophylline is in the range from 0mM to 0.5mM, the concentration of Theophylline and the resulting fluorescence intensity are directly proportional. </p><br />
<p align="justify">Theophylline concentration beyond certain extent will be hazardous to cells and how it affects cells depends on strain type. The study by NYMU Taipei 2010 alerted adding more than 4mM of Theophylline would cause E. coli to die. In our experiments, we find that after adding more than 0.5mM, the Theophylline spectrum curve would be invalid. As a result, we pick up data with concentrations below 0.5mM to analyze as the E. coli cell would be unstable or the regulation of the Theophylline aptamer would not be accurate. </p><br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/2/20/Screen_Shot_2012-09-26_at_%E4%B8%8B%E5%8D%885.27.52.png" width="700px" /><br />
<br />
<p align="justify">Fig.14 origin data of clover 2 regulatory tests. First line of each form is different treatments of Theophylline concentration and data in table cells are fluorescence intensity/ OD.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/igem.org/2/25/Riboscaffold_fig_15_上.jpg" width="700px" /><br />
<img src="https://static.igem.org/mediawiki/igem.org/2/2d/Riboscaffold_fig_15_下.jpg" width="700px" /><br />
<br />
<p align="justify">Fig.15 7 tests of fluorescence/ OD change over theophylline concentration. There’s evident positive correlation in between.</p><br />
<br />
<p align="justify">Then we build several SAS models to analyze data with SAS software GLM procedure between 0-0.5mM Theophylline concentrations of treatments, choosing” clover version 2: different treatments versus blocks” test 5-7 to run a SAS model.</p><br />
<p align="justify">ANOVA result P-value shows that Theophylline concentrations have significant impact on fluorescence intensity of clover version 2 and almost no impact on D0. That is to say, our designed RNA scaffold clover version 2 can be regulated and controlled by Theophylline within 0-0.5mM not for random errors or common phenomenon in RNA scaffolds.</p><br />
<br />
<p align="justify">If you want more details about SAS source programs and software computational results, please click here <a href="https://2012.igem.org/Team:ZJU-China/sourcecode1.htm">[code]</a>. </p><br />
<p>&nbsp;</p><br />
<h2>S2: SCAFFOLD LIBRARY</h2><br />
<p>&nbsp;</p><br />
<h2>S3: BIOSYNTHESIS OF IAA</h2><br />
</div><br />
</div><!-- end .acc_container --><br />
<br />
<h2 class="acc_trigger">09 <strong>APPLICATIONS</strong></h2><br />
<div class="acc_container" style="display: none; "><br />
<br />
<!--Content Goes Here--><br />
<div style="height:800px;overflow:scroll;"> <br />
<h2>1. RNA aptamers take place of fluorescent proteins </h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Some RNA aptamers can bind fluorophores, such as 4-hydroxybenzlidene imidazolinone (HBI), 3,5-dimethoxy-4-hydroxybenzylidene imidazolinone (DMHBI), 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI), resembling the fluorophore in GFP, and then these RNA-fluorophore complexes enable to emit different colors of fluorescence comparable in brightness with fluorescent proteins. </p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">These RNA-fluorophore complexes could be used to tag RNAs in living cells to reveal the intracellular dynamics of RNA, including RNA-RNA and RNA-protein interactions.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Jeremy S. Paige, Karen Y. Wu, Samie R. Jaffrey, RNA Mimics of Green Fluorescent Protein science, 2011 vol 333, 642-646]</p><br />
<p align="justify">&nbsp;</p><br />
<h2>2. kinetic investigation of RNA hybridizations and foldings</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">By introducing fluorophores like 1-ethynylpyrene into the 2-position of RNA adenosine, through an intermolecular interaction of the pyrene residues in twofold labelled RNA, single and double strands can be distinguished by their fluorescence spectrum changes.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">With this fluorescence shift, one can distinguish between single-stranded and double-stranded RNA during thermal denaturation. This behavior could be used for the time resolved investigation of RNA hybridizations and folding by fluorescence spectroscopy.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Josef Wachtveitlb, Joachim W. Engels, ect. RNA as scaffold for pyrene excited complexes, Bioorganic & Medicinal Chemistry 16 (2008) 19-26]</p><br />
<p align="justify">&nbsp;</p><br />
<h2>3. Medicine & health</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">To date, many groups have successfully identifi ed aptamers with a variety of functions, including inhibitory and decoy-like aptamers, regulatable aptamers, multivalent/agonistic aptamers, and aptamers that act as delivery vehicles. Each of these classes of aptamers has potential applications in therapeutics and/or diagnostics.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Inhibitory aptamers:The most extensively characterized inhibitory aptamer is the RNA aptamer that targets VEGF. This aptamer was approved by the FDA in December 2004, for the treatment of wet age-related macular degeneration (AMD)</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Decoy-like aptamers:By mimicking the target sequence of the proteins, aptamers can act as decoys to inhibit binding of transcriptional factors such as HIV-tat, NF-κB, and E2F to their cognate sequences on DNA and thus prevent transcription of target genes and may result in powerful therapeutics for treating many human pathologies</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Multivalent aptamers: A bivalent aptamer targeting HIV has also been described and consists of 2 separate RNA aptamers that bind to 2 distinct stem-loop structures within the HIV 5′UTR: the HIV-1 TAR element and the dimerization initiation site. Similarly, bivalent aptamers targeting thrombin have been engineered as a way to increase the avidity of the aptamer for its target and enhance the anticoagulation effect</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Aptamers as delivery tools: Several groups have reported linking siRNAs to aptamers as a way to specifi cally deliver siRNAs to target cells. Aptamers are also being utilized to deliver toxins, radioisotopes, and chemotherapeutic agents encapsulated in nanoparticles.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Kristina W. Thiel and Paloma H. Giangrande, Therapeutic Applications of DNA and RNA Aptamers. Oligonucleotides, 2009, Volume 19, Number 3, 209-222]</p><br />
<p align="justify">&nbsp;</p><br />
<h2>4. Regular of gene expression</h2><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Aptamers are small oligonucleic acid molecules that can be selected in vitro against nearly any target of choice. And they often show remarkable binding affinity and specificity, and consequently have a huge potential for application. One of their usages is to play a role in activating gene expression.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">Some RNA aptamers can specifically bind some transcriptional regulator. For example, people have selected one RNA aptamer that can bind TetR, which usually binds on operator sequence and repress gene expression. So once the RNA aptamer binds to the transcriptional regulator, the targeting gene-expression is activated.</p><br />
<p align="justify">&nbsp;</p><br />
<p align="justify">[Reference: Anke Hunsicker, Markus Steber, ect. An RNA Aptamer that Induces Transcription, Chemistry & Biology, 2009,Volume 16, Issue 2, 173–180] </p><br />
<p align="justify">&nbsp;</p><br />
</div><br />
</div><!-- end .acc_container --><br />
<!-- end #main --></div><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<br class="clearfloat"><br />
<!-- end #columnRight --></div><br />
<!-- end .content --></div><br />
<!-- end .container --></div><br />
</div><!-- end .wrapper --><br />
<div><img src="https://static.igem.org/mediawiki/igem.org/d/d9/Zju_foot.png" width="100%"></div><br />
<div id="footer"><br />
<div id="footerImg"><br />
</div><!-- end footerImg --><br />
<!-- end #footer --></div> <br />
<script type="text/javascript"> Cufon.now(); </script><br />
</body></html></div>Smilehttp://2012.igem.org/Team:ZJU-ChinaTeam:ZJU-China2012-07-15T02:51:55Z<p>Smile: /* Our wiki is under construction - come back soon for more project details! */</p>
<hr />
<div>{|align="center"<br />
|[[Image:ZJU-China_logo.png|center|thumb|900px]]<br />
<br />
<br />
== <center>'''Our wiki is under construction - come back soon for more project details!'''</center>==<br />
<br />
{|align="justify" 2012 marks the fourth year of the Cornell iGEM team's participation in the competition. Last year we did [https://2011.igem.org/Team:Cornell very well], and this year we aim to do even better!<br />
<br />
This year, the ZJU-China iGEM team aims to design and realize a tunable RNA scaffold to accelerate biosynthesis pathways and turn their on and off. As one of the most vital biomacromolecules, RNA plays a crucial role not only in coding process, but also in non-coding one. RNA scaffold is designed to colocalize enzymes through interactions between binding domains on the scaffold and target peptides fused to each enzyme in engineered biosynthesis pathways ''in vivo'', which may suffered from low efficiency of production caused by relative lack of spatial organization of non-homologous enzymes. The scaffold allows efficient channeling of substrates to products over several enzymatic steps by limiting the diffusion of intermediates thus providing a bright future for solving the problem. Meanwhile, we plan to add an aptamer structure on RNA scaffold as a riboswitch to regulate biosynthesis pathways by micromolecular ligands. Then we can control the all-or-none binding relationship between the enzymes and RNA scaffold by whether the special ligands are presented or not.<br />
<br />
|[[Image:ZJU-China_team.png|center|thumb|900px]]<br />
|}</div>Smile