http://2012.igem.org/wiki/index.php?title=Special:Contributions/Rwilkinson&feed=atom&limit=50&target=Rwilkinson&year=&month=2012.igem.org - User contributions [en]2024-03-29T00:39:02ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/Team:University_College_London/LabBook/Week9Team:University College London/LabBook/Week92012-09-27T03:51:00Z<p>Rwilkinson: /* Friday 10.8.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="8-4" src="https://static.igem.org/mediawiki/2012/0/08/Ucl2012-labbook-graph98-4.png" /><br />
<div class="experimentContent"></html><br />
<br />
== Monday 6.7.12 ==<br />
<br />
<br />
'''Aim:''' Inoculate the Plates that were transformed on Thursday. On Thursday we began Expt 8.5 by transforming the BioBricks, and our results on Friday indicated there was growth for all. (However, the negative control was contaminated, so we will have to be careful to assess the analytical restriction digest for correct products). The table below describes the BioBricks that were used:<br />
<br />
The two constitutive promoters were used because we were never able to detect our previous constitutive promoter BBa_J23119 (Expt 7.3) and our 3A ligation of BBa_J23119 and BBa_B0034 failed (Expt 8.4). This does not necessarily indicate our transformation of BBa_J23119 has failed, but we decided to transform several more in case. The RBS promoter BBa_B0030 was transformed for the same reason. The Gas Vesicle Cluster was transformed because all previous attempts have failed. <br />
<br />
<br />
'''Method'''<br />
<br />
<br />
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html><br />
<br />
'''Step 2 – Inoculating Colonies into a Selective Broth:''' The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Volume Inoculated !! Broth (ml) !! Antibiotic (ug/ml)<br />
|-<br />
| rowspan="8" |BioBrick ||rowspan="2" | BBa_J23100 || 10ul ||rowspan="8" |Lysogeny Broth (5) || rowspan="8" | Ampicillin(50ug/ml)<br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | BBa_J23106 || 10ul <br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | BBa_B0030 || 10ul <br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | BBa_I750016 || 10ul <br />
|-<br />
| 90ul <br />
|}<br />
<br />
== Tuesday 7 ==<br />
<br />
'''Aim:''' Results from Colony Picking<br />
<br />
'''Results'''The table below indicates there was growth for all BioBricks.<br />
<br />
{| class="wikitable"<br />
|-<br />
! Biobrick !! Growth<br />
|-<br />
| I750016 sample 1 || No Growth<br />
|-<br />
| I750016 sample 2 || No Growth<br />
|-<br />
| I750016 sample 3 || No Growth<br />
|-<br />
| B0030 sample 1 || No Growth<br />
|-<br />
| B0030 sample 2 || No Growth<br />
|-<br />
| B0030 sample 3 || No Growth<br />
|-<br />
| J23100 sample 1 || No Growth<br />
|-<br />
| J23100 sample 2 || No Growth<br />
|-<br />
| J23100 sample 3 || No Growth<br />
|-<br />
| J23106 sample 1 || Growth<br />
|-<br />
| J23106 sample 1 || Growth<br />
|-<br />
| J23106 sample 1 || Growth<br />
|}<br />
<br />
'''Conclusion:''' We are unsure why we have failed to get colonies for many of the BioBricks. Again, we are considering the possibility that our agar is not selective enough. Initially we thought this may be due to adding Antibiotic while the agar is too hot, leading to degradation of the sample. However this has been corrected in the protocol, but the problem is persisting. Instead we are considering running a troubleshoot by testing the selectivity of the various eppendorfs of antibiotic stocks we made at the beginning of the summer. If any show less selectivity then we can stop using them. This will be considered for later in the week. Meanwhile, we can miniprep and nanodrop BBa_J23106 (strong constitutive promoter) <br />
<br />
<html><div class="protocol protocol-Miniprep">Miniprep Protocol 1 (ANACHEM)</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Miniprep2}}<html></div></html><br />
<br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
<br />
'''Results:''' There was no product for BBa_J23106 on the gel, therefore either the transformation failed or the concentration is very low<br />
<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="8-5" src="https://static.igem.org/mediawiki/2012/5/58/Ucl2012-labbook-graph98-5.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 6.7.12 ==<br />
<br />
'''Aim:''' Repeat the inoculation of the ligation products (J23119 + B0034) done last week. Innoculation is only done for the (J23119 + B0034), but not for the (starvation promoter + B0034) because that ligation did not transform.<br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html><br />
<br />
Step 2 – Inoculating Colonies into a Selective Broth: The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.<br />
<br />
{| class="wikitable"<br />
|-<br />
! Ligation !! No. innoculations !! Broth !! Antibiotic<br />
|-<br />
| J23119 + B0034 || 3 || Lysogeny Broth || Kanamycin<br />
|}<br />
<br />
== Tuesday 7 ==<br />
<br />
<br />
'''Aim:''' Check results of Colony Picking<br />
<br />
'''Results:''' The table below indicates whether there was growth for the BioBricks ligations<br />
<br />
{| class="wikitable"<br />
|-<br />
! Ligation !! Growth/No Growth<br />
|-<br />
| J23119+B0034 sample 1 || Growth<br />
|-<br />
| J23119+B0034 sample 2|| Growth<br />
|-<br />
| J23119+B0034 sample 3 || Growth<br />
|}<br />
<br />
'''Conclusion:''' We can proceed now to miniprep the samples, and run them on a gel to test the presence of a band<br />
<br />
'''Method:''' <br />
<br />
<html><div class="protocol protocol-Miniprep">Miniprep Protocol 1 (ANACHEM)</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Miniprep2}}<html></div></html><br />
<br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
'''Results:''' There was no product on the gel, suggesting the ligation failed. <br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="9-1" src="https://static.igem.org/mediawiki/2012/2/2c/Ucl2012-labbook-graph9-1.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 8.8.12==<br />
<br />
'''Aim:''' To repeat Expt 8.2, where we undertook PCR amplification of pSB1A3, pSB1C3, pSB1K3 for 3A assembly. While we achieved bands of the correct size for all three plasmid backbones in Expt 8.2, the nanodrop concentration for pSB1A3 and pSB1C3 was very low (unusable). Therefore we decided to repeat the PCR. As the concentration of pSB1K3 was not particularly high, we decided to repeat this again also.<br />
<br />
<br />
'''Method:'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.1, with a 1000bp ladder. No products were detected. We expected a product corresponding to the size of the plasmid pSB1K3 (2000bp), pSB1C3 (2000bp) and pSB1A3 (2000bp) in Lanes 1-3 respectively. These are indicated by the letters A (pSB1K3), B (pSB1C3) and C (pSB1A3). <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/1/14/Ucligem2012Expt_9.1.png}}<br />
<br />
{| class="wikitable"<br />
|-<br />
! Backbone !! Expected Size<br />
|-<br />
| pSB1K3 || 2204bp<br />
|-<br />
| pSB1C3 || 2070bp<br />
|-<br />
| pSB1A3|| 2155bp<br />
|}<br />
<br />
<br />
'''Conclusion:''' We feel the poor nanodrop results from Expt 8.2, and the poor electrophoresis results from this Expt may be a result of the choice of polymerase. Our supervisors recommended we try Phusion Polymerase, which we will attempt tomorrow.<br />
<br />
== Tuesday 9.8.12 ==<br />
<br />
<br />
'''Aim:''' To repeat PCR with Phusion Polymerase to amplify the three plasmid backbones. As we had more confidence that this PCR reaction would work, we included an extra plasmid, pSB1T3, also required for ligation. <br />
<br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.1, with a 1000bp ladder. In Lane 1 can be seen a product corresponding to the correct size of pSB1A3 (2155) as indicated by A. In Lane 2 is a product, shown by B, which is of the correct size for the plasmid pSB1K3 (22040bp). In Lane 3, we expect a band of size 2461bp, for the plasmid pSB1T3. This is shown by C. As it is absent, it would appear the PCR reaction failed. In Lane 4 is a product corresponding to pSB1C3 (2070bp) as shown by D. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/9/99/Ucl2012Expt9.1.2.png}}<br />
<br />
{| class="wikitable"<br />
|-<br />
! Backbone !! Expected Size<br />
|-<br />
| pSB1K3 || 2204bp<br />
|-<br />
| pSB1C3 || 2070bp<br />
|-<br />
| pSB1A3|| 2155bp<br />
|-<br />
| pSB1T3 || 2461bp<br />
|}<br />
<br />
'''Conclusion:''' The PCR reaction worked for pSB1K3, pSB1C3 and pSB1A3. This would suggest the Phusion Polymerase is a better choice than Taq polymerase. These plasmids can now be nanodropped, and if their concentration is sufficient they can be used for ligation.<br />
<br />
== Thursday 10.8.12 ==<br />
<br />
<br />
'''Aim:''' To carry out nanodrop for the PCR reaction of plasmids with phusion polymerase<br />
<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-Nanodrop">Nanodrop Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Nanodrop}}<html></div></html><br />
<br />
<br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! λ260 !! λ 280<br />
|-<br />
| pSB1A3 (ng/μl) || 45.7 || 45.4<br />
|-<br />
| pSB1C3 (ng/μl) || 52.2 || 48.0<br />
|-<br />
| pSB1K3 (ng/μl) || 57.9 || 59.4<br />
|}<br />
<br />
<br />
'''Conclusion:''' The results of the nanodrop indicate that we have usable concentrations of the plasmids, though they are not particularly high. However, we can attempt to use these for 3A ligation.<br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/e/ea/Ucl2012-labbook-graph9-2.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Wednesday 8.8.12 ==<br />
<br />
'''Aim:''' To extract the Laccase gene for the Degradation module and the IrrE gene for the Salt Tolerance module.<br />
<br />
<br />
'''Method:''' <br />
<br />
DNA for the laccase gene was extracted from cultured colonies according to the protocol below:<br />
<br />
<html><div class="protocol protocol-DNAExtractionFromColonies">DNA Extraction From Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColonyDNAExtraction}}<html></div></html><br />
<br />
DNA for IrrE was extracted by Genomic Extraction<br />
<br />
Protocol: Genomic Extraction<br />
<br />
<html><div class="protocol protocol-PrimerDesign">Primer Design Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PrimerDesign}}<html></div></html><br />
<br />
The design of the primers is shown by the table below<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes''' The table below gives the identity of the primers used for each reaction.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Extracted !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |IrrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|}<br />
<br />
== Thursday 9.8.12 ==<br />
<br />
<br />
'''Aim:''' Run a gel for the PCR reaction of irrE and Laccase carried out yesterday. <br />
<br />
'''Method:''' <br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
'''Results:''' The image belows shows that the gel failed to produce any products of the correct size. We feel the best explanation of this is that there was human error somewhere along the lines – leading to a mix up of the samples. <br />
<br />
<br />
<html><br />
</div><div class="experiment"></div><img id="9-3" src="https://static.igem.org/mediawiki/2012/3/3c/Ucl2012-labbook-graph9-3.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Thursday 9.8.12 ==<br />
<br />
'''Aim:''' inoculation of marine bacterium. We aim to grow up a stock of the marine bacterium Oceanibulbus indolifex, which has been selected as one of the chassis we wish to investigate. <br />
<br />
<br />
'''Method'''<br />
Oceanibulbus was ordered from NCMB and recieved as a liquid stock. <br />
<br />
Step 1: Prepare agar plates<br />
<br />
Step 2: Dip an inoculation loop into the liquid stock of bacteria and spread over the surface of the agar<br />
<br />
Step 3: Leave the bacteria to grow overnight or over the weekend.<br />
<br />
== Friday 10.8.12 ==<br />
<br />
'''Aim:''' Check the results of O.indolifex culture<br />
<br />
'''Results:''' The image below indicates there was growth for both inoculations of O.indolifex. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/9/9f/Ucligem2012Oceo.png}}<br />
<br />
<html><br />
</div><div class="experiment"></div><img id="9-4" src="https://static.igem.org/mediawiki/2012/e/e8/Ucl2012-labbook-graph9-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Thursday 9.8.12 ==<br />
<br />
'''Aim:''' To check the selectivity of our antibiotic stocks. After growth on agar plates, our transformations frequently fail to grow after inoculation into falcons. This has led us to consider the possibility that the selection has not been strong enough, leading to the growth of untransformed cells. We have designed an experiment to test whether our stocks of antibiotics are effective enough. Numerous agar plates will be made with varying antibiotic resistance, and will be inoculated with a variety of antibiotic-resistant and non-resistant bacteria. If non-resistant bacteria can grow on the antibiotic-inoculated agar, we will have some indication of whether the antibiotic activity is high enough.<br />
<br />
<br />
'''Method:'''<br />
Making plates<br />
<br />
<br />
The table below indicates the plates that were made with each antibiotic. NB// we have several eppendorf stocks of antibiotics; the plate was labelled according to the eppendorf stock it came from. This is intended to identify any of our stocks which may not be of sufficient quality to create a selective agar. <br />
<br />
{| class="wikitable"<br />
|-<br />
! Antibiotic Stock !! Presumed Concentration<br />
|-<br />
| Kanamycin 01 || 50ug/ml<br />
|-<br />
| Chloramphenicol 01 || 50ug/ml<br />
|-<br />
| Chloramphenicol 02 || 50ug/ml<br />
|-<br />
| Chloramphenicol 03 || 50ug/ml<br />
|-<br />
| Tetracycline 01 || 50ug/ml<br />
|-<br />
| Tetracycline 02|| 50ug/ml<br />
|-<br />
| Tetracycline 03 || 50ug/ml<br />
|-<br />
| Ampicillin 01 || 50ug/ml<br />
|-<br />
| Ampicillin 02|| 50ug/ml<br />
|-<br />
| Ampicillin 03 || 50ug/ml<br />
|-<br />
| Ampicillin 04 || 50ug/ml<br />
|}<br />
<br />
== Friday 10.8.12 ==<br />
<br />
<br />
'''Aim:''' To set up our samples on the plates made yesterday<br />
<br />
<br />
'''Method:''' the plates from yesterday have been split into half (in order to prevent wasting resources). Each side is being treated as a separate sample.<br />
<br />
<br />
The following table summarises the type of plates and their contents. Top10, W3110 and pTopDsh have no antibiotic resistance, and so they are our negative controls – there should be no growth except on drug-free agar. WNu has Ampicillin resistant, and should go in the presence of Ampicillin but not other antiobiotics. pTopDsh carries Tetracycline resistance, and should grow in the presence of Tetracycline but not the other antibiotics. <br />
<br />
{| class="wikitable"<br />
|-<br />
! Antibiotic Stock !! Sample Added !! Expected Result !! Result<br />
|-<br />
|rowspan="2"| Kanamycin 01 || WNu || No growth (WNu is Ampicillin resistant only) || no colony<br />
|-<br />
| WNu|| No growth (WNu is Ampicillin resistant only)|| no colony<br />
|-<br />
|rowspan="2"| Chloramphenicol 01 || Cobalt Curli Cells || Growth (Cobalt Curli cells is Chloramphenicol resistant) || colonies<br />
|-<br />
| WNu || No growth (WNu is Ampicillin resistant only)|| no colony<br />
|-<br />
|rowspan="2"| Chloramphenicol 02 ||Cobalt Curli Cells || Growth (Cobalt Curli cells is Chloramphenicol resistant) || colonies<br />
|-<br />
| WNu || No growth (WNu is Ampicillin resistant only)|| no colony<br />
|-<br />
|rowspan="2"| Chloramphenicol 03 || Cobalt Curli Cells|| Growth (Cobalt Curli cells is Chloramphenicol resistant) || colonies <br />
|-<br />
|W3110 || No growth (W3110 has no resistance)|| no colony<br />
|-<br />
|rowspan="2"| Tetracycline 01|| WNu ||No growth (WNu is Ampicillin resistant only)|| no colony<br />
|-<br />
|75 ||Growth (75 is Tetracycline Resistant)|| colonies<br />
|-<br />
|rowspan="2"| Tetracycline 02|| WNu ||No growth (WNu is Ampicillin resistant only)|| no colony<br />
|-<br />
|75 ||Growth (75 is Tetracycline Resistant)|| colonies<br />
|-<br />
|rowspan="2"| Tetracycline 03|| WNu ||No growth (WNu is Ampicillin resistant only)|| no colony<br />
|-<br />
|75 ||Growth (75 is Tetracycline Resistant)|| no colony<br />
|-<br />
|rowspan="2"| Ampicillin 01 || pTopDsh || No Growth (pTopDsh has no resistance)|| no colony<br />
|-<br />
|WNu||No growth (WNu is Ampicillin resistant only)|| colonies <br />
|-<br />
| rowspan="2"| Ampicillin 02|| WNu || Growth (WNu is Ampicillin resistant)|| no colony<br />
|-<br />
|W3100 || No Growth (W3100 has no resistance)|| colonies<br />
|-<br />
| rowspan="2"| Ampicillin 03 || WNu ||Growth (WNu is Ampicillin resistant)|| no colony<br />
|-<br />
| pTopDsh || No Growth (pTopDsh has no resistance)|| no colony<br />
|-<br />
|rowspan="2"| Ampicillin 04 || WNu ||Growth (WNu is Ampicillin resistant)|| colonies<br />
|-<br />
| pTopDsh || No Growth (pTopDsh has no resistance)|| no colony<br />
|-<br />
|rowspan="5"| Control - No Drug || W3110 || Growth||colonies<br />
|-<br />
| Top10 || Growth|| colonies<br />
|-<br />
| 75 || Growth|| colonies<br />
|-<br />
| CoCurli || Growth|| colonies<br />
|-<br />
|pTopDsh || Growth|| colonies<br />
|}<br />
<br />
Plates results are as expected, no problem with the activity of the antibiotics however we are not sure if the antibiotic are at the concentration stated. <br />
<br />
<html><br />
</div><div class="experiment"></div><img id="9-5" src="https://static.igem.org/mediawiki/2012/6/6a/Ucl2012-labbook-graph9-5.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Friday 10.8.12 ==<br />
<br />
'''Aim:''' To characterise the unmodified Curli BioBrick. As part of our experiment, we want to change the promoter in front of the Curli cluster of genes. This experiment will test the protocol we intend to use using the original BioBrick (BBa_K540000)<br />
<br />
<br />
'''Method'''<br />
<br />
Congo Red<br />
<br />
<html><div class="protocol protocol-CurliCharacterisation">Curli Characterisation Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/CurliCharacterisation}}<html></div></html><br />
<br />
'''Step 2 - Streak Cells:''' Streak a sample of WNu onto a Antibiotic-inoculated Congo Red plate and a Antibiotic-Free Congo Red Plate. Do the same for the CoCurli (BBa_K540000 transformed) cells. The table below indicates the results expected for each of these four plates. <br />
<br />
{| class="wikitable"<br />
|-<br />
! Cell Type !! Expected Results on Antibiotic-free Congo Red Agar !! Expected Results on Chloramphenicol-inoculated Congo Red Agar<br />
|-<br />
| WNu || Formation of White Colonies || No Colony Formation (WNu are not Chloramphenicol-resistant)<br />
|-<br />
| K540000 (cobalt curli) transformed cells || Formation of Red Colonies || Formation of Red Colonies<br />
|}<br />
<br />
<br />
'''Step 3 - Incubate:''' A sample of each were cultured at 30 degrees over the weekend because Curli production is expressed better at lower temperatures. <br />
<br />
<br />
<br />
<br />
<br />
<html><br />
</div><div class="experiment"></div><img id="9-6" src="https://static.igem.org/mediawiki/2012/d/da/Ucl2012-labbook-graph9-6.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Friday 10.8.12==<br />
<br />
'''Aim:''' To assay the nuclease activity in a test of the protocol. We will use a cell line called WNu which has native secreted nuclease activity. This, alongside a nuclease-negative control, will be cultured on agar containing DNA. Nuclease activity will be indicated by the presence of 'halos' surrounding the colonies, where nuclease activity has degraded DNA and increased the translucence of the agar.<br />
<br />
<br />
'''Method'''<br />
Prepare DNAase agar +IPTG + amp.<br />
<br />
<br />
'''Results'''<br />
The table below summarises the results from this experiment. Also included is an image of the agars, with the halo of nuclease activity indicated. <br />
<br />
{| class="wikitable"<br />
|-<br />
! Sample !! Ampicillin + IPTG !! Ampicillin !! No Antibiotic<br />
|-<br />
|Control BBa_K540000 transformed cells || Opaque || Opaque || Opaque<br />
|-<br />
| WNu Cells || Halo Formation || Halo Formation || Halo Formation<br />
|}<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/ed/Ucligem2012expt9.6.png}}<br />
<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/Protocols/RestrictionEnzymeDigest1Team:University College London/Protocols/RestrictionEnzymeDigest12012-09-27T01:36:03Z<p>Rwilkinson: </p>
<hr />
<div><noinclude>{{:Team:University_College_London/templates/head|coverpicture=week4}}<br />
<br />
<html><img href="https://static.igem.org/mediawiki/2012/d/de/Ucl2012-protocols-logo-enzdig.png" /></html><br />
== Enzyme Digest Protocol 1 ==</noinclude><br />
<br />
'''Step 1 - Thawing cells:''' Thaw all materials on ice<br />
<br />
'''Step 2 - Adding Ingredient:''' Add the following ingredients to autoclaved/sterile eppendorf tubes <br />
<br />
{| class="wikitable"<br />
|-<br />
! Component !! Amount (ul) (one enzyme used) !! Amount (ul) (two enzymes used)<br />
|-<br />
| dH20 || 2.5 || 1.5<br />
|-<br />
| Buffer 1x || 1 || 1<br />
|-<br />
| DNA template|| 5|| 5<br />
|-<br />
| BSA || 0.5|| 0.5<br />
|-<br />
| Enzyme 1 || 1 || 2<br />
|-<br />
| Enzyme 2 || N/A|| 1<br />
|}<br />
<br />
<br />
'''Step 3 - Addition of BioBrick:''' Flick contents gently and centrifuge. <br />
<br />
'''Step 4 - Centrifuge:'''<br />
<br />
RPM: 14000<br />
<br />
Time: 1 minute<br />
<br />
Temperature: 18oC<br />
<br />
'''Step 5 - Digest Program:''' Place the samples on a thermocycler under the following conditions: <br />
<br />
RPM: 550<br />
<br />
Time: 2.5 hours<br />
<br />
Temperature: 37oC<br />
<br />
'''Step 6 - Denaturing Enzymes:''' If you are not running the samples on a gel immediately, denature the restriction enzymes by running the samples on a thermocycler under the following conditions:<br />
<br />
RPM: 550<br />
<br />
Time: 25 minutes<br />
<br />
Temperature: 65oC <br />
<br />
<br />
<noinclude><br />
{{:Team:University_College_London/templates/foot}}<br />
</noinclude></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week9Team:University College London/LabBook/Week92012-09-27T01:34:04Z<p>Rwilkinson: /* Friday 10.8.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="8-4" src="https://static.igem.org/mediawiki/2012/0/08/Ucl2012-labbook-graph98-4.png" /><br />
<div class="experimentContent"></html><br />
<br />
== Monday 6.7.12 ==<br />
<br />
<br />
'''Aim:''' Inoculate the Plates that were transformed on Thursday. On Thursday we began Expt 8.5 by transforming the BioBricks, and our results on Friday indicated there was growth for all. (However, the negative control was contaminated, so we will have to be careful to assess the analytical restriction digest for correct products). The table below describes the BioBricks that were used:<br />
<br />
The two constitutive promoters were used because we were never able to detect our previous constitutive promoter BBa_J23119 (Expt 7.3) and our 3A ligation of BBa_J23119 and BBa_B0034 failed (Expt 8.4). This does not necessarily indicate our transformation of BBa_J23119 has failed, but we decided to transform several more in case. The RBS promoter BBa_B0030 was transformed for the same reason. The Gas Vesicle Cluster was transformed because all previous attempts have failed. <br />
<br />
<br />
'''Method'''<br />
<br />
<br />
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html><br />
<br />
'''Step 2 – Inoculating Colonies into a Selective Broth:''' The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Volume Inoculated !! Broth (ml) !! Antibiotic (ug/ml)<br />
|-<br />
| rowspan="8" |BioBrick ||rowspan="2" | BBa_J23100 || 10ul ||rowspan="8" |Lysogeny Broth (5) || rowspan="8" | Ampicillin(50ug/ml)<br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | BBa_J23106 || 10ul <br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | BBa_B0030 || 10ul <br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | BBa_I750016 || 10ul <br />
|-<br />
| 90ul <br />
|}<br />
<br />
== Tuesday 7 ==<br />
<br />
'''Aim:''' Results from Colony Picking<br />
<br />
'''Results'''The table below indicates there was growth for all BioBricks.<br />
<br />
{| class="wikitable"<br />
|-<br />
! Biobrick !! Growth<br />
|-<br />
| I750016 sample 1 || No Growth<br />
|-<br />
| I750016 sample 2 || No Growth<br />
|-<br />
| I750016 sample 3 || No Growth<br />
|-<br />
| B0030 sample 1 || No Growth<br />
|-<br />
| B0030 sample 2 || No Growth<br />
|-<br />
| B0030 sample 3 || No Growth<br />
|-<br />
| J23100 sample 1 || No Growth<br />
|-<br />
| J23100 sample 2 || No Growth<br />
|-<br />
| J23100 sample 3 || No Growth<br />
|-<br />
| J23106 sample 1 || Growth<br />
|-<br />
| J23106 sample 1 || Growth<br />
|-<br />
| J23106 sample 1 || Growth<br />
|}<br />
<br />
'''Conclusion:''' We are unsure why we have failed to get colonies for many of the BioBricks. Again, we are considering the possibility that our agar is not selective enough. Initially we thought this may be due to adding Antibiotic while the agar is too hot, leading to degradation of the sample. However this has been corrected in the protocol, but the problem is persisting. Instead we are considering running a troubleshoot by testing the selectivity of the various eppendorfs of antibiotic stocks we made at the beginning of the summer. If any show less selectivity then we can stop using them. This will be considered for later in the week. Meanwhile, we can miniprep and nanodrop BBa_J23106 (strong constitutive promoter) <br />
<br />
<html><div class="protocol protocol-Miniprep">Miniprep Protocol 1 (ANACHEM)</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Miniprep2}}<html></div></html><br />
<br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
<br />
'''Results:''' There was no product for BBa_J23106 on the gel, therefore either the transformation failed or the concentration is very low<br />
<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="8-5" src="https://static.igem.org/mediawiki/2012/5/58/Ucl2012-labbook-graph98-5.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 6.7.12 ==<br />
<br />
'''Aim:''' Repeat the inoculation of the ligation products (J23119 + B0034) done last week. Innoculation is only done for the (J23119 + B0034), but not for the (starvation promoter + B0034) because that ligation did not transform.<br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html><br />
<br />
Step 2 – Inoculating Colonies into a Selective Broth: The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.<br />
<br />
{| class="wikitable"<br />
|-<br />
! Ligation !! No. innoculations !! Broth !! Antibiotic<br />
|-<br />
| J23119 + B0034 || 3 || Lysogeny Broth || Kanamycin<br />
|}<br />
<br />
== Tuesday 7 ==<br />
<br />
<br />
'''Aim:''' Check results of Colony Picking<br />
<br />
'''Results:''' The table below indicates whether there was growth for the BioBricks ligations<br />
<br />
{| class="wikitable"<br />
|-<br />
! Ligation !! Growth/No Growth<br />
|-<br />
| J23119+B0034 sample 1 || Growth<br />
|-<br />
| J23119+B0034 sample 2|| Growth<br />
|-<br />
| J23119+B0034 sample 3 || Growth<br />
|}<br />
<br />
'''Conclusion:''' We can proceed now to miniprep the samples, and run them on a gel to test the presence of a band<br />
<br />
'''Method:''' <br />
<br />
<html><div class="protocol protocol-Miniprep">Miniprep Protocol 1 (ANACHEM)</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Miniprep2}}<html></div></html><br />
<br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
'''Results:''' There was no product on the gel, suggesting the ligation failed. <br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="9-1" src="https://static.igem.org/mediawiki/2012/2/2c/Ucl2012-labbook-graph9-1.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 8.8.12==<br />
<br />
'''Aim:''' To repeat Expt 8.2, where we undertook PCR amplification of pSB1A3, pSB1C3, pSB1K3 for 3A assembly. While we achieved bands of the correct size for all three plasmid backbones in Expt 8.2, the nanodrop concentration for pSB1A3 and pSB1C3 was very low (unusable). Therefore we decided to repeat the PCR. As the concentration of pSB1K3 was not particularly high, we decided to repeat this again also.<br />
<br />
<br />
'''Method:'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.1, with a 1000bp ladder. No products were detected. We expected a product corresponding to the size of the plasmid pSB1K3 (2000bp), pSB1C3 (2000bp) and pSB1A3 (2000bp) in Lanes 1-3 respectively. These are indicated by the letters A (pSB1K3), B (pSB1C3) and C (pSB1A3). <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/1/14/Ucligem2012Expt_9.1.png}}<br />
<br />
{| class="wikitable"<br />
|-<br />
! Backbone !! Expected Size<br />
|-<br />
| pSB1K3 || 2204bp<br />
|-<br />
| pSB1C3 || 2070bp<br />
|-<br />
| pSB1A3|| 2155bp<br />
|}<br />
<br />
<br />
'''Conclusion:''' We feel the poor nanodrop results from Expt 8.2, and the poor electrophoresis results from this Expt may be a result of the choice of polymerase. Our supervisors recommended we try Phusion Polymerase, which we will attempt tomorrow.<br />
<br />
== Tuesday 9.8.12 ==<br />
<br />
<br />
'''Aim:''' To repeat PCR with Phusion Polymerase to amplify the three plasmid backbones. As we had more confidence that this PCR reaction would work, we included an extra plasmid, pSB1T3, also required for ligation. <br />
<br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.1, with a 1000bp ladder. In Lane 1 can be seen a product corresponding to the correct size of pSB1A3 (2155) as indicated by A. In Lane 2 is a product, shown by B, which is of the correct size for the plasmid pSB1K3 (22040bp). In Lane 3, we expect a band of size 2461bp, for the plasmid pSB1T3. This is shown by C. As it is absent, it would appear the PCR reaction failed. In Lane 4 is a product corresponding to pSB1C3 (2070bp) as shown by D. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/9/99/Ucl2012Expt9.1.2.png}}<br />
<br />
{| class="wikitable"<br />
|-<br />
! Backbone !! Expected Size<br />
|-<br />
| pSB1K3 || 2204bp<br />
|-<br />
| pSB1C3 || 2070bp<br />
|-<br />
| pSB1A3|| 2155bp<br />
|-<br />
| pSB1T3 || 2461bp<br />
|}<br />
<br />
'''Conclusion:''' The PCR reaction worked for pSB1K3, pSB1C3 and pSB1A3. This would suggest the Phusion Polymerase is a better choice than Taq polymerase. These plasmids can now be nanodropped, and if their concentration is sufficient they can be used for ligation.<br />
<br />
== Thursday 10.8.12 ==<br />
<br />
<br />
'''Aim:''' To carry out nanodrop for the PCR reaction of plasmids with phusion polymerase<br />
<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-Nanodrop">Nanodrop Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Nanodrop}}<html></div></html><br />
<br />
<br />
{| class="wikitable"<br />
|-<br />
! Plasmid !! λ260 !! λ 280<br />
|-<br />
| pSB1A3 (ng/μl) || 45.7 || 45.4<br />
|-<br />
| pSB1C3 (ng/μl) || 52.2 || 48.0<br />
|-<br />
| pSB1K3 (ng/μl) || 57.9 || 59.4<br />
|}<br />
<br />
<br />
'''Conclusion:''' The results of the nanodrop indicate that we have usable concentrations of the plasmids, though they are not particularly high. However, we can attempt to use these for 3A ligation.<br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/e/ea/Ucl2012-labbook-graph9-2.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Wednesday 8.8.12 ==<br />
<br />
'''Aim:''' To extract the Laccase gene for the Degradation module and the IrrE gene for the Salt Tolerance module.<br />
<br />
<br />
'''Method:''' <br />
<br />
DNA for the laccase gene was extracted from cultured colonies according to the protocol below:<br />
<br />
<html><div class="protocol protocol-DNAExtractionFromColonies">DNA Extraction From Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColonyDNAExtraction}}<html></div></html><br />
<br />
DNA for IrrE was extracted by Genomic Extraction<br />
<br />
Protocol: Genomic Extraction<br />
<br />
<html><div class="protocol protocol-PrimerDesign">Primer Design Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PrimerDesign}}<html></div></html><br />
<br />
The design of the primers is shown by the table below<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes''' The table below gives the identity of the primers used for each reaction.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Extracted !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |IrrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|}<br />
<br />
== Thursday 9.8.12 ==<br />
<br />
<br />
'''Aim:''' Run a gel for the PCR reaction of irrE and Laccase carried out yesterday. <br />
<br />
'''Method:''' <br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
'''Results:''' The image belows shows that the gel failed to produce any products of the correct size. We feel the best explanation of this is that there was human error somewhere along the lines – leading to a mix up of the samples. <br />
<br />
<br />
<html><br />
</div><div class="experiment"></div><img id="9-3" src="https://static.igem.org/mediawiki/2012/3/3c/Ucl2012-labbook-graph9-3.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Thursday 9.8.12 ==<br />
<br />
'''Aim:''' inoculation of marine bacterium. We aim to grow up a stock of the marine bacterium Oceanibulbus indolifex, which has been selected as one of the chassis we wish to investigate. <br />
<br />
<br />
'''Method'''<br />
Oceanibulbus was ordered from NCMB and recieved as a liquid stock. <br />
<br />
Step 1: Prepare agar plates<br />
<br />
Step 2: Dip an inoculation loop into the liquid stock of bacteria and spread over the surface of the agar<br />
<br />
Step 3: Leave the bacteria to grow overnight or over the weekend.<br />
<br />
== Friday 10.8.12 ==<br />
<br />
'''Aim:''' Check the results of O.indolifex culture<br />
<br />
'''Results:''' The image below indicates there was growth for both inoculations of O.indolifex. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/9/9f/Ucligem2012Oceo.png}}<br />
<br />
<html><br />
</div><div class="experiment"></div><img id="9-4" src="https://static.igem.org/mediawiki/2012/e/e8/Ucl2012-labbook-graph9-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Thursday 9.8.12 ==<br />
<br />
'''Aim:''' To check the selectivity of our antibiotic stocks. After growth on agar plates, our transformations frequently fail to grow after inoculation into falcons. This has led us to consider the possibility that the selection has not been strong enough, leading to the growth of untransformed cells. We have designed an experiment to test whether our stocks of antibiotics are effective enough. Numerous agar plates will be made with varying antibiotic resistance, and will be inoculated with a variety of antibiotic-resistant and non-resistant bacteria. If non-resistant bacteria can grow on the antibiotic-inoculated agar, we will have some indication of whether the antibiotic activity is high enough.<br />
<br />
<br />
'''Method:'''<br />
Making plates<br />
<br />
<br />
The table below indicates the plates that were made with each antibiotic. NB// we have several eppendorf stocks of antibiotics; the plate was labelled according to the eppendorf stock it came from. This is intended to identify any of our stocks which may not be of sufficient quality to create a selective agar. <br />
<br />
{| class="wikitable"<br />
|-<br />
! Antibiotic Stock !! Presumed Concentration<br />
|-<br />
| Kanamycin 01 || 50ug/ml<br />
|-<br />
| Chloramphenicol 01 || 50ug/ml<br />
|-<br />
| Chloramphenicol 02 || 50ug/ml<br />
|-<br />
| Chloramphenicol 03 || 50ug/ml<br />
|-<br />
| Tetracycline 01 || 50ug/ml<br />
|-<br />
| Tetracycline 02|| 50ug/ml<br />
|-<br />
| Tetracycline 03 || 50ug/ml<br />
|-<br />
| Ampicillin 01 || 50ug/ml<br />
|-<br />
| Ampicillin 02|| 50ug/ml<br />
|-<br />
| Ampicillin 03 || 50ug/ml<br />
|-<br />
| Ampicillin 04 || 50ug/ml<br />
|}<br />
<br />
== Friday 10.8.12 ==<br />
<br />
<br />
'''Aim:''' To set up our samples on the plates made yesterday<br />
<br />
<br />
'''Method:''' the plates from yesterday have been split into half (in order to prevent wasting resources). Each side is being treated as a separate sample.<br />
<br />
<br />
The following table summarises the type of plates and their contents. Top10, W3110 and pTopDsh have no antibiotic resistance, and so they are our negative controls – there should be no growth except on drug-free agar. WNu has Ampicillin resistant, and should go in the presence of Ampicillin but not other antiobiotics. pTopDsh carries Tetracycline resistance, and should grow in the presence of Tetracycline but not the other antibiotics. <br />
<br />
{| class="wikitable"<br />
|-<br />
! Antibiotic Stock !! Sample Added !! Expected Result !! Result<br />
|-<br />
|rowspan="2"| Kanamycin 01 || WNu || No growth (WNu is Ampicillin resistant only) ||insert<br />
|-<br />
|W3110 || No growth (W3110 has no resistance)||insert<br />
|-<br />
|rowspan="2"| Kanamycin 01 || WNu || No growth (WNu is Ampicillin resistant only) ||insert<br />
|-<br />
|W3110 || No growth (W3110 has no resistance)||insert<br />
|-<br />
|rowspan="2"| Tetracycline 01|| WNu ||No growth (WNu is Ampicillin resistant only)||insert<br />
|-<br />
|75 ||Growth (75 is Tetracycline Resistant)||insert<br />
|-<br />
|rowspan="2"| Tetracycline 02|| WNu ||No growth (WNu is Ampicillin resistant only)||insert<br />
|-<br />
|75 ||Growth (75 is Tetracycline Resistant)||insert<br />
|-<br />
|rowspan="2"| Tetracycline 03|| WNu ||No growth (WNu is Ampicillin resistant only)||insert<br />
|-<br />
|75 ||Growth (75 is Tetracycline Resistant)||insert<br />
|-<br />
|rowspan="2"| Ampicillin 01 || pTopDsh || No Growth (pTopDsh has no resistance)||insert<br />
|-<br />
|WNu||No growth (WNu is Ampicillin resistant only)||insert<br />
|-<br />
| rowspan="2"| Ampicillin 02|| WNu || Growth (WNu is Ampicillin resistant)||insert<br />
|-<br />
|W3100 || No Growth (W3100 has no resistance)||insert<br />
|-<br />
| rowspan="2"| Ampicillin 03 || WNu ||Growth (WNu is Ampicillin resistant)||insert<br />
|-<br />
| pTopDsh || No Growth (pTopDsh has no resistance)||insert<br />
|-<br />
|rowspan="2"| Ampicillin 04 || WNu ||Growth (WNu is Ampicillin resistant)||insert<br />
|-<br />
| pTopDsh || No Growth (pTopDsh has no resistance)||insert<br />
|-<br />
|rowspan="5"| Control - No Drug || W3110 || Growth||insert<br />
|-<br />
| Top10 || Growth||insert<br />
|-<br />
| 75 || Growth||insert<br />
|-<br />
| CoCurli || Growth||insert<br />
|-<br />
|pTopDsh || Growth||insert<br />
|}<br />
<br />
The samples will be incubated over hte weekend at 30˚C and there growth assessed on Monday<br />
<br />
<html><br />
</div><div class="experiment"></div><img id="9-5" src="https://static.igem.org/mediawiki/2012/6/6a/Ucl2012-labbook-graph9-5.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Friday 10.8.12 ==<br />
<br />
'''Aim:''' To characterise the unmodified Curli BioBrick. As part of our experiment, we want to change the promoter in front of the Curli cluster of genes. This experiment will test the protocol we intend to use using the original BioBrick (BBa_K540000)<br />
<br />
<br />
'''Method'''<br />
<br />
Congo Red<br />
<br />
<html><div class="protocol protocol-CurliCharacterisation">Curli Characterisation Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/CurliCharacterisation}}<html></div></html><br />
<br />
'''Step 2 - Streak Cells:''' Streak a sample of WNu onto a Antibiotic-inoculated Congo Red plate and a Antibiotic-Free Congo Red Plate. Do the same for the CoCurli (BBa_K540000 transformed) cells. The table below indicates the results expected for each of these four plates. <br />
<br />
{| class="wikitable"<br />
|-<br />
! Cell Type !! Expected Results on Antibiotic-free Congo Red Agar !! Expected Results on Chloramphenicol-inoculated Congo Red Agar<br />
|-<br />
| WNu || Formation of White Colonies || No Colony Formation (WNu are not Chloramphenicol-resistant)<br />
|-<br />
| K540000 (cobalt curli) transformed cells || Formation of Red Colonies || Formation of Red Colonies<br />
|}<br />
<br />
<br />
'''Step 3 - Incubate:''' A sample of each were cultured at 30 degrees over the weekend because Curli production is expressed better at lower temperatures. <br />
<br />
<br />
<br />
<br />
<br />
<html><br />
</div><div class="experiment"></div><img id="9-6" src="https://static.igem.org/mediawiki/2012/d/da/Ucl2012-labbook-graph9-6.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Friday 10.8.12==<br />
<br />
'''Aim:''' To assay the nuclease activity in a test of the protocol. We will use a cell line called WNu which has native secreted nuclease activity. This, alongside a nuclease-negative control, will be cultured on agar containing DNA. Nuclease activity will be indicated by the presence of 'halos' surrounding the colonies, where nuclease activity has degraded DNA and increased the translucence of the agar.<br />
<br />
<br />
'''Method'''<br />
Prepare DNAase agar +IPTG + amp.<br />
<br />
<br />
'''Results'''<br />
The table below summarises the results from this experiment. Also included is an image of the agars, with the halo of nuclease activity indicated. <br />
<br />
{| class="wikitable"<br />
|-<br />
! Sample !! Ampicillin + IPTG !! Ampicillin !! No Antibiotic<br />
|-<br />
|Control BBa_K540000 transformed cells || Opaque || Opaque || Opaque<br />
|-<br />
| WNu Cells || Halo Formation || Halo Formation || Halo Formation<br />
|}<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/ed/Ucligem2012expt9.6.png}}<br />
<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week7Team:University College London/LabBook/Week72012-09-27T01:30:47Z<p>Rwilkinson: /* Tuesday 24.7.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="6-3" src="https://static.igem.org/mediawiki/2012/1/17/Ucl2012-labbook-graph76-3.png" /><div class="experimentContent"><br />
</html><br />
== Monday (23.7.12) ==<br />
<br />
'''Aim - Picking colonies:''' On Friday 20.7.12 we found that the transformation for BBa_J23119, BBa_I750016, BBa_B0015, and BBa_B0034 all produced colonies and were suitable for colony picking. <br />
<br />
<html><div class="protocol protocol-ColPic">Picking Colonies</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html><br />
<br />
'''Step 2 – Inoculating Colonies into a Selective Broth:''' The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Volume Inoculated !! Broth (ml) !! Antibiotic (ug/ml)<br />
|-<br />
| rowspan="8" |BioBrick ||rowspan="2" | BBa_J23119 || 10ul ||rowspan="8" |Lysogeny Broth (5) || rowspan="8" | Ampicillin(50ug/ml)<br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | BBa_I750016 || 10ul <br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | BBa_B0015 || 10ul <br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | BBa_B0034 || 10ul <br />
|-<br />
| 90ul <br />
|}<br />
<br />
<br />
== Tuesday 24.7.12 ==<br />
<br />
'''Aim – Results from Colony Picking'''<br />
<br />
'''Results:''' The table below indicates whether there was growth for the BioBricks<br />
<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Volume Inoculated !! Growth<br />
|-<br />
| rowspan="8" |BioBrick ||rowspan="2" | BBa_J23119 || 10μl || Yes<br />
|-<br />
| 90μl || Yes<br />
|-<br />
| rowspan="2" | BBa_I750016 || 10μl || No<br />
|-<br />
| 90μl || No<br />
|-<br />
| rowspan="2" | BBa_B0015 || 10μl || Yes<br />
|-<br />
| 90μl || Yes<br />
|-<br />
| rowspan="2" | BBa_B0034 || 10μl || No<br />
|-<br />
| 90μl || No<br />
|}<br />
<br />
<br />
'''Conclusion:''' We concluded that the failure of BBa_I750016 and BBa_B0034 is not necessarily due to failed transformation, as there was an unusual degree difficulty Picking the colonies 23.7.12. From this, it is possible that colonies were not properly inoculated, and so this requires a repeat. BBa_J23119 and BBa_B0015 however appeared sufficient for the protocol to be continued<br />
<br />
<br />
Miniprep of Samples<br />
<br />
<html><div class="protocol protocol-Miniprep">Miniprep Protocol 1 (Qiagen)</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Miniprep1}}<html></div></html><br />
<br />
<br />
The above protocol was done only for J23119 and B0015 – three stocks of each, originating from each of the three replicate falcon tubes<br />
<br />
<br />
Restriction Digest and Gel Electrophoresis of Samples<br />
<html><div class="protocol protocol-RestrictionEnzymeDigest">Restriction Enzyme Digest Protocol 1</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/RestrictionEnzymeDigest1}}<html></div></html><br />
<br />
<br />
'''Step 2:''' Set up Reaction 1(Plasmid) and Reaction 2 (Control) for both the miniprepped BioBricks.<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !!Recipe !! Enzymes <br />
|-<br />
| rowspan="8" |BioBrick || rowspan="2" | BBa_J23119 ||Digested Plasmid || Xba1 & Spe1 <br />
|-<br />
| Undigested Plasmid (Control) || None <br />
|-<br />
| rowspan="2" | BBa_B0015 || Digested Plasmid|| Xba1 & Spe1<br />
|-<br />
| Undigested Plasmid (Control) || None <br />
|-<br />
|}<br />
<br />
'''Results:'''<br />
The gel demonstrated no bands for the plasmid and the uncut DNA, which would suggest that there is a low concentration of the plasmid. Therefore we undertook a Nanodrop of the sample.<br />
<br />
<html><div class="protocol protocol-Nanodrop">Nanodrop Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Nanodrop}}<html></div></html><br />
<br />
'''Results''' <br />
{| class="wikitable"<br />
|-<br />
! BioBrick !! λ260 !! λ 280<br />
|-<br />
| BBa_J23119 (ng/μl) || 24.8 || 26.1 <br />
|-<br />
| BBa_B0015 (ng/μl) ||41.7 || 56.6<br />
|-<br />
|}<br />
<br />
'''Conclusion:''' The concentration of these plasmids is very low<br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="7-1" src="https://static.igem.org/mediawiki/2012/1/13/Ucl2012-labbook-graph7-1.png" /><br />
<div class="experimentContent"></html><br />
<br />
==Monday 23.7.12 ==<br />
<br />
'''Aim - Transformation of TetR BBa_C0040 BioBrick'''<br />
<br />
<html><div class="protocol protocol-Transformation">Transformation Protocol 3</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Transformation3}}<html></div></html><br />
<br />
'''Step 1 – Thawing Cells:''' Use W3110 cell line created in Week 2 (Expt 2.1)<br />
<br />
'''Step 3 – Addition of BioBrick:''' To a 2ml eppendorf, add 1ul of the following BioBricks. Note: we have changed the protocol for our positive control. Previously it contained no BioBrick, but it has been recommended to us that we transform our positive control such that there is one for each BioBrick – this will tell us if the BioBrick has in any way affected cell viability. This will be used from this point onwards. Include an extra tube as a negative control, with no BioBrick added<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Function !! Module<br />
|-<br />
| BioBrick || BBa_C0040 ||Tetracycline Repressor || Buoyancy<br />
|-<br />
| rowspan="2" | Control || Positive (Contains BioBrick BBa_C0040) || || <br />
|-<br />
| Negative (No Biobrick) || || <br />
|-<br />
|}<br />
<br />
'''Step 9 - Plating samples on Agar Plates:''' The table below indicates the chosen inoculation volume (two for each BioBrick) and the correct gel antibiotic concentration for all samples.<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Volume Inoculated !! Antibiotic in Gel (μg/ml)<br />
|-<br />
| rowspan="2" |BioBrick ||rowspan="2" | BBa_C0040 || 10μl || rowspan="2" | Ampicillin(50ug/ml)<br />
|-<br />
| 90μl <br />
|-<br />
| rowspan="2" | Control || Positive (Contains BioBrick BBa_C0040)|| 36μl || No Antibiotic<br />
|-<br />
| Negative (No BioBrick)|| 36μl || 2x Ampicillin(50μg/ml)<br />
|-<br />
|}<br />
<br />
<br />
== Tuesday 24.7.12 ==<br />
<br />
'''Aim - Results of Transformation'''<br />
<br />
'''Result:''' The table below indicates that there was growth for this transformation. <br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Volume Inoculated !! Colony Formation<br />
|-<br />
| rowspan="2" |BioBrick ||rowspan="2" | BBa_C0040 || 10ul || Yes<br />
|-<br />
| 90ul || Yes<br />
|-<br />
| rowspan="2" | Control || Positive (Contains BioBrick BBa_C0040)|| 36ul || Yes<br />
|-<br />
| Negative (No BioBrick)|| 36ul || No<br />
|-<br />
|}<br />
<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="7-2" src="https://static.igem.org/mediawiki/2012/2/22/Ucl2012-labbook-graph7-2.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 23.7.12 ==<br />
'''Aim - Repeat Restriction Digest for BioBricks in Expt 4.1 and 5.1, where the gel previously was inconclusive''':<br />
This is intended to diagnose whether the correct plasmid had been transformed into our bacteria, by measuring the size of the digested products against a DNA ladder. In previous gel attempts, K540000 has produced a band of the correct size, but we are repeating it because of the presence of other unexpected bands, which we expect are contaminants from the reaction. A previous restriction digest of BBa_I13522 has failed to produce a band of the correct size, so we are repeating the digest before considering another transformation. For the same reason, we are repeating the digest of BBa_K398108, which produced bands of incorrect size, which is suggestive of contamination. <br />
<br />
<html><div class="protocol protocol-RestrictionEnzymeDigest">Restriction Enzyme Digest Protocol 1</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/RestrictionEnzymeDigest1}}<html></div></html><br />
<br />
'''Step 2:''' Set up as follows<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Recipe !! Enzymes<br />
|-<br />
| rowspan="5" | '''BioBricks''' || BBa_K540000 (Expt 4.1) || Digested || Xbar 1 & Spe1<br />
|-<br />
| BBa_I13522 (Expt 4.1) || Digested || Xbar 1 & Spe1<br />
|-<br />
| BBa_K398108 (Expt 5.1) || Digested || Xbar 1 & Spe1<br />
|-<br />
| BBa_KI23003 (Expt 5.1) || Digested || Xbar 1 & Spe1<br />
|-<br />
|}<br />
<br />
<br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 7.2. Visible in Lane 1 is a product of the correct size for the BBa_K540000 insert (3123bp), as indicated by A. Also shown is a correct sized product for the backbone pSB1C3 (2070bp), as indicated by B. Lane 2 shows a product corresponding to the size of the BBa_I13522 insert (937bp) as indicated by C. Also present is a product corresponding to the size of the pSB1A3 backbone (2155bp) as indicated by D. Lane 3 has a product corresponding to the expected size of insert BBa_K398108 (844bp) as indicated by E, and a product of the expected size for the plasmid backbone pSB1C3 (2070bp) as indicated by F. Lane 4 shows no products, where we would expect a product of size 1849bp (indicated by G) and a product of 2155 (indicated by H). <br />
<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/3/37/Ucl2012-labbook-week7-gel1.png}}<br />
<br />
<br />
'''Conclusion:''' Plasmids BBa_K540000 (3123), BBa_I13522 (937) and BBa_K398108 (844) have produced bands of the correct size. The band at 2000 is the plasmid backbone. The failure of BBa_K123003 to produce a band is not of great concern, as we do not expect we will require this BioBrick. However, we may repeat it at a later date.<br />
<br />
<br />
== Friday 3.8.12 ==<br />
<br />
'''Aim - Check results of Transformation:''' The table below indicates whether there was growth on the Agar Plates after Transformation.<br />
<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Volume Inoculated !! Colony Formation<br />
|-<br />
| rowspan="2" |BioBrick ||rowspan="2" | BBa_J23100 || 10ul || Yes<br />
|-<br />
| 90ul || Yes<br />
|-<br />
| rowspan="2" |BioBrick ||rowspan="2" | BBa_J23106 || 10ul || Yes<br />
|-<br />
| 90ul || Yes<br />
|-<br />
| rowspan="2" |BioBrick ||rowspan="2" | BBa_B0030 || 10ul || Yes<br />
|-<br />
| 90ul || Yes<br />
|-<br />
| rowspan="2" |BioBrick ||rowspan="2" | BBa_I750016 || 10ul || Yes<br />
|-<br />
| 90ul || Yes<br />
|-<br />
| rowspan="2" | Control || Positive || 36ul || Yes<br />
|-<br />
| Negative (No BioBrick)|| 36ul || Yes<br />
|-<br />
|}<br />
<br />
<br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="7-3" src="https://static.igem.org/mediawiki/2012/6/6e/Ucl2012-labbook-graph7-3.png" /><div class="experimentContent"></html><br />
<br />
==Tuesday 24.7.12 ==<br />
<br />
'''Aim - Colony Picking from unsuccessful colonies for Expt 7.1 and 6.3'''<br />
<br />
<br />
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html><br />
<br />
'''Step 2 – Inoculating Colonies into a Selective Broth:''' The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick.<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Number of Falcons !! Broth !! Antibiotic<br />
|-<br />
|rowspan="6" |Biobrick || BBa_C0040 || 3 || rowspan="6" | Lysogeny Broth (5ml) || rowspan="6" |Ampicillin(50ug/ml)<br />
|-<br />
| BBa_I750016 || 4 <br />
|-<br />
| BBa_B0034 || 5 <br />
|-<br />
| BBa_B0015 || 3 <br />
|-<br />
| BBa_J23119 || 2 <br />
|-<br />
|}<br />
<br />
<br />
== Wednesday 23.7.12 == <br />
<br />
'''Aim - Results from Colony Picking'''<br />
<br />
<br />
'''Results:'''<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Number of Falcons !! Growth <br />
|-<br />
| rowspan="6" |BioBrick || BBa_C0040 || 3 || None <br />
|-<br />
| BBa_I750016|| 4 || None <br />
|-<br />
| BBa_B0034 || 5 || Growth in one <br />
|-<br />
| BBa_B0015 || 3 || Growth <br />
|-<br />
| BBa_J23119 || 2 || Growth <br />
|-<br />
|}<br />
<br />
'''Conclusion:''' We are beginning to consider other possibilities for the failure of Colony Picking in Expt 7.1 and Expt 6.3. Foremost, we believe it may be due to the addition of Ampicillin to the Agar before it has cooled sufficiently, leading to degradation of the antibiotic. This would reduce the selective pressure, and allow growth of colonies that are not Ampicillin-resistant. Subsequent inoculation into Amipicillin positive LB broth leads to failed growth. Those BioBricks that have worked will undergo Miniprep, Restriction Enzyme Digests and Nanodrop.<br />
<br />
'''Method'''<br />
<br />
'''Miniprep:''' <br />
<html><div class="protocol protocol-Miniprep">Miniprep Protocol 1 (Qiagen)</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Miniprep1}}<html></div></html><br />
<br />
<br />
'''Step 1:''' Set up an eppendorf as follows<br />
<br />
'''Step 1:''' Used 2mls <br />
<br />
'''Step 8:''' Step 8 had to be missed because we realised too late we had too little PE buffer remaining. <br />
<br />
<br />
'''Restriction Digest:'''<br />
<html><div class="protocol protocol-RestrictionEnzymeDigest">Restriction Enzyme Digest Protocol 1</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/RestrictionEnzymeDigest1}}<html></div></html><br />
<br />
'''Step 2 - Setting up Digests and Controls:''' The protocol describes the recipe for (i) Digested Plasmid and (ii) Uncut Control. The table below indicates that an uncut and an Xcar1/Spe1 digested sample be set up for each BioBrick. Set up Eppendorfs as follows<br />
<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !!Recipe !! Enzymes <br />
|-<br />
| rowspan="7" |BioBrick || rowspan="2" | BBa_J23119 ||Digested Plasmid || Xba1 & Spe1 <br />
|-<br />
| Undigested Plasmid (Control) || None <br />
|-<br />
| rowspan="2" | BBa_B0015 || Digested Plasmid|| Xba1 & Spe1<br />
|-<br />
| Undigested Plasmid (Control) || None <br />
|-<br />
| rowspan="2" | BBa_B0034 || Digested Plasmid || Xba1 & Spe1<br />
|-<br />
| Undigested Plasmid (Control) || None <br />
|-<br />
|}<br />
<br />
<html><div class="protocol protocol-Electrophoresis">Electrophoresis Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Electrophoresis}}<html></div></html><br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 7.2. Visible in Lane 1 is a band corresponding to the Plasmid Backbone pSB1A2 (2079bp) as show by A, but it is not possible to detect our BBa_J23119 insert on this gel, as it is just 35bp long. Lane 2 shows the uncut plasmid for BBa_J23119 (shown by B) but the size difference between A and B appears to large for BBa_J23119 to have been the insert. This will require further investigation. Lane 3 shows a product 129bp long (indicated by C) which is the correct size for our insert BBa_B0015. A stronger band is also visible, indicated by D, which corresponds to the plasmid backbone pSB1AK3 (3189bp). Lane 4 displays a product which is somewhat larger than the expected size for the uncut plasmid (3318bp) as indicated by E. Lane 5 displays the correct product for the pSB1A2 backbone (2079bp) as indicated by F, but the extremely small size of the BBa_B0034 insert (12bp) means that it cannot be detect on this gel. Lane 6 indicates a band larger than expected, and does not correspond to the size of the uncut plasmid (2091bp) as shown by G. <br />
<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=gel2|url=images/7/77/UCL2012-labbookweek7-gel2.png}}<br />
<br />
'''Conclusion:''' The BBa_B0015 transformation was a success. However, with regard BBa_J23119, we feel that the difference in the product size of A (pSB1A2 plasmid backbone) and B (uncut plasmid) raises concerns as to whether the insert could be as short as 35bp. However, we must also consider the secondary effects had by the conformation of an uncut plasmid on its migration through the gel. It is possible this is sufficient to misplace the plasmid, such that its position does not represent its size. Even without this possibility, however, it would not be possible to determine whether there was a 35bp difference on such a crude scale of ladder. Instead we will reattempt the Analysis against a 25bp ladder, with the intention of detecting the insert. (See Expt 8.1). We have similar concerns for BBa_B0034, and so this too will be run against a 25bp ladder.<br />
<br />
'''Nanodrop:'''<br />
<br />
<html><div class="protocol protocol-Nanodrop">Nanodrop Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Nanodrop}}<html></div></html><br />
<br />
{| class="wikitable"<br />
|-<br />
! BioBrick !! λ260 !! λ 280<br />
|-<br />
| BBa_J23119 (ng/μl) || 77.6 || 71.8 <br />
|-<br />
| BBa_B0034 (ng/μl) || 70 || 71.2 <br />
|-<br />
| BBa_B0015 (ng/μl) ||128.9 || 128 <br />
|-<br />
|}<br />
<br />
<html> </div><div class="experiment"> </div><br />
<img id="7-4" src="https://static.igem.org/mediawiki/2012/e/ed/Ucl2012-labbook-graph7-4.png" /><div class="experimentContent"></html><br />
<br />
==Thursday 26.7.12 ==<br />
<br />
'''Aim - Transformation of previously failed BioBricks:''' BBa_I750016 was previously grown on an Agar Plate (Expt 6.3) but failed to produce growth after colony picking. BBa_C0040 was previously grown on an Agar Plate (Expt 7.1) but also failed to produce growth after colony picking. R0040 failed to produce colonies in Expt 5.1.<br />
<br />
<br />
'''Method:'''<br />
<html><div class="protocol protocol-Transformation">Transformation Protocol 1</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/Transformation1}}<html></div></html><br />
<br />
<br />
'''Step 1 – Thawing Cells:''' Use W3110 cell line created in Week 2 (Expt 2.1)<br />
<br />
'''Step 3 – Addition of BioBrick:''' To each 2ml eppendorf, add 1ul of the following BioBricks. Include an extra tube as a control, with no BioBrick added<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | !! Function !! Module<br />
|-<br />
| rowspan="3" |BioBrick|| BBa_I750016 || Gas Vesicle Polycistronic Cluster || Buoyancy<br />
|-<br />
| BBa_C0040 || Tetracycline Repressor|| Buoyancy <br />
|-<br />
| BBa_R0040 || TetR Repressible Promoter || Buoyancy<br />
|-<br />
| rowspan="2"|Control || Positive (one for each of the above BioBricks)|| ||<br />
|-<br />
| Negative (No BioBrick) || ||<br />
|}<br />
<br />
'''Step 9 – Plating samples on Agar Plates:''' The table below indicates the chosen inoculation volume (two for each BioBrick) and the correct gel antibiotic concentration for all samples.(Extra caution was taken to allow agar to cool before adding Ampicillin, in case this is the cause of difficulty). <br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Volume Inoculated !! Antibiotic in Gel (ug/ml)<br />
|-<br />
| rowspan="6" |BioBrick ||rowspan="2" | BBa_I750016 || 10ul || rowspan="6" | Ampicillin(50ug/ml)<br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | BBa_C0040 || 10ul <br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | BBa_R0040 || 10ul <br />
|-<br />
| 90ul <br />
|-<br />
| rowspan="2" | Control || Positive (Contains BioBrick BBa_C0040)|| 36ul || No Antibiotic<br />
|-<br />
| Negative (No BioBrick)|| 36ul || 1x Ampicillin(50ug/ml)<br />
|-<br />
|}<br />
<br />
<br />
== Friday 27.7.12 ==<br />
<br />
'''Aim - Check results of Transformation:''' The table below indicates whether there was growth on the Agar Plates after Transformation. Included below are images of the Agar Plates for each BioBrick.<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/c/cb/UCLigem2012_Agar_7.4.2.png}}<br />
<br />
{| class="wikitable"<br />
|-<br />
! colspan="2" | Samples !! Volume Inoculated !! Colony Formation<br />
|-<br />
| rowspan="2" |BioBrick ||rowspan="2" | BBa_I750016 || 10ul || No<br />
|-<br />
| 90ul || No<br />
|-<br />
| rowspan="2" |BioBrick ||rowspan="2" | BBa_C0040 || 10ul || Yes<br />
|-<br />
| 90ul || Yes<br />
|-<br />
| rowspan="2" |BioBrick ||rowspan="2" | BBa_R0040 || 10ul || Yes<br />
|-<br />
| 90ul || Yes<br />
|-<br />
| rowspan="2" | Control || Positive (Contains BioBrick BBa_C0040)|| 36ul || Yes<br />
|-<br />
| Negative (No BioBrick)|| 36ul || No<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Conclusion:''' Given there was growth on the negative control we are wary of our results. We feel the contamination was not a result of any of our materials, but rather the pattern of spread on the agar is suggestive of a contaminant entering during spreading. A similar pattern is seen on our BBa_C0040 plates, and so it is likely we will repeat these. A very different pattern was observed on the BBa_I750016 agars, and so we will carry out an analytical digest to determine whether it has been transformed correctly. <br />
<br />
<html> </div><div class="experiment"> </div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/BioBricksTeam:University College London/BioBricks2012-09-26T22:50:39Z<p>Rwilkinson: /* Module: Containment */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= BioBricks =<br />
<br />
== BioBricks submitted to the Registry ==<br />
<br />
<groupparts>iGEM012 University_College_London</groupparts><br />
<br />
== Module 1: Plastic Detection ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/1/16/Ucl2Dete.png" alt="Detection" /></div></html><br />
<br />
'''Figure 1:''' The figure above shows our genetic circuit for the Detection Module. The Constitutive Promoter (BBa_J23119) drives constant expression of the NahR protein BBa_K228004 ('''modified''' - see below). NahR is a transcriptional activator, which is activated in response to salicylate molecules. Our proxy for plastic - Organic Pollutants - have a salicylate-like domain, and are therefore capable of activating NahR. Activated NahR binds the pSal promoter (Figure 2) thus activating the circuit for Module 2 (Aggregation). <br />
<br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
<br />
Please see our [[Team:University_College_London/Module_1|Detection Description Subpage]] for more details on this Module.<br />
<br />
== Module 2: Aggregation ==<br />
<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/2/2a/UclCurli.png" alt="Aggregation" /></div></html><br />
<br />
<br />
'''Figure 2:''' The Figure above illustrates our circuit for Module 2 (Aggregation). The pSal promoter BBa_K228004 (modified - see below) which triggers the Aggregation circuit is turned on when bound by activated NahR protein from Module 1. Once the pSal promoter is activated, it drives expression of the curli cluster of genes (BBa_K729003). The individuals genes of the cluster are shown radiating from BBa_K540000. <br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
'''BBa_K729003:''' This BioBrick is modified from BBa_K540000, which has a cobalt promoter.<br />
<br />
For more information on how this circuit is triggered, and the individual roles of the Curli genes, please visit our [[Team:University_College_London/Module_2|Aggregation Description Subpage]]<br />
<br />
== Module 3: Plastic Degradation ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/8/89/UclDeg.png" alt="Degradation" /></div></html><br />
<br />
'''Figure 3:''' The image above shows the circuit for Module 3 (Degradation). The Constitutive Promoter (BBa_J23119) drives constant expression of the Laccase BioBrick (BBa_K729002). The Laccase gene we intend to use originates from a particular bacterial strain, and is capable of Polyethylene Degradation.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_3|Degradation Description Subpage]]<br />
<br />
== Module 4: Buoyancy ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/8/8d/UclBuoy.png" /></div></html><br />
<br />
'''Figure 4:''' The image above depicts the circuit for Module 4 (Buoyancy). The Starvation Promoter (BBa_K118011) drives expression of the Gas Vesicle Cluster (BBa_I750016) when the environmental glucose concentration is low. The Gas Vesicle Cluster selected originates from ''Bacillus Megaterium'', and induces buoyancy in the cell.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_4|Buoyancy Description Subpage]]<br />
<br />
== Module 5: Salt Tolerance ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/d/d0/UclSalt.png" alt="Salt Tolerance" /></div></html><br />
<br />
<br />
'''Figure 5:''' The image above illustrates the circuit design for Module 5 (Salt Tolerance). The Constitutive Promoter (BBa_J23119) will drive constant expression of our novel BioBrick IrrE, which confers salt resistance onto ''E. Coli''.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_5|Salt Tolerance Description Subpage]]<br />
<br />
== Module: Containment ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f9/UclContainment.png" alt="Containment" /></div></html><br />
<br />
<br />
'''Figure 6:''' The above image shows the genetic circuits for our threefold Containment module. Plasmid A carries the three toxin genes - Holin/Endolysin (BBa_K729009), Colicin E3 (BBa_K729005), and EcoRI (BBa_K729006). Plasmid B carries the antitoxins Anti-Holin (BBa_K729010), Colicin E3 Immuntiy (BBa_K729008), and Methytransferase Ecori. Plasmid A and B work in conjunction with one another to prevent Horizontal Gene Transfer by conjugation. Plasmid C carries a periplasmic nuclease (BBa_K279004) driven by the constitutive promoter BBa_J23119.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_6|Containment Description Subpage]]<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:UclContainment.pngFile:UclContainment.png2012-09-26T22:50:20Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/BioBricksTeam:University College London/BioBricks2012-09-26T22:48:44Z<p>Rwilkinson: /* Module 5: Salt Tolerance */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= BioBricks =<br />
<br />
== BioBricks submitted to the Registry ==<br />
<br />
<groupparts>iGEM012 University_College_London</groupparts><br />
<br />
== Module 1: Plastic Detection ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/1/16/Ucl2Dete.png" alt="Detection" /></div></html><br />
<br />
'''Figure 1:''' The figure above shows our genetic circuit for the Detection Module. The Constitutive Promoter (BBa_J23119) drives constant expression of the NahR protein BBa_K228004 ('''modified''' - see below). NahR is a transcriptional activator, which is activated in response to salicylate molecules. Our proxy for plastic - Organic Pollutants - have a salicylate-like domain, and are therefore capable of activating NahR. Activated NahR binds the pSal promoter (Figure 2) thus activating the circuit for Module 2 (Aggregation). <br />
<br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
<br />
Please see our [[Team:University_College_London/Module_1|Detection Description Subpage]] for more details on this Module.<br />
<br />
== Module 2: Aggregation ==<br />
<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/2/2a/UclCurli.png" alt="Aggregation" /></div></html><br />
<br />
<br />
'''Figure 2:''' The Figure above illustrates our circuit for Module 2 (Aggregation). The pSal promoter BBa_K228004 (modified - see below) which triggers the Aggregation circuit is turned on when bound by activated NahR protein from Module 1. Once the pSal promoter is activated, it drives expression of the curli cluster of genes (BBa_K729003). The individuals genes of the cluster are shown radiating from BBa_K540000. <br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
'''BBa_K729003:''' This BioBrick is modified from BBa_K540000, which has a cobalt promoter.<br />
<br />
For more information on how this circuit is triggered, and the individual roles of the Curli genes, please visit our [[Team:University_College_London/Module_2|Aggregation Description Subpage]]<br />
<br />
== Module 3: Plastic Degradation ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/8/89/UclDeg.png" alt="Degradation" /></div></html><br />
<br />
'''Figure 3:''' The image above shows the circuit for Module 3 (Degradation). The Constitutive Promoter (BBa_J23119) drives constant expression of the Laccase BioBrick (BBa_K729002). The Laccase gene we intend to use originates from a particular bacterial strain, and is capable of Polyethylene Degradation.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_3|Degradation Description Subpage]]<br />
<br />
== Module 4: Buoyancy ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/8/8d/UclBuoy.png" /></div></html><br />
<br />
'''Figure 4:''' The image above depicts the circuit for Module 4 (Buoyancy). The Starvation Promoter (BBa_K118011) drives expression of the Gas Vesicle Cluster (BBa_I750016) when the environmental glucose concentration is low. The Gas Vesicle Cluster selected originates from ''Bacillus Megaterium'', and induces buoyancy in the cell.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_4|Buoyancy Description Subpage]]<br />
<br />
== Module 5: Salt Tolerance ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/d/d0/UclSalt.png" alt="Salt Tolerance" /></div></html><br />
<br />
<br />
'''Figure 5:''' The image above illustrates the circuit design for Module 5 (Salt Tolerance). The Constitutive Promoter (BBa_J23119) will drive constant expression of our novel BioBrick IrrE, which confers salt resistance onto ''E. Coli''.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_5|Salt Tolerance Description Subpage]]<br />
<br />
== Module: Containment ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/9/9f/UcligemContainment_BioBrick.png" alt="Containment" /></div></html><br />
<br />
<br />
'''Figure 6:''' The above image shows the genetic circuits for our threefold Containment module. Plasmid A carries the three toxin genes - Holin/Endolysin (BBa_K729009), Colicin E3 (BBa_K729005), and EcoRI (BBa_K729006). Plasmid B carries the antitoxins Anti-Holin (BBa_K729010), Colicin E3 Immuntiy (BBa_K729008), and Methytransferase Ecori. Plasmid A and B work in conjunction with one another to prevent Horizontal Gene Transfer by conjugation. Plasmid C carries a periplasmic nuclease (BBa_K279004) driven by the constitutive promoter BBa_J23119.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_6|Containment Description Subpage]]<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:UclSalt.pngFile:UclSalt.png2012-09-26T22:47:33Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/BioBricksTeam:University College London/BioBricks2012-09-26T22:46:49Z<p>Rwilkinson: /* Module 4: Buoyancy */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= BioBricks =<br />
<br />
== BioBricks submitted to the Registry ==<br />
<br />
<groupparts>iGEM012 University_College_London</groupparts><br />
<br />
== Module 1: Plastic Detection ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/1/16/Ucl2Dete.png" alt="Detection" /></div></html><br />
<br />
'''Figure 1:''' The figure above shows our genetic circuit for the Detection Module. The Constitutive Promoter (BBa_J23119) drives constant expression of the NahR protein BBa_K228004 ('''modified''' - see below). NahR is a transcriptional activator, which is activated in response to salicylate molecules. Our proxy for plastic - Organic Pollutants - have a salicylate-like domain, and are therefore capable of activating NahR. Activated NahR binds the pSal promoter (Figure 2) thus activating the circuit for Module 2 (Aggregation). <br />
<br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
<br />
Please see our [[Team:University_College_London/Module_1|Detection Description Subpage]] for more details on this Module.<br />
<br />
== Module 2: Aggregation ==<br />
<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/2/2a/UclCurli.png" alt="Aggregation" /></div></html><br />
<br />
<br />
'''Figure 2:''' The Figure above illustrates our circuit for Module 2 (Aggregation). The pSal promoter BBa_K228004 (modified - see below) which triggers the Aggregation circuit is turned on when bound by activated NahR protein from Module 1. Once the pSal promoter is activated, it drives expression of the curli cluster of genes (BBa_K729003). The individuals genes of the cluster are shown radiating from BBa_K540000. <br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
'''BBa_K729003:''' This BioBrick is modified from BBa_K540000, which has a cobalt promoter.<br />
<br />
For more information on how this circuit is triggered, and the individual roles of the Curli genes, please visit our [[Team:University_College_London/Module_2|Aggregation Description Subpage]]<br />
<br />
== Module 3: Plastic Degradation ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/8/89/UclDeg.png" alt="Degradation" /></div></html><br />
<br />
'''Figure 3:''' The image above shows the circuit for Module 3 (Degradation). The Constitutive Promoter (BBa_J23119) drives constant expression of the Laccase BioBrick (BBa_K729002). The Laccase gene we intend to use originates from a particular bacterial strain, and is capable of Polyethylene Degradation.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_3|Degradation Description Subpage]]<br />
<br />
== Module 4: Buoyancy ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/8/8d/UclBuoy.png" /></div></html><br />
<br />
'''Figure 4:''' The image above depicts the circuit for Module 4 (Buoyancy). The Starvation Promoter (BBa_K118011) drives expression of the Gas Vesicle Cluster (BBa_I750016) when the environmental glucose concentration is low. The Gas Vesicle Cluster selected originates from ''Bacillus Megaterium'', and induces buoyancy in the cell.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_4|Buoyancy Description Subpage]]<br />
<br />
== Module 5: Salt Tolerance ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f7/UcligemSalt_Tolerance_Biobrick.png" alt="Salt Tolerance" /></div></html><br />
<br />
<br />
'''Figure 5:''' The image above illustrates the circuit design for Module 5 (Salt Tolerance). The Constitutive Promoter (BBa_J23119) will drive constant expression of our novel BioBrick IrrE, which confers salt resistance onto ''E. Coli''.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_5|Salt Tolerance Description Subpage]]<br />
<br />
== Module: Containment ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/9/9f/UcligemContainment_BioBrick.png" alt="Containment" /></div></html><br />
<br />
<br />
'''Figure 6:''' The above image shows the genetic circuits for our threefold Containment module. Plasmid A carries the three toxin genes - Holin/Endolysin (BBa_K729009), Colicin E3 (BBa_K729005), and EcoRI (BBa_K729006). Plasmid B carries the antitoxins Anti-Holin (BBa_K729010), Colicin E3 Immuntiy (BBa_K729008), and Methytransferase Ecori. Plasmid A and B work in conjunction with one another to prevent Horizontal Gene Transfer by conjugation. Plasmid C carries a periplasmic nuclease (BBa_K279004) driven by the constitutive promoter BBa_J23119.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_6|Containment Description Subpage]]<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:UclBuoy.pngFile:UclBuoy.png2012-09-26T22:46:29Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/BioBricksTeam:University College London/BioBricks2012-09-26T22:45:27Z<p>Rwilkinson: /* Module 3: Plastic Degradation */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= BioBricks =<br />
<br />
== BioBricks submitted to the Registry ==<br />
<br />
<groupparts>iGEM012 University_College_London</groupparts><br />
<br />
== Module 1: Plastic Detection ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/1/16/Ucl2Dete.png" alt="Detection" /></div></html><br />
<br />
'''Figure 1:''' The figure above shows our genetic circuit for the Detection Module. The Constitutive Promoter (BBa_J23119) drives constant expression of the NahR protein BBa_K228004 ('''modified''' - see below). NahR is a transcriptional activator, which is activated in response to salicylate molecules. Our proxy for plastic - Organic Pollutants - have a salicylate-like domain, and are therefore capable of activating NahR. Activated NahR binds the pSal promoter (Figure 2) thus activating the circuit for Module 2 (Aggregation). <br />
<br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
<br />
Please see our [[Team:University_College_London/Module_1|Detection Description Subpage]] for more details on this Module.<br />
<br />
== Module 2: Aggregation ==<br />
<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/2/2a/UclCurli.png" alt="Aggregation" /></div></html><br />
<br />
<br />
'''Figure 2:''' The Figure above illustrates our circuit for Module 2 (Aggregation). The pSal promoter BBa_K228004 (modified - see below) which triggers the Aggregation circuit is turned on when bound by activated NahR protein from Module 1. Once the pSal promoter is activated, it drives expression of the curli cluster of genes (BBa_K729003). The individuals genes of the cluster are shown radiating from BBa_K540000. <br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
'''BBa_K729003:''' This BioBrick is modified from BBa_K540000, which has a cobalt promoter.<br />
<br />
For more information on how this circuit is triggered, and the individual roles of the Curli genes, please visit our [[Team:University_College_London/Module_2|Aggregation Description Subpage]]<br />
<br />
== Module 3: Plastic Degradation ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/8/89/UclDeg.png" alt="Degradation" /></div></html><br />
<br />
'''Figure 3:''' The image above shows the circuit for Module 3 (Degradation). The Constitutive Promoter (BBa_J23119) drives constant expression of the Laccase BioBrick (BBa_K729002). The Laccase gene we intend to use originates from a particular bacterial strain, and is capable of Polyethylene Degradation.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_3|Degradation Description Subpage]]<br />
<br />
== Module 4: Buoyancy ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f8/UclBuoy.2.png" /></div></html><br />
<br />
'''Figure 4:''' The image above depicts the circuit for Module 4 (Buoyancy). The Starvation Promoter (BBa_K118011) drives expression of the Gas Vesicle Cluster (BBa_I750016) when the environmental glucose concentration is low. The Gas Vesicle Cluster selected originates from ''Bacillus Megaterium'', and induces buoyancy in the cell.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_4|Buoyancy Description Subpage]]<br />
<br />
== Module 5: Salt Tolerance ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f7/UcligemSalt_Tolerance_Biobrick.png" alt="Salt Tolerance" /></div></html><br />
<br />
<br />
'''Figure 5:''' The image above illustrates the circuit design for Module 5 (Salt Tolerance). The Constitutive Promoter (BBa_J23119) will drive constant expression of our novel BioBrick IrrE, which confers salt resistance onto ''E. Coli''.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_5|Salt Tolerance Description Subpage]]<br />
<br />
== Module: Containment ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/9/9f/UcligemContainment_BioBrick.png" alt="Containment" /></div></html><br />
<br />
<br />
'''Figure 6:''' The above image shows the genetic circuits for our threefold Containment module. Plasmid A carries the three toxin genes - Holin/Endolysin (BBa_K729009), Colicin E3 (BBa_K729005), and EcoRI (BBa_K729006). Plasmid B carries the antitoxins Anti-Holin (BBa_K729010), Colicin E3 Immuntiy (BBa_K729008), and Methytransferase Ecori. Plasmid A and B work in conjunction with one another to prevent Horizontal Gene Transfer by conjugation. Plasmid C carries a periplasmic nuclease (BBa_K279004) driven by the constitutive promoter BBa_J23119.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_6|Containment Description Subpage]]<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:UclDeg.pngFile:UclDeg.png2012-09-26T22:45:08Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/BioBricksTeam:University College London/BioBricks2012-09-26T22:43:56Z<p>Rwilkinson: /* Module 2: Aggregation */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= BioBricks =<br />
<br />
== BioBricks submitted to the Registry ==<br />
<br />
<groupparts>iGEM012 University_College_London</groupparts><br />
<br />
== Module 1: Plastic Detection ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/1/16/Ucl2Dete.png" alt="Detection" /></div></html><br />
<br />
'''Figure 1:''' The figure above shows our genetic circuit for the Detection Module. The Constitutive Promoter (BBa_J23119) drives constant expression of the NahR protein BBa_K228004 ('''modified''' - see below). NahR is a transcriptional activator, which is activated in response to salicylate molecules. Our proxy for plastic - Organic Pollutants - have a salicylate-like domain, and are therefore capable of activating NahR. Activated NahR binds the pSal promoter (Figure 2) thus activating the circuit for Module 2 (Aggregation). <br />
<br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
<br />
Please see our [[Team:University_College_London/Module_1|Detection Description Subpage]] for more details on this Module.<br />
<br />
== Module 2: Aggregation ==<br />
<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/2/2a/UclCurli.png" alt="Aggregation" /></div></html><br />
<br />
<br />
'''Figure 2:''' The Figure above illustrates our circuit for Module 2 (Aggregation). The pSal promoter BBa_K228004 (modified - see below) which triggers the Aggregation circuit is turned on when bound by activated NahR protein from Module 1. Once the pSal promoter is activated, it drives expression of the curli cluster of genes (BBa_K729003). The individuals genes of the cluster are shown radiating from BBa_K540000. <br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
'''BBa_K729003:''' This BioBrick is modified from BBa_K540000, which has a cobalt promoter.<br />
<br />
For more information on how this circuit is triggered, and the individual roles of the Curli genes, please visit our [[Team:University_College_London/Module_2|Aggregation Description Subpage]]<br />
<br />
== Module 3: Plastic Degradation ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/7/7a/UcligemDegradation_BioBrick.png" alt="Degradation" /></div></html><br />
<br />
'''Figure 3:''' The image above shows the circuit for Module 3 (Degradation). The Constitutive Promoter (BBa_J23119) drives constant expression of the Laccase BioBrick (BBa_K729002). The Laccase gene we intend to use originates from a particular bacterial strain, and is capable of Polyethylene Degradation.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_3|Degradation Description Subpage]]<br />
<br />
== Module 4: Buoyancy ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f8/UclBuoy.2.png" /></div></html><br />
<br />
'''Figure 4:''' The image above depicts the circuit for Module 4 (Buoyancy). The Starvation Promoter (BBa_K118011) drives expression of the Gas Vesicle Cluster (BBa_I750016) when the environmental glucose concentration is low. The Gas Vesicle Cluster selected originates from ''Bacillus Megaterium'', and induces buoyancy in the cell.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_4|Buoyancy Description Subpage]]<br />
<br />
== Module 5: Salt Tolerance ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f7/UcligemSalt_Tolerance_Biobrick.png" alt="Salt Tolerance" /></div></html><br />
<br />
<br />
'''Figure 5:''' The image above illustrates the circuit design for Module 5 (Salt Tolerance). The Constitutive Promoter (BBa_J23119) will drive constant expression of our novel BioBrick IrrE, which confers salt resistance onto ''E. Coli''.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_5|Salt Tolerance Description Subpage]]<br />
<br />
== Module: Containment ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/9/9f/UcligemContainment_BioBrick.png" alt="Containment" /></div></html><br />
<br />
<br />
'''Figure 6:''' The above image shows the genetic circuits for our threefold Containment module. Plasmid A carries the three toxin genes - Holin/Endolysin (BBa_K729009), Colicin E3 (BBa_K729005), and EcoRI (BBa_K729006). Plasmid B carries the antitoxins Anti-Holin (BBa_K729010), Colicin E3 Immuntiy (BBa_K729008), and Methytransferase Ecori. Plasmid A and B work in conjunction with one another to prevent Horizontal Gene Transfer by conjugation. Plasmid C carries a periplasmic nuclease (BBa_K279004) driven by the constitutive promoter BBa_J23119.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_6|Containment Description Subpage]]<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:UclCurli.pngFile:UclCurli.png2012-09-26T22:43:37Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/BioBricksTeam:University College London/BioBricks2012-09-26T22:42:08Z<p>Rwilkinson: /* Module 1: Plastic Detection */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= BioBricks =<br />
<br />
== BioBricks submitted to the Registry ==<br />
<br />
<groupparts>iGEM012 University_College_London</groupparts><br />
<br />
== Module 1: Plastic Detection ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/1/16/Ucl2Dete.png" alt="Detection" /></div></html><br />
<br />
'''Figure 1:''' The figure above shows our genetic circuit for the Detection Module. The Constitutive Promoter (BBa_J23119) drives constant expression of the NahR protein BBa_K228004 ('''modified''' - see below). NahR is a transcriptional activator, which is activated in response to salicylate molecules. Our proxy for plastic - Organic Pollutants - have a salicylate-like domain, and are therefore capable of activating NahR. Activated NahR binds the pSal promoter (Figure 2) thus activating the circuit for Module 2 (Aggregation). <br />
<br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
<br />
Please see our [[Team:University_College_London/Module_1|Detection Description Subpage]] for more details on this Module.<br />
<br />
== Module 2: Aggregation ==<br />
<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/c/c5/UcligemAggregation_BioBrick.png" alt="Aggregation" /></div></html><br />
<br />
<br />
'''Figure 2:''' The Figure above illustrates our circuit for Module 2 (Aggregation). The pSal promoter BBa_K228004 (modified - see below) which triggers the Aggregation circuit is turned on when bound by activated NahR protein from Module 1. Once the pSal promoter is activated, it drives expression of the curli cluster of genes (BBa_K729003). The individuals genes of the cluster are shown radiating from BBa_K540000. <br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
'''BBa_K729003:''' This BioBrick is modified from BBa_K540000, which has a cobalt promoter.<br />
<br />
For more information on how this circuit is triggered, and the individual roles of the Curli genes, please visit our [[Team:University_College_London/Module_2|Aggregation Description Subpage]]<br />
<br />
== Module 3: Plastic Degradation ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/7/7a/UcligemDegradation_BioBrick.png" alt="Degradation" /></div></html><br />
<br />
'''Figure 3:''' The image above shows the circuit for Module 3 (Degradation). The Constitutive Promoter (BBa_J23119) drives constant expression of the Laccase BioBrick (BBa_K729002). The Laccase gene we intend to use originates from a particular bacterial strain, and is capable of Polyethylene Degradation.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_3|Degradation Description Subpage]]<br />
<br />
== Module 4: Buoyancy ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f8/UclBuoy.2.png" /></div></html><br />
<br />
'''Figure 4:''' The image above depicts the circuit for Module 4 (Buoyancy). The Starvation Promoter (BBa_K118011) drives expression of the Gas Vesicle Cluster (BBa_I750016) when the environmental glucose concentration is low. The Gas Vesicle Cluster selected originates from ''Bacillus Megaterium'', and induces buoyancy in the cell.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_4|Buoyancy Description Subpage]]<br />
<br />
== Module 5: Salt Tolerance ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f7/UcligemSalt_Tolerance_Biobrick.png" alt="Salt Tolerance" /></div></html><br />
<br />
<br />
'''Figure 5:''' The image above illustrates the circuit design for Module 5 (Salt Tolerance). The Constitutive Promoter (BBa_J23119) will drive constant expression of our novel BioBrick IrrE, which confers salt resistance onto ''E. Coli''.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_5|Salt Tolerance Description Subpage]]<br />
<br />
== Module: Containment ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/9/9f/UcligemContainment_BioBrick.png" alt="Containment" /></div></html><br />
<br />
<br />
'''Figure 6:''' The above image shows the genetic circuits for our threefold Containment module. Plasmid A carries the three toxin genes - Holin/Endolysin (BBa_K729009), Colicin E3 (BBa_K729005), and EcoRI (BBa_K729006). Plasmid B carries the antitoxins Anti-Holin (BBa_K729010), Colicin E3 Immuntiy (BBa_K729008), and Methytransferase Ecori. Plasmid A and B work in conjunction with one another to prevent Horizontal Gene Transfer by conjugation. Plasmid C carries a periplasmic nuclease (BBa_K279004) driven by the constitutive promoter BBa_J23119.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_6|Containment Description Subpage]]<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:Ucl2Dete.pngFile:Ucl2Dete.png2012-09-26T22:41:52Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/BioBricksTeam:University College London/BioBricks2012-09-26T22:40:32Z<p>Rwilkinson: /* Module 1: Plastic Detection */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= BioBricks =<br />
<br />
== BioBricks submitted to the Registry ==<br />
<br />
<groupparts>iGEM012 University_College_London</groupparts><br />
<br />
== Module 1: Plastic Detection ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/4/46/Ucl1Dete.png" alt="Detection" /></div></html><br />
<br />
'''Figure 1:''' The figure above shows our genetic circuit for the Detection Module. The Constitutive Promoter (BBa_J23119) drives constant expression of the NahR protein BBa_K228004 ('''modified''' - see below). NahR is a transcriptional activator, which is activated in response to salicylate molecules. Our proxy for plastic - Organic Pollutants - have a salicylate-like domain, and are therefore capable of activating NahR. Activated NahR binds the pSal promoter (Figure 2) thus activating the circuit for Module 2 (Aggregation). <br />
<br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
<br />
Please see our [[Team:University_College_London/Module_1|Detection Description Subpage]] for more details on this Module.<br />
<br />
== Module 2: Aggregation ==<br />
<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/c/c5/UcligemAggregation_BioBrick.png" alt="Aggregation" /></div></html><br />
<br />
<br />
'''Figure 2:''' The Figure above illustrates our circuit for Module 2 (Aggregation). The pSal promoter BBa_K228004 (modified - see below) which triggers the Aggregation circuit is turned on when bound by activated NahR protein from Module 1. Once the pSal promoter is activated, it drives expression of the curli cluster of genes (BBa_K729003). The individuals genes of the cluster are shown radiating from BBa_K540000. <br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
'''BBa_K729003:''' This BioBrick is modified from BBa_K540000, which has a cobalt promoter.<br />
<br />
For more information on how this circuit is triggered, and the individual roles of the Curli genes, please visit our [[Team:University_College_London/Module_2|Aggregation Description Subpage]]<br />
<br />
== Module 3: Plastic Degradation ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/7/7a/UcligemDegradation_BioBrick.png" alt="Degradation" /></div></html><br />
<br />
'''Figure 3:''' The image above shows the circuit for Module 3 (Degradation). The Constitutive Promoter (BBa_J23119) drives constant expression of the Laccase BioBrick (BBa_K729002). The Laccase gene we intend to use originates from a particular bacterial strain, and is capable of Polyethylene Degradation.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_3|Degradation Description Subpage]]<br />
<br />
== Module 4: Buoyancy ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f8/UclBuoy.2.png" /></div></html><br />
<br />
'''Figure 4:''' The image above depicts the circuit for Module 4 (Buoyancy). The Starvation Promoter (BBa_K118011) drives expression of the Gas Vesicle Cluster (BBa_I750016) when the environmental glucose concentration is low. The Gas Vesicle Cluster selected originates from ''Bacillus Megaterium'', and induces buoyancy in the cell.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_4|Buoyancy Description Subpage]]<br />
<br />
== Module 5: Salt Tolerance ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f7/UcligemSalt_Tolerance_Biobrick.png" alt="Salt Tolerance" /></div></html><br />
<br />
<br />
'''Figure 5:''' The image above illustrates the circuit design for Module 5 (Salt Tolerance). The Constitutive Promoter (BBa_J23119) will drive constant expression of our novel BioBrick IrrE, which confers salt resistance onto ''E. Coli''.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_5|Salt Tolerance Description Subpage]]<br />
<br />
== Module: Containment ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/9/9f/UcligemContainment_BioBrick.png" alt="Containment" /></div></html><br />
<br />
<br />
'''Figure 6:''' The above image shows the genetic circuits for our threefold Containment module. Plasmid A carries the three toxin genes - Holin/Endolysin (BBa_K729009), Colicin E3 (BBa_K729005), and EcoRI (BBa_K729006). Plasmid B carries the antitoxins Anti-Holin (BBa_K729010), Colicin E3 Immuntiy (BBa_K729008), and Methytransferase Ecori. Plasmid A and B work in conjunction with one another to prevent Horizontal Gene Transfer by conjugation. Plasmid C carries a periplasmic nuclease (BBa_K279004) driven by the constitutive promoter BBa_J23119.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_6|Containment Description Subpage]]<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:Ucl1Dete.pngFile:Ucl1Dete.png2012-09-26T22:40:13Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/BioBricksTeam:University College London/BioBricks2012-09-26T22:35:47Z<p>Rwilkinson: /* Module 1: Plastic Detection */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= BioBricks =<br />
<br />
== BioBricks submitted to the Registry ==<br />
<br />
<groupparts>iGEM012 University_College_London</groupparts><br />
<br />
== Module 1: Plastic Detection ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f5/UclDete.png" alt="Detection" /></div></html><br />
<br />
'''Figure 1:''' The figure above shows our genetic circuit for the Detection Module. The Constitutive Promoter (BBa_J23119) drives constant expression of the NahR protein BBa_K228004 ('''modified''' - see below). NahR is a transcriptional activator, which is activated in response to salicylate molecules. Our proxy for plastic - Organic Pollutants - have a salicylate-like domain, and are therefore capable of activating NahR. Activated NahR binds the pSal promoter (Figure 2) thus activating the circuit for Module 2 (Aggregation). <br />
<br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
<br />
Please see our [[Team:University_College_London/Module_1|Detection Description Subpage]] for more details on this Module.<br />
<br />
== Module 2: Aggregation ==<br />
<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/c/c5/UcligemAggregation_BioBrick.png" alt="Aggregation" /></div></html><br />
<br />
<br />
'''Figure 2:''' The Figure above illustrates our circuit for Module 2 (Aggregation). The pSal promoter BBa_K228004 (modified - see below) which triggers the Aggregation circuit is turned on when bound by activated NahR protein from Module 1. Once the pSal promoter is activated, it drives expression of the curli cluster of genes (BBa_K729003). The individuals genes of the cluster are shown radiating from BBa_K540000. <br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
'''BBa_K729003:''' This BioBrick is modified from BBa_K540000, which has a cobalt promoter.<br />
<br />
For more information on how this circuit is triggered, and the individual roles of the Curli genes, please visit our [[Team:University_College_London/Module_2|Aggregation Description Subpage]]<br />
<br />
== Module 3: Plastic Degradation ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/7/7a/UcligemDegradation_BioBrick.png" alt="Degradation" /></div></html><br />
<br />
'''Figure 3:''' The image above shows the circuit for Module 3 (Degradation). The Constitutive Promoter (BBa_J23119) drives constant expression of the Laccase BioBrick (BBa_K729002). The Laccase gene we intend to use originates from a particular bacterial strain, and is capable of Polyethylene Degradation.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_3|Degradation Description Subpage]]<br />
<br />
== Module 4: Buoyancy ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f8/UclBuoy.2.png" /></div></html><br />
<br />
'''Figure 4:''' The image above depicts the circuit for Module 4 (Buoyancy). The Starvation Promoter (BBa_K118011) drives expression of the Gas Vesicle Cluster (BBa_I750016) when the environmental glucose concentration is low. The Gas Vesicle Cluster selected originates from ''Bacillus Megaterium'', and induces buoyancy in the cell.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_4|Buoyancy Description Subpage]]<br />
<br />
== Module 5: Salt Tolerance ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f7/UcligemSalt_Tolerance_Biobrick.png" alt="Salt Tolerance" /></div></html><br />
<br />
<br />
'''Figure 5:''' The image above illustrates the circuit design for Module 5 (Salt Tolerance). The Constitutive Promoter (BBa_J23119) will drive constant expression of our novel BioBrick IrrE, which confers salt resistance onto ''E. Coli''.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_5|Salt Tolerance Description Subpage]]<br />
<br />
== Module: Containment ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/9/9f/UcligemContainment_BioBrick.png" alt="Containment" /></div></html><br />
<br />
<br />
'''Figure 6:''' The above image shows the genetic circuits for our threefold Containment module. Plasmid A carries the three toxin genes - Holin/Endolysin (BBa_K729009), Colicin E3 (BBa_K729005), and EcoRI (BBa_K729006). Plasmid B carries the antitoxins Anti-Holin (BBa_K729010), Colicin E3 Immuntiy (BBa_K729008), and Methytransferase Ecori. Plasmid A and B work in conjunction with one another to prevent Horizontal Gene Transfer by conjugation. Plasmid C carries a periplasmic nuclease (BBa_K279004) driven by the constitutive promoter BBa_J23119.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_6|Containment Description Subpage]]<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:UclDete.pngFile:UclDete.png2012-09-26T22:35:14Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/BioBricksTeam:University College London/BioBricks2012-09-26T22:34:05Z<p>Rwilkinson: /* Module 4: Buoyancy */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= BioBricks =<br />
<br />
== BioBricks submitted to the Registry ==<br />
<br />
<groupparts>iGEM012 University_College_London</groupparts><br />
<br />
== Module 1: Plastic Detection ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/e/ef/UcligemDetection_BioBrick.png" alt="Detection" /></div></html><br />
<br />
'''Figure 1:''' The figure above shows our genetic circuit for the Detection Module. The Constitutive Promoter (BBa_J23119) drives constant expression of the NahR protein BBa_K228004 ('''modified''' - see below). NahR is a transcriptional activator, which is activated in response to salicylate molecules. Our proxy for plastic - Organic Pollutants - have a salicylate-like domain, and are therefore capable of activating NahR. Activated NahR binds the pSal promoter (Figure 2) thus activating the circuit for Module 2 (Aggregation). <br />
<br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
<br />
Please see our [[Team:University_College_London/Module_1|Detection Description Subpage]] for more details on this Module.<br />
<br />
== Module 2: Aggregation ==<br />
<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/c/c5/UcligemAggregation_BioBrick.png" alt="Aggregation" /></div></html><br />
<br />
<br />
'''Figure 2:''' The Figure above illustrates our circuit for Module 2 (Aggregation). The pSal promoter BBa_K228004 (modified - see below) which triggers the Aggregation circuit is turned on when bound by activated NahR protein from Module 1. Once the pSal promoter is activated, it drives expression of the curli cluster of genes (BBa_K729003). The individuals genes of the cluster are shown radiating from BBa_K540000. <br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
'''BBa_K729003:''' This BioBrick is modified from BBa_K540000, which has a cobalt promoter.<br />
<br />
For more information on how this circuit is triggered, and the individual roles of the Curli genes, please visit our [[Team:University_College_London/Module_2|Aggregation Description Subpage]]<br />
<br />
== Module 3: Plastic Degradation ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/7/7a/UcligemDegradation_BioBrick.png" alt="Degradation" /></div></html><br />
<br />
'''Figure 3:''' The image above shows the circuit for Module 3 (Degradation). The Constitutive Promoter (BBa_J23119) drives constant expression of the Laccase BioBrick (BBa_K729002). The Laccase gene we intend to use originates from a particular bacterial strain, and is capable of Polyethylene Degradation.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_3|Degradation Description Subpage]]<br />
<br />
== Module 4: Buoyancy ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f8/UclBuoy.2.png" /></div></html><br />
<br />
'''Figure 4:''' The image above depicts the circuit for Module 4 (Buoyancy). The Starvation Promoter (BBa_K118011) drives expression of the Gas Vesicle Cluster (BBa_I750016) when the environmental glucose concentration is low. The Gas Vesicle Cluster selected originates from ''Bacillus Megaterium'', and induces buoyancy in the cell.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_4|Buoyancy Description Subpage]]<br />
<br />
== Module 5: Salt Tolerance ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f7/UcligemSalt_Tolerance_Biobrick.png" alt="Salt Tolerance" /></div></html><br />
<br />
<br />
'''Figure 5:''' The image above illustrates the circuit design for Module 5 (Salt Tolerance). The Constitutive Promoter (BBa_J23119) will drive constant expression of our novel BioBrick IrrE, which confers salt resistance onto ''E. Coli''.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_5|Salt Tolerance Description Subpage]]<br />
<br />
== Module: Containment ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/9/9f/UcligemContainment_BioBrick.png" alt="Containment" /></div></html><br />
<br />
<br />
'''Figure 6:''' The above image shows the genetic circuits for our threefold Containment module. Plasmid A carries the three toxin genes - Holin/Endolysin (BBa_K729009), Colicin E3 (BBa_K729005), and EcoRI (BBa_K729006). Plasmid B carries the antitoxins Anti-Holin (BBa_K729010), Colicin E3 Immuntiy (BBa_K729008), and Methytransferase Ecori. Plasmid A and B work in conjunction with one another to prevent Horizontal Gene Transfer by conjugation. Plasmid C carries a periplasmic nuclease (BBa_K279004) driven by the constitutive promoter BBa_J23119.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_6|Containment Description Subpage]]<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:UclBuoy.2.pngFile:UclBuoy.2.png2012-09-26T22:33:48Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/BioBricksTeam:University College London/BioBricks2012-09-26T22:32:33Z<p>Rwilkinson: /* Module 4: Buoyancy */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= BioBricks =<br />
<br />
== BioBricks submitted to the Registry ==<br />
<br />
<groupparts>iGEM012 University_College_London</groupparts><br />
<br />
== Module 1: Plastic Detection ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/e/ef/UcligemDetection_BioBrick.png" alt="Detection" /></div></html><br />
<br />
'''Figure 1:''' The figure above shows our genetic circuit for the Detection Module. The Constitutive Promoter (BBa_J23119) drives constant expression of the NahR protein BBa_K228004 ('''modified''' - see below). NahR is a transcriptional activator, which is activated in response to salicylate molecules. Our proxy for plastic - Organic Pollutants - have a salicylate-like domain, and are therefore capable of activating NahR. Activated NahR binds the pSal promoter (Figure 2) thus activating the circuit for Module 2 (Aggregation). <br />
<br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
<br />
Please see our [[Team:University_College_London/Module_1|Detection Description Subpage]] for more details on this Module.<br />
<br />
== Module 2: Aggregation ==<br />
<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/c/c5/UcligemAggregation_BioBrick.png" alt="Aggregation" /></div></html><br />
<br />
<br />
'''Figure 2:''' The Figure above illustrates our circuit for Module 2 (Aggregation). The pSal promoter BBa_K228004 (modified - see below) which triggers the Aggregation circuit is turned on when bound by activated NahR protein from Module 1. Once the pSal promoter is activated, it drives expression of the curli cluster of genes (BBa_K729003). The individuals genes of the cluster are shown radiating from BBa_K540000. <br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
'''BBa_K729003:''' This BioBrick is modified from BBa_K540000, which has a cobalt promoter.<br />
<br />
For more information on how this circuit is triggered, and the individual roles of the Curli genes, please visit our [[Team:University_College_London/Module_2|Aggregation Description Subpage]]<br />
<br />
== Module 3: Plastic Degradation ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/7/7a/UcligemDegradation_BioBrick.png" alt="Degradation" /></div></html><br />
<br />
'''Figure 3:''' The image above shows the circuit for Module 3 (Degradation). The Constitutive Promoter (BBa_J23119) drives constant expression of the Laccase BioBrick (BBa_K729002). The Laccase gene we intend to use originates from a particular bacterial strain, and is capable of Polyethylene Degradation.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_3|Degradation Description Subpage]]<br />
<br />
== Module 4: Buoyancy ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/e/e7/UclBuoy.1.png" /></div></html><br />
<br />
'''Figure 4:''' The image above depicts the circuit for Module 4 (Buoyancy). The Starvation Promoter (BBa_K118011) drives expression of the Gas Vesicle Cluster (BBa_I750016) when the environmental glucose concentration is low. The Gas Vesicle Cluster selected originates from ''Bacillus Megaterium'', and induces buoyancy in the cell.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_4|Buoyancy Description Subpage]]<br />
<br />
== Module 5: Salt Tolerance ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f7/UcligemSalt_Tolerance_Biobrick.png" alt="Salt Tolerance" /></div></html><br />
<br />
<br />
'''Figure 5:''' The image above illustrates the circuit design for Module 5 (Salt Tolerance). The Constitutive Promoter (BBa_J23119) will drive constant expression of our novel BioBrick IrrE, which confers salt resistance onto ''E. Coli''.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_5|Salt Tolerance Description Subpage]]<br />
<br />
== Module: Containment ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/9/9f/UcligemContainment_BioBrick.png" alt="Containment" /></div></html><br />
<br />
<br />
'''Figure 6:''' The above image shows the genetic circuits for our threefold Containment module. Plasmid A carries the three toxin genes - Holin/Endolysin (BBa_K729009), Colicin E3 (BBa_K729005), and EcoRI (BBa_K729006). Plasmid B carries the antitoxins Anti-Holin (BBa_K729010), Colicin E3 Immuntiy (BBa_K729008), and Methytransferase Ecori. Plasmid A and B work in conjunction with one another to prevent Horizontal Gene Transfer by conjugation. Plasmid C carries a periplasmic nuclease (BBa_K279004) driven by the constitutive promoter BBa_J23119.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_6|Containment Description Subpage]]<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:UclBuoy.1.pngFile:UclBuoy.1.png2012-09-26T22:32:04Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/File:Ucligem012Buoy.pngFile:Ucligem012Buoy.png2012-09-26T22:29:16Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/BioBricksTeam:University College London/BioBricks2012-09-26T22:24:24Z<p>Rwilkinson: /* Module 4: Buoyancy */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= BioBricks =<br />
<br />
== BioBricks submitted to the Registry ==<br />
<br />
<groupparts>iGEM012 University_College_London</groupparts><br />
<br />
== Module 1: Plastic Detection ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/e/ef/UcligemDetection_BioBrick.png" alt="Detection" /></div></html><br />
<br />
'''Figure 1:''' The figure above shows our genetic circuit for the Detection Module. The Constitutive Promoter (BBa_J23119) drives constant expression of the NahR protein BBa_K228004 ('''modified''' - see below). NahR is a transcriptional activator, which is activated in response to salicylate molecules. Our proxy for plastic - Organic Pollutants - have a salicylate-like domain, and are therefore capable of activating NahR. Activated NahR binds the pSal promoter (Figure 2) thus activating the circuit for Module 2 (Aggregation). <br />
<br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
<br />
Please see our [[Team:University_College_London/Module_1|Detection Description Subpage]] for more details on this Module.<br />
<br />
== Module 2: Aggregation ==<br />
<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/c/c5/UcligemAggregation_BioBrick.png" alt="Aggregation" /></div></html><br />
<br />
<br />
'''Figure 2:''' The Figure above illustrates our circuit for Module 2 (Aggregation). The pSal promoter BBa_K228004 (modified - see below) which triggers the Aggregation circuit is turned on when bound by activated NahR protein from Module 1. Once the pSal promoter is activated, it drives expression of the curli cluster of genes (BBa_K729003). The individuals genes of the cluster are shown radiating from BBa_K540000. <br />
<br />
'''Modified BBa_K228004:''' The BBa_K228004 BioBrick must be modified as it combines both the NahR protein and the pSal promoter. We wish to seperate these.<br />
<br />
'''BBa_K729003:''' This BioBrick is modified from BBa_K540000, which has a cobalt promoter.<br />
<br />
For more information on how this circuit is triggered, and the individual roles of the Curli genes, please visit our [[Team:University_College_London/Module_2|Aggregation Description Subpage]]<br />
<br />
== Module 3: Plastic Degradation ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/7/7a/UcligemDegradation_BioBrick.png" alt="Degradation" /></div></html><br />
<br />
'''Figure 3:''' The image above shows the circuit for Module 3 (Degradation). The Constitutive Promoter (BBa_J23119) drives constant expression of the Laccase BioBrick (BBa_K729002). The Laccase gene we intend to use originates from a particular bacterial strain, and is capable of Polyethylene Degradation.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_3|Degradation Description Subpage]]<br />
<br />
== Module 4: Buoyancy ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/2/23/Buoyancy.3.png" /></div></html><br />
<br />
'''Figure 4:''' The image above depicts the circuit for Module 4 (Buoyancy). The Starvation Promoter (BBa_K118011) drives expression of the Gas Vesicle Cluster (BBa_I750016) when the environmental glucose concentration is low. The Gas Vesicle Cluster selected originates from ''Bacillus Megaterium'', and induces buoyancy in the cell.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_4|Buoyancy Description Subpage]]<br />
<br />
== Module 5: Salt Tolerance ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/f/f7/UcligemSalt_Tolerance_Biobrick.png" alt="Salt Tolerance" /></div></html><br />
<br />
<br />
'''Figure 5:''' The image above illustrates the circuit design for Module 5 (Salt Tolerance). The Constitutive Promoter (BBa_J23119) will drive constant expression of our novel BioBrick IrrE, which confers salt resistance onto ''E. Coli''.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_5|Salt Tolerance Description Subpage]]<br />
<br />
== Module: Containment ==<br />
<br />
<html><div align="center"><img src="https://static.igem.org/mediawiki/2012/9/9f/UcligemContainment_BioBrick.png" alt="Containment" /></div></html><br />
<br />
<br />
'''Figure 6:''' The above image shows the genetic circuits for our threefold Containment module. Plasmid A carries the three toxin genes - Holin/Endolysin (BBa_K729009), Colicin E3 (BBa_K729005), and EcoRI (BBa_K729006). Plasmid B carries the antitoxins Anti-Holin (BBa_K729010), Colicin E3 Immuntiy (BBa_K729008), and Methytransferase Ecori. Plasmid A and B work in conjunction with one another to prevent Horizontal Gene Transfer by conjugation. Plasmid C carries a periplasmic nuclease (BBa_K279004) driven by the constitutive promoter BBa_J23119.<br />
<br />
For more information on how this circuit functions, please visit our [[Team:University_College_London/Module_6|Containment Description Subpage]]<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:Buoyancy.3.pngFile:Buoyancy.3.png2012-09-26T22:23:56Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabSafetyTeam:University College London/LabSafety2012-09-07T22:24:18Z<p>Rwilkinson: /* Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= Lab Safety =<br />
<br />
== Would any of your project ideas raise safety issues in terms of: ==<br />
<br />
'''Researcher safety'''<br />
<br />
There are a number of standard lab reagents that we require the use of in our project, that are harmful on contact. These include: <br />
<br />
'''Ethidium Bromide'''<br />
<br />
Material Safety Data Sheet for Ethidium Bromide <br />
<br />
Acute: Hazardous when ingested or inhaled, and is an irritant of the skin and eye. <br />
Chronic: In the long term exposure can have carcinogenic, mutagenic, and teratogenic effects, and can cause developmental toxicity.<br />
<br />
'''Congo Red'''<br />
<br />
Material Safety Data Sheet for Congo Red<br />
<br />
Acute: Hazardous when ingested of inhaled, is an irritant of the eye, and an irritant and sensitizer of the skin.<br />
Chronic: In the long term exposure can have carcinogenic, mutagenic and teratogenic effects, and can cause developmental toxicity. <br />
<br />
<br />
'''Public safety'''<br />
<br />
'''Environmental safety'''<br />
<br />
With regards to environmental safety there are many concerns, that are not restricted to our project, regarding the release of genetically modified organisms. The end point of our project necessitates the release of genetically modified ''Roseobacter'' into the ocean, where there is no possible physical containment of bacteria. This of course raises concerns as to whether the use of living machines may integrate into and alter the local ecosystem, and potentially spread. Furthermore there are concerns that the natural process of mutation found in bacterium may have an unpredictable effect in an organism that has already been genetically modified. As of yet, the release of GMOs on this scale has not yet been approved, but we hope that this project may push that boundary.<br />
<br />
== Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? ==<br />
<br />
Issues regarding safety have been raised through a number of aspects of BioBrick construction. Firstly, for our Aggregation module the original BioBrick containing the curli cluster that we are improving contains a Cobalt dependant promoter meaning that in order to assess this and our BioBrick we required the use of Cobalt Chloride. Cobalt Chloride is very hazardous in the case of skin or eye contact, or inhalation, thus steps had to be taken to ensure the safety of team members. <br />
<br />
In addition, part of our project aims to transform a number of our BioBricks into a marine chassis ''(Roseobacter denitrificans & Oceanibulbus indolifex)''. The most successful means of generating competent marine bacteria has been shown to be through electroporation rather than more traditional chemical competency. The major concern here is from the high voltages used in the operation of the apparatus.<br />
<br />
'''Did you document these issues in the Registry?'''<br />
<br />
As yet, neither of the above issues have been noted on the registry as the parts to which they correspond have not been submitted. Once the relevant BioBricks are ready to be added to the registry, the safety issues will be commented upon along with all other aspects associated with the part, it’s construction, and it's characterisation.<br />
<br />
'''How did you manage to handle the safety issue?'''<br />
<br />
Regarding the safety concerns associated with Cobalt Chloride, risk assessments were conducted in conjunction with the department safety officer to ensure that all team members concerned were aware of the risks of use and the steps they needed to take in order to minimise the possibility of any harm.<br />
<br />
Discussions with experienced technical staff from the Structural and Molecular Biology department were carried out in order to ensure that there was no unnecessary risk to operators of the equipment. As mentioned above the main risk concerned with electroporation is the application of high voltages, and so using equipment only in accordance with established protocols and manufacturer’s instructions is essential.<br />
<br />
'''How could other teams learn from your experience?'''<br />
<br />
The risk of Cobalt Chloride is an established one and so I do not believe there is anything that we have done which any other team would not have had to do as standard practice. All that can be said is that it is essential to carry out risk assessments and consult with safety staff as early in the process as possible.<br />
<br />
Electroporation on the other hand is a lesser used technique and so our experiences with the practice, once documented, should provide helpful information to future teams looking to use the method. This will become especially true as more teams look to use marine organisms as part of the iGEM competition, tackling issues such as those that we have approached in our project.<br />
<br />
== Is there a local biosafety group, committee, or review board at your institution? ==<br />
<br />
Yes - we have the Departmental Genetic Modification Safety Officer (DGMSO) and the College Genetic Modification Safety Committee, who must approve of our work before it commences. We complete risk assessments, which must meet UCL Local Rules, and we are all fully trained in lab work and monitored. <br />
<br />
'''If yes, what does your local biosafety group think about your project?'''<br />
<br />
They are interested in our project, but have concerns about one of our Human Practice events - DIYbio - in which we proposed to carry out research into GMOs in the community. The efforts into assessing the safety of this project is ongoing, but we feel it would be a worthwhile venture. It may disperse some of the conventional worries harboured by the wider community about the use of GMO, and encourage more objective discussion. It would also bring science into the community, and we would present it in a way that makes it accessible to non-scientists.<br />
<br />
== Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering? ==<br />
<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabSafetyTeam:University College London/LabSafety2012-09-07T22:23:21Z<p>Rwilkinson: /* Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= Lab Safety =<br />
<br />
== Would any of your project ideas raise safety issues in terms of: ==<br />
<br />
'''Researcher safety'''<br />
<br />
There are a number of standard lab reagents that we require the use of in our project, that are harmful on contact. These include: <br />
<br />
'''Ethidium Bromide'''<br />
<br />
Material Safety Data Sheet for Ethidium Bromide <br />
<br />
Acute: Hazardous when ingested or inhaled, and is an irritant of the skin and eye. <br />
Chronic: In the long term exposure can have carcinogenic, mutagenic, and teratogenic effects, and can cause developmental toxicity.<br />
<br />
'''Congo Red'''<br />
<br />
Material Safety Data Sheet for Congo Red<br />
<br />
Acute: Hazardous when ingested of inhaled, is an irritant of the eye, and an irritant and sensitizer of the skin.<br />
Chronic: In the long term exposure can have carcinogenic, mutagenic and teratogenic effects, and can cause developmental toxicity. <br />
<br />
<br />
'''Public safety'''<br />
<br />
'''Environmental safety'''<br />
<br />
With regards to environmental safety there are many concerns, that are not restricted to our project, regarding the release of genetically modified organisms. The end point of our project necessitates the release of genetically modified ''Roseobacter'' into the ocean, where there is no possible physical containment of bacteria. This of course raises concerns as to whether the use of living machines may integrate into and alter the local ecosystem, and potentially spread. Furthermore there are concerns that the natural process of mutation found in bacterium may have an unpredictable effect in an organism that has already been genetically modified. As of yet, the release of GMOs on this scale has not yet been approved, but we hope that this project may push that boundary.<br />
<br />
== Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? ==<br />
<br />
Issues regarding safety have been raised through a number of aspects of BioBrick construction. Firstly, for our Aggregation module the original BioBrick containing the curli cluster that we are improving contains a Cobalt dependant promoter meaning that in order to assess this and our BioBrick we required the use of Cobalt Chloride. Cobalt Chloride is very hazardous in the case of skin or eye contact, or inhalation, thus steps had to be taken to ensure the safety of team members. <br />
<br />
In addition, part of our project aims to transform a number of our BioBricks into a marine chassis ''(Roseobacter denitrificans & Oceanibulbus indolifex)''. The most successful means of generating competent marine bacteria has been shown to be through electroporation rather than more traditional chemical competency. The major concern here is from the high voltages used in the operation of the apparatus.<br />
<br />
'''Did you document these issues in the Registry?'''<br />
<br />
As yet, neither of the above issues have been noted on the registry as the parts to which they correspond have not been submitted. Once the relevant BioBricks are ready to be added to the registry, the safety issues will be commented upon along with all other aspects associated with the part, it’s construction and characterisation.<br />
<br />
'''How did you manage to handle the safety issue?'''<br />
<br />
Regarding the safety concerns associated with Cobalt Chloride, risk assessments were conducted in conjunction with the department safety officer to ensure that all team members concerned were aware of the risks of use and the steps they needed to take in order to minimise the possibility of any harm.<br />
<br />
Discussions with experienced technical staff from the Structural and Molecular Biology department were carried out in order to ensure that there was no unnecessary risk to operators of the equipment. As mentioned above the main risk concerned with electroporation is the application of high voltages, and so using equipment only in accordance with established protocols and manufacturer’s instructions is essential.<br />
<br />
'''How could other teams learn from your experience?'''<br />
<br />
The risk of Cobalt Chloride is an established one and so I do not believe there is anything that we have done which any other team would not have had to do as standard practice. All that can be said is that it is essential to carry out risk assessments and consult with safety staff as early in the process as possible.<br />
<br />
Electroporation on the other hand is a lesser used technique and so our experiences with the practice, once documented, should provide helpful information to future teams looking to use the method. This will become especially true as more teams look to use marine organisms as part of the iGEM competition, tackling issues such as those that we have approached in our project.<br />
<br />
== Is there a local biosafety group, committee, or review board at your institution? ==<br />
<br />
Yes - we have the Departmental Genetic Modification Safety Officer (DGMSO) and the College Genetic Modification Safety Committee, who must approve of our work before it commences. We complete risk assessments, which must meet UCL Local Rules, and we are all fully trained in lab work and monitored. <br />
<br />
'''If yes, what does your local biosafety group think about your project?'''<br />
<br />
They are interested in our project, but have concerns about one of our Human Practice events - DIYbio - in which we proposed to carry out research into GMOs in the community. The efforts into assessing the safety of this project is ongoing, but we feel it would be a worthwhile venture. It may disperse some of the conventional worries harboured by the wider community about the use of GMO, and encourage more objective discussion. It would also bring science into the community, and we would present it in a way that makes it accessible to non-scientists.<br />
<br />
== Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering? ==<br />
<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabSafetyTeam:University College London/LabSafety2012-09-07T22:22:41Z<p>Rwilkinson: /* Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= Lab Safety =<br />
<br />
== Would any of your project ideas raise safety issues in terms of: ==<br />
<br />
'''Researcher safety'''<br />
<br />
There are a number of standard lab reagents that we require the use of in our project, that are harmful on contact. These include: <br />
<br />
'''Ethidium Bromide'''<br />
<br />
Material Safety Data Sheet for Ethidium Bromide <br />
<br />
Acute: Hazardous when ingested or inhaled, and is an irritant of the skin and eye. <br />
Chronic: In the long term exposure can have carcinogenic, mutagenic, and teratogenic effects, and can cause developmental toxicity.<br />
<br />
'''Congo Red'''<br />
<br />
Material Safety Data Sheet for Congo Red<br />
<br />
Acute: Hazardous when ingested of inhaled, is an irritant of the eye, and an irritant and sensitizer of the skin.<br />
Chronic: In the long term exposure can have carcinogenic, mutagenic and teratogenic effects, and can cause developmental toxicity. <br />
<br />
<br />
'''Public safety'''<br />
<br />
'''Environmental safety'''<br />
<br />
With regards to environmental safety there are many concerns, that are not restricted to our project, regarding the release of genetically modified organisms. The end point of our project necessitates the release of genetically modified ''Roseobacter'' into the ocean, where there is no possible physical containment of bacteria. This of course raises concerns as to whether the use of living machines may integrate into and alter the local ecosystem, and potentially spread. Furthermore there are concerns that the natural process of mutation found in bacterium may have an unpredictable effect in an organism that has already been genetically modified. As of yet, the release of GMOs on this scale has not yet been approved, but we hope that this project may push that boundary.<br />
<br />
== Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? ==<br />
<br />
Issues regarding safety have been raised through a number of aspects of BioBrick construction. Firstly, for our Aggregation module the original BioBrick containing the curli cluster that we are improving contains a Cobalt dependant promoter meaning that in order to assess this and our BioBrick we required the use of Cobalt Chloride. Cobalt Chloride is very hazardous in the case of skin or eye contact, or inhalation, thus steps had to be taken to ensure the safety of team members. <br />
<br />
In addition, part of our project aims to transform a number of our BioBricks into a marine chassis ''(Roseobacter denitrificans & Oceanibulbus indolifex)''. The most successful means of generating competent marine bacteria has been shown to be through electroporation rather than more traditional chemical competency. The major concern here is from the high voltages used in the operation of the apparatus.<br />
<br />
'''Did you document these issues in the Registry?'''<br />
<br />
As yet neither of the above issues have been noted on the registry as the parts to which they correspond have not been submitted. Once the relevant BioBricks are ready to be added to the registry, the safety issues will be commented upon along with all other aspects associated with the part, it’s construction and characterisation.<br />
<br />
'''How did you manage to handle the safety issue?'''<br />
<br />
Regarding the safety concerns associated with Cobalt Chloride, risk assessments were conducted in conjunction with the department safety officer to ensure that all team members concerned were aware of the risks of use and the steps they needed to take in order to minimise the possibility of any harm.<br />
<br />
Discussions with experienced technical staff from the Structural and Molecular Biology department were carried out in order to ensure that there was no unnecessary risk to operators of the equipment. As mentioned above the main risk concerned with electroporation is the application of high voltages, and so using equipment only in accordance with established protocols and manufacturer’s instructions is essential.<br />
<br />
'''How could other teams learn from your experience?'''<br />
<br />
The risk of Cobalt Chloride is an established one and so I do not believe there is anything that we have done which any other team would not have had to do as standard practice. All that can be said is that it is essential to carry out risk assessments and consult with safety staff as early in the process as possible.<br />
<br />
Electroporation on the other hand is a lesser used technique and so our experiences with the practice, once documented, should provide helpful information to future teams looking to use the method. This will become especially true as more teams look to use marine organisms as part of the iGEM competition, tackling issues such as those that we have approached in our project.<br />
<br />
== Is there a local biosafety group, committee, or review board at your institution? ==<br />
<br />
Yes - we have the Departmental Genetic Modification Safety Officer (DGMSO) and the College Genetic Modification Safety Committee, who must approve of our work before it commences. We complete risk assessments, which must meet UCL Local Rules, and we are all fully trained in lab work and monitored. <br />
<br />
'''If yes, what does your local biosafety group think about your project?'''<br />
<br />
They are interested in our project, but have concerns about one of our Human Practice events - DIYbio - in which we proposed to carry out research into GMOs in the community. The efforts into assessing the safety of this project is ongoing, but we feel it would be a worthwhile venture. It may disperse some of the conventional worries harboured by the wider community about the use of GMO, and encourage more objective discussion. It would also bring science into the community, and we would present it in a way that makes it accessible to non-scientists.<br />
<br />
== Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering? ==<br />
<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabSafetyTeam:University College London/LabSafety2012-09-07T22:21:49Z<p>Rwilkinson: /* Would any of your project ideas raise safety issues in terms of: */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= Lab Safety =<br />
<br />
== Would any of your project ideas raise safety issues in terms of: ==<br />
<br />
'''Researcher safety'''<br />
<br />
There are a number of standard lab reagents that we require the use of in our project, that are harmful on contact. These include: <br />
<br />
'''Ethidium Bromide'''<br />
<br />
Material Safety Data Sheet for Ethidium Bromide <br />
<br />
Acute: Hazardous when ingested or inhaled, and is an irritant of the skin and eye. <br />
Chronic: In the long term exposure can have carcinogenic, mutagenic, and teratogenic effects, and can cause developmental toxicity.<br />
<br />
'''Congo Red'''<br />
<br />
Material Safety Data Sheet for Congo Red<br />
<br />
Acute: Hazardous when ingested of inhaled, is an irritant of the eye, and an irritant and sensitizer of the skin.<br />
Chronic: In the long term exposure can have carcinogenic, mutagenic and teratogenic effects, and can cause developmental toxicity. <br />
<br />
<br />
'''Public safety'''<br />
<br />
'''Environmental safety'''<br />
<br />
With regards to environmental safety there are many concerns, that are not restricted to our project, regarding the release of genetically modified organisms. The end point of our project necessitates the release of genetically modified ''Roseobacter'' into the ocean, where there is no possible physical containment of bacteria. This of course raises concerns as to whether the use of living machines may integrate into and alter the local ecosystem, and potentially spread. Furthermore there are concerns that the natural process of mutation found in bacterium may have an unpredictable effect in an organism that has already been genetically modified. As of yet, the release of GMOs on this scale has not yet been approved, but we hope that this project may push that boundary.<br />
<br />
== Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? ==<br />
<br />
Issues regarding safety have been raised through a number of aspects of BioBrick construction. Firstly, for our Aggregation module the original BioBrick containing the curli cluster that we are improving contains a Cobalt dependant promoter meaning that in order to assess this and our brick we required the use of Cobalt Chloride. Cobalt Chloride is very hazardous in the case of skin or eye contact, or inhalation, thus steps had to be taken to ensure the safety of tem members. <br />
<br />
In addition, part of our project aims to transform a number of our BioBricks into marine chassis ''(Roseobacter denitrificans & Oceanibulbus indolifex)''. The most successful means of generating competent marine bacteria has been shown to be through electroporation rather than more traditional chemical competency. The major concern here is from the high voltages used in the operation of the apparatus.<br />
<br />
'''Did you document these issues in the Registry?'''<br />
<br />
As yet neither of the above issues have been noted on the registry as the parts to which they correspond have not been submitted. Once the relevant BioBricks are ready to be added to the registry, the safety issues will be commented upon along with all other aspects associated with the part, it’s construction and characterisation.<br />
<br />
'''How did you manage to handle the safety issue?'''<br />
<br />
Regarding the safety concerns associated with Cobalt Chloride, risk assessments were conducted in conjunction with the department safety officer to ensure that all team members concerned were aware of the risks of use and the steps they needed to take in order to minimise the possibility of any harm.<br />
<br />
Discussions with experienced technical staff from the Structural and Molecular Biology department were carried out in order to ensure that there was no unnecessary risk to operators of the equipment. As mentioned above the main risk concerned with electroporation is the application of high voltages, and so using equipment only in accordance with established protocols and manufacturer’s instructions is essential.<br />
<br />
'''How could other teams learn from your experience?'''<br />
<br />
The risk of Cobalt Chloride is an established one and so I do not believe there is anything that we have done which any other team would not have had to do as standard practice. All that can be said is that it is essential to carry out risk assessments and consult with safety staff as early in the process as possible.<br />
<br />
Electroporation on the other hand is a lesser used technique and so our experiences with the practice, once documented, should provide helpful information to future teams looking to use the method. This will become especially true as more teams look to use marine organisms as part of the iGEM competition, tackling issues such as those that we have approached in our project.<br />
<br />
== Is there a local biosafety group, committee, or review board at your institution? ==<br />
<br />
Yes - we have the Departmental Genetic Modification Safety Officer (DGMSO) and the College Genetic Modification Safety Committee, who must approve of our work before it commences. We complete risk assessments, which must meet UCL Local Rules, and we are all fully trained in lab work and monitored. <br />
<br />
'''If yes, what does your local biosafety group think about your project?'''<br />
<br />
They are interested in our project, but have concerns about one of our Human Practice events - DIYbio - in which we proposed to carry out research into GMOs in the community. The efforts into assessing the safety of this project is ongoing, but we feel it would be a worthwhile venture. It may disperse some of the conventional worries harboured by the wider community about the use of GMO, and encourage more objective discussion. It would also bring science into the community, and we would present it in a way that makes it accessible to non-scientists.<br />
<br />
== Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering? ==<br />
<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabSafetyTeam:University College London/LabSafety2012-09-07T22:21:29Z<p>Rwilkinson: /* Would any of your project ideas raise safety issues in terms of: */</p>
<hr />
<div>{{:Team:University_College_London/templates/head|coverpicture=training}}<br />
<br />
= Lab Safety =<br />
<br />
== Would any of your project ideas raise safety issues in terms of: ==<br />
<br />
'''Researcher safety'''<br />
<br />
There are a number of standard lab reagents that we require the use of in our project, that are harmful on contact. These include: <br />
<br />
Ethidium Bromide<br />
<br />
Material Safety Data Sheet for Ethidium Bromide <br />
<br />
Acute: Hazardous when ingested or inhaled, and is an irritant of the skin and eye. <br />
Chronic: In the long term exposure can have carcinogenic, mutagenic, and teratogenic effects, and can cause developmental toxicity.<br />
<br />
Congo Red<br />
<br />
Material Safety Data Sheet for Congo Red<br />
<br />
Acute: Hazardous when ingested of inhaled, is an irritant of the eye, and an irritant and sensitizer of the skin.<br />
Chronic: In the long term exposure can have carcinogenic, mutagenic and teratogenic effects, and can cause developmental toxicity. <br />
<br />
<br />
'''Public safety'''<br />
<br />
'''Environmental safety'''<br />
<br />
With regards to environmental safety there are many concerns, that are not restricted to our project, regarding the release of genetically modified organisms. The end point of our project necessitates the release of genetically modified ''Roseobacter'' into the ocean, where there is no possible physical containment of bacteria. This of course raises concerns as to whether the use of living machines may integrate into and alter the local ecosystem, and potentially spread. Furthermore there are concerns that the natural process of mutation found in bacterium may have an unpredictable effect in an organism that has already been genetically modified. As of yet, the release of GMOs on this scale has not yet been approved, but we hope that this project may push that boundary.<br />
<br />
== Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? ==<br />
<br />
Issues regarding safety have been raised through a number of aspects of BioBrick construction. Firstly, for our Aggregation module the original BioBrick containing the curli cluster that we are improving contains a Cobalt dependant promoter meaning that in order to assess this and our brick we required the use of Cobalt Chloride. Cobalt Chloride is very hazardous in the case of skin or eye contact, or inhalation, thus steps had to be taken to ensure the safety of tem members. <br />
<br />
In addition, part of our project aims to transform a number of our BioBricks into marine chassis ''(Roseobacter denitrificans & Oceanibulbus indolifex)''. The most successful means of generating competent marine bacteria has been shown to be through electroporation rather than more traditional chemical competency. The major concern here is from the high voltages used in the operation of the apparatus.<br />
<br />
'''Did you document these issues in the Registry?'''<br />
<br />
As yet neither of the above issues have been noted on the registry as the parts to which they correspond have not been submitted. Once the relevant BioBricks are ready to be added to the registry, the safety issues will be commented upon along with all other aspects associated with the part, it’s construction and characterisation.<br />
<br />
'''How did you manage to handle the safety issue?'''<br />
<br />
Regarding the safety concerns associated with Cobalt Chloride, risk assessments were conducted in conjunction with the department safety officer to ensure that all team members concerned were aware of the risks of use and the steps they needed to take in order to minimise the possibility of any harm.<br />
<br />
Discussions with experienced technical staff from the Structural and Molecular Biology department were carried out in order to ensure that there was no unnecessary risk to operators of the equipment. As mentioned above the main risk concerned with electroporation is the application of high voltages, and so using equipment only in accordance with established protocols and manufacturer’s instructions is essential.<br />
<br />
'''How could other teams learn from your experience?'''<br />
<br />
The risk of Cobalt Chloride is an established one and so I do not believe there is anything that we have done which any other team would not have had to do as standard practice. All that can be said is that it is essential to carry out risk assessments and consult with safety staff as early in the process as possible.<br />
<br />
Electroporation on the other hand is a lesser used technique and so our experiences with the practice, once documented, should provide helpful information to future teams looking to use the method. This will become especially true as more teams look to use marine organisms as part of the iGEM competition, tackling issues such as those that we have approached in our project.<br />
<br />
== Is there a local biosafety group, committee, or review board at your institution? ==<br />
<br />
Yes - we have the Departmental Genetic Modification Safety Officer (DGMSO) and the College Genetic Modification Safety Committee, who must approve of our work before it commences. We complete risk assessments, which must meet UCL Local Rules, and we are all fully trained in lab work and monitored. <br />
<br />
'''If yes, what does your local biosafety group think about your project?'''<br />
<br />
They are interested in our project, but have concerns about one of our Human Practice events - DIYbio - in which we proposed to carry out research into GMOs in the community. The efforts into assessing the safety of this project is ongoing, but we feel it would be a worthwhile venture. It may disperse some of the conventional worries harboured by the wider community about the use of GMO, and encourage more objective discussion. It would also bring science into the community, and we would present it in a way that makes it accessible to non-scientists.<br />
<br />
== Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering? ==<br />
<br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T14:07:14Z<p>Rwilkinson: /* Wednesday 15.08.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
'''Aim - Repeat the PCR again to optimise results:''' As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
'''Step 2 – PCR Program:''' An annealing temperature of 57oC was used instead of the standard 55oC.<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. A and C correspond to the bands expected for Laccase, and B and D for bands expected for irrE. The final two columns are negative controls for which no product was expected. The reason for the failure of this gel is unclear. <br />
<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/a/a1/UclExpt_9.2.png}}<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12 ==<br />
<br />
'''Aim - Check the results of the weekend culture of plates:''' At the end of last week we set up Expt 9.4, to assess whether poor activity of our antibiotics was a cause of the poor results we get after colony picking. We proposed that our antibiotics may be weak, allowing opportunistic colonies to grow on agar. Therefore we set up a series of agar plates with various antibiotics and controls, to see if we could prove that bacteria without resistance is capable of growing on antibiotic inoculated agar. If this is the case, we know our antibiotic is weak.<br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12==<br />
<br />
'''Aims – To test the growth of marine bacteria in different media:''' This is to optimise the conditions of growth for the bacteria. A test for the marine bacteria will be compared to control E.coli, and the difference in growth measured using a spectrometer. The two media being tested are LB media (typically used for E.coli) and marine media. We expect to have greater optical density of indoliflex in marine medium & greater optical density for W3110 in LB. <br />
<br />
<br />
'''Methods'''<br />
<br />
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html><br />
<br />
'''Step 2 – Inoculating Colonies into a Selective Broth:''' The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick. Each cell type will be inoculated into both types of media.<br />
<br />
{| class="wikitable"<br />
|-<br />
! rowspan="2" | Type of Bacterium !! colspan="2" | LB media !! colspan="2" | Marine media <br />
|-<br />
| No. Falcons || Volume Used (ml) || No. Falcons || Volume Used<br />
|-<br />
| W3100 (control) || 3 || 2 || 1 || 2<br />
|-<br />
| Oceanibulbus indoliflex (marine) || 2 || 2 || 4 || 2 <br />
|}<br />
<br />
<br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim: To measure the optical density of bacterium after overnight culture in different media.''' <br />
<br />
'''Method?'''<br />
<br />
'''Results:''' The table below summarises the results of OD600 measurement. As expected, all three samples of W3100 grown in LB media have a higher optical density (and therefore growth) than the single sample of W3100 grown in marine media. The marine bacterium Oceanibulbus indoliflex also gave us our expected results, with the four samples grown in marine media giving higher optical density (and therefore growth) than the two samples grown in LB media.<br />
<br />
{| class="wikitable"<br />
|-<br />
! rowspan="2" colspan="2" |Type of bacterium !! colspan="3" | Optical Density 600 in LB media !! colspan="4" | Optical Density 600 in Marine media <br />
|-<br />
| Sample 1 || Sample 2 || Sample 3 || Sample 1 || Sample 2 || Sample 3 || Sample 4<br />
|-<br />
| rowspan="3" | W3100 (Control|| Run 1 || 0.526 || 1.085 || 1.035 || 0.185 || / || / || / <br />
|-<br />
| Run 2 || 0.525 || 1.082 || 1.023 || 0.184 || / || / || /<br />
|-<br />
| Run 3 || 0.526 || 1.078|| 1.021 || 0.183 || / || / || / <br />
|-<br />
| rowspan="3" |Oceanibulbus indoliflex (Marine) || Run 1 || 0.033 || 0.003 || / || 0.291 || 0.239 || 0.335 || 0.325 <br />
|-<br />
| Run 2 || 0.033 || 0.003 || / || 0.289 || 0.226 || 0.335 || 0.322<br />
|-<br />
| Run 3 || 0.033 || 0.003 || / || 0.290 || 0.226 || 0.336 || 0.320 <br />
|}<br />
<br />
<br />
'''Conclusions'''<br />
<br />
This demonstrates the better suitability of marine media for the marine bacterium. Glycerol stocks were made of the W3100 Sample 2 cultured in LB media, and of the Oceanibulbus indoliflex Sample 3 culture in marine media, as these had the highest density. The W3100 sample will be used for competent cell preparation.<br />
<br />
<br />
<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T13:54:34Z<p>Rwilkinson: /* Tuesday 14.8.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
'''Aim - Repeat the PCR again to optimise results:''' As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
'''Step 2 – PCR Program:''' An annealing temperature of 57oC was used instead of the standard 55oC.<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The reason for this are unclear. <br />
<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/a/a1/UclExpt_9.2.png}}<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12 ==<br />
<br />
'''Aim - Check the results of the weekend culture of plates:''' At the end of last week we set up Expt 9.4, to assess whether poor activity of our antibiotics was a cause of the poor results we get after colony picking. We proposed that our antibiotics may be weak, allowing opportunistic colonies to grow on agar. Therefore we set up a series of agar plates with various antibiotics and controls, to see if we could prove that bacteria without resistance is capable of growing on antibiotic inoculated agar. If this is the case, we know our antibiotic is weak.<br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12==<br />
<br />
'''Aims – To test the growth of marine bacteria in different media:''' This is to optimise the conditions of growth for the bacteria. A test for the marine bacteria will be compared to control E.coli, and the difference in growth measured using a spectrometer. The two media being tested are LB media (typically used for E.coli) and marine media. We expect to have greater optical density of indoliflex in marine medium & greater optical density for W3110 in LB. <br />
<br />
<br />
'''Methods'''<br />
<br />
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html><br />
<br />
'''Step 2 – Inoculating Colonies into a Selective Broth:''' The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick. Each cell type will be inoculated into both types of media.<br />
<br />
{| class="wikitable"<br />
|-<br />
! rowspan="2" | Type of Bacterium !! colspan="2" | LB media !! colspan="2" | Marine media <br />
|-<br />
| No. Falcons || Volume Used (ml) || No. Falcons || Volume Used<br />
|-<br />
| W3100 (control) || 3 || 2 || 1 || 2<br />
|-<br />
| Oceanibulbus indoliflex (marine) || 2 || 2 || 4 || 2 <br />
|}<br />
<br />
<br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim: To measure the optical density of bacterium after overnight culture in different media.''' <br />
<br />
'''Method?'''<br />
<br />
'''Results:''' The table below summarises the results of OD600 measurement. As expected, all three samples of W3100 grown in LB media have a higher optical density (and therefore growth) than the single sample of W3100 grown in marine media. The marine bacterium Oceanibulbus indoliflex also gave us our expected results, with the four samples grown in marine media giving higher optical density (and therefore growth) than the two samples grown in LB media.<br />
<br />
{| class="wikitable"<br />
|-<br />
! rowspan="2" colspan="2" |Type of bacterium !! colspan="3" | Optical Density 600 in LB media !! colspan="4" | Optical Density 600 in Marine media <br />
|-<br />
| Sample 1 || Sample 2 || Sample 3 || Sample 1 || Sample 2 || Sample 3 || Sample 4<br />
|-<br />
| rowspan="3" | W3100 (Control|| Run 1 || 0.526 || 1.085 || 1.035 || 0.185 || / || / || / <br />
|-<br />
| Run 2 || 0.525 || 1.082 || 1.023 || 0.184 || / || / || /<br />
|-<br />
| Run 3 || 0.526 || 1.078|| 1.021 || 0.183 || / || / || / <br />
|-<br />
| rowspan="3" |Oceanibulbus indoliflex (Marine) || Run 1 || 0.033 || 0.003 || / || 0.291 || 0.239 || 0.335 || 0.325 <br />
|-<br />
| Run 2 || 0.033 || 0.003 || / || 0.289 || 0.226 || 0.335 || 0.322<br />
|-<br />
| Run 3 || 0.033 || 0.003 || / || 0.290 || 0.226 || 0.336 || 0.320 <br />
|}<br />
<br />
<br />
'''Conclusions'''<br />
<br />
This demonstrates the better suitability of marine media for the marine bacterium. Glycerol stocks were made of the W3100 Sample 2 cultured in LB media, and of the Oceanibulbus indoliflex Sample 3 culture in marine media, as these had the highest density. The W3100 sample will be used for competent cell preparation.<br />
<br />
<br />
<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T13:54:04Z<p>Rwilkinson: /* Tuesday 14.8.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
'''Aim - Repeat the PCR again to optimise results:''' As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
'''Step 2 – PCR Program:''' An annealing temperature of 57oC was used instead of the standard 55oC.<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The reason for this are unclear. <br />
<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/a/a1/UclExpt_9.2.png}}<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12 ==<br />
<br />
'''Aim - Check the results of the weekend culture of plates:''' At the end of last week we set up Expt 9.4, to assess whether poor activity of our antibiotics was a cause of the poor results we get after colony picking. We proposed that our antibiotics may be weak, allowing opportunistic colonies to grow on agar. Therefore we set up a series of agar plates with various antibiotics and controls, to see if we could prove that bacteria without resistance is capable of growing on antibiotic inoculated agar. If this is the case, we know our antibiotic is weak.<br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12==<br />
<br />
'''Aims – To test the growth of marine bacteria in different media:''' This is to optimise the conditions of growth for the bacteria. A test for the marine bacteria will be compared to control E.coli, and the difference in growth measured using a spectrometer. The two media being tested are LB media (typically used for E.coli) and marine media. We expect to have greater optical density of indoliflex in marine medium & greater optical density for W3110 in LB. <br />
<br />
<br />
'''Methods'''<br />
<br />
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html><br />
<br />
'''Step 2 – Inoculating Colonies into a Selective Broth:''' The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick. Each cell type will be inoculated into both types of media.<br />
<br />
{| class="wikitable"<br />
|-<br />
! rowspan="2" | Type of Bacterium !! colspan="2" | LB media !! colspan="2" | Marine media <br />
|-<br />
| No. Falcons || Volume Used (ml) || No. Falcons || Volume Used<br />
|-<br />
| W3100 (control) || 3 || 2 || 1 || 2<br />
|-<br />
| Oceanibulbus indoliflex (marine) || 2 || 2 || 4 || 2 <br />
|}<br />
<br />
<br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim: To measure the optical density of bacterium after overnight culture in different media.''' <br />
<br />
'''Method?'''<br />
<br />
'''Results:''' The table below summarises the results of OD600 measurement. As expected, all three samples of W3100 grown in LB media have a higher optical density (and therefore growth) than the single sample of W3100 grown in marine media. The marine bacterium Oceanibulbus indoliflex also gave us our expected results, with the four samples grown in marine media giving higher optical density (and therefore growth) than the two samples grown in LB media.<br />
<br />
{| class="wikitable"<br />
|-<br />
! rowspan="2" colspan="2" |Type of bacterium !! colspan="3" | Optical Density 600 in LB media !! colspan="4" | Optical Density 600 in Marine media <br />
|-<br />
| Sample 1 || Sample 2 || Sample 3 || Sample 1 || Sample 2 || Sample 3 || Sample 4<br />
|-<br />
| rowspan="3" | W3100 (Control|| Run 1 || 0.526 || 1.085 || 1.035 || 0.185 || / || / || / <br />
|-<br />
| Run 2 || 0.525 || 1.082 || 1.023 || 0.184 || / || / || /<br />
|-<br />
| Run 3 || 0.526 || 1.078|| 1.021 || 0.183 || / || / || / <br />
|-<br />
| rowspan="3" |Oceanibulbus indoliflex (Marine) || Run 1 || 0.033 || 0.003 || / || 0.291 || 0.239 || 0.335 || 0.325 <br />
|-<br />
| Run 2 || 0.033 || 0.003 || / || 0.289 || 0.226 || 0.335 || 0.322<br />
|-<br />
| Run 3 || 0.033 || 0.003 || / || 0.290 || 0.226 || 0.336 || 0.320 <br />
|}<br />
<br />
<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T13:53:27Z<p>Rwilkinson: /* Monday 13.8.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
'''Aim - Repeat the PCR again to optimise results:''' As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
'''Step 2 – PCR Program:''' An annealing temperature of 57oC was used instead of the standard 55oC.<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The reason for this are unclear. <br />
<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/a/a1/UclExpt_9.2.png}}<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12 ==<br />
<br />
'''Aim - Check the results of the weekend culture of plates:''' At the end of last week we set up Expt 9.4, to assess whether poor activity of our antibiotics was a cause of the poor results we get after colony picking. We proposed that our antibiotics may be weak, allowing opportunistic colonies to grow on agar. Therefore we set up a series of agar plates with various antibiotics and controls, to see if we could prove that bacteria without resistance is capable of growing on antibiotic inoculated agar. If this is the case, we know our antibiotic is weak.<br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12==<br />
<br />
'''Aims – To test the growth of marine bacteria in different media:''' This is to optimise the conditions of growth for the bacteria. A test for the marine bacteria will be compared to control E.coli, and the difference in growth measured using a spectrometer. The two media being tested are LB media (typically used for E.coli) and marine media. We expect to have greater optical density of indoliflex in marine medium & greater optical density for W3110 in LB. <br />
<br />
<br />
'''Methods'''<br />
<br />
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html><br />
<br />
'''Step 2 – Inoculating Colonies into a Selective Broth:''' The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick. Each cell type will be inoculated into both types of media.<br />
<br />
{| class="wikitable"<br />
|-<br />
! rowspan="2" | Type of Bacterium !! colspan="2" | LB media !! colspan="2" | Marine media <br />
|-<br />
| No. Falcons || Volume Used (ml) || No. Falcons || Volume Used<br />
|-<br />
| W3100 (control) || 3 || 2 || 1 || 2<br />
|-<br />
| Oceanibulbus indoliflex (marine) || 2 || 2 || 4 || 2 <br />
|}<br />
<br />
<br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim: To measure the optical density of bacterium after overnight culture in different media.''' <br />
<br />
Method?<br />
<br />
'''Results:''' The table below summarises the results of OD600 measurement. As expected, all three samples of W3100 grown in LB media have a higher optical density (and therefore growth) than the single sample of W3100 grown in marine media. The marine bacterium Oceanibulbus indoliflex also gave us our expected results, with the four samples grown in marine media giving higher optical density (and therefore growth) than the two samples grown in LB media.<br />
<br />
{| class="wikitable"<br />
|-<br />
! rowspan="2" colspan="2" |Type of bacterium !! colspan="3" | Optical Density 600 in LB media !! colspan="4" | Optical Density 600 in Marine media <br />
|-<br />
| Sample 1 || Sample 2 || Sample 3 || Sample 1 || Sample 2 || Sample 3 || Sample 4<br />
|-<br />
| rowspan="3" | W3100 (Control|| Run 1 || 0.526 || 1.085 || 1.035 || 0.185 || / || / || / <br />
|-<br />
| Run 2 || 0.525 || 1.082 || 1.023 || 0.184 || / || / || /<br />
|-<br />
| Run 3 || 0.526 || 1.078|| 1.021 || 0.183 || / || / || / <br />
|-<br />
| rowspan="3" |Oceanibulbus indoliflex (Marine) || Run 1 || 0.033 || 0.003 || / || 0.291 || 0.239 || 0.335 || 0.325 <br />
|-<br />
| Run 2 || 0.033 || 0.003 || / || 0.289 || 0.226 || 0.335 || 0.322<br />
|-<br />
| Run 3 || 0.033 || 0.003 || / || 0.290 || 0.226 || 0.336 || 0.320 <br />
|}<br />
<br />
<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T13:31:28Z<p>Rwilkinson: /* 10-1 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
'''Aim - Repeat the PCR again to optimise results:''' As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
'''Step 2 – PCR Program:''' An annealing temperature of 57oC was used instead of the standard 55oC.<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The reason for this are unclear. <br />
<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/a/a1/UclExpt_9.2.png}}<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12 ==<br />
<br />
'''Aim - Check the results of the weekend culture of plates:''' At the end of last week we set up Expt 9.4, to assess whether poor activity of our antibiotics was a cause of the poor results we get after colony picking. We proposed that our antibiotics may be weak, allowing opportunistic colonies to grow on agar. Therefore we set up a series of agar plates with various antibiotics and controls, to see if we could prove that bacteria without resistance is capable of growing on antibiotic inoculated agar. If this is the case, we know our antibiotic is weak.<br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12==<br />
<br />
Aims – To test the growth of marine bacteria in different media: This is to optimise the conditions of growth for the bacteria. A test for the marine bacteria will be compared to control E.coli, and the difference in growth measured using a spectrometer. The two media being tested are LB media (typically used for E.coli) and marine media. We expect to have greater optical density of indoliflex in marine medium & greater optical density for W3110 in LB. <br />
<br />
<br />
Methods<br />
<br />
<html><div class="protocol protocol-ColPic">Picking Colonies Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/ColPic}}<html></div></html><br />
<br />
Step 2 – Inoculating Colonies into a Selective Broth: The table below indicates the volume of broth and the concentration of antibiotic required for each BioBrick. Each cell type will be inoculated into both types of media.<br />
<br />
{| class="wikitable"<br />
|-<br />
! rowspan="2" | Type of Bacterium !! colspan="2" | LB media !! colspan="2" | Marine media <br />
|-<br />
| No. Falcons || Volume Used (ml) || No. Falcons || Volume Used<br />
|-<br />
| W3100 (control) || 3 || 2 || 1 || 2<br />
|-<br />
| Oceanibulbus indoliflex (marine) || 2 || 2 || 4 || 2 <br />
|}<br />
<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T12:09:30Z<p>Rwilkinson: /* Monday 13.8.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
'''Aim - Repeat the PCR again to optimise results:''' As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
'''Step 2 – PCR Program:''' An annealing temperature of 57oC was used instead of the standard 55oC.<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The reason for this are unclear. <br />
<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/a/a1/UclExpt_9.2.png}}<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12 ==<br />
<br />
'''Aim - Check the results of the weekend culture of plates:''' At the end of last week we set up Expt 9.4, to assess whether poor activity of our antibiotics was a cause of the poor results we get after colony picking. We proposed that our antibiotics may be weak, allowing opportunistic colonies to grow on agar. Therefore we set up a series of agar plates with various antibiotics and controls, to see if we could prove that bacteria without resistance is capable of growing on antibiotic inoculated agar. If this is the case, we know our antibiotic is weak.<br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
<br />
== 10-1 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T12:09:16Z<p>Rwilkinson: /* 9-4 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
'''Aim - Repeat the PCR again to optimise results:''' As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
'''Step 2 – PCR Program:''' An annealing temperature of 57oC was used instead of the standard 55oC.<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The reason for this are unclear. <br />
<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/a/a1/UclExpt_9.2.png}}<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== Monday 13.8.12 ==<br />
<br />
Aim - Check the results of the weekend culture of plates: At the end of last week we set up Expt 9.4, to assess whether poor activity of our antibiotics was a cause of the poor results we get after colony picking. We proposed that our antibiotics may be weak, allowing opportunistic colonies to grow on agar. Therefore we set up a series of agar plates with various antibiotics and controls, to see if we could prove that bacteria without resistance is capable of growing on antibiotic inoculated agar. If this is the case, we know our antibiotic is weak.<br />
<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
<br />
== 10-1 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T12:06:51Z<p>Rwilkinson: /* Wednesday 15.08.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
'''Aim - Repeat the PCR again to optimise results:''' As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
'''Step 2 – PCR Program:''' An annealing temperature of 57oC was used instead of the standard 55oC.<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The reason for this are unclear. <br />
<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/a/a1/UclExpt_9.2.png}}<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== 9-4 ==<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
== 10-1 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:UclExpt_9.2.pngFile:UclExpt 9.2.png2012-08-24T12:04:21Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T12:03:06Z<p>Rwilkinson: /* Wednesday 15.08.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
'''Aim - Repeat the PCR again to optimise results:''' As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
'''Step 2 – PCR Program:''' An annealing temperature of 57oC was used instead of the standard 55oC.<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The reason for this are unclear. <br />
<br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/3/31/Ucligem2012Expt_9.2.2.png}}<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== 9-4 ==<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
== 10-1 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:Ucligem2012Expt_9.2.2.pngFile:Ucligem2012Expt 9.2.2.png2012-08-24T12:02:36Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T12:01:41Z<p>Rwilkinson: /* Wednesday 15.08.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
'''Aim - Repeat the PCR again to optimise results:''' As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
'''Step 2 – PCR Program:''' An annealing temperature of 57oC was used instead of the standard 55oC.<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The reason for this are unclear. <br />
<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== 9-4 ==<br />
<html><br />
</div><div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
== 10-1 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T11:34:54Z<p>Rwilkinson: /* Wednesday 15.08.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
'''Aim - Repeat the PCR again to optimise results:''' As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
'''Method'''<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== 9-4 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
== 10-1 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T11:34:16Z<p>Rwilkinson: /* Tuesday 14.8.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
'''Conclusion:''' We will revise the protocol to see if we can detect any bands.<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
Aim: Repeat the PCR again to optimise results. As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
Method<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
Step 1 - Setting up PCR tubes: The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== 9-4 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
== 10-1 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T11:28:42Z<p>Rwilkinson: /* Tuesday 14.8.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. In Lanes 1 and 3 we expected a product corresponding to the size of the irrE gene (1974bp) as indicated by A and C respectively. C would be marginally larger because it also contains the standard BioBrick prefix and suffix, but this different would not be noticeable on a gel. In Lane 2 and 4 we would expect products corresponding to the size of the Laccase gene (1554bp), as shown by B and D. Again we would expect D to be a slightly larger product because the primers were designed to include the prefix and suffix, but this is not a difference we would expect to detect. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered. <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
<br />
<br />
== Wednesday 15.08.12 ==<br />
<br />
<br />
Aim: Repeat the PCR again to optimise results. As an improvement we are using:<br />
- Phusion polymerase<br />
- Diluting the irrE DNA 10-fold, due to the excessive dose on DNA shown on the gel from yesterday. <br />
- Changing the annealing temperature from 55C to 57C <br />
<br />
Method<br />
<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
Step 1 - Setting up PCR tubes: The polymerase used was Phusion, and we had two template DNAs – irrE and Laccase.<br />
<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== 9-4 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
== 10-1 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T11:19:30Z<p>Rwilkinson: /* Tuesday 14.8.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Degradation || rowspan="2" |LR1/LF1||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" |No Template (Negative Control) ||rowspan="2" | N/A || rowspan="2" |Salt Tolerance || rowspan="2" |STF1/STF2||STF1 ||atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R|| tcactgtgcagcgtcctgcg<br />
|-<br />
|}<br />
<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered, <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== 9-4 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
== 10-1 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T11:03:14Z<p>Rwilkinson: /* Tuesday 14.8.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|}<br />
<br />
<br />
{| class="wikitable"<br />
|-<br />
! Template DNA !! Primer Pair <br />
|-<br />
| None (Negative Control) || STF1/ST2R <br />
|-<br />
| None (Negative Control) || LR1/LF1 <br />
|-<br />
| None (Negative Control) || BirAF/BirAR <br />
|}<br />
<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered, <br />
<br />
{{:Team:University_College_London/templates/pictureinsert|title=Picture 1|url=images/e/e4/Ucligem2012Expt_9.2.png}}<br />
<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== 9-4 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
== 10-1 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinsonhttp://2012.igem.org/File:Ucligem2012Expt_9.2.pngFile:Ucligem2012Expt 9.2.png2012-08-24T11:01:58Z<p>Rwilkinson: </p>
<hr />
<div></div>Rwilkinsonhttp://2012.igem.org/Team:University_College_London/LabBook/Week10Team:University College London/LabBook/Week102012-08-24T10:23:08Z<p>Rwilkinson: /* Tuesday 14.8.12 */</p>
<hr />
<div>{{:Team:University_College_London/templates/headimg|coverpicture=images/a/a1/Ucl2012-labbook-title.png}}<html><script type="text/javascript" src="https://2012.igem.org/wiki/index.php?title=Team:University_College_London/js/labbookjs&amp;action=raw&amp;ctype=text/js"></script><br />
</html>{{:Team:University_College_London/templates/labbookmenu}}<html><br />
<img src="https://static.igem.org/mediawiki/2012/d/d4/Ucl2012-labbook-monfri.png" /><br />
<img id="9-2" src="https://static.igem.org/mediawiki/2012/9/97/Ucl2012-labbook-graph109-2.png" /><br />
<div class="experimentContent"></html><br />
== Tuesday 14.8.12 ==<br />
<br />
'''Aim - Repeat experiment 9.2:''' We think there might have been a confusion in preparing the samples for the PCR because we did not obtain any bands on the gel for irrE or Laccase.<br />
<br />
'''Method'''<br />
<html><div class="protocol protocol-PCR">PCR Protocol</div><div class="protocolContent"></html>{{:Team:University_College_London/Protocols/PCR}}<html></div></html><br />
<br />
'''Step 1 - Setting up PCR tubes:''' The table below gives the identity of the primers used for each reaction. It indicates the samples that were set up for the repeat of Expt 9.2, as was done in the first attempt of Expt 9.2. <br />
<br />
{| class="wikitable"<br />
|-<br />
! DNA Template !! Function !! Module!! Primer Pair!! Primer!! Primer Sequence<br />
|-<br />
| rowspan="4" |BBa_K729002 ||rowspan="4" | Laccase Gene|| rowspan="4" |Degradation || rowspan="2" | LR1/LF1 ||LR1 ||gaatacggtctttttataccg<br />
|-<br />
| LF1|| gaaataactatgcaacgtcg<br />
|-<br />
| rowspan="2" |REVLF2/LFTW0 ||REVLF2|| gtttcttcctgcagcggccgctactagtagaatacggtctttttataccg<br />
|-<br />
|LFTW0 || gtttcttcgaattcgcggccgcttctagaggaaataactatgcaacgtcg<br />
|-<br />
| rowspan="4" |BBa_K729001 || rowspan="4" |irrE|| rowspan="4" |Salt Tolerance ||rowspan="2" | STF1/ST2R||STF1 || atggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST2R ||tcactgtgcagcgtcctgcg<br />
|-<br />
| rowspan="2" | STF3/ST4R || STF3 || gtttcttcgaattcgcggccgcttctagagatggggccaaaagctaaagctgaagcc<br />
|-<br />
| ST4R || gtttcttcctgcagcggccgctactagtatcactgtgcagcgtcctgcg<br />
|}<br />
<br />
'''Results:''' The image below shows a 1% Agarose Gel of an Analytical Restriction Enzyme Digest for Expt 9.2, with a 1000bp ladder. Again we have not obtained any bands. The strong patches of white demonstrate to us that our DNA template is at a high concentration, and should be diluted before we attempt any repeats. The lack of any products suggest we need to reconsider the protocol. Revising the annealing temperature or designing new primers will have to be considered, <br />
<br />
<br />
<br />
<br />
<html></div><br />
<div class="experiment"></div><br />
<img id="9-4" src="https://static.igem.org/mediawiki/2012/2/2b/Ucl2012-labbook-graph109-4.png" /><div class="experimentContent"><br />
</html><br />
<br />
== 9-4 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<div class="experiment"></div><br />
<img id="10-1" src="https://static.igem.org/mediawiki/2012/e/ee/Ucl2012-labbook-graph10-1.png" /><div class="experimentContent"><br />
</html><br />
== 10-1 ==<br />
<html><br />
</div><div class="experiment"></div></html><br />
<br />
{{:Team:University_College_London/templates/foot}}</div>Rwilkinson