http://2012.igem.org/wiki/index.php?title=Special:Contributions/RNagy&feed=atom&limit=50&target=RNagy&year=&month=2012.igem.org - User contributions [en]2024-03-28T10:38:50ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface/DiscussionTeam:Edinburgh/Project/Bioelectric-Interface/Discussion2012-10-27T00:45:09Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
</style><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Bio-electric Interface:<br />
<br /><br /><br />
Discussion and conclusions<br />
</p><br />
<p class="normal-text"><br />
<br />
For the fuel cell experiment we have obtained a series of interesting results. In our half fuel cells, <i>E. coli</i> seemed to exhibit properties similar to <i>S. oneidensis. E. coli</i> generates potential which closely relates to <i>S. oneidensis</i> outputs and the results repeat throughout multiple media, except for the final experiment using M9 with sodium acetate, which limited the growth of <i>E. coli</i> altogether as well as limiting the electrogenicity of other bacteria. However, <i>S. oneidensis</i> electrogenicity remains superior in all experiments, most likely because of its electron export system proteins. We hope that transferring <i>S. oneidensis</i> genes (especially <i>mtrA</i> or <i>mtrCAB</i>) into <i>E. coli</i> will improve its response. <br /><br />
It seems that electrogenicity can be linked to the growth of cultures, at least in the minimal media. This shows a great potential for using microbial half fuel cells in combination with different promoters and selectable markers. To test this concept we have tested the <b>BBa_J33203 (arsenic promoter) + <i>lacZ'</i> construct in our half fuel cells as a growth-based biosensor. We have obtained encouraging results,</b> where transformed cells show faster voltage change compared to controls, <b>showing a good potential for our system to serve as a reliable bio-detector</b> generating data which would be easy to obtain and link to a computer system. With its potential for automation and miniaturisation, this system offers a potential advancement in the field of biosensors. We are intending to further test this idea by using cells with arsenic promoter linked to the sucrose hydrolase gene. In such a system, detection of arsenic would induce expression of sucrose hydrolase, necessary for the growth of <i> E. coli K-12</i> in media containing sucrose as the sole carbon source.<br /><br /><br />
<br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
<ul style="padding-left:10px; list-style-type:circle;"><br/><br />
<li>We managed to obtain, BioBrick and submit the <i>napC, cymA, ccm and mtrA</i> genes<br /><br /></li><br />
<li>We have tested <i>ccm, cymA and napC</i> using haem staining procedure and obtained positive results<br /><br /></li><br />
<li>We have mutagenised the internal PstI side in <i>mtrA</i></li><br/<br/><br />
<li>We had some success in cloning the <i>mtrCAB</i> and <i>S. oneidensis ccm</i> genes which may enhance the efficiency of the system <br/><br/></li><br />
<li>We would like to clone these genes into the pSB1C3 vector to create a functional BioBrick (<a href="http://partsregistry.org/Part:BBa_K917007">BBa_K917007</a>). However, the longer products (<i>mtrCAB</i> and <i>ccm</i> genes) seem to be more problematic to clone, with the digestion/ligation step being the limiting factor, despite using several alternative techniques (A-tailing with Taq and TA cloning, fusion PCR). </li><br/<br/><br />
</ul><br />
</p><br />
<br />
<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface/Microbial-Half-Fuel-Cells"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">__</span>4/4</span><span style="color:white;">__</span><span class="subtle-emphasis">Next&gt;&gt;</span><span style="color:white;">___</span><br />
<br /><br /><br />
</p><br />
</html><br />
{{:Edinburgh/Project/Bioelectric-Interface/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-bio-el-interface p,<br />
#page-navigation ul li#nav-bio-el-interface ul li#nav-bio-el-discussion a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-bio-el-interface ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-bio-el-interface ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface/Microbial-Half-Fuel-CellsTeam:Edinburgh/Project/Bioelectric-Interface/Microbial-Half-Fuel-Cells2012-10-27T00:37:27Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#fig01,#fig02,#fig03{<br />
width:100%;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'pSBIC3-method'){<br />
document.getElementById('fig1').style.height="auto";<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'pSBIC3-method'){<br />
document.getElementById('fig1').style.height="0px";<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Bio-electric Interface:<br />
<br /><br /><br />
Microbial half fuel cells<br />
</p><br />
<p class="h2"><br />
Methods<br />
</p><br />
<p class="normal-text"><br />
<br /><br />
The half fuel cells were constructed using the following components provided by Matthew Knighton from Dr Bruce Ward’s lab: <br /><br />
- 250 ml or 500 ml glass bottle <br /><br />
- A standard plastic cap with two holes drilled for electrodes <br /><br />
- carbon weave electrode fixed to the cap with silicone sealant <br /><br />
- reference electrode "red rod" REF201 available for sale from Radiometer analytical <br /><br />
<br />
<br /><br />
- Following the assembly, bottles were autoclaved (reference electrodes were instead sterilised with alcohol as they are temperature sensitive). Under sterile conditions, reference electrodes were dipped in alcohol, inserted into the cap of the bottles and sealed with silicon sealant. The half fuel cells were then filled with media, inoculated with bacteria and sealed with parafilm in order to ensure anaerobic growth. The bacteria were left to grow at room temperature. (Figure 1)<br />
<br /><br /><br />
- Media used: standard LB or M9 (<a href="http://openwetware.org/wiki/M9_medium/minimal">minimal growth medium</a>) supplemented with 1% lactose, 0,4% glycerol or 0,4% sodium acetate.<br />
<br /><br /><br />
- Measurements were obtained using a digital multimeter.<br />
</p><br />
<p class="h2"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
- We have examined the behaviour of <i>S. oneidensis</i> and <i>E. coli</i> in different media using half fuel cells. We managed to obtain results using the following media: LB, M9 with glycerol and M9 with sodium acetate. The results are summarised in figures 2 and 3 below. We also performed a measurement for <i>Citrobacter freundii</i> to see whether it differs from other bacteria.<br /><br /><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/e/e4/Bio-el-interface-fig09.JPG"><br /><br />
<b>Figure 1:</b> Our microbial half fuel cells with <i>S. oneidensis</i> and <i>E. coli</i><br />
<br /><br /><br />
<img id="fig02" src="https://static.igem.org/mediawiki/2012/9/91/Bioelec1.jpg"><br /><br />
<b>Figure 2:</b> Half fuel cells experiments 1 and 2, using LB medium for growth of <i>S. oneidensis</i> and <i>E. coli</i>. Experiment 1 (left) was performed using 500 ml of medium while experiment 2 (right) was performed using 250 ml of medium.<br />
<br /><br /><br />
<img id="fig03" src="https://static.igem.org/mediawiki/2012/c/cc/Bioelec2.jpg"><br /><br />
<b>Figure 3:</b> Half fuel cell experiments 3 and 4, using M9 medium for growth of <i>S. oneidensis</i>, <i>E. coli</i> and <i>Citrobacter freundii</i>. Experiment 3 (left) was performed using 250 ml of medium M9 with 0,4% glycerol while experiment 4 (right) was performed using 250 ml of medium M9 with 0,4% sodium acetate. In experiment 4, <i>C. freundii</i> was also tested.<br />
</p><br />
<p class="h2"><br />
Growth-based biosensor<br />
</p><br />
<p class="normal-text"><br />
We have designed and tested a growth-based arsenic biosensor with a direct electric output. In order to test the principle of this device, we have transformed <i>E. coli</i> JM109 with Edinburgh 2006's <a href="http://partsregistry.org/Part:BBa_J33203">BBa_J33203</a> BioBrick (arsenic promoter with <i>arsR</i> repressor linked to <i>lacZ'</i> gene responsible for lactose degradation). We have then prepared 3 half-fuel cells with lactose medium (M9 with trace elements and thiamine + 1% lactose): <br /><br />
1) BBa_J33203 transformants in medium with sodium arsenate (100 parts per billion concentration)<br /><br />
2) BBa_J33203 transformants in medium without sodium arsenate <br /><br />
3) control, wild type <i>E. coli</i> in medium with sodium arsenate (100 parts per billion concentration)<br /><br /><br />
<img src= "https://static.igem.org/mediawiki/2012/2/2e/Biosensor_final.jpg" width="700"> <br /><br />
<b>Figure 4</b>: Growth-based arsenic biosensor: change in voltage over time using <i>E. coli</i> transformed with BBa_J33203 + lacZ' and WT <i>E. coli</i> as control<br /><br /><br />
The growth of cells and associated change in voltage was much slower compared to our previous experiments. This can probably be attributed to the lower temperature of incubation as the fuel cells were incubated at room temperature. Despite the slower growth rate, the results we have obtained are encouraging. BBa_J33203 transformed cells in the presence of arsenate show a faster drop in voltage compared to other samples. This is especially important compared to the BBa_J33203 cells in the medium without arsenate. These results show promising prospect for growth-based biosensors. With more sophisticated measurement methods it would be possible to connect our system to a computer which would allow for automated and quantitative analysis of the data, allowing for simple and automated contamination detection. <br /><br />
Current results are encouraging but background growth is still present in the media and therefore further experiments are necessary to optimise the growth parameters. One possible improvement includes the addition of the <i>cscA</i> BioBrick that we have designed this year. Using sucrose instead of lactose may reduce background growth and allow for tighter control of the system. <br />
</p><br />
<br />
<p class="h2"><br />
Acknowledgements<br />
</p><br />
<p class="normal-text"><br />
We would like to thank Dr Bruce Ward and Matthew Knighton for their help with the fuel cells and for lending us their lab equipment.<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface/Bio-electric-Interface-BioBricks-Cloning"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">__</span>3/4</span></a><span style="color:white;">__</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface/Discussion"><span class="intense-emphasis">Next&gt;&gt;</span></a></span><br />
<br /><br /><br />
</p><br />
</html><br />
{{:Edinburgh/Project/Bioelectric-Interface/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-bio-el-interface p,<br />
#page-navigation ul li#nav-bio-el-interface ul li#nav-bio-el-fuel-cells a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-bio-el-interface ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-bio-el-interface ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/AttributionsTeam:Edinburgh/Attributions2012-10-26T18:01:07Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<html><br />
<style type="text/css"><br />
/* header edit */<br />
#attributions-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#attributions-page a,<br />
#attributions-page a:visited{<br />
color: #000;<br />
}<br />
#attributions-page a:hover{<br />
cursor: default;<br />
color: #000;<br />
}<br />
/* attributions page */<br />
#attributions-middle{<br />
background-color:#fff;<br />
border:1px solid #a8a8a8;<br />
box-shadow:0px 0px 10px #a8a8a8;<br />
border-radius: 20px;<br />
width:1083px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
margin-top:20px;<br />
}<br />
#sponsors a img{<br />
width:16%;<br />
padding-left:0.8%;<br />
padding-top:60px;<br />
padding-bottom:60px;<br />
float:left;<br />
}<br />
#sponsors a#sponsor-UoE img{<br />
width:12%;<br />
padding:2%;<br />
}<br />
#sponsors a#sponsor-SELEX img{<br />
padding-top:40px;<br />
padding-bottom:80px;<br />
}<br />
#sponsors a#sponsor-MSD img{<br />
padding-top:30px;<br />
padding-bottom:90px;<br />
}<br />
.normal-text{<br />
font: normal 14px/20px verdana, calibri, tahoma, sans-serif;<br />
}<br />
</style><br />
<br />
<div id="attributions-middle"><br />
<div class="text"><br />
<p class="h2"> Attributions </p><br/><br />
<p class="normal-text"><br />
All experimental work was performed by team members except for the following: <br /><br/><br />
<li> The <i>cscA</i> gene was originally obtained by Chris French's lab from <i>Escherichia coli</i> O157:H7 strain Sakai</li><br /> <br />
<li> We were assisted in the cloning of <i>cymA, napC </i>and<i> ccm </i> as well as the transfer of the <i>ccm</i> part from pSB1C3 to pSC4K5 vector by our advisers (Dr. David Radford and Eugene Fletcher) and supervisor(Dr. Chris French)</li> <br /><br />
<li> Mutagenesis of the <i>mtrA</i> part (obtained by the team members) was performed by Dr. Chris French (using primers designed by the team members) </li><br /><br />
<li> The <i>Citrobacter freundii</i> genomes were sequenced by Prof. Anil Wipat and Dr. Wendy Smith at Newcastle University. Genome sequencing was done by Dr. Smith while genome assembly was done by Prof. Anil Wipat together with two team members. Genome annotation was done automatically by RAST and data extraction from this annotation was done by the team.</li><br />
<br />
<br /><br /><br />
</p><br />
<br />
<p class="h2"><br />
We would like to thank all the people who guided us through this tough but rewarding summer:<br />
<br /><br /><br />
</p><br />
<p class="normal-text"><br />
<b>Dr. Chris French</b> for his support in every step, for teaching us that there are shortcuts in science, for all the work on getting the biobricks right and for so many other things!<br />
<br /><br /><br />
<b>Eugene Fletcher</b> for all the help in the lab and for being our sequencing guru,<br />
<br /><br /><br />
<b>Dr. David Radford</b> for showing us the lawful evil way of doing experiments!<br />
<br /><br /><br />
<b>Dr. Jane Calvert</b> for being an amazing guide in the world of human practices, for being there for us every week, for the enthusiasm and for liking our (sometimes not so good) ideas,<br />
<br /><br /><br />
<b>Dr. Pablo Schyfter</b> for teaching us that you should look at everything from all possible angles, for contradicting Jane and for teaching us to always ask 'Where is the Why?',<br />
<br /><br /><br />
<b>Dr. Louise Horsfall</b> for her very inspiring views on the relationship between the public and science,<br />
<br /><br /><br />
<b>Dr. Claire Marris</b> for giving us food for thought on regulations and legislation,<br />
<br /><br /><br />
<b>John Wilson-Kanamori</b> and <b>Donal Stewart</b> for their help in trying to make some sense of our models,<br />
<br /><br /><br />
<b>Donal Stewart</b> for the nice java tool that helped us visualise the model.<br />
<br /><br /><br />
<b>John Innes</b> for his interesting views on life, the universe and everything and for the stimulating conversations,<br />
<br /><br /><br />
<b>Dr. Wendy Smith</b> for showing us around the Centre for Bacterial Cell Biology and walking us through every step that leads from raw DNA to getting its genome sequence<br />
<br /><br /><br />
<b>Prof. Anil Wipat</b> for showing us what to do with said sequence<br />
<br /><br /><br />
<b>Dr. Bruce Ward</b> and <b>Matthew Knighton</b> for their help with the fuel cells and for lending us their lab equipment.<br />
<br /><br /><br />
<b>Dr. Chris Mowat</b> for his help with haem staining protocol and general advice on work with <i>S. oneidensis</i><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /attributions-middle --><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-useTeam:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use2012-10-26T17:56:56Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#method{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig01, fig02{<br />
width:100%;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation:<br />
<br /><br /><br />
Sugar use<br />
</p><br />
<p class="normal-text"><br />
An ideal chassis should be able to use various sugars as carbon sources. In order to show that <i>C. freundii</i> is capable of using a variety of carbon sources, we have tested its growth on M9 minimal media plates containing different types of sugars. In addition to plates, we have also assessed its growth in liquid media containing these and other sugars.<br />
<br /><br /><br />
While it has not yet been tested by our team, others in the C. French lab has shown that <i>C. freundii</i> grows well on media that contain cellobiose as the sole carbon source, whereas <i>E. coli</i> cannot use cellobiose. Cellobiose is a major component of biomass, so <i>C. freundii</i> can be used well for biomass degradation experiments.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Method <a class="cursor-pointer" onclick="expand('method')">(expand)</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><br />
<i>Small wells were cut in the middle of the plates and 150 μl of 20% sugar solution (glucose, sucrose, lactose, or glycerol) was added to each well. To some plates, powdered sucrose or glucose was added instead. The plates were then streaked with four strains ( E. coli, E. coli + sucrose hydrolase gene, C. freundii NCIMB and C. freundii SBS197) and incubated overnight at 37&deg;C.<br />
<br /><br /><br />
A final test involved adding the various sugars to the M9 medium in the bottle as opposed to either adding it to the plate before pouring the agar on top or adding them into the well on the plate. 5x100ml M9 medium bottles were prepared as before and autoclaved. The sugars (1ml) and thiamine hydrochloride (3.4 ml) were added to the bottles prior to the agar getting poured, with two bottles having no sugar added to them. After the agar had set, the plates were inoculated as before. One of the no sugar plates had solid citrate added to its middle, as before with the solid glucose and sucrose, to test the growth of C. freundii on this medium that gives it its name.<br /><br/><br />
<br />
For the liquid cultures, M9 minimal medium was used, supplemented with various sugars at a 1% final concentration and chloramphenicol20. The bottles were inoculated with cells containing pSB1C3 grown overnight, and incubated overnight at 37&deg;C</i><br />
<a class="cursor-pointer" onclick="collapse('method')">Close the method.</a><br />
<br /><br /><br />
<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Results - Plates<br />
</p><br />
<p class="normal-text"><br />
The results of these experiments can be seen in Figures 1 and 2 below.<br />
<br /><br /><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/4/4a/Lemon-fig05.JPG"><br /><br />
<b>Figure 1</b> - M9 plates with sugars added to wells in the middle of the plates<br />
<br /><br /><br />
<img id="fig02" src="https://static.igem.org/mediawiki/2012/9/99/Lemon-fig06.JPG"><br /><br />
<img id="fig03" src="https://static.igem.org/mediawiki/2012/8/8b/Lemon-fig07.JPG"><br /><br />
<b>Figure 2</b> - Sugars were added to the agar before the plates were poured<br />
<br /><br /><br />
<b>From these results, it can be seen that C. freundii SBS197 grows less well on lactose, sucrose and citrate but both strains grow equally well on glycerol and glucose. </b>The <i>E. coli</i> + sucrose hydrolase cells grew well on sucrose even without there being any arsenic (the inducer of the sucrose hydrolase gene) on the plate. For some reason, all bacteria grew weakly on the lactose plates, this might mean that our lactose stock quality needs to be checked.<br />
</p><br />
<p class="h2"><br />
<a name="liquid-media">Liquid Media</a><br />
</p><br />
<p class="normal-text"><br />
To better quantify <i>Citrobacter freundii</i>’s ability to grow using a variety of carbon sources, we have grown them in M9 minimal medium supplemented with these various sources. The growth results can be seen in Figure 3 below. <br />
<br /><br /><br />
<img id="fig04" src="https://static.igem.org/mediawiki/2012/6/61/EdiGEM-graph.png"><br />
<br /><br />
<b>Figure 3</b> – The growth of <i>Citrobacter freundii</i> using various carbon sources. Bars in blue show OD measured after overnight incubation at 37°C while bars in red show OD measured after incubation for two days at 37°C (these media did not yield significant results after just one day of incubation).<br />
<br /><br /><br />
These results show that <i>Citrobacter freundii</i> can use all but one of the tested sugars as sole carbon sources – the one outlier, xylitol, got us thinking about developing a selectable marker system similar to the sucrose hydrolase system we used for our <i> E. coli </i> cells – one that depends on sugar use. Similarly to how<i> E. coli </i> K12 is unable to use sucrose, <i>Citrobacter freundii</i> cannot grow on xylitol (as shown by our experiments and quoted in Bergey’s Manual of Systematic Bacteriology). We have chosen xylitol as the carbon source for this marker and have developed a theoretical protocol for how the development of such a marker could be done. You can read about it on this <a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase#xylitol ">page</a>.<br /><br /><br />
</p><br />
<p class="normal-text" style="border-top:1px solid #000;"><br />
<i>The RAST Server: Rapid Annotations using Subsystems Technology.</i><br/><br />
Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, Formsma K, Gerdes S, Glass EM, Kubal M, Meyer F, Olsen GJ, Olson R, Osterman AL, Overbeek RA, McNeil LK, Paarmann D, Paczian T, Parrello B, Pusch GD, Reich C, Stevens R, Vassieva O, Vonstein V, Wilke A, Zagnitko O.<br/><br />
<i>BMC Genomics, 2008</i><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/2-Growth-in-sea-salts"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/4-Lac-promoter"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-3 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/5-Genome-sequencingTeam:Edinburgh/Project/Citrobacter-Freundii/5-Genome-sequencing2012-10-26T17:51:50Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation:<br />
<br /><br /><br />
Genome sequencing<br />
</p><br />
<p class="normal-text"><br />
One major advantage of <i>E. coli</i> over <i>C. freundii</i> is the fact that there is a lot of sequence information available on the former, while no whole genome sequences exist for the latter. In order to get the ball rolling, the genomes of two <i>C. freundii</i> strains (the type strain, ATCC 8090 and another strain our lab had, called SBS 197) were sequenced in Newcastle by Drs Wendy Smith and Anil Wipat with IonTorrent Sequencing.<br />
<br /><br /><br />
<span class="intense-emphasis">To the best of our knowledge, no other iGEM projects have yielded genome sequencing data before, so this is a first both for our team, Europe and iGEM in general.</span><br />
<br /><br /><br />
While a complete assembly of the sequence reads could not be done, these sequences constitute the first step towards unraveling the genome of our proposed chassis organism and even in this form they can provide valuable information.<br />
<br /><br /><br />
Since our project was concerned with making synthetic biology safer, we wanted to see whether <i>Citrobacter freundii</i> contains any antibiotic resistance genes in its genome. With the help of the sequencing data (Figure 1), we have found that both strains have got several beta-lactamases encoded within their genomes, which normally confer these bacteria resistance to antibiotics with beta-lactam rings, such as ampicillin.<br />
<br /><br /><br />
<img style="padding-left:100px;" src="https://static.igem.org/mediawiki/2012/a/a6/EdiGEM-Graph3.png"><br />
<br /><br /><br />
Figure 1 – A snapshot of the sequencing reads that covered one of the beta-lactamase regions in <i>Citrobacter freundii</i>, showing good sequence coverage.<br />
<br /><br /><br />
This is a puzzling find, as neither strain shows any resistance to carbenicillin, a synthetic ampicillin analogue. Nonetheless, a lot of gram negative bacteria carry beta-lactamases within their genomes, so even if <i>Citrobacter freundii</i> were released into the environment, it should not lead to an increase in the spread of antibiotic resistance. <br />
<br /><br /><br />
The raw sequencing files (zip files) and the contigs that have been assembled de novo (.fa format) can be accessed at the public <span class="plainlinks"><a href="https://www.dropbox.com/sh/wg3a7jnvsr02hxn/7clt9E1xaS">Dropbox folder</a></span> along with pdf files of the assembly reports. In addition, the automated annotation spread sheets (done by RAST) for both strains can also be accessed from this location.<br />
</p><br />
<p class="h2"><br />
Lac operator sequence analysis<br />
</p><br />
<p class="normal-text"><br />
One possible reason the Lac promoter coupled to our BioBricks is not regulated is because its LacI binding sequence might be different from that of the native <i>Citrobacter freundii</i> operator sequence. To test this, we have done a sequence alignment of the region where we think the <i>Citrobacter freundii</i> operator region might be with the consensus operator sequence in <i>E. coli</i> (5'-T GGAATTGTGAGCGGATAACAATT-3'). The sequence alignment can be seen in Figure 1 below.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/5/59/EdiGEM_-_Graph4.png"><br />
<br /><br />
Figure 1 – Sequence alignment between our <i>Citrobacter freundii</i> sequence and the consensus <i>E. coli</i> operator region sequence<br />
<br /><br /><br />
As it can be seen from this sequence alignment, the <i>Citrobacter freundii</i> sequence, while showing some similarities, is not completely identical to the <i>E. coli </i> consensus sequence, which might be the reason.<br />
We then looked at the sequence of the LacR repressor protein in <i>Citrobacter freundii</i>, as it is known that the N-terminal sequence of this protein is what binds to DNA. We wanted to see whether there are any differences between this protein’s N-terminal sequence and that of <i>E. coli</i> MG1655, the strain that is most often used in iGEM and in labs in general. The protein BLAST results can be seen in Figure 2.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/b/b5/EdiGEM_-_Graph5.png"><br />
<br /><br />
Figure 2 – protein BLAST results showing homology between the <i>Citrobacter freundii</i> (Query) and <i>E. coli </i> <br /><br /><br />
K-12 MG1655 (Subject) Lac repressor protein sequence.<br />
This result shows that the N-terminus of this protein is well conserved between these two organisms, but there are a few differences in amino acids that may account for this protein not being able to regulate a foreign Lac promoter.<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/4-Lac-promoter"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/6-Valencia"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-5 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/4-Lac-promoterTeam:Edinburgh/Project/Citrobacter-Freundii/4-Lac-promoter2012-10-26T17:49:51Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#fig01{<br />
width:100%;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation:<br />
<br /><br /><br />
Lac promoter characterisation<br />
</p><br />
<p class="normal-text"><br />
As the lac promoter is often used in synthetic biology, we wanted to test the its activity out in <i>C. freundii</i> by measuring the fluorescence of the RFP gene tied to this promoter. The reason for doing this is because it is not yet known whether our strain of <i>C. freundii</i> has a lacI gene. If the lacI gene is present on the host’s chromosome, we expect the fluorescence to be much lower when the cells are grown in media that contain no IPTG than in the ones that contain IPTG as the promoter will not be on. If there is no lacI gene, or if the <i>C. freundii</i> lacI cannot inhibit the <i>E. coli</i> Lac promoter, we expect the fluorescence in all 3 bottles will fall into a similar range.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Method<br />
</p><br />
<p class="normal-text"><br />
Three different sets of E. coli and <i>C. freundii</i> containing the pSB1C3 + Plac-RFP plasmid were grown overnight in LB+chloramphenicol, their OD was measured in order to normalize the number of cells and the normalized dilutions were used to inoculate 2.5ml M9 media that contained chloramphenicol and either no IPTG or 1, 2, 3, 4 or 5 &mu;l IPTG. These bottles were then incubated at 37&deg;C for 24 hours. The overnight LB cultures were inoculated into M9 in order to minimize background fluorescence to get clearer results.<br />
<br /><br /><br />
The fluorescence of the cultures was measured just after inoculation (using a green filter with the fluorimeter) and it was fairly even within the two species, averaging 1669.88 FSU for E. coli and 1235.91 FSU for <i>C. freundii</i>. Their fluorescence and OD was again measured after 24 hours in order to quantify RFP expression. These readings were normalized by dividing the fluorescence with the OD and the averages of the three sets were calculated. </p><br />
<p class="h2" style="padding-left:50px;"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/d/d0/Lac_plasmid_ecoli.png"><br /><br />
<b>Figure 1</b> - Graphs showing RFP fluorescence when cells were grown in M9 with or without IPTG<br />
<br /><br /><br />
In Figure 1 above, the peaks that can be seen in <i>C. freundii</i> at 2 and 4 &mu;l IPTG are due very high fluorescence readings in one of the sets, which have skewed these averages somewhat. These results do, however, show that there is a significant difference in RFP expression in <i>E. coli</i> with and without IPTG, while no significant difference in the levels of RFP expression is observable in <i>C. freundii</i>. This confirms that <i>E. coli</i> has got a native LacI protein that represses the Lac promoter on the plasmid. <i>C. freundii</i> may lack a native LacI protein or <i>C. freundii</i> can’t regulate the <i>E. coli</i> Lac promoter, which results in the RFP gene being constitutively expressed in <i>C. freundii</i>.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Genome sequencing<br />
</p><br />
<p class="normal-text"><br />
The genomes of two <i>C. freundii</i> strains (the type strain, ATCC 8090 and another strain our lab had, called SBS 197) were sequenced in Newcastle by Dr Wendy Smith and Prof Anil Wipat with IonTorrent Sequencing. We hoped that these sequences would help elucidate the mystery of the constitutive lac promoter.<br />
<br /><br /><br />
One reason the Lac promoter coupled to our BioBricks is not regulated is because its LacI binding sequence might be different from that of the native <i>Citrobacter freundii</i> operator sequence. To test this, we have done a sequence alignment of the region where we think the <i>Citrobacter freundii</i> operator region might be with the consensus operator sequence in <i>E. coli</i> (5'-T GGAATTGTGAGCGGATAACAATT-3'). The sequence alignment can be seen in Figure 2 below.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/5/59/EdiGEM_-_Graph4.png"><br />
<br /><br />
<b>Figure 2</b> – Sequence alignment between our <i>Citrobacter freundii</i> sequence and the consensus <i>E. coli</i> operator region sequence<br />
<br /><br /><br />
As it can be seen from this sequence alignment, the <i>Citrobacter freundii</i> sequence, while showing some similarities, is not completely identical to the <i>E. coli </i> consensus sequence, which might be the reason.<br />
We then looked at the sequence of the LacR repressor protein in <i>Citrobacter freundii</i>, as it is known that the N-terminal sequence of this protein is what binds to DNA. We wanted to see whether there are any differences between this protein’s N-terminal sequence and that of <i>E. coli</i> MG1655, the strain that is most often used in iGEM and in labs in general. The protein BLAST results can be seen in Figure 3.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/b/b5/EdiGEM_-_Graph5.png"><br />
<br /><br />
<b>Figure 3</b> – protein BLAST results showing homology between the <i>Citrobacter freundii</i> (Query) and <i>E. coli </i> <br /><br /><br />
K-12 MG1655 (Subject) Lac repressor protein sequence.<br />
This result shows that the N-terminus of this protein is well conserved between these two organisms, but there are a few differences in amino acids that may account for this protein not being able to regulate a foreign Lac promoter.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Is an unregulated Plac promoter a bad thing?<br />
</p><br />
<p class="normal-text"><br />
Not necessarily, as regulation can still be obtained if the <i>E. coli</i> <i>lacI</i> gene is supplied in addition to the Plac construct. By controlling LacI expression levels, expression can be controlled without IPTG, as in the repressilator, toggle switch and other devices, without worrying about endogenous LacI activity.<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/5-Genome-sequencing"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-4 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/4-Lac-promoterTeam:Edinburgh/Project/Citrobacter-Freundii/4-Lac-promoter2012-10-26T17:46:04Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#fig01{<br />
width:100%;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation:<br />
<br /><br /><br />
Lac promoter characterisation<br />
</p><br />
<p class="normal-text"><br />
As the lac promoter is often used in synthetic biology, we wanted to test the its activity out in <i>C. freundii</i> by measuring the fluorescence of the RFP gene tied to this promoter. The reason for doing this is because it is not yet known whether our strain of <i>C. freundii</i> has a lacI gene. If the lacI gene is present on the host’s chromosome, we expect the fluorescence to be much lower when the cells are grown in media that contain no IPTG than in the ones that contain IPTG as the promoter will not be on. If there is no lacI gene, or if the <i>C. freundii</i> lacI cannot inhibit the <i>E. coli</i> Lac promoter, we expect the fluorescence in all 3 bottles will fall into a similar range.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Method<br />
</p><br />
<p class="normal-text"><br />
Three different sets of E. coli and <i>C. freundii</i> containing the pSB1C3 + Plac-RFP plasmid were grown overnight in LB+chloramphenicol, their OD was measured in order to normalize the number of cells and the normalized dilutions were used to inoculate 2.5ml M9 media that contained chloramphenicol and either no IPTG or 1, 2, 3, 4 or 5 &mu;l IPTG. These bottles were then incubated at 37&deg;C for 24 hours. The overnight LB cultures were inoculated into M9 in order to minimize background fluorescence to get clearer results.<br />
<br /><br /><br />
The fluorescence of the cultures was measured just after inoculation (using a green filter with the fluorimeter) and it was fairly even within the two species, averaging 1669.88 FSU for E. coli and 1235.91 FSU for <i>C. freundii</i>. Their fluorescence and OD was again measured after 24 hours in order to quantify RFP expression. These readings were normalized by dividing the fluorescence with the OD and the averages of the three sets were calculated. </p><br />
<p class="h2" style="padding-left:50px;"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/d/d0/Lac_plasmid_ecoli.png"><br /><br />
<b>Figure 1</b> - Graphs showing RFP fluorescence when cells were grown in M9 with or without IPTG<br />
<br /><br /><br />
In Figure 1 above, the peaks that can be seen in <i>C. freundii</i> at 2 and 4 &mu;l IPTG are due very high fluorescence readings in one of the sets, which have skewed these averages somewhat. These results do, however, show that there is a significant difference in RFP expression in <i>E. coli</i> with and without IPTG, while no significant difference in the levels of RFP expression is observable in <i>C. freundii</i>. This suggests that <i>E. coli</i> has got a native LacI gene that represses the Lac promoter on the plasmid, while <i>C. freundii</i> lacks a native LacI gene, or that <i>C. freundii</i> can’t regulate the <i>E. coli</i> Lac promoter, which results in the RFP gene being constitutively expressed in <i>C. freundii</i>.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Genome sequencing<br />
</p><br />
<p class="normal-text"><br />
The genomes of two <i>C. freundii</i> strains (the type strain, ATCC 8090 and another strain our lab had, called SBS 197) were sequenced in Newcastle by Dr Wendy Smith and Prof Anil Wipat with IonTorrent Sequencing. We hoped that these sequences would help elucidate the mystery of the constitutive lac promoter.<br />
<br /><br /><br />
One reason the Lac promoter coupled to our BioBricks is not regulated is because its LacI binding sequence might be different from that of the native <i>Citrobacter freundii</i> operator sequence. To test this, we have done a sequence alignment of the region where we think the <i>Citrobacter freundii</i> operator region might be with the consensus operator sequence in <i>E. coli</i> (5'-T GGAATTGTGAGCGGATAACAATT-3'). The sequence alignment can be seen in Figure 2 below.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/5/59/EdiGEM_-_Graph4.png"><br />
<br /><br />
<b>Figure 2</b> – Sequence alignment between our <i>Citrobacter freundii</i> sequence and the consensus <i>E. coli</i> operator region sequence<br />
<br /><br /><br />
As it can be seen from this sequence alignment, the <i>Citrobacter freundii</i> sequence, while showing some similarities, is not completely identical to the <i>E. coli </i> consensus sequence, which might be the reason.<br />
We then looked at the sequence of the LacR repressor protein in <i>Citrobacter freundii</i>, as it is known that the N-terminal sequence of this protein is what binds to DNA. We wanted to see whether there are any differences between this protein’s N-terminal sequence and that of <i>E. coli</i> MG1655, the strain that is most often used in iGEM and in labs in general. The protein BLAST results can be seen in Figure 3.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/b/b5/EdiGEM_-_Graph5.png"><br />
<br /><br />
<b>Figure 3</b> – protein BLAST results showing homology between the <i>Citrobacter freundii</i> (Query) and <i>E. coli </i> <br /><br /><br />
K-12 MG1655 (Subject) Lac repressor protein sequence.<br />
This result shows that the N-terminus of this protein is well conserved between these two organisms, but there are a few differences in amino acids that may account for this protein not being able to regulate a foreign Lac promoter.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Is an unregulated Plac promoter a bad thing?<br />
</p><br />
<p class="normal-text"><br />
Not necessarily, as regulation can still be obtained if the <i>E. coli</i> lacI gene is supplied in addition to the Plac construct. By controlling lacI expression levels, expression can be controlled without IPTG, as in the repressilator, toggle switch and other devices, without worrying about endogenous lacI.<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/5-Genome-sequencing"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-4 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/File:Lac_plasmid_ecoli.pngFile:Lac plasmid ecoli.png2012-10-26T17:44:58Z<p>RNagy: uploaded a new version of &quot;File:Lac plasmid ecoli.png&quot;</p>
<hr />
<div></div>RNagyhttp://2012.igem.org/File:Lac_plasmid_ecoli.pngFile:Lac plasmid ecoli.png2012-10-26T17:43:44Z<p>RNagy: </p>
<hr />
<div></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-useTeam:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use2012-10-26T17:31:34Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#method{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig01, fig02{<br />
width:100%;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation:<br />
<br /><br /><br />
Sugar use<br />
</p><br />
<p class="normal-text"><br />
An ideal chassis should be able to use various sugars as carbon sources. In order to show that <i>C. freundii</i> is capable of using a variety of carbon sources, we have tested its growth on M9 minimal media plates containing different types of sugars. In addition to plates, we have also assessed its growth in liquid media containing these and other sugars.<br />
<br /><br /><br />
While it has not yet been tested by our team, others in the C. French lab has shown that <i>C. freundii</i> grows well on media that contain cellobiose as the sole carbon source, whereas <i>E. coli</i> cannot use cellobiose. Cellobiose is a major component of biomass, so <i>C. freundii</i> can be used well for biomass degradation experiments.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Method <a class="cursor-pointer" onclick="expand('method')">(expand)</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><br />
<i>Small wells were cut in the middle of the plates and 150 μl of 20% sugar solution (glucose, sucrose, lactose, or glycerol) was added to each well. To some plates, powdered sucrose or glucose was added instead. The plates were then streaked with four strains ( E. coli, E. coli + sucrose hydrolase gene, C. freundii NCIMB and C. freundii SBS197) and incubated overnight at 37&deg;C.<br />
<br /><br /><br />
A final test involved adding the various sugars to the M9 medium in the bottle as opposed to either adding it to the plate before pouring the agar on top or adding them into the well on the plate. 5x100ml M9 medium bottles were prepared as before and autoclaved. The sugars (1ml) and thiamine hydrochloride (3.4 ml) were added to the bottles prior to the agar getting poured, with two bottles having no sugar added to them. After the agar had set, the plates were inoculated as before. One of the no sugar plates had solid citrate added to its middle, as before with the solid glucose and sucrose, to test the growth of C. freundii on this medium that gives it its name.<br /><br/><br />
<br />
For the liquid cultures, M9 minimal medium was used, supplemented with various sugars at a 1% final concentration and chloramphenicol20. The bottles were inoculated with cells containing pSB1C3 grown overnight, and incubated overnight at 37&deg;C</i><br />
<a class="cursor-pointer" onclick="collapse('method')">Close the method.</a><br />
<br /><br /><br />
<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Results - Plates<br />
</p><br />
<p class="normal-text"><br />
The results of these experiments can be seen in Figures 1 and 2 below.<br />
<br /><br /><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/4/4a/Lemon-fig05.JPG"><br /><br />
<b>Figure 1</b> - M9 plates with sugars added to wells in the middle of the plates<br />
<br /><br /><br />
<img id="fig02" src="https://static.igem.org/mediawiki/2012/9/99/Lemon-fig06.JPG"><br /><br />
<img id="fig03" src="https://static.igem.org/mediawiki/2012/8/8b/Lemon-fig07.JPG"><br /><br />
<b>Figure 2</b> - Sugars were added to the agar before the plates were poured<br />
<br /><br /><br />
<b>From these results, it can be seen that C. freundii SBS197 grows less well on lactose, sucrose and citrate but both strains grow equally well on glycerol and glucose. </b>The <i>E. coli</i> + sucrose hydrolase cells grew well on sucrose even without there being any arsenic (the inducer of the sucrose hydrolase gene) on the plate. For some reason, all bacteria grew weakly on the lactose plates, this might mean that our lactose stock quality needs to be checked.<br />
</p><br />
<p class="h2"><br />
<a name="liquid-media">Liquid Media</a><br />
</p><br />
<p class="normal-text"><br />
To better quantify <i>Citrobacter freundii</i>’s ability to grow using a variety of carbon sources, we have grown them in M9 minimal medium supplemented with these various sources. The growth results can be seen in Figure 3 below. <br />
<br /><br /><br />
<img id="fig04" src="https://static.igem.org/mediawiki/2012/6/61/EdiGEM-graph.png"><br />
<br /><br />
<b>Figure 3</b> – The growth of <i>Citrobacter freundii</i> using various carbon sources. Bars in blue show OD measured after overnight incubation at 37°C while bars in red show OD measured after incubation for two days at 37°C (these media did not yield significant results after just one day of incubation).<br />
<br /><br /><br />
These results show that <i>Citrobacter freundii</i> can use all but one of the tested sugars as sole carbon sources – the one outlier, xylitol, got us thinking about developing a selectable marker system similar to the sucrose hydrolase system we used for our <i> E. coli </i> cells – one that depends on sugar use. Similarly to how<i> E. coli </i> K12 is unable to use sucrose, <i>Citrobacter freundii</i> cannot grow on xylitol (as shown by our experiments and quoted in Bergey’s Manual of Systematic Bacteriology). We have chosen xylitol as the carbon source for this marker and have developed a theoretical protocol for how the development of such a marker could be done. You can read about it on this <a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase#xylitol ">page</a>.<br /><br /><br />
</p><br />
<p class="normal-text" style="border-top:1px solid #000;"><br />
<b>Noel R. Krieg, ed.,</b> 1984. <i>Bergey’s Manual of Systematic Bacteriology.</i> Vol. 2 (2nd ed.). The Williams & Wilkins Co., Baltimore<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/2-Growth-in-sea-salts"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/4-Lac-promoter"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-3 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/2-Growth-in-sea-saltsTeam:Edinburgh/Project/Citrobacter-Freundii/2-Growth-in-sea-salts2012-10-26T17:30:03Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#failure-methods{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig01{<br />
width:600px;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation:<br />
<br /><br /><br />
Growth in sea salts<br />
</p><br />
<p class="normal-text"><br />
Since synthetic biology is a rapidly developing field, we think that it will see a lot of innovation in the years to come. We also think that the use of fresh water for large scale experiments and industrial applications will eventually become limited as fresh water supplies will be scarce, or salt water will be more accessible to people. This is why we think that a novel chassis should be able to grow in seawater/salt water. The following experiments serve to characterize the ability of <i>Citrobacter</i> to grow in water containing varying concentrations of sea salts. Note that the average salt concentration of seawater is between 20 and 40 g/l.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Methods <a class="cursor-pointer" onclick="expand('failure-methods')">(expand)</a><br /><br />
</p><br />
<p class="normal-text"><br />
<span class="intense-emphasis"><br />
As we have mentioned previously, we urge everyone to talk about their failed experiments, as if nobody talks about them, a lot of time could be wasted by different people trying to do the same thing to no avail. As such, the following experiments can be considered an example of how we started out with a failure but then modified the circumstances to get meaningful results.</span><br />
</p><br />
<p class="normal-text" id="failure-methods"><br />
<br /><br />
<i>1.1 First, we wanted to asses growth of <i>C. freundii</i> on media plates. For this purpose, M9 minimal medium was made up, using glucose as a carbon source, and varying amounts of sea salts were added to these media. Unfortunately, at higher (>40g/l) sea salt concentrations, the agar did not solidify so growth above this concentration could not be assessed. The plates that did solidify had 100 &mu;l <i>C. freundii</i> spread on them and were put into the 37&deg;C incubator overnight.<br />
<br /><br /><br />
1.2 Liquid M9 medium was then made up using varying amounts of sea salts. These media were not clear as expected but what whitish precipitates floating in the medium, so we speculate that the M9 salts did not react well to the presence of sea salts. The precipitate is probably magnesium and calcium phosphate, as M9 is very high in phosphates. Nonetheless, we inoculated these bottles with overnight cultures (grown in LB) to see if any growth would occur. After overnight incubation at 37&deg;C on a shaker, the ODs were measured (using the appropriate sea salt concentration M9 as blank for each culture to prevent interference of the precipitate with the readings).<br />
<br /><br /><br />
1.3 Next, LB medium was made up, using yeast extract (5g/l) and tryptone (10g/l) and varying concentrations of sea salts (replacing the normal NaCl). These bottles of media were inoculated with overnight cultures, incubated overnight at 37&deg;C with shaking and the ODs measured as described above.<br />
<br /><br /><br />
1.4 Finally, we wanted to compare the ability of <i>C. freundii</i> to grow in the presence in sea salts with that of <i>E. coli</i>, so we set up 250ml flasks with 25ml of LB or LB with 40g/l sea salts, inoculated them with overnight cultures of E. coli MG1655 or <i>C. freundii</i> and measured OD every 30 minutes over the course of a day.<br /></i><br />
<a class="cursor-pointer" onclick="collapse('failure-methods')">Close the method.</a><br />
<br /><br /><br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
<b>1.1</b> All the plates that were inoculated showed a lawn of cells, suggesting that <i>C. freundii</i> can grow well in the presence of sea salts. Unfortunately, the sea salts + M9 salts formed a white precipitate, so the plates could not be photographed in a way that would actually show that there were cells growing on them.<br />
<br /><br /><br />
<b>1.2</b> A graph showing the OD readings taken from bottles of M9 + varying concentrations of sea salts can be seen in Figure 1.<br />
<br /><br /><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/3/32/Lemon-fig02.JPG"><br /><br />
<b>Figure 1</b> - <i>C. freundii</i> growth in M9 minimal medium + varying concentrations of sea salts<br />
<br /><br /><br />
These results show that <i>C. freundii</i> does not grow well in minimal medium + sea salts, as the OD keeps decreasing as the concentration of sea salts increases.<br />
<br /><br /><br />
<b>1.3</b> A graph showing the OD readings taken from bottles of LB + varying concentrations of sea salts incubated with <i>C. freundii</i> overnight can be seen in Figure 2.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/f/f6/Lemon-fig03.JPG"><br /><br />
<b>Figure 2</b> - <i>C. freundii</i> growth in LB + varying concentrations of sea salts<br />
<br /><br /><br />
These results show that <i>C. freundii</i> can happily grow in LB + sea salts even when the salt concentration is higher than that of most seawaters. Concentrations of 10-20g/l seem to be more optimal but an OD above 1.8 is maintained throughout. This suggests that our novel chassis would indeed be able to be grown without having to waste freshwater on it.<br />
<br /><br /><br />
<b>1.4</b> Figure 3 shows the OD readings taken every 30 minutes from flasks containing either LB or LB + sea salts inoculated with either <i>E. coli</i> or <i>C. freundii.</i><br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/c/c8/Lemon-fig04.JPG"><br /><br />
<b>Figure 3</b> - <i>C. freundii</i> and <i>E. coli</i> growth over time in either LB or LB with sea salts<br />
<br /><br /><br />
<b>These results show that <i>C. freundii</i> can grow with and without sea salts at a similar rate to <i>E. coli</i>, so there would be no hindrance in using <i>C. freundii</i> for synthetic biology (and any biology) work over <i>E. coli</i> in sea salt medium.</b><br />
</p><br />
<p class="h2"><br />
Conclusions<br />
</p><br />
<p class="normal-text"><br />
<ul style="list-style-type:circle;padding:10px;"><br />
<li>We extensively characterized the ability of <i>Citrobacter freundii</i> to grow in the presence of various concentrations of sea salts, both on plates and in liquid media<br /><br /></li><br />
<li>We turned a failure (M9 liquid media) into a success <br /><br /></li><br />
<li>We assessed the growth rate of <i>Citrobacter freundii</i> and <i>E. coli</i> in 40g/l sea salt concentration media <br /><br /></li><br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/1-Replicon-compatibility"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-2 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/1-Replicon-compatibilityTeam:Edinburgh/Project/Citrobacter-Freundii/1-Replicon-compatibility2012-10-26T17:25:13Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#table02-method{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig01,#table02{<br />
width:100%;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation:<br />
<br /><br /><br />
Replicon compatibility<br />
</p><br />
<p class="normal-text"><br />
To even consider a new chassis for synthetic biology (and especially iGEM), it should first of all be able to replicate the various types of plasmids that are used to insert genes/BioBricks into it. To test this, our <i>C. freundii</i> was transformed with several plasmids containing the most commonly used replicons. The transformations were done according to standard protocol written for <i> E. coli </i> and the transformants were plated out onto media as indicated in Table 1 and shown in Figure 1.<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/3/38/Lemon-table01.JPG"><br /><br />
<b>Table 1</b> - Replicon compatibility media and results<br /><br /><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/7/7c/Lemon-fig01.JPG"><br /><br />
<b>Figure 1</b> - Plates containing <i>E. coli</i> or <i>Citrobacter freundii</i> transformed with plasmids that have different replicons. Note that the top row shows <i>Citrobacter freundii</i> cells and the bottom row shows <i>E. coli</i> cells, except for the first plates in each row, which are switched around, for colour comparison.<br />
<br /><br /><br />
<b>These results show that all but one of the plasmids have successfully been transformed into both <i>E. coli</i> and <i>C. freundii</i>, therefore these replicons are compatible with <i>C. freundii</i>.</b><br />
<br /><br /><br />
<i>C. freundii</i> cells with the multi-host plasmid (pTG262) did not grow at all. The most probable reason is that the <i>cmlR</i> gene (which confers chloramphenicol resistance) in pTG262 is a Gram positive one (from <i>Lactobacillus</i>) which works much less well even in <i>E. coli</i> than the standard iGEM <i>cmlR</i> gene, so if <i>C. freundii</i> is a little more chloramphenicol-sensitive or expresses it a little worse, it would explain why no growth was seen on this plate.<br/><br />
<br /><br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
pTG262 characterisation<br />
</p><br />
<p class="normal-text"><br />
One reason why the <i>C. freundii</i> cell transformed with pTG262 did not grow may be that the <i>C. freundii</i> cells are less resistant to chloramphenicol than <i>E. coli</i>, so they were plated onto plates with varying concentrations of chloramphenicol (Table 2) to see whether they grow at all. pSB2K3 was used as a negative control, as it does not have chloramphenicol resistance.<br /><br /><br />
<img id="table02" src="https://static.igem.org/mediawiki/2012/b/be/Lemon-table02.JPG"><br /><br />
<b>Table 2</B> - Table indicating the amount of chloramphenicol added to each (20ml) plate.<br /><br />
<a class="cursor-pointer" onclick="expand('table02-method')">Method</a><br />
</p><br />
<p class="normal-text" id="table02-method"><br />
<br /><br />
<i>The plates were incubated for two days and growth was observed on the 5 and 10 μl chloramphenicol plates. In order to assess whether growth on these plates was due to the activity of the resistance gene on the plasmid or due to some innate resistance to chloramphenicol, 20 μl of C. freundii containing the plasmid or 20 μl untransformed C. freundii were plated out onto LB agar containing 5, 6, 7, 8, 9 or 10 μl chloramphenicol and incubated at 37&deg;C overnight.</i><br />
<a class="cursor-pointer" onclick="collapse('table02-method')">Close the method.</a><br />
<br /><br /><br />
</p><br />
<p class="normal-text"><br />
The <i>C. freundii</i> + pTG262 plasmid grew on all plates to some extent whereas the no plasmid control grew only below 8 &mu;l chloramphenicol and there were fewer colonies on the plates compared to the <i>C. freundii</i> + pTG262. This suggests that the plasmid works, but very weakly.<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<p class="h2"><br />
Conclusions<br />
</p><br />
<p class="normal-text"><br />
<ul style="list-style-type:circle;padding:10px;"><br />
<li>We characterised the compatibility of <i>Citrobacter freundii</i> with the major replicon types used by iGEM<br /><br /></li><br />
<li>We extensively characterized the pTG262 plasmid to figure out why it was not working well in <i>Citrobacter freundii</i><br /><br /></li><br />
<li>We have concluded that the other replicons are compatible with this organism<br /><br /></li><br />
<br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/0-Introduction"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/2-Growth-in-sea-salts"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-1 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Gene-replacement-strategyTeam:Edinburgh/Project/Non-antibiotic-Markers/Gene-replacement-strategy2012-10-26T17:21:02Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#pSB1C3-primers,<br />
#pSB1C3-seq,<br />
#pSB1C3-method,<br />
#Plac-lacZ-method,<br />
#PstI{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig1, #fig2, #fig3,<br />
#fig4, #fig5, #fig6{<br />
height:0px;<br />
margin:5px;<br />
}<br />
#fig1, #fig3{<br />
margin-left:240px;<br />
}<br />
#fig2, #fig5, #fig6{<br />
margin-left:300px;<br />
}<br />
#fig4{<br />
margin-left:310px;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'pSB1C3-method'){<br />
document.getElementById('fig1').style.height="auto";<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
if(x == 'Plac-lacZ-method'){<br />
document.getElementById('fig3').style.height="auto";<br />
document.getElementById('fig4').style.height="auto";<br />
document.getElementById('fig5').style.height="auto";<br />
document.getElementById('fig6').style.height="auto";<br />
}<br />
if(x == 'PstI'){<br />
document.getElementById('fig7').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'pSB1C3-method'){<br />
document.getElementById('fig1').style.height="0px";<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
if(x == 'Plac-lacZ-method'){<br />
document.getElementById('fig3').style.height="0px";<br />
document.getElementById('fig4').style.height="0px";<br />
document.getElementById('fig5').style.height="0px";<br />
document.getElementById('fig6').style.height="0px";<br />
}<br />
if(x == 'PstI'){<br />
document.getElementById('fig7').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Two-step protocol for gene replacement using a selection-counterselection cassette<br />
</p><br />
<p class="normal-text"><br />
This protocol is useful if you want to replace a gene X with another gene Y. The example used here will detail the replacement of the <i> Citrobacter freundii </i> cephalosporinase gene with the limonene synthase gene, what makes our cells less antibiotic resistant and more citrus-scented (Figure 1). The idea was pioneered by Edinburgh's 2010 iGEM team - you can read more about their BRIDGE (BioBrick Recombination In Direct Genomic Editing) project <br />
<a href="https://2010.igem.org/Team:Edinburgh/Project/Protocol">here</a><br /><br /><br />
<img style="width:70%;padding-left:15%;" src="https://static.igem.org/mediawiki/2012/4/48/EdiGEM_-_Graph2.png"><br />
<br /><br /><br />
Figure 1: Two-step gene replacement strategy, simplified schematic.<br />
<br /><br /><br />
<ol style="text-align:justify;"><br />
<li> The first step in the process is creating homology arms by PCR for the selection-counterselection cassette that are homologous to the regions flanking the cephalosporinase gene. The arm upstream of the cassette should have an EcoRI site at its 5’ end and the arm downstream of the cassette should have a PstI site at its 3’ end.<br /><br /></li><br />
<li> The upstream arm can then be digested with EcoRI and the downstream arm with PstI and these can then be ligated to the selection-counterselection cassette that was digested with both enzymes.<br /><br /></li><br />
<li> A PCR using the outer primer pair should next be done to generate lots of a single linear product containing all three components (the upstream arm + cassette + downstream arm).<br /><br /></li><br />
<li> Cells should first be transformed with a lambda red plasmid such as pSC101-gbaA (commercially available from GeneBridges http://www.genebridges.com/). This plasmid allows the cell to take up linear pieces of DNA without degrading them.<br /><br /></li><br />
<li> They can then be transformed with this linear piece of DNA and hopefully some of them will undergo homologous recombination, cutting out the cephalosporinase gene and replacing it with the selection-counterselection cassette. After this step, the cells should be plated onto a kanamycin-containing medium to <i>select</i> for the cells that have taken up the cassette.<br /><br /></li><br />
<li> The second step involves the replacement of this cassette with the limonene synthase gene – the cells that have grown on the kanamycin plate should be transformed with single stranded DNA containing the appropriate upstream arm + limonene synthase (or any other BioBrick) + downstream arm. Again, in some of the cells homologous recombination will cause the excision of the cassette and insertion of the limonene synthase gene into the vacated region.<br /><br /></li><br />
<li> This time, in order to select for the cells that have lost the cassette (<i> counter-select </i> for the cells that have the cassette), they should be plated out onto media that contain sucrose – cells that can grow on this medium (and are not red) have lost the levansucrase gene, and so the cassette, and are therefore good candidates for having had the cephalosporinase gene replaced by the limonene synthase gene.<br /><br /></li><br />
<li> Finally, grow the cells at a non-permissive temperature to remove the lambda red plasmid and enjoy your lemon-scented cells!</li><br />
</ol><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacB"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/0-Introduction"><span class="intense-emphasis">Next&gt;&gt;</span></a></span><br />
<br /><br /><br />
</p><br />
<br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-gene-rep{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacBTeam:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacB2012-10-26T17:15:26Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#plasmid,<br />
#method,<br />
#sequencing{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig17,<br />
#fig18,<br />
#fig19{<br />
height:0px;<br />
margin:5px;<br />
}<br />
#fig20,<br />
#fig21,<br />
#fig22{<br />
width:100%;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="auto";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="auto";<br />
document.getElementById('fig19').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="0px";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="0px";<br />
document.getElementById('fig19').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Levansucrase <i>(sacB) </i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
SacB is the levansucrase enzyme from <i>Bacillus subtilis</i> <a href="#bibliography" onclick="expand('works-cited');">(Gay, Coq, Strinmetz, Ferrari, & Hoch, 1983)</a> which converts sucrose into fructose polymers which are lethal to <i>Esherichia coli</i> <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. This part was deposited into the Registry by Team Edinburgh 2010 and can be used as a counter selectable marker <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. Our aim is to improve the part by assessing its counter selection efficiency.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="normal-text"><br />
The plac-RFP fragment was obtained from the standard BioBrick <a class="cursor-pointer" onclick="expand('plasmid');">plasmid</a> and inserted in front of the sacB BioBrick. <a class="cursor-pointer" onclick="expand('method');">Method</a>. The construct was confirmed with <a class="cursor-pointer" onclick="expand('sequencing');">sequencing</a>.<br />
</p><br />
<p class="normal-text" id="plasmid"><br />
<br /><i>PCR of pSB1K3 plasmid (Kanamycin resistance) with psBNX3 insF2 forward primer (specific for BioBrick prefix) and dsred r2 reverse primer (specific for RFP) was prepared in order to obtain the plac-RFP fragment.</i><br /><br />
<img id="fig17" src="https://static.igem.org/mediawiki/2012/3/3b/Markers-fig17.JPG"><br /><br />
<i><b>Figure 1</b>: DNA gel of the PCR product from pSB1K3 amplification with primers specific to the BioBrick prefix and RFP. The band is abound 1 kb which corresponds to the expected size of plac-RFP.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('plasmid');">Close the plasmid.</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><i>The plac-RFP PCR product was purified and digested with EcoRI HF and SpeI. The <i>sacB</i> BioBrick deposited in 2010 <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a> was digested with EcoRI and XbaI. These were ligated together after purification. <i>E.coli</i> cells were transformed with the ligation. The red transformants were minipreped, digested with EcoRI HF in order to linearise them and with EcoRI HF and PstI in order to check the size of the insert.</i><br /><br />
<img id="fig18" src="https://static.igem.org/mediawiki/2012/4/4c/Markers-fig18.JPG"><br /><br />
<i><b>Figure 2:</b> DNA gel of miniprepped red clones of linearized plac-RFP-SacB ligation transformants. The band is around 4.5 kb which corresponds to pSB1C3 (2kb)+ +</i><br /><br />
<img id="fig19" src="https://static.igem.org/mediawiki/2012/1/10/Markers-fig19.JPG"><br /><br />
<i><b>Figure 3:</b> The same clones were digested with EcoRI HF and PstI to check the size of the insert. The band is around 2.5 kb which corresponds to SacB (1.5 kb)+ plac-rfp (1kb).</i><br /><br />
<a class="cursor-pointer" onclick="collapse('method');">Close the method.</a><br /><br />
</p><br />
<p class="normal-text" id="sequencing"><br />
<br /><i>Sequencing results<br />Forward primer:<br /><br />
Ctttaaaaaaaatcccttagctttcgctaaggtgatttctggaattcgcggccgcttctagagcaatac<br />
gcaaaccgtttcaccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactgga<br />
aagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacact<br />
ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagataaaga<br />
ggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcttatgga<br />
aggttccgttaactgtcactagttcgaaatcgaaggtgaatgtgaaggtcgtccgtactaaggtaccca<br />
gactgctaaactgaaagttactaaag<br />
<br /><br /><br />
Reverse primer:<br /><br />
aggggccttaaacataaacttttcggttttagaaaagggcagggtggtgacaccttgcccttttttgcc<br />
ggactgcagctactagtaatttatttgttaactgttaattgtccttgttcaaggatgctgtctttgaca<br />
acagatgttttcttgcctttgatgttcagcaggaagcttggcgcaaacgttgattgtttgtctgcgtaa<br />
aatcctctgtttgtcatatagcttgtaatcacgacattgtttcctttcgcttgaggtacagcgaagtgt<br />
gagtaattaaaggttacatcgttaggatcaagatccatttttaacacatggcctgttttgttcagcggc<br />
ttgtatgggccatttaaagaattagaaactttaccaagcatgttaatatcgttagacttatttccgtca<br />
atccttatttttgatccgcgggagtcatttaacaggtaccatttgccgttcattttattttcgttcgcg<br />
cgtctatttctttttgttactttgttttatgcaatcacgttttcattccttttttaattttgtatcatcgt</i><br /><br />
<a class="cursor-pointer" onclick="collapse('sequencing');">Close the sequencing results.</a><br /><br />
</p><br />
<p class="normal-text"><br />
<br />The idea of placing <i>sacB</i> under the control of the lac promoter is to create kanamycin-independent control. Moreover, by changing the IPTG levels, the level of selection can be controlled.<br />
<br /><br /><br />
One of the weaknesses of <i>sacB</i> selection often mentioned in the literature is that sacB loss-of-function mutants also survive, and this may occur at higher frequency than loss of the cassette. RFP is added to ensure that cells which have lost the cassette (should be white because of loss of RFP) can be distinguished from cells which have lost SacB function (should be red as RFP is still present). This would allow us to assess the counter-selection efficiency of SacB.<br /><br />
We also prepared a Kan-plac-RFP-sacB selection-counterselection cassette. <br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="normal-text"><br />
The growth of SacB (bottom) and a control (top) were tested by adding 1.3 g solid sucrose plus 0.5 ml sterile water into a well in the middle of the plate, as shown in Figure 4 below.. <br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/7/79/SAM_3111.JPG"><br /><br />
<b>Figure 4</b>: A quick test of SacB transformants' growth in the presence of sucrose. The growth of SacB (bottom) is inhibited near the well in comparison to the control (top). <br />
</p><br />
<p class="h3"><br />
<i>Citrobacter freundii</i><br />
</p><br />
<p class="normal-text"><br />
<i>SacB</i> and control (pSB1C3 only) transformants were streaked onto LB plates (with either cml40 or cml15) and solid sucrose was added to the regions indicated by the crosses or circles in Figure 5. The plates were incubated at 37&deg;C overnight.<br />
<br /><br /><br />
<img id="fig20" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114357.jpg" border="0"/><br />
<br /><br />
<b>Figure 5</b>: A quick test of <i>sacB</i> and control’s ability to grow in the presence of sucrose. The zone of clearance indicates that the cells containing <i>sacB</i> are inhibited by sucrose while the controls are unaffected. The control on the plate on the right is purple due to both expressing the RFP gene and turning blue because of the X-gal on the plate.<br />
<br /><br /><br />
The bottom streak on plate on the left in Figure 5 contains cells that have the selection-counterselection cassette so this test shows that the counterselection component of the cassette is working. <br />
<br /><br /><br />
We also tested the selection component of this cassette by streaking the cells onto plates containing both chloramphenicol and kanamycin and incubated overnight. These results can be seen in Figure 6.<br />
<br /><br /><br />
<img id="fig21" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114629.jpg" border="0"/><br />
<br /><br />
<b>Figure 6:</b> Plate showing that the kanamycin resistance component of the selection-counterselection cassette works. The control did not grow at all, even after 4 days, as it was inhibited by the kanamycin, while the cells containing the cassette show growth. Growth is weaker because we have found that using the concentration of chloramphenicol we normally use (cml40) in combination with the sacB in <i>Citrobacter freundii</i> causes slower growth, presumably because levansucrase expression is unregulated in these bacteria which puts a strain on the cell.<br />
</p><br />
<p class="h3"><br />
Sugar-dependent selection-counterselection cassette concept<br />
</p><br />
<p class="normal-text"><br />
The reason we did not use our sucrose hydrolase gene for the selection component of the selection-counterselection cassette was because both it and levansucrase depend on the same substrate – sucrose – for their function, so this would have not yielded good results.<br />
<br /><br /><br />
We have found that <i> Citrobacter freundii </i> can use sucrose as a sole carbon source without the need for the sucrose hydrolase gene – this means that if we want to develop a non-antibiotic resistance-dependent selection-counterselection cassette for this organism, we need to use a different sugar. One sugar that, according to our findings, <i>Citrobacter freundii </i> cannot use is xylitol – see our ‘Xylitol dehydrogenase’ section for more details on this. We could therefore combine this gene with the levansucrase gene to obtain an antibiotic resistance-independent selection-counterselection cassette that dependent entirely on sugars.<br />
</p><br />
<p class="h3"><br />
Levans<br />
</p><br />
<p class="normal-text"><br />
We have found that under sublethal doses of sucrose, the <i>E. coli </i> cells start to secrete a lot of gloopy substance, which we believe to be levans (Figure 7), the fructose polymers formed because of the levansucrase activity. <br />
<br /><br /><br />
<img id="fig22" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121018_132400.jpg" border="0"/><br />
<br /><br />
<b>Figure 7:</b> Secretion of levans outside of the cell – it is only present on the lower two colonies but is absent in the two controls above.<br />
<br /><br /><br />
We find this important to mention, as levans have got several applications in various fields <a href="#bibliography" onclick="expand('works-cited');">(Kang <i>et al.</i>, 2009)</a>.<br />
<br /><br /><br />
<ul id="list"><br />
<li>Food<br />
<ul><br />
<li>has prebiotic effects</li><br />
<li>provides dietary fibres</li><br />
<li>reduces serum cholesterol levels </li><br />
<li>it can be used as a food additive in the following ways: a stabilizer, an emulsifier, a formulation aid, surface-finishing agent, an encapsulating agent, and a carrier of flavours and fragrances </li><br />
</ul><br />
</li><br />
<li>Pharmaceutical industry <br />
<ul><br />
<li>can be used as a coating material for drugs </li><br />
<li>has anti-tumour properties <i>in vitro</i></li><br />
<li>can be used as a blood plasma volume expander</li><br />
<li>has anti-diabetic effects <a href="#bibliography" onclick="expand('works-cited');">(Dahech <i>et al.</i>, 2011)</a></li><br />
<li>levan derivatives are shown to be anti-AIDS agents</li><br />
</ul><br />
</li><br />
<li>Cosmetics<br />
<ul><br />
<li>good as a cell-proliferating agent</li><br />
<li>skin moisturising agent</li><br />
<li>reduces skin irritation</li><br />
</ul><br />
</li><br />
<li>Industry<br />
<ul><br />
<li>it can be used in a two-phase liquid good for the separation of biological samples</li><br />
<li>it can be used an environmentally friendly adhesive</li><br />
<li>it can be used as a temporary adhesive in water-soluble form</li><br />
<li>it can be used as a water-resistant adhesive for a long period of time in cross-linked form</li><br />
<li>it can form a water-resistant film</li><br />
<li>it acts as a cryoprotectant for the preservation of animal cells and fish</li><br />
</ul><br />
</li><br />
</ul><br />
</p><br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
<ul style="padding-left:10px; list-style-type:circle;"><br />
<li>We prepared a plac-RFP-SacB construct which can be used for assessing counter-selection efficiency. (<a href="http://partsregistry.org/Part:BBa_K917002">BBa_K917002</a>)<br /><br /></li><br />
<li>We placed <i>sacB</i> under the lac promoter which allows IPTG dependent control rather than kanamycin dependent control and IPTG concentration-dependent control of the levels of selection.<br /><br /></li><br />
<li>We added RFP to allow distinguishing loss of the counter-selection cassette form loss of SacB fuction.<br /><br /></li><br />
<li>We prepared and characterized a Kan-plac-RFP-sacB selection-counterselection cassette in both <i>E. coli</i> and <i> Citrobacter freundii </i> (<a href="http://partsregistry.org/Part:BBa_K917010">BBa_K917010</a>)</li><br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/DhlA"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Gene-replacement-strategy"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-Plac-RFP-SacB a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
<br />
#list{<br />
list-style-type:circle;<br />
}<br />
#list li{<br />
margin-left:20px;<br />
padding-bottom:10px;<br />
}<br />
#list li ul{<br />
list-style-type:square;<br />
}<br />
#list li ul li{<br />
margin-left:50px;<br />
padding:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacBTeam:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacB2012-10-26T17:14:53Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#plasmid,<br />
#method,<br />
#sequencing{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig17,<br />
#fig18,<br />
#fig19{<br />
height:0px;<br />
margin:5px;<br />
}<br />
#fig20,<br />
#fig21,<br />
#fig22{<br />
width:100%;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="auto";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="auto";<br />
document.getElementById('fig19').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="0px";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="0px";<br />
document.getElementById('fig19').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Levansucrase <i>(sacB) </i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
SacB is the levansucrase enzyme from <i>Bacillus subtilis</i> <a href="#bibliography" onclick="expand('works-cited');">(Gay, Coq, Strinmetz, Ferrari, & Hoch, 1983)</a> which converts sucrose into fructose polymers which are lethal to <i>Esherichia coli</i> <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. This part was deposited into the Registry by Team Edinburgh 2010 and can be used as a counter selectable marker <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. Our aim is to improve the part by assessing its counter selection efficiency.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="normal-text"><br />
The plac-RFP fragment was obtained from the standard BioBrick <a class="cursor-pointer" onclick="expand('plasmid');">plasmid</a> and inserted in front of the sacB BioBrick. <a class="cursor-pointer" onclick="expand('method');">Method</a>. The construct was confirmed with <a class="cursor-pointer" onclick="expand('sequencing');">sequencing</a>.<br />
</p><br />
<p class="normal-text" id="plasmid"><br />
<br /><i>PCR of pSB1K3 plasmid (Kanamycin resistance) with psBNX3 insF2 forward primer (specific for BioBrick prefix) and dsred r2 reverse primer (specific for RFP) was prepared in order to obtain the plac-RFP fragment.</i><br /><br />
<img id="fig17" src="https://static.igem.org/mediawiki/2012/3/3b/Markers-fig17.JPG"><br /><br />
<i><b>Figure 1</b>: DNA gel of the PCR product from pSB1K3 amplification with primers specific to the BioBrick prefix and RFP. The band is abound 1 kb which corresponds to the expected size of plac-RFP.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('plasmid');">Close the plasmid.</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><i>The plac-RFP PCR product was purified and digested with EcoRI HF and SpeI. The <i>sacB</i> BioBrick deposited in 2010 <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a> was digested with EcoRI and XbaI. These were ligated together after purification. <i>E.coli</i> cells were transformed with the ligation. The red transformants were minipreped, digested with EcoRI HF in order to linearise them and with EcoRI HF and PstI in order to check the size of the insert.</i><br /><br />
<img id="fig18" src="https://static.igem.org/mediawiki/2012/4/4c/Markers-fig18.JPG"><br /><br />
<i><b>Figure 2:</b> DNA gel of miniprepped red clones of linearized plac-RFP-SacB ligation transformants. The band is around 4.5 kb which corresponds to pSB1C3 (2kb)+ +</i><br /><br />
<img id="fig19" src="https://static.igem.org/mediawiki/2012/1/10/Markers-fig19.JPG"><br /><br />
<i><b>Figure 3:</b> The same clones were digested with EcoRI HF and PstI to check the size of the insert. The band is around 2.5 kb which corresponds to SacB (1.5 kb)+ plac-rfp (1kb).</i><br /><br />
<a class="cursor-pointer" onclick="collapse('method');">Close the method.</a><br /><br />
</p><br />
<p class="normal-text" id="sequencing"><br />
<br /><i>Sequencing results<br />Forward primer:<br /><br />
Ctttaaaaaaaatcccttagctttcgctaaggtgatttctggaattcgcggccgcttctagagcaatac<br />
gcaaaccgtttcaccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactgga<br />
aagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacact<br />
ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagataaaga<br />
ggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcttatgga<br />
aggttccgttaactgtcactagttcgaaatcgaaggtgaatgtgaaggtcgtccgtactaaggtaccca<br />
gactgctaaactgaaagttactaaag<br />
<br /><br /><br />
Reverse primer:<br /><br />
aggggccttaaacataaacttttcggttttagaaaagggcagggtggtgacaccttgcccttttttgcc<br />
ggactgcagctactagtaatttatttgttaactgttaattgtccttgttcaaggatgctgtctttgaca<br />
acagatgttttcttgcctttgatgttcagcaggaagcttggcgcaaacgttgattgtttgtctgcgtaa<br />
aatcctctgtttgtcatatagcttgtaatcacgacattgtttcctttcgcttgaggtacagcgaagtgt<br />
gagtaattaaaggttacatcgttaggatcaagatccatttttaacacatggcctgttttgttcagcggc<br />
ttgtatgggccatttaaagaattagaaactttaccaagcatgttaatatcgttagacttatttccgtca<br />
atccttatttttgatccgcgggagtcatttaacaggtaccatttgccgttcattttattttcgttcgcg<br />
cgtctatttctttttgttactttgttttatgcaatcacgttttcattccttttttaattttgtatcatcgt</i><br /><br />
<a class="cursor-pointer" onclick="collapse('sequencing');">Close the sequencing results.</a><br /><br />
</p><br />
<p class="normal-text"><br />
<br />The idea of placing <i>sacB</i> under the control of the lac promoter is to create kanamycin-independent control. Moreover, by changing the IPTG levels, the level of selection can be controlled.<br />
<br /><br /><br />
One of the weaknesses of <i>sacB</i> selection often mentioned in the literature is that sacB loss-of-function mutants also survive, and this may occur at higher frequency than loss of the cassette. RFP is added to ensure that cells which have lost the cassette (should be white because of loss of RFP) can be distinguished from cells which have lost SacB function (should be red as RFP is still present). This would allow us to assess the counter-selection efficiency of SacB.<br /><br />
We also prepared a Kan-plac-RFP-sacB selection-counterselection cassette. <br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="normal-text"><br />
The growth of SacB (bottom) and a control (top) were tested by adding 1.3 g solid sucrose plus 0.5 ml sterile water into a well in the middle of the plate, as shown in Figure 4 below.. <br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/7/79/SAM_3111.JPG"><br /><br />
<b>Figure 4</b>: A quick test of SacB transformants' growth in the presence of sucrose. The growth of SacB (bottom) is inhibited near the well in comparison to the control (top). <br />
</p><br />
<p class="h3"><br />
<i>Citrobacter freundii</i><br />
</p><br />
<p class="normal-text"><br />
<i>SacB</i> and control (pSB1C3 only) transformants were streaked onto LB plates (with either cml40 or cml15) and solid sucrose was added to the regions indicated by the crosses or circles in Figure 5. The plates were incubated at 37&deg;C overnight.<br />
<br /><br /><br />
<img id="fig20" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114357.jpg" border="0"/><br />
<br /><br />
<b>Figure 5</b>: A quick test of <i>sacB</i> and control’s ability to grow in the presence of sucrose. The zone of clearance indicates that the cells containing <i>sacB</i> are inhibited by sucrose while the controls are unaffected. The control on the plate on the right is purple due to both expressing the RFP gene and turning blue because of the X-gal on the plate.<br />
<br /><br /><br />
The bottom streak on plate on the left in Figure 5 contains cells that have the selection-counterselection cassette so this test shows that the counterselection component of the cassette is working. <br />
<br /><br /><br />
We also tested the selection component of this cassette by streaking the cells onto plates containing both chloramphenicol and kanamycin and incubated overnight. These results can be seen in Figure 6.<br />
<br /><br /><br />
<img id="fig21" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114629.jpg" border="0"/><br />
<br /><br />
<b>Figure 6:</b> Plate showing that the kanamycin resistance component of the selection-counterselection cassette works. The control did not grow at all, even after 4 days, as it was inhibited by the kanamycin, while the cells containing the cassette show growth. Growth is weaker because we have found that using the concentration of chloramphenicol we normally use (cml40) in combination with the sacB in <i>Citrobacter freundii</i> causes slower growth, presumably because levansucrase expression is unregulated in these bacteria which puts a strain on the cell.<br />
</p><br />
<p class="h3"><br />
Sugar-dependent selection-counterselection cassette concept<br />
</p><br />
<p class="normal-text"><br />
The reason we did not use our sucrose hydrolase gene for the selection component of the selection-counterselection cassette was because both it and levansucrase depend on the same substrate – sucrose – for their function, so this would have not yielded good results.<br />
<br /><br /><br />
We have found that <i> Citrobacter freundii </i> can use sucrose as a sole carbon source without the need for the sucrose hydrolase gene – this means that if we want to develop a non-antibiotic resistance-dependent selection-counterselection cassette for this organism, we need to use a different sugar. One sugar that, according to our findings, <i>Citrobacter freundii </i> cannot use is xylitol – see our ‘Xylitol dehydrogenase’ section for more details on this. We could therefore combine this gene with the levansucrase gene to obtain an antibiotic resistance-independent selection-counterselection cassette that dependent entirely on sugars.<br />
</p><br />
<p class="h3"><br />
Levans<br />
</p><br />
<p class="normal-text"><br />
We have found that under sublethal doses of sucrose, the <i>E. coli </i> cells start to secrete a lot of gloopy substance, which we believe to be levans (Figure 4), the fructose polymers formed because of the levansucrase activity. <br />
<br /><br /><br />
<img id="fig22" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121018_132400.jpg" border="0"/><br />
<br /><br />
Figure 4: Secretion of levans outside of the cell – it is only present on the lower two colonies but is absent in the two controls above.<br />
<br /><br /><br />
We find this important to mention, as levans have got several applications in various fields <a href="#bibliography" onclick="expand('works-cited');">(Kang <i>et al.</i>, 2009)</a>.<br />
<br /><br /><br />
<ul id="list"><br />
<li>Food<br />
<ul><br />
<li>has prebiotic effects</li><br />
<li>provides dietary fibres</li><br />
<li>reduces serum cholesterol levels </li><br />
<li>it can be used as a food additive in the following ways: a stabilizer, an emulsifier, a formulation aid, surface-finishing agent, an encapsulating agent, and a carrier of flavours and fragrances </li><br />
</ul><br />
</li><br />
<li>Pharmaceutical industry <br />
<ul><br />
<li>can be used as a coating material for drugs </li><br />
<li>has anti-tumour properties <i>in vitro</i></li><br />
<li>can be used as a blood plasma volume expander</li><br />
<li>has anti-diabetic effects <a href="#bibliography" onclick="expand('works-cited');">(Dahech <i>et al.</i>, 2011)</a></li><br />
<li>levan derivatives are shown to be anti-AIDS agents</li><br />
</ul><br />
</li><br />
<li>Cosmetics<br />
<ul><br />
<li>good as a cell-proliferating agent</li><br />
<li>skin moisturising agent</li><br />
<li>reduces skin irritation</li><br />
</ul><br />
</li><br />
<li>Industry<br />
<ul><br />
<li>it can be used in a two-phase liquid good for the separation of biological samples</li><br />
<li>it can be used an environmentally friendly adhesive</li><br />
<li>it can be used as a temporary adhesive in water-soluble form</li><br />
<li>it can be used as a water-resistant adhesive for a long period of time in cross-linked form</li><br />
<li>it can form a water-resistant film</li><br />
<li>it acts as a cryoprotectant for the preservation of animal cells and fish</li><br />
</ul><br />
</li><br />
</ul><br />
</p><br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
<ul style="padding-left:10px; list-style-type:circle;"><br />
<li>We prepared a plac-RFP-SacB construct which can be used for assessing counter-selection efficiency. (<a href="http://partsregistry.org/Part:BBa_K917002">BBa_K917002</a>)<br /><br /></li><br />
<li>We placed <i>sacB</i> under the lac promoter which allows IPTG dependent control rather than kanamycin dependent control and IPTG concentration-dependent control of the levels of selection.<br /><br /></li><br />
<li>We added RFP to allow distinguishing loss of the counter-selection cassette form loss of SacB fuction.<br /><br /></li><br />
<li>We prepared and characterized a Kan-plac-RFP-sacB selection-counterselection cassette in both <i>E. coli</i> and <i> Citrobacter freundii </i> (<a href="http://partsregistry.org/Part:BBa_K917010">BBa_K917010</a>)</li><br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/DhlA"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Gene-replacement-strategy"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-Plac-RFP-SacB a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
<br />
#list{<br />
list-style-type:circle;<br />
}<br />
#list li{<br />
margin-left:20px;<br />
padding-bottom:10px;<br />
}<br />
#list li ul{<br />
list-style-type:square;<br />
}<br />
#list li ul li{<br />
margin-left:50px;<br />
padding:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacBTeam:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacB2012-10-26T17:14:12Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#plasmid,<br />
#method,<br />
#sequencing{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig17,<br />
#fig18,<br />
#fig19{<br />
height:0px;<br />
margin:5px;<br />
}<br />
#fig20,<br />
#fig21,<br />
#fig22{<br />
width:100%;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="auto";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="auto";<br />
document.getElementById('fig19').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="0px";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="0px";<br />
document.getElementById('fig19').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Levansucrase <i>(sacB) </i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
SacB is the levansucrase enzyme from <i>Bacillus subtilis</i> <a href="#bibliography" onclick="expand('works-cited');">(Gay, Coq, Strinmetz, Ferrari, & Hoch, 1983)</a> which converts sucrose into fructose polymers which are lethal to <i>Esherichia coli</i> <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. This part was deposited into the Registry by Team Edinburgh 2010 and can be used as a counter selectable marker <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. Our aim is to improve the part by assessing its counter selection efficiency.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="normal-text"><br />
The plac-RFP fragment was obtained from the standard BioBrick <a class="cursor-pointer" onclick="expand('plasmid');">plasmid</a> and inserted in front of the sacB BioBrick. <a class="cursor-pointer" onclick="expand('method');">Method</a>. The construct was confirmed with <a class="cursor-pointer" onclick="expand('sequencing');">sequencing</a>.<br />
</p><br />
<p class="normal-text" id="plasmid"><br />
<br /><i>PCR of pSB1K3 plasmid (Kanamycin resistance) with psBNX3 insF2 forward primer (specific for BioBrick prefix) and dsred r2 reverse primer (specific for RFP) was prepared in order to obtain the plac-RFP fragment.</i><br /><br />
<img id="fig17" src="https://static.igem.org/mediawiki/2012/3/3b/Markers-fig17.JPG"><br /><br />
<i><b>Figure 1</b>: DNA gel of the PCR product from pSB1K3 amplification with primers specific to the BioBrick prefix and RFP. The band is abound 1 kb which corresponds to the expected size of plac-RFP.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('plasmid');">Close the plasmid.</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><i>The plac-RFP PCR product was purified and digested with EcoRI HF and SpeI. The <i>sacB</i> BioBrick deposited in 2010 <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a> was digested with EcoRI and XbaI. These were ligated together after purification. <i>E.coli</i> cells were transformed with the ligation. The red transformants were minipreped, digested with EcoRI HF in order to linearise them and with EcoRI HF and PstI in order to check the size of the insert.</i><br /><br />
<img id="fig18" src="https://static.igem.org/mediawiki/2012/4/4c/Markers-fig18.JPG"><br /><br />
<i><b>Figure 2:</b> DNA gel of miniprepped red clones of linearized plac-RFP-SacB ligation transformants. The band is around 4.5 kb which corresponds to pSB1C3 (2kb)+ +</i><br /><br />
<img id="fig19" src="https://static.igem.org/mediawiki/2012/1/10/Markers-fig19.JPG"><br /><br />
<i><b>Figure 3:</b> The same clones were digested with EcoRI HF and PstI to check the size of the insert. The band is around 2.5 kb which corresponds to SacB (1.5 kb)+ plac-rfp (1kb).</i><br /><br />
<a class="cursor-pointer" onclick="collapse('method');">Close the method.</a><br /><br />
</p><br />
<p class="normal-text" id="sequencing"><br />
<br /><i>Sequencing results<br />Forward primer:<br /><br />
Ctttaaaaaaaatcccttagctttcgctaaggtgatttctggaattcgcggccgcttctagagcaatac<br />
gcaaaccgtttcaccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactgga<br />
aagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacact<br />
ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagataaaga<br />
ggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcttatgga<br />
aggttccgttaactgtcactagttcgaaatcgaaggtgaatgtgaaggtcgtccgtactaaggtaccca<br />
gactgctaaactgaaagttactaaag<br />
<br /><br /><br />
Reverse primer:<br /><br />
aggggccttaaacataaacttttcggttttagaaaagggcagggtggtgacaccttgcccttttttgcc<br />
ggactgcagctactagtaatttatttgttaactgttaattgtccttgttcaaggatgctgtctttgaca<br />
acagatgttttcttgcctttgatgttcagcaggaagcttggcgcaaacgttgattgtttgtctgcgtaa<br />
aatcctctgtttgtcatatagcttgtaatcacgacattgtttcctttcgcttgaggtacagcgaagtgt<br />
gagtaattaaaggttacatcgttaggatcaagatccatttttaacacatggcctgttttgttcagcggc<br />
ttgtatgggccatttaaagaattagaaactttaccaagcatgttaatatcgttagacttatttccgtca<br />
atccttatttttgatccgcgggagtcatttaacaggtaccatttgccgttcattttattttcgttcgcg<br />
cgtctatttctttttgttactttgttttatgcaatcacgttttcattccttttttaattttgtatcatcgt</i><br /><br />
<a class="cursor-pointer" onclick="collapse('sequencing');">Close the sequencing results.</a><br /><br />
</p><br />
<p class="normal-text"><br />
<br />The idea of placing <i>sacB</i> under the control of the lac promoter is to create kanamycin-independent control. Moreover, by changing the IPTG levels, the level of selection can be controlled.<br />
<br /><br /><br />
One of the weaknesses of <i>sacB</i> selection often mentioned in the literature is that sacB loss-of-function mutants also survive, and this may occur at higher frequency than loss of the cassette. RFP is added to ensure that cells which have lost the cassette (should be white because of loss of RFP) can be distinguished from cells which have lost SacB function (should be red as RFP is still present). This would allow us to assess the counter-selection efficiency of SacB.<br /><br />
We also prepared a Kan-plac-RFP-sacB selection-counterselection cassette. <br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="normal-text"><br />
The growth of SacB (bottom) and a control (top) were tested by adding 1.3 g solid sucrose plus 0.5 ml sterile water into a well in the middle of the plate, as shown in Figure 4 below.. <br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/7/79/SAM_3111.JPG"><br /><br />
<b>Figure 4</b>: A quick test of SacB transformants' growth in the presence of sucrose. The growth of SacB (bottom) is inhibited near the well in comparison to the control (top). <br />
</p><br />
<p class="h3"><br />
<i>Citrobacter freundii</i><br />
</p><br />
<p class="normal-text"><br />
<i>SacB</i> and control (pSB1C3 only) transformants were streaked onto LB plates (with either cml40 or cml15) and solid sucrose was added to the regions indicated by the crosses or circles in Figure 5. The plates were incubated at 37&deg;C overnight.<br />
<br /><br /><br />
<img id="fig20" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114357.jpg" border="0"/><br />
<br /><br />
<b>Figure 5</b>: A quick test of <i>sacB</i> and control’s ability to grow in the presence of sucrose. The zone of clearance indicates that the cells containing <i>sacB</i> are inhibited by sucrose while the controls are unaffected. The control on the plate on the right is purple due to both expressing the RFP gene and turning blue because of the X-gal on the plate.<br />
<br /><br /><br />
The bottom streak on plate on the left in Figure 5 contains cells that have the selection-counterselection cassette so this test shows that the counterselection component of the cassette is working. <br />
<br /><br /><br />
We also tested the selection component of this cassette by streaking the cells onto plates containing both chloramphenicol and kanamycin and incubated overnight. These results can be seen in Figure 3.<br />
<br /><br /><br />
<img id="fig21" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114629.jpg" border="0"/><br />
<br /><br />
Figure 3: Plate showing that the kanamycin resistance component of the selection-counterselection cassette works. The control did not grow at all, even after 4 days, as it was inhibited by the kanamycin, while the cells containing the cassette show growth. Growth is weaker because we have found that using the concentration of chloramphenicol we normally use (cml40) in combination with the sacB in <i>Citrobacter freundii</i> causes slower growth, presumably because levansucrase expression is unregulated in these bacteria which puts a strain on the cell.<br />
</p><br />
<p class="h3"><br />
Sugar-dependent selection-counterselection cassette concept<br />
</p><br />
<p class="normal-text"><br />
The reason we did not use our sucrose hydrolase gene for the selection component of the selection-counterselection cassette was because both it and levansucrase depend on the same substrate – sucrose – for their function, so this would have not yielded good results.<br />
<br /><br /><br />
We have found that <i> Citrobacter freundii </i> can use sucrose as a sole carbon source without the need for the sucrose hydrolase gene – this means that if we want to develop a non-antibiotic resistance-dependent selection-counterselection cassette for this organism, we need to use a different sugar. One sugar that, according to our findings, <i>Citrobacter freundii </i> cannot use is xylitol – see our ‘Xylitol dehydrogenase’ section for more details on this. We could therefore combine this gene with the levansucrase gene to obtain an antibiotic resistance-independent selection-counterselection cassette that dependent entirely on sugars.<br />
</p><br />
<p class="h3"><br />
Levans<br />
</p><br />
<p class="normal-text"><br />
We have found that under sublethal doses of sucrose, the <i>E. coli </i> cells start to secrete a lot of gloopy substance, which we believe to be levans (Figure 4), the fructose polymers formed because of the levansucrase activity. <br />
<br /><br /><br />
<img id="fig22" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121018_132400.jpg" border="0"/><br />
<br /><br />
Figure 4: Secretion of levans outside of the cell – it is only present on the lower two colonies but is absent in the two controls above.<br />
<br /><br /><br />
We find this important to mention, as levans have got several applications in various fields <a href="#bibliography" onclick="expand('works-cited');">(Kang <i>et al.</i>, 2009)</a>.<br />
<br /><br /><br />
<ul id="list"><br />
<li>Food<br />
<ul><br />
<li>has prebiotic effects</li><br />
<li>provides dietary fibres</li><br />
<li>reduces serum cholesterol levels </li><br />
<li>it can be used as a food additive in the following ways: a stabilizer, an emulsifier, a formulation aid, surface-finishing agent, an encapsulating agent, and a carrier of flavours and fragrances </li><br />
</ul><br />
</li><br />
<li>Pharmaceutical industry <br />
<ul><br />
<li>can be used as a coating material for drugs </li><br />
<li>has anti-tumour properties <i>in vitro</i></li><br />
<li>can be used as a blood plasma volume expander</li><br />
<li>has anti-diabetic effects <a href="#bibliography" onclick="expand('works-cited');">(Dahech <i>et al.</i>, 2011)</a></li><br />
<li>levan derivatives are shown to be anti-AIDS agents</li><br />
</ul><br />
</li><br />
<li>Cosmetics<br />
<ul><br />
<li>good as a cell-proliferating agent</li><br />
<li>skin moisturising agent</li><br />
<li>reduces skin irritation</li><br />
</ul><br />
</li><br />
<li>Industry<br />
<ul><br />
<li>it can be used in a two-phase liquid good for the separation of biological samples</li><br />
<li>it can be used an environmentally friendly adhesive</li><br />
<li>it can be used as a temporary adhesive in water-soluble form</li><br />
<li>it can be used as a water-resistant adhesive for a long period of time in cross-linked form</li><br />
<li>it can form a water-resistant film</li><br />
<li>it acts as a cryoprotectant for the preservation of animal cells and fish</li><br />
</ul><br />
</li><br />
</ul><br />
</p><br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
<ul style="padding-left:10px; list-style-type:circle;"><br />
<li>We prepared a plac-RFP-SacB construct which can be used for assessing counter-selection efficiency. (<a href="http://partsregistry.org/Part:BBa_K917002">BBa_K917002</a>)<br /><br /></li><br />
<li>We placed <i>sacB</i> under the lac promoter which allows IPTG dependent control rather than kanamycin dependent control and IPTG concentration-dependent control of the levels of selection.<br /><br /></li><br />
<li>We added RFP to allow distinguishing loss of the counter-selection cassette form loss of SacB fuction.<br /><br /></li><br />
<li>We prepared and characterized a Kan-plac-RFP-sacB selection-counterselection cassette in both <i>E. coli</i> and <i> Citrobacter freundii </i> (<a href="http://partsregistry.org/Part:BBa_K917010">BBa_K917010</a>)</li><br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/DhlA"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Gene-replacement-strategy"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-Plac-RFP-SacB a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
<br />
#list{<br />
list-style-type:circle;<br />
}<br />
#list li{<br />
margin-left:20px;<br />
padding-bottom:10px;<br />
}<br />
#list li ul{<br />
list-style-type:square;<br />
}<br />
#list li ul li{<br />
margin-left:50px;<br />
padding:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacBTeam:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacB2012-10-26T17:08:25Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#plasmid,<br />
#method,<br />
#sequencing{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig17,<br />
#fig18,<br />
#fig19{<br />
height:0px;<br />
margin:5px;<br />
}<br />
#fig20,<br />
#fig21,<br />
#fig22{<br />
width:100%;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="auto";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="auto";<br />
document.getElementById('fig19').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="0px";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="0px";<br />
document.getElementById('fig19').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Levansucrase <i>(sacB) </i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
SacB is the levansucrase enzyme from <i>Bacillus subtilis</i> <a href="#bibliography" onclick="expand('works-cited');">(Gay, Coq, Strinmetz, Ferrari, & Hoch, 1983)</a> which converts sucrose into fructose polymers which are lethal to <i>Esherichia coli</i> <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. This part was deposited into the Registry by Team Edinburgh 2010 and can be used as a counter selectable marker <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. Our aim is to improve the part by assessing its counter selection efficiency.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="normal-text"><br />
The plac-RFP fragment was obtained from the standard BioBrick <a class="cursor-pointer" onclick="expand('plasmid');">plasmid</a> and inserted in front of the sacB BioBrick. <a class="cursor-pointer" onclick="expand('method');">Method</a>. The construct was confirmed with <a class="cursor-pointer" onclick="expand('sequencing');">sequencing</a>.<br />
</p><br />
<p class="normal-text" id="plasmid"><br />
<br /><i>PCR of pSB1K3 plasmid (Kanamycin resistance) with psBNX3 insF2 forward primer (specific for BioBrick prefix) and dsred r2 reverse primer (specific for RFP) was prepared in order to obtain the plac-RFP fragment.</i><br /><br />
<img id="fig17" src="https://static.igem.org/mediawiki/2012/3/3b/Markers-fig17.JPG"><br /><br />
<i>Figure 1: DNA gel of the PCR product from pSB1K3 amplification with primers specific to the BioBrick prefix and RFP. The band is abound 1 kb which corresponds to the expected size of plac-RFP.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('plasmid');">Close the plasmid.</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><i>The plac-RFP PCR product was purified and digested with EcoRI HF and SpeI. The <i>sacB</i> BioBrick deposited in 2010 <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a> was digested with EcoRI and XbaI. These were ligated together after purification. <i>E.coli</i> cells were transformed with the ligation. The red transformants were minipreped, digested with EcoRI HF in order to linearise them and with EcoRI HF and PstI in order to check the size of the insert.</i><br /><br />
<img id="fig18" src="https://static.igem.org/mediawiki/2012/4/4c/Markers-fig18.JPG"><br /><br />
<i>Figure 2: DNA gel of miniprepped red clones of linearized plac-RFP-SacB ligation transformants. The band is around 4.5 kb which corresponds to pSB1C3 (2kb)+ +</i><br /><br />
<img id="fig19" src="https://static.igem.org/mediawiki/2012/1/10/Markers-fig19.JPG"><br /><br />
<i>Figure 3: The same clones were digested with EcoRI HF and PstI to check the size of the insert. The band is around 2.5 kb which corresponds to SacB (1.5 kb)+ plac-rfp (1kb).</i><br /><br />
<a class="cursor-pointer" onclick="collapse('method');">Close the method.</a><br /><br />
</p><br />
<p class="normal-text" id="sequencing"><br />
<br /><i>Sequencing results<br />Forward primer:<br /><br />
Ctttaaaaaaaatcccttagctttcgctaaggtgatttctggaattcgcggccgcttctagagcaatac<br />
gcaaaccgtttcaccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactgga<br />
aagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacact<br />
ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagataaaga<br />
ggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcttatgga<br />
aggttccgttaactgtcactagttcgaaatcgaaggtgaatgtgaaggtcgtccgtactaaggtaccca<br />
gactgctaaactgaaagttactaaag<br />
<br /><br /><br />
Reverse primer:<br /><br />
aggggccttaaacataaacttttcggttttagaaaagggcagggtggtgacaccttgcccttttttgcc<br />
ggactgcagctactagtaatttatttgttaactgttaattgtccttgttcaaggatgctgtctttgaca<br />
acagatgttttcttgcctttgatgttcagcaggaagcttggcgcaaacgttgattgtttgtctgcgtaa<br />
aatcctctgtttgtcatatagcttgtaatcacgacattgtttcctttcgcttgaggtacagcgaagtgt<br />
gagtaattaaaggttacatcgttaggatcaagatccatttttaacacatggcctgttttgttcagcggc<br />
ttgtatgggccatttaaagaattagaaactttaccaagcatgttaatatcgttagacttatttccgtca<br />
atccttatttttgatccgcgggagtcatttaacaggtaccatttgccgttcattttattttcgttcgcg<br />
cgtctatttctttttgttactttgttttatgcaatcacgttttcattccttttttaattttgtatcatcgt</i><br /><br />
<a class="cursor-pointer" onclick="collapse('sequencing');">Close the sequencing results.</a><br /><br />
</p><br />
<p class="normal-text"><br />
<br />The idea of placing <i>sacB</i> under the control of the lac promoter is to create kanamycin-independent control. Moreover, by changing the IPTG levels, the level of selection can be controlled.<br />
<br /><br /><br />
One of the weaknesses of <i>sacB</i> selection often mentioned in the literature is that sacB loss-of-function mutants also survive, and this may occur at higher frequency than loss of the cassette. RFP is added to ensure that cells which have lost the cassette (should be white because of loss of RFP) can be distinguished from cells which have lost SacB function (should be red as RFP is still present). This would allow us to assess the counter-selection efficiency of SacB.<br /><br />
We also prepared a Kan-plac-RFP-sacB selection-counterselection cassette. <br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="normal-text"><br />
The growth of SacB (bottom) and a control (top) were tested by adding 1.3 g solid sucrose plus 0.5 ml sterile water into a well in the middle of the plate. <br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/7/79/SAM_3111.JPG"><br /><br />
Figure 1: A quick test of SacB transformants' growth in the presence of sucrose. The growth of SacB (bottom) is inhibited near the well in comparison to the control (top). <br />
</p><br />
<p class="h3"><br />
<i>Citrobacter freundii</i><br />
</p><br />
<p class="normal-text"><br />
<i>SacB</i> and control (pSB1C3 only) transformants were streaked onto LB plates (with either cml40 or cml15) and solid sucrose was added to the regions indicated by the crosses or circles in Figure 2. The plates were incubated at 37&deg;C overnight.<br />
<br /><br /><br />
<img id="fig20" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114357.jpg" border="0"/><br />
<br /><br />
Figure 2: A quick test of <i>sacB</i> and control’s ability to grow in the presence of sucrose. The zone of clearance indicates that the cells containing <i>sacB</i> are inhibited by sucrose while the controls are unaffected. The control on the plate on the right is purple due to both expressing the RFP gene and turning blue because of the X-gal on the plate.<br />
<br /><br /><br />
The bottom streak on plate on the left in Figure 1 contains cells that have the selection-counterselection cassette so this test shows that the counterselection component of the cassette is working. <br />
<br /><br /><br />
We also tested the selection component of this cassette by streaking the cells onto plates containing both chloramphenicol and kanamycin and incubated overnight. These results can be seen in Figure 3.<br />
<br /><br /><br />
<img id="fig21" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114629.jpg" border="0"/><br />
<br /><br />
Figure 3: Plate showing that the kanamycin resistance component of the selection-counterselection cassette works. The control did not grow at all, even after 4 days, as it was inhibited by the kanamycin, while the cells containing the cassette show growth. Growth is weaker because we have found that using the concentration of chloramphenicol we normally use (cml40) in combination with the sacB in <i>Citrobacter freundii</i> causes slower growth, presumably because levansucrase expression is unregulated in these bacteria which puts a strain on the cell.<br />
</p><br />
<p class="h3"><br />
Sugar-dependent selection-counterselection cassette concept<br />
</p><br />
<p class="normal-text"><br />
The reason we did not use our sucrose hydrolase gene for the selection component of the selection-counterselection cassette was because both it and levansucrase depend on the same substrate – sucrose – for their function, so this would have not yielded good results.<br />
<br /><br /><br />
We have found that <i> Citrobacter freundii </i> can use sucrose as a sole carbon source without the need for the sucrose hydrolase gene – this means that if we want to develop a non-antibiotic resistance-dependent selection-counterselection cassette for this organism, we need to use a different sugar. One sugar that, according to our findings, <i>Citrobacter freundii </i> cannot use is xylitol – see our ‘Xylitol dehydrogenase’ section for more details on this. We could therefore combine this gene with the levansucrase gene to obtain an antibiotic resistance-independent selection-counterselection cassette that dependent entirely on sugars.<br />
</p><br />
<p class="h3"><br />
Levans<br />
</p><br />
<p class="normal-text"><br />
We have found that under sublethal doses of sucrose, the <i>E. coli </i> cells start to secrete a lot of gloopy substance, which we believe to be levans (Figure 4), the fructose polymers formed because of the levansucrase activity. <br />
<br /><br /><br />
<img id="fig22" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121018_132400.jpg" border="0"/><br />
<br /><br />
Figure 4: Secretion of levans outside of the cell – it is only present on the lower two colonies but is absent in the two controls above.<br />
<br /><br /><br />
We find this important to mention, as levans have got several applications in various fields <a href="#bibliography" onclick="expand('works-cited');">(Kang <i>et al.</i>, 2009)</a>.<br />
<br /><br /><br />
<ul id="list"><br />
<li>Food<br />
<ul><br />
<li>has prebiotic effects</li><br />
<li>provides dietary fibres</li><br />
<li>reduces serum cholesterol levels </li><br />
<li>it can be used as a food additive in the following ways: a stabilizer, an emulsifier, a formulation aid, surface-finishing agent, an encapsulating agent, and a carrier of flavours and fragrances </li><br />
</ul><br />
</li><br />
<li>Pharmaceutical industry <br />
<ul><br />
<li>can be used as a coating material for drugs </li><br />
<li>has anti-tumour properties <i>in vitro</i></li><br />
<li>can be used as a blood plasma volume expander</li><br />
<li>has anti-diabetic effects <a href="#bibliography" onclick="expand('works-cited');">(Dahech <i>et al.</i>, 2011)</a></li><br />
<li>levan derivatives are shown to be anti-AIDS agents</li><br />
</ul><br />
</li><br />
<li>Cosmetics<br />
<ul><br />
<li>good as a cell-proliferating agent</li><br />
<li>skin moisturising agent</li><br />
<li>reduces skin irritation</li><br />
</ul><br />
</li><br />
<li>Industry<br />
<ul><br />
<li>it can be used in a two-phase liquid good for the separation of biological samples</li><br />
<li>it can be used an environmentally friendly adhesive</li><br />
<li>it can be used as a temporary adhesive in water-soluble form</li><br />
<li>it can be used as a water-resistant adhesive for a long period of time in cross-linked form</li><br />
<li>it can form a water-resistant film</li><br />
<li>it acts as a cryoprotectant for the preservation of animal cells and fish</li><br />
</ul><br />
</li><br />
</ul><br />
</p><br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
<ul style="padding-left:10px; list-style-type:circle;"><br />
<li>We prepared a plac-RFP-SacB construct which can be used for assessing counter-selection efficiency. (<a href="http://partsregistry.org/Part:BBa_K917002">BBa_K917002</a>)<br /><br /></li><br />
<li>We placed <i>sacB</i> under the lac promoter which allows IPTG dependent control rather than kanamycin dependent control and IPTG concentration-dependent control of the levels of selection.<br /><br /></li><br />
<li>We added RFP to allow distinguishing loss of the counter-selection cassette form loss of SacB fuction.<br /><br /></li><br />
<li>We prepared and characterized a Kan-plac-RFP-sacB selection-counterselection cassette in both <i>E. coli</i> and <i> Citrobacter freundii </i> (<a href="http://partsregistry.org/Part:BBa_K917010">BBa_K917010</a>)</li><br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/DhlA"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Gene-replacement-strategy"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-Plac-RFP-SacB a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
<br />
#list{<br />
list-style-type:circle;<br />
}<br />
#list li{<br />
margin-left:20px;<br />
padding-bottom:10px;<br />
}<br />
#list li ul{<br />
list-style-type:square;<br />
}<br />
#list li ul li{<br />
margin-left:50px;<br />
padding:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-HydrolaseTeam:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase2012-10-26T16:59:46Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#CscA-primers,<br />
#CscA-method,<br />
#figure1,<br />
#figure2,<br />
#figure3{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig12{<br />
height:0px;<br />
margin:5px;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
document.getElementById('fig12').style.height="auto";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="auto";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
document.getElementById('fig12').style.height="0px";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="0px";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Sucrose Hydrolase <i> (cscA)</i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
Sucrose hydrolase is an enzyme from <i>Escherichia coli</i> O157:H7 strain Sakai which is involved in sucrose utilisation <a href="#bibliography" onclick="expand('works-cited');">(Jahreis, et al., 2002)</a>. Transforming <i>Escherichia coli</i> K12 strains with sucrose hydrolase allows the cells to grow with sucrose as a sole carbon source, something the untransformed K12 strain cannot do. This allows this gene to be used as a selectable marker.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="h3"><br />
<i>cscA</i> cloning <br />
</p><br />
<p class="normal-text"><br />
The <i>cscA</i> gene was cloned PCR with <i>cscA</i> specific primers. <a onclick="expand('figure1');">Figure 1.</a><br />
</p><br />
<p class="normal-text" id="figure1"><br />
<br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/0/06/G1.png"><br /><br />
Figure 1: DNA gel of PCR amplification with primers specific for <i> cscA </i>. The product is around 1.4-1.5 kb which corresponds to the size of <i> cscA </i> gene, around 1.5 kb.<br /><br /><br />
<a onclick="collapse('figure1');">Close figure 1.</a><br />
</p><br />
<p class="normal-text"><br />
<br />This fragment was inserted into the standard BioBrick vector pSB1C3. <a onclick="expand('figure2');">Figure 2.</a><br />
</p><br />
<p class="normal-text" id="figure2"><br />
<br /><br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/8/85/G2.png"><br /><br />
Figure 2:DNA gel of pSBIC3-<i>cscA</i> ligation digested with EcoRI in order to linearise the plasmid. The band is around 3.5 kb which corresponds to the vector pSBIC3 (around 2 kb) together with the <i>cscA</i> gene (arounf 1.5 kb)<br /><br /><br />
<a onclick="collapse('figure2');">Close figure 2.</a><br />
</p><br />
<p class="normal-text"><br />
<br />A promoter and a reporter gene were added in front of the <i>cscA</i> gene (Plac-lacZ'). <a onclick="expand('figure3');">Figure 3.</a><br />
</p><br />
<p class="normal-text" id="figure3"><br />
<br /><br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/e/e2/G9.png"><br /><br />
Figure 3: DNA gel of pSB1C3-Plac-lacZ'-cscA digested with XbaI and PstI. The clear band just above 2kb corresponds both to the size of the vector and the Plac-lacZ'-cscA fragment. The band around 4 kb is likely to correspond to the undigested plasmid. <br /><br /><br />
<a onclick="collapse('figure3');">Close figure 3.</a><br />
</p><br />
<br />
<p class="h3"><br />
cscA selection plasmid<br />
</p><br />
<p class="normal-text"><br />
In order to create a <i>cscA</i> selection plasmid, we wanted to replace the chloramphenicol resistance in pSB1C3 with <i>cscA</i>. The <i>cscA</i> and pSB1C3 gene were cloned using these <a class="cursor-pointer" onclick="expand('CscA-primers');">primers</a>. <a class="cursor-pointer" onclick="expand('CscA-method')">Method</a>. However, this resulted in no successful pSB1C3-cscA ligation transformants.<br />
</p><br />
<p class="normal-text" id="CscA-primers"><br />
<br /><i>Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat<br /><br />
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT<br /></i><br />
<img id="fig12" src="https://static.igem.org/mediawiki/2012/7/75/Markers-fig12.JPG"><br /><br />
<i>Figure 1: DNA gel of PCR products of pSB1C3 without chloramphenicol and <i>cscA</i>. One product is around 1.4 kb which corresponds to the size of <i>cscA</i> gene, the other is around 2.2 kb which corresponds to the pSB1C3 vector without cml resistance.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-primers');">Close the primers.</a><br /><br />
</p><br />
<p class="normal-text" id="CscA-method"><br />
<br /><i>Method: The purified <i>cscA</i> and psB1C3 PCR products were digested with NdeI and ClaI. Both products were ligated and E.coli cells transformed with the ligation.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-method');">Close the method.</a><br /><br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="h3"><br />
Plates<br />
</p><br />
<p class="normal-text"><br />
Plate characterisation showed that <i>cscA</i> is a suitable selectable marker- only cells which had the gene grew on sucrose as a sole carbon sourse (Figure 4). The drawback of this antibiotic-free selectable marker is that more time is required for the growth of the <i>cscA</i> cells on sucrose plates (we incubated them overnight at 37°C+4 days at room temperature, but they might have grown faster had we left them in the incubator).<br />
<br /><br /><br />
<img id="fig13" src="https://static.igem.org/mediawiki/2012/2/26/Markers-fig13.JPG"><br /><br />
Figure 4: Cells transformed with <i>cscA</i> (<a href="http://partsregistry.org/Part:BBa_K917000">BBa_K917000</a>) (bottom row) as well as control cells (top row) were spread on LB plate, minimal plate with sucrose, minimal plate with glucose and minimal plate with no sugars, straight after transformation (without preselection on chloramphenicol). Neither the <i>cscA</i> nor the control cells grow on minimal media with no sugars and grew well on LB and minimal plate with glucose. However, <i>cscA</i> cells are growing on minimal media with sucrose while the control cells are not.<br />
</p><br />
<p class="h3"><br />
Liquid Cultures<br />
</p><br />
<p class="normal-text"><br />
In order to better quantify our results, we have decided to grow our transformants in liquid media and measure OD after overnight incubation. We set up bottles with the same media as we have used for the plates (LB, M9 minimal medium with no sugars, M9 with 1% glucose and M9 with 1% sucrose), inoculated them with <i>cscA</i> or control transformants grown overnight and incubated them overnight before measuring OD. The results can be seen in Figure 5 below.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/2/2e/EdiGEM-Fig5.png"><br />
<br /><br />
Figure 5: Comparison of growth between cells containing the sucrose hydrolase (<i>cscA</i>) selectable marker and control. LB and M9 glucose were used as positive controls, M9 with no sugars was used as a negative control.<br />
</p><br />
<p class="h2"><br />
<a name="xylitol">Citrobacter xylitol selection marker strategy</a><br />
</p><br />
<p class="normal-text"><br />
In addition to <i> E. coli</i>, we were also working with the organism <i>Citrobacter freundii</i> over summer. <br /><br /><br />
Unfortunately, we could not test our sucrose hydrolase selection system in this organism, as it can already degrade sucrose naturally. We have therefore devised the concept for an alternative sugar selection system that could be used in <i>Citrobacter freundii</i>. This sugar selection system is based on the sugar alcohol xylitol – our <a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use#liquid-media"><i>Citrobacter freundii</i> sugar use experiments</a> show that it cannot grow on this sugar as a sole carbon source, so it seems to be an ideal candidate for selectable marker design.<br />
<br /><br /><br />
As some organisms <i>can</i> use and degrade xylitol, we have found an enzyme, called <vb>xylitol dehydrogenase </b>, which oxidizes xylitol to xylulose. This gene can be found in (for example) the gram negative rod <i> Gluconobacter oxydans </i> which is also friendly to humans, as it is not known to be pathogenic and in addition it is also used in various fields of biotechnology for example in the construction of bionsensors or for vinegar, vitamin C or sorbitol production.<br />
<br /><br /><br />
The cloning strategy could be the same as was used to make the sucrose hydrolase BioBrick and assessing its effectivity could also be done following the same protocols, but of course, replacing sucrose with xylitol where needed. <br />
<br /><br /><br />
This non-antibiotic selectable marker could be coupled up with our levansucrase (<i>sacB</i> counterselectable marker to form a selection-counterselection cassette that depends entirely on the presence of sugars, rather than antibiotics.<br />
</p><br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
<ul style="padding-left:10px; list-style-type:circle;"><br />
<li>We successfully cloned the sucrose hydrolase gene and inserted it into the BioBrick vector. (<a href="http://partsregistry.org/Part:BBa_K917000">BBa_K917000</a>)<br /><br /></li><br />
<li>We extensively characterised the sucrose hydrolase gene on plates and in liquid cultures.<br /><br /></li><br />
<li>We determined its suitability as a selectable marker.</li><br/<br/><br />
<li>We have developed a conceptual sugar-based selection system for <i>Citrobacter freundii </i></li><br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Nitroreductase"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/DhlA"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-sucrose-hydrolase a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-HydrolaseTeam:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase2012-10-26T16:57:49Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#CscA-primers,<br />
#CscA-method,<br />
#figure1,<br />
#figure2,<br />
#figure3{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig12{<br />
height:0px;<br />
margin:5px;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
document.getElementById('fig12').style.height="auto";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="auto";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
document.getElementById('fig12').style.height="0px";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="0px";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Sucrose Hydrolase <i> (cscA)</i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
Sucrose hydrolase is an enzyme from <i>Escherichia coli</i> O157:H7 strain Sakai which is involved in sucrose utilisation <a href="#bibliography" onclick="expand('works-cited');">(Jahreis, et al., 2002)</a>. Transforming <i>Escherichia coli</i> K12 strains with sucrose hydrolase allows the cells to grow with sucrose as a sole carbon source, something the untransformed K12 strain cannot do. This allows this gene to be used as a selectable marker.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="h3"><br />
<i>cscA</i> cloning <br />
</p><br />
<p class="normal-text"><br />
The <i>cscA</i> gene was cloned PCR with <i>cscA</i> specific primers. <a onclick="expand('figure1');">Figure 1.</a><br />
</p><br />
<p class="normal-text" id="figure1"><br />
<br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/0/06/G1.png"><br /><br />
Figure 1: DNA gel of PCR amplification with primers specific for <i> cscA </i>. The product is around 1.4-1.5 kb which corresponds to the size of <i> cscA </i> gene, around 1.5 kb.<br /><br /><br />
<a onclick="collapse('figure1');">Close figure 1.</a><br />
</p><br />
<p class="normal-text"><br />
<br />This fragment was inserted into the standard BioBrick vector pSB1C3. <a onclick="expand('figure2');">Figure 2.</a><br />
</p><br />
<p class="normal-text" id="figure2"><br />
<br /><br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/8/85/G2.png"><br /><br />
Figure 2:DNA gel of pSBIC3-<i>cscA</i> ligation digested with EcoRI in order to linearise the plasmid. The band is around 3.5 kb which corresponds to the vector pSBIC3 (around 2 kb) together with the <i>cscA</i> gene (arounf 1.5 kb)<br /><br /><br />
<a onclick="collapse('figure2');">Close figure 2.</a><br />
</p><br />
<p class="normal-text"><br />
<br />A promoter and a reporter gene were added in front of the <i>cscA</i> gene (Plac-lacZ'). <a onclick="expand('figure3');">Figure 3.</a><br />
</p><br />
<p class="normal-text" id="figure3"><br />
<br /><br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/e/e2/G9.png"><br /><br />
Figure 3: DNA gel of pSB1C3-Plac-lacZ'-cscA digested with XbaI and PstI. The clear band just above 2kb corresponds both to the size of the vector and the Plac-lacZ'-cscA fragment. The band around 4 kb is likely to correspond to the undigested plasmid. <br /><br /><br />
<a onclick="collapse('figure3');">Close figure 3.</a><br />
</p><br />
<br />
<p class="h3"><br />
cscA selection plasmid<br />
</p><br />
<p class="normal-text"><br />
In order to create a <i>cscA</i> selection plasmid, we wanted to replace the chloramphenicol resistance in pSB1C3 with <i>cscA</i>. The <i>cscA</i> and pSB1C3 gene were cloned using these <a class="cursor-pointer" onclick="expand('CscA-primers');">primers</a>. <a class="cursor-pointer" onclick="expand('CscA-method')">Method</a>. However, this resulted in no successful pSB1C3-cscA ligation transformants.<br />
</p><br />
<p class="normal-text" id="CscA-primers"><br />
<br /><i>Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat<br /><br />
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT<br /></i><br />
<img id="fig12" src="https://static.igem.org/mediawiki/2012/7/75/Markers-fig12.JPG"><br /><br />
<i>Figure 1: DNA gel of PCR products of pSB1C3 without chloramphenicol and <i>cscA</i>. One product is around 1.4 kb which corresponds to the size of <i>cscA</i> gene, the other is around 2.2 kb which corresponds to the pSB1C3 vector without cml resistance.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-primers');">Close the primers.</a><br /><br />
</p><br />
<p class="normal-text" id="CscA-method"><br />
<br /><i>Method: The purified <i>cscA</i> and psB1C3 PCR products were digested with NdeI and ClaI. Both products were ligated and E.coli cells transformed with the ligation.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-method');">Close the method.</a><br /><br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="h3"><br />
Plates<br />
</p><br />
<p class="normal-text"><br />
Plate characterisation showed that <i>cscA</i> is a suitable selectable marker- only cells which had the gene grew on sucrose as a sole carbon sourse (Figure 4). The drawback of this antibiotic-free selectable marker is that more time is required for the growth of the <i>cscA</i> cells on sucrose plates (overnight at 37°C+4 days at room temperature).<br />
<br /><br /><br />
<img id="fig13" src="https://static.igem.org/mediawiki/2012/2/26/Markers-fig13.JPG"><br /><br />
Figure 4: Cells transformed with <i>cscA</i> (<a href="http://partsregistry.org/Part:BBa_K917000">BBa_K917000</a>) (bottom row) as well as control cells (top row) were spread on LB plate, minimal plate with sucrose, minimal plate with glucose and minimal plate with no sugars, straight after transformation (without preselection on chloramphenicol). Neither the <i>cscA</i> nor the control cells grow on minimal media with no sugars and grew well on LB and minimal plate with glucose. However, <i>cscA</i> cells are growing on minimal media with sucrose while the control cells are not.<br />
</p><br />
<p class="h3"><br />
Liquid Cultures<br />
</p><br />
<p class="normal-text"><br />
In order to better quantify our results, we have decided to grow our transformants in liquid media and measure OD after overnight incubation. We set up bottles with the same media as we have used for the plates (LB, M9 minimal medium with no sugars, M9 with 1% glucose and M9 with 1% sucrose), inoculated them with <i>cscA</i> or control transformants grown overnight and incubated them overnight before measuring OD. The results can be seen in Figure 5 below.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/2/2e/EdiGEM-Fig5.png"><br />
<br /><br />
Figure 5: Comparison of growth between cells containing the sucrose hydrolase (<i>cscA</i>) selectable marker and control. LB and M9 glucose were used as positive controls, M9 with no sugars was used as a negative control.<br />
</p><br />
<p class="h2"><br />
<a name="xylitol">Citrobacter xylitol selection marker strategy</a><br />
</p><br />
<p class="normal-text"><br />
In addition to <i> E. coli</i>, we were also working with the organism <i>Citrobacter freundii</i> over summer. <br /><br /><br />
Unfortunately, we could not test our sucrose hydrolase selection system in this organism, as it can already degrade sucrose naturally. We have therefore devised the concept for an alternative sugar selection system that could be used in <i>Citrobacter freundii</i>. This sugar selection system is based on the sugar alcohol xylitol – our <a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use#liquid-media"><i>Citrobacter freundii</i> sugar use experiments</a> show that it cannot grow on this sugar as a sole carbon source, so it seems to be an ideal candidate for selectable marker design.<br />
<br /><br /><br />
As some organisms <i>can</i> use and degrade xylitol, we have found an enzyme, called <vb>xylitol dehydrogenase </b>, which oxidizes xylitol to xylulose. This gene can be found in (for example) the gram negative rod <i> Gluconobacter oxydans </i> which is also friendly to humans, as it is not known to be pathogenic and in addition it is also used in various fields of biotechnology for example in the construction of bionsensors or for vinegar, vitamin C or sorbitol production.<br />
<br /><br /><br />
The cloning strategy could be the same as was used to make the sucrose hydrolase BioBrick and assessing its effectivity could also be done following the same protocols, but of course, replacing sucrose with xylitol where needed. <br />
<br /><br /><br />
This non-antibiotic selectable marker could be coupled up with our levansucrase (<i>sacB</i> counterselectable marker to form a selection-counterselection cassette that depends entirely on the presence of sugars, rather than antibiotics.<br />
</p><br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
<ul style="padding-left:10px; list-style-type:circle;"><br />
<li>We successfully cloned the sucrose hydrolase gene and inserted it into the BioBrick vector. (<a href="http://partsregistry.org/Part:BBa_K917000">BBa_K917000</a>)<br /><br /></li><br />
<li>We extensively characterised the sucrose hydrolase gene on plates and in liquid cultures.<br /><br /></li><br />
<li>We determined its suitability as a selectable marker.</li><br/<br/><br />
<li>We have developed a conceptual sugar-based selection system for <i>Citrobacter freundii </i></li><br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Nitroreductase"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/DhlA"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-sucrose-hydrolase a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/ProjectTeam:Edinburgh/Project2012-10-26T16:22:10Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
cursor: default;<br />
color: #000;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
/*background-image: url('https://static.igem.org/mediawiki/2012/d/de/Edi-project-bg-5.png');<br />
background-repeat: no-repeat;*/<br />
border:1px solid #ccc;<br />
}<br />
#project-abstract-video{<br />
margin-top:20px;<br />
margin-left:120px;<br />
border:1px solid #a8a8a8;<br />
padding:4px;<br />
border-radius:4px;<br />
box-shadow:0px 0px 5px #a8a8a8;<br />
background:#f2f2f2;<br />
width:560px;<br />
}<br />
</style><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="normal-text"><br />
In the spirit of iGEM, our project’s aim is to design new biological systems that will make synthetic biology more accessible and friendly. Our team plans to achieve this by constructing a bio-electric interface, designing new selectable and counterselectable markers and characterising <i>Citrobacter freundii</i> to start a dialogue on what a synthetic-biology specific chassis should look like. <span class="intense-emphasis">For more detailed information on each of these sub-projects, refer to the links in the navigation menu on the left.</span><br />
<br /><br /><br />
However, if you are short for time, you may want to have a look at <span class="plainlinks"><a href="http://dl.dropbox.com/u/108285418/EdiGEM%20-%20iGEM%20Edinburgh%202012.pdf"><b>EdiGEM's Concise Project Description</b></a></span>.<br />
</p><br />
<p class="h1"><br />
Project Abstract<br />
</h1><br />
<div id="project-abstract-video"><br />
<iframe class="project-abstract" width="560" height="315" src="http://www.youtube.com/embed/wnd77MsyMi4" frameborder="0" allowfullscreen></iframe><br />
</div><!-- /project-abstract-video --><br />
<p class="h2"><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface">Bioelectric interface</a><br />
</p><br />
<p class="normal-text"><br />
As part of our project we will attempt to create a bioelectric interface - a way to connect biological and electronic systems in a standardised, inducible and quantifiable way.<br />
<br /><br /><br />
To achieve our goal we will use the MtrCAB proteins (cytochromes, proteins that mediate electron transport) from <i>Shewanella oneidensis</i>. We will transform <i>E. coli</i> with these genes along with a <i>ccm</i> gene cluster (cytochrome c maturation proteins) and couple it to an inducible promoter such as the Ars or Lac promoters which are induced by arsenate or lactose/IPTG.<br />
<br /><br /><br />
As a result, we should be able to obtain a system that would allow us to measure the rate of electron export in response to an input of arsenate or IPTG. Possible methods to measure electron export include measuring the transfer of electrons to an electrode with a volt meter by comparing it to a reference electrode; construction of a microbial fuel cell or the use of the ferrozine assay to measure the rate of reduction of iron (III) ions to iron (II).<br />
<br /><br /><br />
We are also looking at two ways of making genetically modified bacteria safer to release into the environment:<br />
</p><br />
<p class="h2"><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers">Alternative Selectable and counter-selectable markers</a><br />
</p><br />
<p class="normal-text"><br />
Alternative to antibiotic resistance: We are investigating other ways to distinguish between the cells which have taken up the plasmid in question and those which have not in order to eliminate the need for antibiotic resistance selection. This would reduce the spreading of antibiotic resistance genes if an engineered bacterium were to be released into the environment either deliberately or by accident.<br />
</p><br />
<p class="h2"><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii">Chassis characterization: <i>Citrobacter freundii</i></a><br />
</p><br />
<p class="normal-text"><br />
We intend to characterize this 'friendly lemon bacterium' (a member of the gamma-proteobacteria, like <i>Escherichia coli</i>) in order to assess whether it would be a good chassis for cloning and gene expression within synthetic biology and beyond. We want to see what it can offer to this field to assess whether there are some new things it can do, or can do better than <i> E. coli </i>, the legacy chassis. We want to start a dialogue about what a synthetic biology-specific chassis should look like, what it should be able to do and what should be known about it before it could be considered a good alternative for the currently existing chassis.<br />
<br /><br /><br />
We also aim to characterize various criteria which would have to be known in order for researchers to start using it as a novel chassis. In addition to characterizing its growth requirements and BioBrick compatibility, we hope to sequence its genome to gain more insight into its metabolic pathways and novel genes.<br />
<br /><br /><br />
Finally, we want to assess whether public opinion would favour the less known but safer <i>Citrobacter freundii</i> over <i>Escherichia coli</i>, which may have a bad reputation due to its association with disease, sewage and ability to become pathogenic if exposed to wild type strains.<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/ProjectTeam:Edinburgh/Project2012-10-26T16:17:38Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
cursor: default;<br />
color: #000;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
/*background-image: url('https://static.igem.org/mediawiki/2012/d/de/Edi-project-bg-5.png');<br />
background-repeat: no-repeat;*/<br />
border:1px solid #ccc;<br />
}<br />
#project-abstract-video{<br />
margin-top:20px;<br />
margin-left:120px;<br />
border:1px solid #a8a8a8;<br />
padding:4px;<br />
border-radius:4px;<br />
box-shadow:0px 0px 5px #a8a8a8;<br />
background:#f2f2f2;<br />
width:560px;<br />
}<br />
</style><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="normal-text"><br />
In the spirit of iGEM, our project’s aim is to design new biological systems that will make synthetic biology more accessible and friendly. Our team plans to achieve this by constructing a bio-electric interface, designing new selectable and counterselectable markers and characterising <i>Citrobacter freundii</i> to start a dialogue on what a synthetic-biology specific chassis should look like. <span class="intense-emphasis">For more detailed information on each of these sub-projects, refer to the links in the navigation menu on the left.</span><br />
<br /><br /><br />
However, if you are short for time, you may want to have a look at <span class="plainlinks"><a href="http://dl.dropbox.com/u/108285418/EdiGEM%20-%20iGEM%20Edinburgh%202012.pdf"><b>EdiGEM's Concise Project Description</b></a></span>.<br />
</p><br />
<p class="h1"><br />
Project Abstract<br />
</h1><br />
<div id="project-abstract-video"><br />
<iframe class="project-abstract" width="560" height="315" src="http://www.youtube.com/embed/wnd77MsyMi4" frameborder="0" allowfullscreen></iframe><br />
</div><!-- /project-abstract-video --><br />
<p class="h2"><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface">Bioelectric interface</a><br />
</p><br />
<p class="normal-text"><br />
As part of our project we will attempt to create a bioelectric interface - a way to connect biological and electronic systems in a standardised, inducible and quantifiable way.<br />
<br /><br /><br />
To achieve our goal we will use the MtrCAB proteins (cytochromes, proteins that mediate electron transport) from <i>Shewanella oneidensis</i>. We will transform <i>E. coli</i> with these genes along with a <i>ccm</i> gene cluster (cytochrome c maturation proteins) and couple it to an inducible promoter such as the Ars or Lac promoters which are induced by arsenate or lactose/IPTG.<br />
<br /><br /><br />
As a result, we should be able to obtain a system that would allow us to measure the rate of electron export in response to an input of arsenate or IPTG. Possible methods to measure electron export include measuring the transfer of electrons to an electrode with a volt meter by comparing it to a reference electrode; construction of a microbial fuel cell or the use of the ferrozine assay to measure the rate of reduction of iron (III) ions to iron (II).<br />
<br /><br /><br />
We are also looking at two ways of making genetically modified bacteria safer to release into the environment:<br />
</p><br />
<p class="h2"><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers">Alternative Selectable and counter-selectable markers</a><br />
</p><br />
<p class="normal-text"><br />
Alternative to antibiotic resistance: We are investigating other ways to distinguish between the cells which have taken up the plasmid in question and those which have not in order to eliminate the need for antibiotic resistance selection. This would reduce the spreading of antibiotic resistance genes if an engineered bacterium were to be released into the environment either deliberately or by accident.<br />
</p><br />
<p class="h2"><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii">Chassis characterization: <i>Citrobacter freundii</i></a><br />
</p><br />
<p class="normal-text"><br />
We intend to characterize this 'friendly lemon bacterium' (a member of the gamma-proteobacteria, like <i>Escherichia coli</i>) in order to assess whether it would be a good chassis for cloning and gene expression within synthetic biology and beyond. We want to see what it can offer to this field to assess whether there are some new things it can do, or can do better than <i> E. coli </i>, the legacy chassis. We want to start a dialogue about what a synthetic biology-specific chassis should look like, what it should be able to do and what should be known about it before it could be considered a good alternative for the currently existing chassis.<br />
<br /><br /><br />
We also aim to characterize various criteria which would have to be known in order for researchers to start using it as a novel chassis. In addition to characterizing its growth requirements and BioBrick compatibility, we hope to sequence its genome to gain more insight into its metabolic pathways and novel genes.<br />
<br /><br /><br />
Finally, we want to assess whether public opinion would favour the less known but safer <i>Citrobacter freundii</i> over <i>Escherichia coli</i>, which may have a bad reputation due to its association with disease, sewage and ability to become pathogenic if exposed to wild type strains.<br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/NitroreductaseTeam:Edinburgh/Project/Non-antibiotic-Markers/Nitroreductase2012-10-26T16:04:33Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#pSB1C3-primers,<br />
#pSB1C3-seq,<br />
#pSB1C3-method,<br />
#Plac-lacZ-method,<br />
#PstI{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig1, #fig2, #fig3,<br />
#fig4, #fig5, #fig6{<br />
height:0px;<br />
margin:5px;<br />
}<br />
#fig1, #fig3{<br />
margin-left:240px;<br />
}<br />
#fig2, #fig5, #fig6{<br />
margin-left:300px;<br />
}<br />
#fig4{<br />
margin-left:310px;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'pSB1C3-method'){<br />
document.getElementById('fig1').style.height="auto";<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
if(x == 'Plac-lacZ-method'){<br />
document.getElementById('fig3').style.height="auto";<br />
document.getElementById('fig4').style.height="auto";<br />
document.getElementById('fig5').style.height="auto";<br />
document.getElementById('fig6').style.height="auto";<br />
}<br />
if(x == 'PstI'){<br />
document.getElementById('fig7').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'pSB1C3-method'){<br />
document.getElementById('fig1').style.height="0px";<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
if(x == 'Plac-lacZ-method'){<br />
document.getElementById('fig3').style.height="0px";<br />
document.getElementById('fig4').style.height="0px";<br />
document.getElementById('fig5').style.height="0px";<br />
document.getElementById('fig6').style.height="0px";<br />
}<br />
if(x == 'PstI'){<br />
document.getElementById('fig7').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Nitroreductase (<i>nfsI</i>)<br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
Nitroreductase is an <i>Enterobacter cloacae</i> enzyme which reduces nitrogen containing compounds <a href="#bibliography" onclick="expand('works-cited');">(Nicklin & Bruce, 1998)</a>. Other nitroreductases were found to convert nitro drugs such as metronidazole into their active forms, which is an essential part of their toxicity <a href="#bibliography" onclick="expand('works-cited');">(Nillius, Muller, & Muller, 2011)</a>. Bearing this in mind, we decided to look into nitroreductase's potential as a counter-selectable marker.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="h3"><br />
pSB1C3-nitroreductase (<a href="http://partsregistry.org/Part:BBa_K917004">BBa_K917004</a>)<br />
</p><br />
<p class="normal-text"><br />
The <i>nfsI</i> gene was cloned using these <a class="cursor-pointer" onclick="expand('pSB1C3-primers');">primers</a> and inserted into the standard BioBrick vector pSB1C3. This construct was confirmed through <a class="cursor-pointer" onclick="expand('pSB1C3-seq');">sequencing</a>.<br />
<a class="cursor-pointer" onclick="expand('pSB1C3-method')">Method</a>.<br />
</p><br />
<p class="normal-text" id="pSB1C3-primers"><br />
<br /><i>Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat<br /><br />
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT<br /></i><br />
<a class="cursor-pointer" onclick="collapse('pSB1C3-primers');">Close the primers.</a><br />
</p><br />
<p class="normal-text" id="pSB1C3-seq"><br />
<i>Sequencing results:<br /><br />
aacttataaatattcttaggcttatctctagggaggatttctggaattcgcggccgcttctagagcaccaggagttgttctggatatgatttctgtcgccctgaaacggcactccaccaaggcgttcgaccc<br />
cgctaaaaaactgaccgcatacgatccggaaaagatcaaacccctgctgcaataccgtccgtccaacaccctgtcccagccgtggcactttattgtccttgcaccgaggaaggtaaaccttgcgtggtttcc<br />
tctgccgaaagcacttacgtcttctacgatcgcaaaacgctggacgcttctctcgtggtggtgttctgcgcgaaaaccgcttcggatgatgccttcatggaacgcttggtggatcatgaagaacccgatggc<br />
cggt</i><br />
<br /><br />
<a class="cursor-pointer" onclick="collapse('pSB1C3-seq');">Close the sequencing results.</a><br />
</p><br />
<p class="normal-text" id="pSB1C3-method"><br />
<i>Method: The nitroreductase PCR product was purified and digested with EcoRI HF and SpeI together with pSB1C3. These were ligated, E.coli cells transformed with the ligation and the white colonies (RFP disruption) were miniprepped. Detailed methods can be found in methods section.</i><br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/9/9e/Markers-fig01.JPG"><br /><br />
Figure 1: DNA gel of PCR product of BS-nitred with primers specific for nitroreductase. The product is around 0.6-0.7 kb which corresponds to the size of nitroreductase gene, around 0.6 kb.<br /><br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/d/d3/Markers-fig02.JPG"><br /><br />
Figure 2: DNA gel of pSB1C3-nitroreductase ligation. The band is around 2.5-2.6 kb which corresponds to the vector pSB1C3 (around 2 kb) together with the nitroreductase (0.6 kb). Sample 2 was confirmed with sequencing.<br /><br />
<a class="cursor-pointer" onclick="collapse('pSB1C3-method')">Close the method.</a><br />
</p><br />
<p class="h3"><br />
<br />Plac-lacZ'-nitroreductase (<a href="http://partsregistry.org/Part:BBa_K917005">BBa_K917005</a>)<br />
</p><br />
<p class="normal-text"><br />
A promoter and a reporter gene were then added in front of the nitroreductase gene (Plac-lacZ').<br />
<a class="cursor-pointer" onclick="expand('Plac-lacZ-method')">Method</a>.<br />
</p><br />
<p class="normal-text" id="Plac-lacZ-method"><br />
<i>Method: The sequence confirmed pSB1C3- nitroreductase was digested with EcoRI HF and XbaI while Edinbrick1 was digested with EcoRI HF and SpeI. These were ligated together. The ligations were transformed into cells and the transformants plated on LB+chloramphenicol+IPTG+Xgal plate. The blue colonies (contain lacZ) were used for the following experiments. Colony PCR screen of pooled blue Plac-lacZ'-nitroreductase transformants with lacZ forward primer and reverse nitroreductase primer showed a band corresponding to lacZ-nitroreductase.</i><br /><br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/4/42/Markers-fig03.JPG"><br /><br />
<i>Figure 3: DNA gel with Colony PCR products of pooled blue Plac-lacZ'-nitroreductase transformants with lacZ forward primer and reverse nitroreductase primer resulted in in bands around 1.2-1.3 kb which correspond to nitroreductase (0.6 kb) plus lacZ (0.6 kb).<br />
<br /><br /><br />
To confirm the presence of Plac-lacZ'-nitroreductase in pSB1C3, the samples in the smallest pool were minipreped, digested with EcoRI and SpeI to check the size of the insert.<br />
</i><br /><br />
<img id="fig4" src="https://static.igem.org/mediawiki/2012/a/a0/Markers-fig04.JPG"><br /><br />
<i>Figure 4: DNA gel with Plac-lacZ'-nitroreductase which was digested with EcoRI HF and SpeI. The biggest band is likely to correspond to pSB1C3 around 2.2-2.3 kb, the middle band is likely to correspond to Plac-lacZ'-nitroreductase around 1.5 kb and the smallest fragment is unknown.</i><br /><br />
<img id="fig5" src="https://static.igem.org/mediawiki/2012/5/5a/Markers-fig05.JPG"><br /><br />
<i>Figure 5: DNA gel with Plac-lacZ'-nitroreductase which was digested with EcoRI HF to linearise the DNA. There are two distinctive bands, one around 3.0 kb and one around 3.6 kb likely to correspond to pSB1C3 with Plac-lacZ'-nitroreductase and Plac-lacZ'.</i><br /><br />
This DNA was further purified to give a single plasmid corresponding to Plac-lacZ'-nitroreductase. <br /><br />
<img id="fig6" src="https://static.igem.org/mediawiki/2012/a/a8/G8.png"><br /><br />
Figure 6: DNA gel of Plac-lacZ'-nitroreductase digested with XbaI and PstI. The band around 1.2 kb corresponds to the Plac-lacZ'-nitroreductase fragment while the band at 2 kb corresponds to the vector. The band just above 3 kb is likely to be the undigested plasmid.<br />
<br />
<a class="cursor-pointer" onclick="collapse('Plac-lacZ-method')">Close the method.</a><br /><br />
</p><br />
<p class="h3"><br />
<br />PstI restriction site <a class="cursor-pointer" onclick="expand('PstI');">(expand)</a><br />
</p><br />
<p class="normal-text" id="PstI"><br />
<i>The original <a href="http://www.ncbi.nlm.nih.gov/nuccore/M63808.1">sequence</a> used for primer design has a PstI restriction site, but our sequencing results suggests that there is no such site. The sequence confirmed pSB1C3-nitroreductase was digested with PstI and run alongside an undigested sample.</i><br /><br />
<img id="fig7" src="https://static.igem.org/mediawiki/2012/0/00/Markers-fig06.JPG"><br /><br />
<i>Figure 7: DNA gel with pSB1C3-nitroreductase undigested and digested with PstI. Only one band at around 3 kb is visible corresponding to the linearized plasmid confirming that there is no PstI restriction site.</i><br />
<a class="cursor-pointer" onclick="collapse('PstI')">Close the method.</a><br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="h3"><br />
Specific activity- BS-nitred<br />
</p><br />
<p class="normal-text"><br />
Before cloning the nitroreductase gene into the BioBrick vector, 3 different plasmids containing 3 nitroreductase genes with different promoters (and a control containing no nitroreductase gene) were used to test nitroreductase specific activity. The method is detailed in the methods section.<br />
<br /><br /><br />
The change of NADH concentration was estimated by the change of OD340 absorbance per minute, background is subtracted and specific activity calculated. The results are presented in the diagram below. The experiment was done in triplicate. The control only had DMSO instead of DNBA substrate(which was used dissolved in DMSO) showed no change in absorbance (data not shown). <br /><br />
<img id="fig8" src="https://static.igem.org/mediawiki/2012/7/76/Specific_activity_nitroreductase.jpg"><br /><br />
Figure 8: Comparison of the specific activity of 3 nitroreductase genes in different vectors with different promoters and control. Error bars show the standard error of the mean. <br />
<br /><br /><br />
BS-nitred was used further for characterisation experiments as it showed the highest specific activity.<br />
<br />
</p><br />
<p class="h3"><br />
Specific activity- Plac-lacZ'-nitroreductase in pSB1C3<br />
</p><br />
<p class="normal-text"><br />
Specific activity was assessed in the BioBricked nitroreductase using the same method.The results are shown in the diagram below. The experiment was done in triplicate. <br /><br />
<img id="fig9" src="https://static.igem.org/mediawiki/2012/9/97/Data_3.jpg"><br /><br />
Figure 9: Comparison of the specific activity of the BioBricked nitroreductase gene and control under induced and uninduced conditions (+ and - IPTG respectively). Error bars show the standard error of the mean. <br />
<br /><br /><br />
This graph shows that only the Plac-lacZ'-nitroreductase with IPTG induction shows nitroreductase activity. In addition, this activity is similar to the nitroreductase in the BlueScript vector(diagram above). <br /><br />
</p><br />
<p class="h3"><br />
<br /><a name="plates">Plates</a><br />
</p><br />
<p class="normal-text"><br />
The following characterization results are produced from the pre-BioBrick form of nitroreductase (nitroreductase in BlueScript vector with lac promoter). Due to the similarity of the vectror, the identical regulation and very similar specific activity (previous section), we believe that the BioBricked Plac-lacZ'-nitroreductase will behave very similarly.<br /><br />
To determine the relative toxicity of different compounds, 5 ul of DMSO, MTZ and DNBA were added at three distinct spots on a freshly spread plate and the amount of clearing was measured (in centimeters).<br /><br /><br />
<img id="table1" src="https://static.igem.org/mediawiki/2012/4/43/Markers-table1.JPG"><br />
<br /><br /><br />
DMSO was determined to be non-toxic, DNBA showed small difference between the different strains while MTZ distinctively more toxic to BS-nitred and BS-contol.<br />
<br /><br /><br />
Numerous plate experiments with MTZ concentration ranging from 0 ug/ml to 300 ug/ml and various concentrations of DNBA and NFT were made to determine concentrations at which BS-control was growing but where BS-nitred’s growth is inhibited. Similar growth patterns were observed in DNBA and NFT plates. All metronidazole experiments showed inhibited growth of BS-nitred in comparison to BS-control however the inhibition was never 100 %, which is required for nitroreductase to be used as a counterselectable marker.<br /><br /><br />
<img id="fig10" src="https://static.igem.org/mediawiki/2012/5/5a/Markers-fig08.JPG"><br /><br /><br />
Figure 10: Overnight plates with 100 ug/ml MTZ concentration with and without IPTG with different nitroreductase strains and control. BS-nitred’s growth was inhibited in comparison with BS-control however there are still some BS-nitred colonies growing.<br /><br /><br />
<img id="fig11" src="https://static.igem.org/mediawiki/2012/2/2d/Markers-fig09.JPG"><br /><br /><br />
Figure 11: Comparison of growth of BS-contol and BS-nitred at 90 ug/ml metronidazole. BS-nitred’s growth is clearly inhibited in comparison to BS-control however growth inhibition is not absolute. <br />
We could not find a concentration of metronidazole at which nitroreductase containing cells’ growth was inhibited while control cells were growing. We determined that this gene is not suitable as a counter-selectable marker on plates.<br />
</p><br />
<p class="h3"><br />
<br />Liquid cultures<br />
</p><br />
<p class="normal-text"><br />
The growth of nitroreductase-containing and control strains was assessed in liquid medium as well. The cells were grown in aerobic or anaerobic conditions with and without MTZ, in triplicate. <br /><br />
<img id="fig10" src="https://static.igem.org/mediawiki/2012/e/e4/Markers-fig10.JPG"><br /><br />
Figure 10: Comparison of growth patterns of BS-nitred and BS-control in 150 ug/ml metronidazole in aerobic cultures. Initial OD600 was extracted and error bars are standard error of the mean.<br /><br />
<img id="fig11" src="https://static.igem.org/mediawiki/2012/a/a8/Markers-fig11.JPG"><br /><br />
Figure 11: Comparison of growth patterns of BS-nitred and BS-control in 150 ug/ml metronidazole in anaerobic cultures. Initial OD600 was extracted and error bars are standard error of the mean.<br />
<br /><br /><br />
The results in aerobic cultures are promising since nitroreductase-containing cells have not grown while the control cells are growing.<br />
Once we obtained the BioBricked version of <i>nfsI</i>, we proceeded to testing this construct to show that it has similar activity to the gene in the BlueScript vector. Transformants and controls were incubated overnight in LB bottles containing either no, or 150ug/ml, metronidazole and OD readings were taken the following day. These results can be seen in Figure 12 below.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/5/54/EdiGEM-Fig12.png"><br />
<br /><br />
Figure 12: Comparison of growth between cells transformed with pSB1C3 plasmids containing either <i>nfsI</i> or control. 150 ug/ml metronidazole was added to bottles that contain it. <br />
</p><br />
<p class="h2"><br />
<i> Citrobacter freundii </i> characterisation<br />
</p><br />
<p class="normal-text"><br />
We tried to see whether this construct would work in <i>Citrobacter freundii </i>, but we did not find a metronidazole concentration that inhibited its growth (we tried adding metronidazole up the concentration of 350ug/ml but this still gave an OD reading of 0.766). <br />
<br /><br /><br />
We have measured nitroreductase activity in the <i>nfsI</i> and control transformants and have found that the specific activity of nitroreductase was 14U/mg in the <i>nfsI</i> transformant, which is much higher than the specific activity we found in <i> E. coli </i> this is consistent with the finding that the Lac promoter is much stronger in <i> Citrobacter freundii </i>, as it is unregulated.<br />
<br /><br /><br />
Since the nitroreductase enzyme itself seems to be working fine, it could mean that <i> Citrobacter freundii </i> is inherently resistant to activated metronidazole, so this is not a good counter-selectable marker option for <i> Citrobacter freundii </i>.<br />
<br /><br /><br />
This is not necessarily a problem, as we have shown that our other counterselectable marker, <i>sacB</i> works very well in <i> Citrobacter freundii </i>, so that gene could instead be used for counterselection in this organism.<br />
</p><br />
<p class="h2"><br />
Conclusions<br />
</p><br />
<p class="normal-text"><br />
<ul style="list-style-type:circle;padding:10px;"><br />
<li>We successfully cloned the nitroreductase gene and inserted it into the BioBrick vector.<br /><br /></li><br />
<li>We extensively characterized the nitroreductase gene on plates and in liquid cultures.<br /><br /></li><br />
<li>We troubleshooted the Plac-lacZ'-nitroreductase clone and managed to purify it. <br /><br /></li><br />
<li>We are developing novel (to the best of our knowledge) counter-selection system which may have advantages over currently used systems.<br /><br /></li><br />
<li>We determined that nitroreductase is most suitable as a counter-selectable marker for <i>E. coli</i>in liquid aerobic cultures at 150 ug/ml metronidazole.</li><br />
</ul><br />
<br /><br /><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/wiki/index.php?title=Team:Edinburgh/Project/Non-antibiotic-Markers"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-nitroreductase a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-HydrolaseTeam:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase2012-10-26T16:01:57Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#CscA-primers,<br />
#CscA-method,<br />
#figure1,<br />
#figure2,<br />
#figure3{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig12{<br />
height:0px;<br />
margin:5px;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
document.getElementById('fig12').style.height="auto";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="auto";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
document.getElementById('fig12').style.height="0px";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="0px";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Sucrose Hydrolase <i> (cscA)</i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
Sucrose hydrolase is an enzyme from <i>Escherichia coli</i> O157:H7 strain Sakai which is involved in sucrose utilisation <a href="#bibliography" onclick="expand('works-cited');">(Jahreis, et al., 2002)</a>. Transforming <i>Escherichia coli</i> K12 strains with sucrose hydrolase allows the cells to grow with sucrose as a sole carbon source, something the untransformed K12 strain cannot do. This allows this gene to be used as a selectable marker.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="h3"><br />
<i>cscA</i> cloning <br />
</p><br />
<p class="normal-text"><br />
The <i>cscA</i> gene was cloned PCR with <i>cscA</i> specific primers. <a onclick="expand('figure1');">Figure 1.</a><br />
</p><br />
<p class="normal-text" id="figure1"><br />
<br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/0/06/G1.png"><br /><br />
Figure 1: DNA gel of PCR amplification with primers specific for <i> cscA </i>. The product is around 1.4-1.5 kb which corresponds to the size of <i> cscA </i> gene, around 1.5 kb.<br /><br /><br />
<a onclick="collapse('figure1');">Close figure 1.</a><br />
</p><br />
<p class="normal-text"><br />
<br />This fragment was inserted into the standard BioBrick vector pSB1C3. <a onclick="expand('figure2');">Figure 2.</a><br />
</p><br />
<p class="normal-text" id="figure2"><br />
<br /><br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/8/85/G2.png"><br /><br />
Figure 2:DNA gel of pSBIC3-<i>cscA</i> ligation digested with EcoRI in order to linearise the plasmid. The band is around 3.5 kb which corresponds to the vector pSBIC3 (around 2 kb) together with the <i>cscA</i> gene (arounf 1.5 kb)<br /><br /><br />
<a onclick="collapse('figure2');">Close figure 2.</a><br />
</p><br />
<p class="normal-text"><br />
<br />A promoter and a reporter gene were added in front of the <i>cscA</i> gene (Plac-lacZ'). <a onclick="expand('figure3');">Figure 3.</a><br />
</p><br />
<p class="normal-text" id="figure3"><br />
<br /><br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/e/e2/G9.png"><br /><br />
Figure 3: DNA gel of pSB1C3-Plac-lacZ'-cscA digested with XbaI and PstI. The clear band just above 2kb corresponds both to the size of the vector and the Plac-lacZ'-cscA fragment. The band around 4 kb is likely to correspond to the undigested plasmid. <br /><br /><br />
<a onclick="collapse('figure3');">Close figure 3.</a><br />
</p><br />
<br />
<p class="h3"><br />
cscA selection plasmid<br />
</p><br />
<p class="normal-text"><br />
In order to create a <i>cscA</i> selection plasmid, we wanted to replace the chloramphenicol resistance in pSB1C3 with <i>cscA</i>. The <i>cscA</i> and pSB1C3 gene were cloned using these <a class="cursor-pointer" onclick="expand('CscA-primers');">primers</a>. <a class="cursor-pointer" onclick="expand('CscA-method')">Method</a>. However, this resulted in no successful pSB1C3-cscA ligation transformants.<br />
</p><br />
<p class="normal-text" id="CscA-primers"><br />
<br /><i>Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat<br /><br />
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT<br /></i><br />
<img id="fig12" src="https://static.igem.org/mediawiki/2012/7/75/Markers-fig12.JPG"><br /><br />
<i>Figure 1: DNA gel of PCR products of pSB1C3 without chloramphenicol and <i>cscA</i>. One product is around 1.4 kb which corresponds to the size of <i>cscA</i> gene, the other is around 2.2 kb which corresponds to the pSB1C3 vector without cml resistance.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-primers');">Close the primers.</a><br /><br />
</p><br />
<p class="normal-text" id="CscA-method"><br />
<br /><i>Method: The purified <i>cscA</i> and psB1C3 PCR products were digested with NdeI and ClaI. Both products were ligated and E.coli cells transformed with the ligation.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-method');">Close the method.</a><br /><br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="h3"><br />
Plates<br />
</p><br />
<p class="normal-text"><br />
Plate characterisation showed that <i>cscA</i> is a suitable selectable marker- only cells which had the gene grew on sucrose as a sole carbon sourse (Figure 4). The drawback of this antibiotic-free selectable marker is that more time is required for the growth of the <i>cscA</i> cells on sucrose plates (overnight at 37°C+4 days at room temperature).<br />
<br /><br /><br />
<img id="fig13" src="https://static.igem.org/mediawiki/2012/2/26/Markers-fig13.JPG"><br /><br />
Figure 4: <i>cscA</i> cells (bottom row) as well as control cells (top row) were spread on LB plate, minimal plate with sucrose, minimal plate with glucose and minimal plate with no sugars. Neither the <i>cscA</i> nor the control cells grow on minimal media with no sugars and grew well on LB and minimal plate with glucose. However, <i>cscA</i> cells are growing on minimal media with sucrose while the control cells are not.<br />
</p><br />
<p class="h3"><br />
Liquid Cultures<br />
</p><br />
<p class="normal-text"><br />
In order to better quantify our results, we have decided to grow our transformants in liquid media and measure OD after overnight incubation. We set up bottles with the same media as we have used for the plates (LB, M9 minimal medium with no sugars, M9 with 1% glucose and M9 with 1% sucrose), inoculated them with <i>cscA</i> or control transformants grown overnight and incubated them overnight before measuring OD. The results can be seen in Figure 5 below.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/2/2e/EdiGEM-Fig5.png"><br />
<br /><br />
Figure 5: Comparison of growth between cells containing the sucrose hydrolase (<i>cscA</i>) selectable marker and control. LB and M9 glucose were used as positive controls, M9 with no sugars was used as a negative control.<br />
</p><br />
<p class="h2"><br />
<a name="xylitol">Citrobacter xylitol selection marker strategy</a><br />
</p><br />
<p class="normal-text"><br />
In addition to <i> E. coli</i>, we were also working with the organism <i>Citrobacter freundii</i> over summer. <br /><br /><br />
Unfortunately, we could not test our sucrose hydrolase selection system in this organism, as it can already degrade sucrose naturally. We have therefore devised the concept for an alternative sugar selection system that could be used in <i>Citrobacter freundii</i>. This sugar selection system is based on the sugar alcohol xylitol – our <a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use#liquid-media"><i>Citrobacter freundii</i> sugar use experiments</a> show that it cannot grow on this sugar as a sole carbon source, so it seems to be an ideal candidate for selectable marker design.<br />
<br /><br /><br />
As some organisms <i>can</i> use and degrade xylitol, we have found an enzyme, called <vb>xylitol dehydrogenase </b>, which oxidizes xylitol to xylulose. This gene can be found in (for example) the gram negative rod <i> Gluconobacter oxydans </i> which is also friendly to humans, as it is not known to be pathogenic and in addition it is also used in various fields of biotechnology for example in the construction of bionsensors or for vinegar, vitamin C or sorbitol production.<br />
<br /><br /><br />
The cloning strategy could be the same as was used to make the sucrose hydrolase BioBrick and assessing its effectivity could also be done following the same protocols, but of course, replacing sucrose with xylitol where needed. <br />
<br /><br /><br />
This non-antibiotic selectable marker could be coupled up with our levansucrase (<i>sacB</i> counterselectable marker to form a selection-counterselection cassette that depends entirely on the presence of sugars, rather than antibiotics.<br />
</p><br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
<ul style="padding-left:10px; list-style-type:circle;"><br />
<li>We successfully cloned the sucrose hydrolase gene and inserted it into the BioBrick vector. (<a href="http://partsregistry.org/Part:BBa_K917000">BBa_K917000</a>)<br /><br /></li><br />
<li>We extensively characterised the sucrose hydrolase gene on plates and in liquid cultures.<br /><br /></li><br />
<li>We determined its suitability as a selectable marker.</li><br/<br/><br />
<li>We have developed a conceptual sugar-based selection system for <i>Citrobacter freundii </i></li><br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Nitroreductase"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/DhlA"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-sucrose-hydrolase a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacBTeam:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacB2012-10-26T15:59:58Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#plasmid,<br />
#method,<br />
#sequencing{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig17,<br />
#fig18,<br />
#fig19{<br />
height:0px;<br />
margin:5px;<br />
}<br />
#fig20,<br />
#fig21,<br />
#fig22{<br />
width:100%;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="auto";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="auto";<br />
document.getElementById('fig19').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="0px";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="0px";<br />
document.getElementById('fig19').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Levansucrase <i>(sacB) </i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
SacB is the levansucrase enzyme from <i>Bacillus subtilis</i> <a href="#bibliography" onclick="expand('works-cited');">(Gay, Coq, Strinmetz, Ferrari, & Hoch, 1983)</a> which converts sucrose into fructose polymers which are lethal to <i>Esherichia coli</i> <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. This part was deposited into the Registry by Team Edinburgh 2010 and can be used as a counter selectable marker <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. Our aim is to improve the part by assessing its counter selection efficiency.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="normal-text"><br />
The plac-RFP fragment was obtained from the standard BioBrick <a class="cursor-pointer" onclick="expand('plasmid');">plasmid</a> and inserted in front of the sacB BioBrick. <a class="cursor-pointer" onclick="expand('method');">Method</a>. The construct was confirmed with <a class="cursor-pointer" onclick="expand('sequencing');">sequencing</a>.<br />
</p><br />
<p class="normal-text" id="plasmid"><br />
<br /><i>PCR of pSB1K3 plasmid (Kanamycin resistance) with psBNX3 insF2 forward primer (specific for BioBrick prefix) and dsred r2 reverse primer (specific for RFP) was prepared in order to obtain the plac-RFP fragment.</i><br /><br />
<img id="fig17" src="https://static.igem.org/mediawiki/2012/3/3b/Markers-fig17.JPG"><br /><br />
<i>Figure 1: DNA gel of the PCR product from pSB1K3 amplification with primers specific to the BioBrick prefix and RFP. The band is abound 1 kb which corresponds to the expected size of plac-RFP.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('plasmid');">Close the plasmid.</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><i>The plac-RFP PCR product was purified and digested with EcoRI HF and SpeI. The <i>sacB</i> BioBrick deposited in 2010 <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a> was digested with EcoRI and XbaI. These were ligated together after purification. <i>E.coli</i> cells were transformed with the ligation. The red transformants were minipreped, digested with EcoRI HF in order to linearise them and with EcoRI HF and PstI in order to check the size of the insert.</i><br /><br />
<img id="fig18" src="https://static.igem.org/mediawiki/2012/4/4c/Markers-fig18.JPG"><br /><br />
<i>Figure 2: DNA gel of miniprepped red clones of linearized plac-RFP-SacB ligation transformants. The band is around 4.5 kb which corresponds to pSB1C3 (2kb)+ +</i><br /><br />
<img id="fig19" src="https://static.igem.org/mediawiki/2012/1/10/Markers-fig19.JPG"><br /><br />
<i>Figure 3: The same clones were digested with EcoRI HF and PstI to check the size of the insert. The band is around 2.5 kb which corresponds to SacB (1.5 kb)+ plac-rfp (1kb).</i><br /><br />
<a class="cursor-pointer" onclick="collapse('method');">Close the method.</a><br /><br />
</p><br />
<p class="normal-text" id="sequencing"><br />
<br /><i>Sequencing results<br />Forward primer:<br /><br />
Ctttaaaaaaaatcccttagctttcgctaaggtgatttctggaattcgcggccgcttctagagcaatac<br />
gcaaaccgtttcaccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactgga<br />
aagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacact<br />
ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagataaaga<br />
ggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcttatgga<br />
aggttccgttaactgtcactagttcgaaatcgaaggtgaatgtgaaggtcgtccgtactaaggtaccca<br />
gactgctaaactgaaagttactaaag<br />
<br /><br /><br />
Reverse primer:<br /><br />
aggggccttaaacataaacttttcggttttagaaaagggcagggtggtgacaccttgcccttttttgcc<br />
ggactgcagctactagtaatttatttgttaactgttaattgtccttgttcaaggatgctgtctttgaca<br />
acagatgttttcttgcctttgatgttcagcaggaagcttggcgcaaacgttgattgtttgtctgcgtaa<br />
aatcctctgtttgtcatatagcttgtaatcacgacattgtttcctttcgcttgaggtacagcgaagtgt<br />
gagtaattaaaggttacatcgttaggatcaagatccatttttaacacatggcctgttttgttcagcggc<br />
ttgtatgggccatttaaagaattagaaactttaccaagcatgttaatatcgttagacttatttccgtca<br />
atccttatttttgatccgcgggagtcatttaacaggtaccatttgccgttcattttattttcgttcgcg<br />
cgtctatttctttttgttactttgttttatgcaatcacgttttcattccttttttaattttgtatcatcgt</i><br /><br />
<a class="cursor-pointer" onclick="collapse('sequencing');">Close the sequencing results.</a><br /><br />
</p><br />
<p class="normal-text"><br />
<br />The idea of placing <i>sacB</i> under the control of the lac promoter is to create kanamycin-independent control. Moreover, by changing the IPTG levels, the level of selection can be controlled.<br />
<br /><br /><br />
RFP is added to ensure that cells which have lost the cassette (should be white because of loss of RFP) can be distinguished from cells which have lost SacB function (should be red as RFP is still present). This would allow us to assess the counter-selection efficiency of SacB.<br /><br />
We also prepared a Kan-plac-RFP-sacB selection-counterselection cassette. <br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="normal-text"><br />
The growth of SacB (bottom) and a control (top) were tested by adding 1.3 g solid sucrose plus 0.5 ml sterile water into a well in the middle of the plate. <br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/7/79/SAM_3111.JPG"><br /><br />
Figure 1: A quick test of SacB transformants' growth in the presence of sucrose. The growth of SacB (bottom) is inhibited near the well in comparison to the control (top). <br />
</p><br />
<p class="h3"><br />
<i>Citrobacter freundii</i><br />
</p><br />
<p class="normal-text"><br />
<i>SacB</i> and control (pSB1C3 only) transformants were streaked onto LB plates (with either cml40 or cml15) and solid sucrose was added to the regions indicated by the crosses or circles in Figure 2. The plates were incubated at 37&deg;C overnight.<br />
<br /><br /><br />
<img id="fig20" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114357.jpg" border="0"/><br />
<br /><br />
Figure 2: A quick test of <i>sacB</i> and control’s ability to grow in the presence of sucrose. The zone of clearance indicates that the cells containing <i>sacB</i> are inhibited by sucrose while the controls are unaffected. The control on the plate on the right is purple due to both expressing the RFP gene and turning blue because of the X-gal on the plate.<br />
<br /><br /><br />
The bottom streak on plate on the left in Figure 1 contains cells that have the selection-counterselection cassette so this test shows that the counterselection component of the cassette is working. <br />
<br /><br /><br />
We also tested the selection component of this cassette by streaking the cells onto plates containing both chloramphenicol and kanamycin and incubated overnight. These results can be seen in Figure 3.<br />
<br /><br /><br />
<img id="fig21" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114629.jpg" border="0"/><br />
<br /><br />
Figure 3: Plate showing that the kanamycin resistance component of the selection-counterselection cassette works. The control did not grow at all, even after 4 days, as it was inhibited by the kanamycin, while the cells containing the cassette show growth. Growth is weaker because we have found that using the concentration of chloramphenicol we normally use (cml40) in combination with the sacB in <i>Citrobacter freundii</i> causes slower growth, presumably because levansucrase expression is unregulated in these bacteria which puts a strain on the cell.<br />
</p><br />
<p class="h3"><br />
Sugar-dependent selection-counterselection cassette concept<br />
</p><br />
<p class="normal-text"><br />
The reason we did not use our sucrose hydrolase gene for the selection component of the selection-counterselection cassette was because both it and levansucrase depend on the same substrate – sucrose – for their function, so this would have not yielded good results.<br />
<br /><br /><br />
We have found that <i> Citrobacter freundii </i> can use sucrose as a sole carbon source without the need for the sucrose hydrolase gene – this means that if we want to develop a non-antibiotic resistance-dependent selection-counterselection cassette for this organism, we need to use a different sugar. One sugar that, according to our findings, <i>Citrobacter freundii </i> cannot use is xylitol – see our ‘Xylitol dehydrogenase’ section for more details on this. We could therefore combine this gene with the levansucrase gene to obtain an antibiotic resistance-independent selection-counterselection cassette that dependent entirely on sugars.<br />
</p><br />
<p class="h3"><br />
Levans<br />
</p><br />
<p class="normal-text"><br />
We have found that under sublethal doses of sucrose, the <i>E. coli </i> cells start to secrete a lot of gloopy substance, which we believe to be levans (Figure 4), the fructose polymers formed because of the levansucrase activity. <br />
<br /><br /><br />
<img id="fig22" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121018_132400.jpg" border="0"/><br />
<br /><br />
Figure 4: Secretion of levans outside of the cell – it is only present on the lower two colonies but is absent in the two controls above.<br />
<br /><br /><br />
We find this important to mention, as levans have got several applications in various fields <a href="#bibliography" onclick="expand('works-cited');">(Kang <i>et al.</i>, 2009)</a>.<br />
<br /><br /><br />
<ul id="list"><br />
<li>Food<br />
<ul><br />
<li>has prebiotic effects</li><br />
<li>provides dietary fibres</li><br />
<li>reduces serum cholesterol levels </li><br />
<li>it can be used as a food additive in the following ways: a stabilizer, an emulsifier, a formulation aid, surface-finishing agent, an encapsulating agent, and a carrier of flavours and fragrances </li><br />
</ul><br />
</li><br />
<li>Pharmaceutical industry <br />
<ul><br />
<li>can be used as a coating material for drugs </li><br />
<li>has anti-tumour properties <i>in vitro</i></li><br />
<li>can be used as a blood plasma volume expander</li><br />
<li>has anti-diabetic effects <a href="#bibliography" onclick="expand('works-cited');">(Dahech <i>et al.</i>, 2011)</a></li><br />
<li>levan derivatives are shown to be anti-AIDS agents</li><br />
</ul><br />
</li><br />
<li>Cosmetics<br />
<ul><br />
<li>good as a cell-proliferating agent</li><br />
<li>skin moisturising agent</li><br />
<li>reduces skin irritation</li><br />
</ul><br />
</li><br />
<li>Industry<br />
<ul><br />
<li>it can be used in a two-phase liquid good for the separation of biological samples</li><br />
<li>it can be used an environmentally friendly adhesive</li><br />
<li>it can be used as a temporary adhesive in water-soluble form</li><br />
<li>it can be used as a water-resistant adhesive for a long period of time in cross-linked form</li><br />
<li>it can form a water-resistant film</li><br />
<li>it acts as a cryoprotectant for the preservation of animal cells and fish</li><br />
</ul><br />
</li><br />
</ul><br />
</p><br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
<ul style="padding-left:10px; list-style-type:circle;"><br />
<li>We prepared a plac-RFP-SacB construct which can be used for assessing counter-selection efficiency. (<a href="http://partsregistry.org/Part:BBa_K917002">BBa_K917002</a>)<br /><br /></li><br />
<li>We placed <i>sacB</i> under the lac promoter which allows IPTG dependent control rather than kanamycin dependent control and IPTG concentration-dependent control of the levels of selection.<br /><br /></li><br />
<li>We added RFP to allow distinguishing loss of the counter-selection cassette form loss of SacB fuction.<br /><br /></li><br />
<li>We prepared and characterized a Kan-plac-RFP-sacB selection-counterselection cassette in both <i>E. coli</i> and <i> Citrobacter freundii </i> (<a href="http://partsregistry.org/Part:BBa_K917010">BBa_K917010</a>)</li><br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/DhlA"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Gene-replacement-strategy"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-Plac-RFP-SacB a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
<br />
#list{<br />
list-style-type:circle;<br />
}<br />
#list li{<br />
margin-left:20px;<br />
padding-bottom:10px;<br />
}<br />
#list li ul{<br />
list-style-type:square;<br />
}<br />
#list li ul li{<br />
margin-left:50px;<br />
padding:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/NitroreductaseTeam:Edinburgh/Project/Non-antibiotic-Markers/Nitroreductase2012-10-26T15:59:09Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#pSB1C3-primers,<br />
#pSB1C3-seq,<br />
#pSB1C3-method,<br />
#Plac-lacZ-method,<br />
#PstI{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig1, #fig2, #fig3,<br />
#fig4, #fig5, #fig6{<br />
height:0px;<br />
margin:5px;<br />
}<br />
#fig1, #fig3{<br />
margin-left:240px;<br />
}<br />
#fig2, #fig5, #fig6{<br />
margin-left:300px;<br />
}<br />
#fig4{<br />
margin-left:310px;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'pSB1C3-method'){<br />
document.getElementById('fig1').style.height="auto";<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
if(x == 'Plac-lacZ-method'){<br />
document.getElementById('fig3').style.height="auto";<br />
document.getElementById('fig4').style.height="auto";<br />
document.getElementById('fig5').style.height="auto";<br />
document.getElementById('fig6').style.height="auto";<br />
}<br />
if(x == 'PstI'){<br />
document.getElementById('fig7').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'pSB1C3-method'){<br />
document.getElementById('fig1').style.height="0px";<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
if(x == 'Plac-lacZ-method'){<br />
document.getElementById('fig3').style.height="0px";<br />
document.getElementById('fig4').style.height="0px";<br />
document.getElementById('fig5').style.height="0px";<br />
document.getElementById('fig6').style.height="0px";<br />
}<br />
if(x == 'PstI'){<br />
document.getElementById('fig7').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Nitroreductase (<i>nfsI</i>)<br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
Nitroreductase is an <i>Enterobacter cloacae</i> enzyme which reduces nitrogen containing compounds <a href="#bibliography" onclick="expand('works-cited');">(Nicklin & Bruce, 1998)</a>. Other nitroreductases were found to convert nitro drugs such as metronidazole into their active forms, which is an essential part of their toxicity <a href="#bibliography" onclick="expand('works-cited');">(Nillius, Muller, & Muller, 2011)</a>. Bearing this in mind, we decided to look into nitroreductase's potential as a counter-selectable marker.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="h3"><br />
pSB1C3-nitroreductase (<a href="http://partsregistry.org/Part:BBa_K917004">BBa_K917004</a>)<br />
</p><br />
<p class="normal-text"><br />
The <i>nfsI</i> gene was cloned using these <a class="cursor-pointer" onclick="expand('pSB1C3-primers');">primers</a> and inserted into the standard BioBrick vector pSB1C3. This construct was confirmed through <a class="cursor-pointer" onclick="expand('pSB1C3-seq');">sequencing</a>.<br />
<a class="cursor-pointer" onclick="expand('pSB1C3-method')">Method</a>.<br />
</p><br />
<p class="normal-text" id="pSB1C3-primers"><br />
<br /><i>Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat<br /><br />
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT<br /></i><br />
<a class="cursor-pointer" onclick="collapse('pSB1C3-primers');">Close the primers.</a><br />
</p><br />
<p class="normal-text" id="pSB1C3-seq"><br />
<i>Sequencing results:<br /><br />
aacttataaatattcttaggcttatctctagggaggatttctggaattcgcggccgcttctagagcaccaggagttgttctggatatgatttctgtcgccctgaaacggcactccaccaaggcgttcgaccc<br />
cgctaaaaaactgaccgcatacgatccggaaaagatcaaacccctgctgcaataccgtccgtccaacaccctgtcccagccgtggcactttattgtccttgcaccgaggaaggtaaaccttgcgtggtttcc<br />
tctgccgaaagcacttacgtcttctacgatcgcaaaacgctggacgcttctctcgtggtggtgttctgcgcgaaaaccgcttcggatgatgccttcatggaacgcttggtggatcatgaagaacccgatggc<br />
cggt</i><br />
<br /><br />
<a class="cursor-pointer" onclick="collapse('pSB1C3-seq');">Close the sequencing results.</a><br />
</p><br />
<p class="normal-text" id="pSB1C3-method"><br />
<i>Method: The nitroreductase PCR product was purified and digested with EcoRI HF and SpeI together with pSB1C3. These were ligated, E.coli cells transformed with the ligation and the white colonies (RFP disruption) were miniprepped. Detailed methods can be found in methods section.</i><br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/9/9e/Markers-fig01.JPG"><br /><br />
Figure 1: DNA gel of PCR product of BS-nitred with primers specific for nitroreductase. The product is around 0.6-0.7 kb which corresponds to the size of nitroreductase gene, around 0.6 kb.<br /><br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/d/d3/Markers-fig02.JPG"><br /><br />
Figure 2: DNA gel of pSB1C3-nitroreductase ligation. The band is around 2.5-2.6 kb which corresponds to the vector pSB1C3 (around 2 kb) together with the nitroreductase (0.6 kb). Sample 2 was confirmed with sequencing.<br /><br />
<a class="cursor-pointer" onclick="collapse('pSB1C3-method')">Close the method.</a><br />
</p><br />
<p class="h3"><br />
<br />Plac-lacZ-nitroreductase (<a href="http://partsregistry.org/Part:BBa_K917005">BBa_K917005</a>)<br />
</p><br />
<p class="normal-text"><br />
A promoter and a reporter gene were then added in front of the nitroreductase gene (plac-lacZ).<br />
<a class="cursor-pointer" onclick="expand('Plac-lacZ-method')">Method</a>.<br />
</p><br />
<p class="normal-text" id="Plac-lacZ-method"><br />
<i>Method: The sequence confirmed pSB1C3- nitroreductase was digested with EcoRI HF and XbaI while Edinbrick1 was digested with EcoRI HF and SpeI. These were ligated together. The ligations were transformed into cells and the transformants plated on LB+chloramphenicol+IPTG+Xgal plate. The blue colonies (contain lacZ) were used for the following experiments. Colony PCR screen of pooled blue plac-lacZ-nitroreductase transformants with lacZ forward primer and reverse nitroreductase primer showed a band corresponding to lacZ-nitroreductase.</i><br /><br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/4/42/Markers-fig03.JPG"><br /><br />
<i>Figure 3: DNA gel with Colony PCR products of pooled blue plac-lacZ-nitroreductase transformants with lacZ forward primer and reverse nitroreductase primer resulted in in bands around 1.2-1.3 kb which correspond to nitroreductase (0.6 kb) plus lacZ (0.6 kb).<br />
<br /><br /><br />
To confirm the presence of plac-lacZ-nitroreductase in pSB1C3, the samples in the smallest pool were minipreped, digested with EcoRI and SpeI to check the size of the insert.<br />
</i><br /><br />
<img id="fig4" src="https://static.igem.org/mediawiki/2012/a/a0/Markers-fig04.JPG"><br /><br />
<i>Figure 4: DNA gel with plac-lacZ-nitroreductase which was digested with EcoRI HF and SpeI. The biggest band is likely to correspond to pSB1C3 around 2.2-2.3 kb, the middle band is likely to correspond to plac-lacZ-nitroreductase around 1.5 kb and the smallest fragment is unknown.</i><br /><br />
<img id="fig5" src="https://static.igem.org/mediawiki/2012/5/5a/Markers-fig05.JPG"><br /><br />
<i>Figure 5: DNA gel with plac-lacZ-nitroreductase which was digested with EcoRI HF to linearise the DNA. There are two distinctive bands, one around 3.0 kb and one around 3.6 kb likely to correspond to pSB1C3 with plac-lacZ-nitroreductase and plac-lacZ.</i><br /><br />
This DNA was further purified to give a single plasmid corresponding to plac-lacZ-nitroreductase. <br /><br />
<img id="fig6" src="https://static.igem.org/mediawiki/2012/a/a8/G8.png"><br /><br />
Figure 6: DNA gel of plac-lacZ-nitroreductase digested with XbaI and PstI. The band around 1.2 kb corresponds to the plac-lacZ-nitroreductase fragment while the band at 2 kb corresponds to the vector. The band just above 3 kb is likely to be the undigested plasmid.<br />
<br />
<a class="cursor-pointer" onclick="collapse('Plac-lacZ-method')">Close the method.</a><br /><br />
</p><br />
<p class="h3"><br />
<br />PstI restriction site <a class="cursor-pointer" onclick="expand('PstI');">(expand)</a><br />
</p><br />
<p class="normal-text" id="PstI"><br />
<i>The original <a href="http://www.ncbi.nlm.nih.gov/nuccore/M63808.1">sequence</a> used for primer design has a PstI restriction site, but our sequencing results suggests that there is no such site. The sequence confirmed pSB1C3-nitroreductase was digested with PstI and run alongside an undigested sample.</i><br /><br />
<img id="fig7" src="https://static.igem.org/mediawiki/2012/0/00/Markers-fig06.JPG"><br /><br />
<i>Figure 7: DNA gel with pSB1C3-nitroreductase undigested and digested with PstI. Only one band at around 3 kb is visible corresponding to the linearized plasmid confirming that there is no PstI restriction site.</i><br />
<a class="cursor-pointer" onclick="collapse('PstI')">Close the method.</a><br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="h3"><br />
Specific activity- BS-nitred<br />
</p><br />
<p class="normal-text"><br />
Before cloning the nitroreductase gene into the BioBrick vector, 3 different plasmids containing 3 nitroreductase genes with different promoters (and a control containing no nitroreductase gene) were used to test nitroreductase specific activity. The method is detailed in the methods section.<br />
<br /><br /><br />
The change of NADH concentration was estimated by the change of OD340 absorbance per minute, background is subtracted and specific activity calculated. The results are presented in the diagram below. The experiment was done in triplicate. The control only had DMSO instead of DNBA substrate(which was used dissolved in DMSO) showed no change in absorbance (data not shown). <br /><br />
<img id="fig8" src="https://static.igem.org/mediawiki/2012/7/76/Specific_activity_nitroreductase.jpg"><br /><br />
Figure 8: Comparison of the specific activity of 3 nitroreductase genes in different vectors with different promoters and control. Error bars show the standard error of the mean. <br />
<br /><br /><br />
BS-nitred was used further for characterisation experiments as it showed the highest specific activity.<br />
<br />
</p><br />
<p class="h3"><br />
Specific activity- plac-lacZ-nitroreductase in pSB1C3<br />
</p><br />
<p class="normal-text"><br />
Specific activity was assessed in the BioBricked nitroreductase using the same method.The results are shown in the diagram below. The experiment was done in triplicate. <br /><br />
<img id="fig9" src="https://static.igem.org/mediawiki/2012/9/97/Data_3.jpg"><br /><br />
Figure 9: Comparison of the specific activity of the BioBricked nitroreductase gene and control under induced and uninduced conditions (+ and - IPTG respectively). Error bars show the standard error of the mean. <br />
<br /><br /><br />
This graph shows that only the plac-lacZ-nitroreductase with IPTG induction shows nitroreductase activity. In addition, this activity is similar to the nitroreductase in the BlueScript vector(diagram above). <br /><br />
</p><br />
<p class="h3"><br />
<br /><a name="plates">Plates</a><br />
</p><br />
<p class="normal-text"><br />
The following characterization results are produced from the pre-BioBrick form of nitroreductase (nitroreductase in BlueScript vector with lac promoter). Due to the similarity of the vectror, the identical regulation and very similar specific activity (previous section), we believe that the BioBricked plac-lacZ-nitroreductase will behave very similarly.<br /><br />
To determine the relative toxicity of different compounds, 5 ul of DMSO, MTZ and DNBA were added at three distinct spots on a freshly spread plate and the amount of clearing was measured (in centimeters).<br /><br /><br />
<img id="table1" src="https://static.igem.org/mediawiki/2012/4/43/Markers-table1.JPG"><br />
<br /><br /><br />
DMSO was determined to be non-toxic, DNBA showed small difference between the different strains while MTZ distinctively more toxic to BS-nitred and BS-contol.<br />
<br /><br /><br />
Numerous plate experiments with MTZ concentration ranging from 0 ug/ml to 300 ug/ml and various concentrations of DNBA and NFT were made to determine concentrations at which BS-control was growing but where BS-nitred’s growth is inhibited. Similar growth patterns were observed in DNBA and NFT plates. All metronidazole experiments showed inhibited growth of BS-nitred in comparison to BS-control however the inhibition was never 100 %, which is required for nitroreductase to be used as a counterselectable marker.<br /><br /><br />
<img id="fig10" src="https://static.igem.org/mediawiki/2012/5/5a/Markers-fig08.JPG"><br /><br /><br />
Figure 10: Overnight plates with 100 ug/ml MTZ concentration with and without IPTG with different nitroreductase strains and control. BS-nitred’s growth was inhibited in comparison with BS-control however there are still some BS-nitred colonies growing.<br /><br /><br />
<img id="fig11" src="https://static.igem.org/mediawiki/2012/2/2d/Markers-fig09.JPG"><br /><br /><br />
Figure 11: Comparison of growth of BS-contol and BS-nitred at 90 ug/ml metronidazole. BS-nitred’s growth is clearly inhibited in comparison to BS-control however growth inhibition is not absolute. <br />
We could not find a concentration of metronidazole at which nitroreductase containing cells’ growth was inhibited while control cells were growing. We determined that this gene is not suitable as a counter-selectable marker on plates.<br />
</p><br />
<p class="h3"><br />
<br />Liquid cultures<br />
</p><br />
<p class="normal-text"><br />
The growth of nitroreductase-containing and control strains was assessed in liquid medium as well. The cells were grown in aerobic or anaerobic conditions with and without MTZ, in triplicate. <br /><br />
<img id="fig10" src="https://static.igem.org/mediawiki/2012/e/e4/Markers-fig10.JPG"><br /><br />
Figure 10: Comparison of growth patterns of BS-nitred and BS-control in 150 ug/ml metronidazole in aerobic cultures. Initial OD600 was extracted and error bars are standard error of the mean.<br /><br />
<img id="fig11" src="https://static.igem.org/mediawiki/2012/a/a8/Markers-fig11.JPG"><br /><br />
Figure 11: Comparison of growth patterns of BS-nitred and BS-control in 150 ug/ml metronidazole in anaerobic cultures. Initial OD600 was extracted and error bars are standard error of the mean.<br />
<br /><br /><br />
The results in aerobic cultures are promising since nitroreductase-containing cells have not grown while the control cells are growing.<br />
Once we obtained the BioBricked version of <i>nfsI</i>, we proceeded to testing this construct to show that it has similar activity to the gene in the BlueScript vector. Transformants and controls were incubated overnight in LB bottles containing either no, or 150ug/ml, metronidazole and OD readings were taken the following day. These results can be seen in Figure 12 below.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/5/54/EdiGEM-Fig12.png"><br />
<br /><br />
Figure 12: Comparison of growth between cells transformed with pSB1C3 plasmids containing either <i>nfsI</i> or control. 150 ug/ml metronidazole was added to bottles that contain it. <br />
</p><br />
<p class="h2"><br />
<i> Citrobacter freundii </i> characterisation<br />
</p><br />
<p class="normal-text"><br />
We tried to see whether this construct would work in <i>Citrobacter freundii </i>, but we did not find a metronidazole concentration that inhibited its growth (we tried adding metronidazole up the concentration of 350ug/ml but this still gave an OD reading of 0.766). <br />
<br /><br /><br />
We have measured nitroreductase activity in the <i>nfsI</i> and control transformants and have found that the specific activity of nitroreductase was 14U/mg in the <i>nfsI</i> transformant, which is much higher than the specific activity we found in <i> E. coli </i> this is consistent with the finding that the Lac promoter is much stronger in <i> Citrobacter freundii </i>, as it is unregulated.<br />
<br /><br /><br />
Since the nitroreductase enzyme itself seems to be working fine, it could mean that <i> Citrobacter freundii </i> is inherently resistant to activated metronidazole, so this is not a good counter-selectable marker option for <i> Citrobacter freundii </i>.<br />
<br /><br /><br />
This is not necessarily a problem, as we have shown that our other counterselectable marker, <i>sacB</i> works very well in <i> Citrobacter freundii </i>, so that gene could instead be used for counterselection in this organism.<br />
</p><br />
<p class="h2"><br />
Conclusions<br />
</p><br />
<p class="normal-text"><br />
<ul style="list-style-type:circle;padding:10px;"><br />
<li>We successfully cloned the nitroreductase gene and inserted it into the BioBrick vector.<br /><br /></li><br />
<li>We extensively characterized the nitroreductase gene on plates and in liquid cultures.<br /><br /></li><br />
<li>We troubleshooted the plac-lacZ-nitroreductase clone and managed to purify it. <br /><br /></li><br />
<li>We are developing novel (to the best of our knowledge) counter-selection system which may have advantages over currently used systems.<br /><br /></li><br />
<li>We determined that nitroreductase is most suitable as a counter-selectable marker for <i>E. coli</i>in liquid aerobic cultures at 150 ug/ml metronidazole.</li><br />
</ul><br />
<br /><br /><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/wiki/index.php?title=Team:Edinburgh/Project/Non-antibiotic-Markers"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-nitroreductase a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Gene-replacement-strategyTeam:Edinburgh/Project/Non-antibiotic-Markers/Gene-replacement-strategy2012-10-26T15:57:12Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#pSB1C3-primers,<br />
#pSB1C3-seq,<br />
#pSB1C3-method,<br />
#Plac-lacZ-method,<br />
#PstI{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig1, #fig2, #fig3,<br />
#fig4, #fig5, #fig6{<br />
height:0px;<br />
margin:5px;<br />
}<br />
#fig1, #fig3{<br />
margin-left:240px;<br />
}<br />
#fig2, #fig5, #fig6{<br />
margin-left:300px;<br />
}<br />
#fig4{<br />
margin-left:310px;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'pSB1C3-method'){<br />
document.getElementById('fig1').style.height="auto";<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
if(x == 'Plac-lacZ-method'){<br />
document.getElementById('fig3').style.height="auto";<br />
document.getElementById('fig4').style.height="auto";<br />
document.getElementById('fig5').style.height="auto";<br />
document.getElementById('fig6').style.height="auto";<br />
}<br />
if(x == 'PstI'){<br />
document.getElementById('fig7').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'pSB1C3-method'){<br />
document.getElementById('fig1').style.height="0px";<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
if(x == 'Plac-lacZ-method'){<br />
document.getElementById('fig3').style.height="0px";<br />
document.getElementById('fig4').style.height="0px";<br />
document.getElementById('fig5').style.height="0px";<br />
document.getElementById('fig6').style.height="0px";<br />
}<br />
if(x == 'PstI'){<br />
document.getElementById('fig7').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Two-step protocol for gene replacement using a selection-counterselection cassette<br />
</p><br />
<p class="normal-text"><br />
This protocol is useful if you want to replace a gene X with another gene Y. The example used here will detail the replacement of the <i> Citrobacter freundii </i> cephalosporinase gene with the limonene synthase gene, what makes our cells less antibiotic resistant and more citrus-scented (Figure 1).<br />
<br /><br /><br />
<img style="width:70%;padding-left:15%;" src="https://static.igem.org/mediawiki/2012/4/48/EdiGEM_-_Graph2.png"><br />
<br /><br /><br />
Figure 1: Two-step gene replacement strategy, simplified schematic.<br />
<br /><br /><br />
<ol style="text-align:justify;"><br />
<li> The first step in the process is creating homology arms by PCR for the selection-counterselection cassette that are homologous to the regions flanking the cephalosproinase gene. The arm upstream of the cassette should have an EcoRI site at its 5’ end and the arm downstream of the cassette should have a PstI site at its 3’ end.<br /><br /></li><br />
<li> The upstream arm can then be digested with EcoRI and the downstream arm with PstI and these can then be ligated to the selection-counterselection cassette that was digested with both enzymes.<br /><br /></li><br />
<li> A PCR using the outer primer pair should next be done to generate lots of a single linear product containing all three components (the upstream arm + cassette + downstream arm).<br /><br /></li><br />
<li> Cells should first be transformed with a lambda red plasmid such as pSC101-gbaA (allowing the cell to take up linear pieces of DNA without degrading them).<br /><br /></li><br />
<li> They can then be transformed with this linear piece of DNA and hopefully some of them will undergo homologous recombination, cutting out the cephalosporinase gene and replacing it with the selection-counterselection cassette. After this step, the cells should be plated onto a kanamycin-containing medium to <i>select</i> for the cells that have taken up the cassette.<br /><br /></li><br />
<li> The second step involves the replacement of this cassette with the limonene synthase gene – the cells that have grown on the kanamycin plate should be transformed with single stranded DNA containing the appropriate upstream arm + limonene synthase (or any other BioBrick) + downstream arm. Again, in some of the cells homologous recombination will cause the excision of the cassette and insertion of the limonene synthase gene into the vacated region.<br /><br /></li><br />
<li> This time, in order to select for the cells that have lost the cassette (<i> counter-select </i> for the cells that have the cassette), they should be plated out onto media that contain sucrose – cells that can grow on this medium (and are not red) have lost the levansucrase gene, and so the cassette, and are therefore good candidates for having had the cephalosporinase gene replaced by the limonene synthase gene.<br /><br /></li><br />
<li> Finally, grow the cells at a non-permissive temperature to remove the lambda red plasmid and enjoy your lemon-scented cells!</li><br />
</ol><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacB"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/0-Introduction"><span class="intense-emphasis">Next&gt;&gt;</span></a></span><br />
<br /><br /><br />
</p><br />
<br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-gene-rep{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface/DiscussionTeam:Edinburgh/Project/Bioelectric-Interface/Discussion2012-10-26T15:55:58Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
</style><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Bio-electric Interface:<br />
<br /><br /><br />
Discussion and conclusions<br />
</p><br />
<p class="normal-text"><br />
<br />
For the fuel cell experiment we have obtained a series of interesting results. In our half fuel cells, <i>E. coli</i> seemed to exhibit properties similar to <i>S. oneidensis. E. coli</i> generates potential which closely relates to <i>S. oneidensis</i> outputs and the results repeat throughout multiple media, except for the final experiment using M9 with sodium acetate, which limited the growth of <i>E. coli</i> altogether as well as limiting the electrogenicity of other bacteria. It seems that electrogenicity can be linked to the growth of cultures, at least in the minimal media. This shows a great potential for using microbial half fuel cells in combination with different promoters and selectable markers. To test this concept we have tested <b>J33203 (arsenic promoter) + <i>lacZ</i> construct in our half fuel cells as a growth-based biosensor. We have obtained encouraging results,</b> where transformed cells show faster voltage change compared to controls, <b>showing a good potential for our system to serve as a reliable bio-detector</b> generating data which would be easy to obtain and link to a computer system. With its potential for automation and miniaturisation this system offers a potential advancement in the field of biosensors. We are intending to further test this idea by using cells with arsenic promoter linked to the sucrose hydrolase gene. In such a system, detection of arsenic would induce expression of sucrose hydrolase, necessary for growth in media containing sucrose as the sole carbon source.<br /><br /><br />
<br />
<b>We managed to obtained, BioBricked and submitted the <i>napC, cymA, ccm and mtrA</i> genes. We have tested <i>ccm, cymA and napC</i> using haem staining procedure and obtained positive results.</b> We have mutagenised the internal PstI side in <i>mtrA</i>. We had some success in cloning the <i>mtrCAB</i> and <i>S. oneidensis ccm</i> genes which may enhance the efficiency of the system. We would like to clone these genes into the pSB1C3 vector to create a functional BioBrick (<a href="http://partsregistry.org/Part:BBa_K917007">BBa_K917007</a>). However, the longer products (<i>mtrCAB</i> and <i>ccm</i> genes) seem to be more problematic to clone, with the digestion/ligation step being the limiting factor, despite using several alternative techniques (polyA tailing, fusion PCR). <br />
<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface/Microbial-Half-Fuel-Cells"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers"><span class="intense-emphasis">Next&gt;&gt;</span></a></span><br />
<br /><br /><br />
</p><br />
</html><br />
{{:Edinburgh/Project/Bioelectric-Interface/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-bio-el-interface p,<br />
#page-navigation ul li#nav-bio-el-interface ul li#nav-bio-el-discussion a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-bio-el-interface ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-bio-el-interface ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-MarkersTeam:Edinburgh/Project/Non-antibiotic-Markers2012-10-26T15:53:37Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
#main-menu ul li#project-page:hover ul li{<br />
top:-9000px;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Introduction<br />
</p><br />
<p class="normal-text"><br />
Genetic modification requires us to discriminate between bacteria which have taken up the DNA of interest and those which have not. This is traditionally done by using antibiotic resistance markers – cells that have taken up the DNA of interest (along with these markers) will be able to survive on media supplemented with the relevant antibiotic while those that do not have the DNA will not grow. <br />
<br /><br /><br />
Selectable markers select for the cells which have taken up the gene of interest (eg. sucrose hydrolase) while counter-selectable markers select against the cells which have the DNA of interest (nitroreductase and SacB), which may be useful if we want to get rid of the cells that still contain a no longer wanted DNA insert.<br />
<br /><br /><br />
The problem with this system is that <a href="https://2012.igem.org/Team:Edinburgh/Human_Practices/Laws-and-Legislations ">international law</a> does not allow the release of genetically modified organisms which contain such antibiotic resistance markers because these might aid the spreading of antibiotic resistance genes in the wild population. <br />
<br /><br /><br />
We have questioned the legacy and safety of using antibiotics for selection and counter-selection and thus we aim to provide alternative markers that do not necessarily rely on antibiotic resistance genes for selection or counterselection. This would allow iGEM projects (and other projects where genetic engineering is used) to pass this hurdle on their way to releasing their constructs into the environment where they could be used for the real life purpose they were built for. This does not, of course, means that any constructs can now be released into the wild, as the properties of the construct still need to be considered, but that the issue of antibiotic resistance will no longer be present.<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<span class="subtle-emphasis">&lt;&lt;Prev</span><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Nitroreductase"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-introduction a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface/Microbial-Half-Fuel-CellsTeam:Edinburgh/Project/Bioelectric-Interface/Microbial-Half-Fuel-Cells2012-10-26T15:15:32Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#fig01,#fig02,#fig03{<br />
width:100%;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'pSBIC3-method'){<br />
document.getElementById('fig1').style.height="auto";<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'pSBIC3-method'){<br />
document.getElementById('fig1').style.height="0px";<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Bio-electric Interface:<br />
<br /><br /><br />
Microbial half fuel cells<br />
</p><br />
<p class="h2"><br />
Methods<br />
</p><br />
<p class="normal-text"><br />
<br /><br />
The half fuel cells were constructed using the following components provided by Matthew Knighton from Dr Bruce Ward’s lab: <br /><br />
- 250 ml or 500 ml glass bottle <br /><br />
- A standard plastic cap with two holes drilled for electrodes <br /><br />
- carbon weave electrode fixed to the cap with silicone sealant <br /><br />
- reference electrode "red rod" REF201 available for sale from Radiometer analytical <br /><br />
<br />
<br /><br />
- Following the assembly bottles were autoclaved (reference electrodes were instead sterilised with alcohol as they are temperature sensitive). In sterile conditions, reference electrodes were dipped in alcohol, inserted into the cap of the bottles and sealed with silicon sealant. The half fuel cells were then filled with media, inoculated with bacteria and sealed with parafilm in order to ensure anaerobic growth. The bacteria were left to grow at room temperature. (Figure 1)<br />
<br /><br /><br />
- Media used: standard LB or M9 (<a href="http://openwetware.org/wiki/M9_medium/minimal">minimal growth medium</a>) supplemented with 1% lactose, 0,4% glycerol or 0,4% sodium acetate.<br />
<br /><br /><br />
- Measurements were obtained using a digital multimeter.<br />
</p><br />
<p class="h2"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
- We have examined the behaviour of <i>S. oneidensis</i> and <i>E. coli</i> in different media using half fuel cells. We managed to obtain results using the following media: LB, M9 with glycerol and M9 with sodium acetate. The results are summarised in figures 2 and 3 below. We also performed a measurement for <i>Citrobacter freundii</i> to see whether it differs from other bacteria.<br /><br /><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/e/e4/Bio-el-interface-fig09.JPG"><br /><br />
Figure 1: Our microbial half fuel cells with <i>S. oneidensis</i> and <i>E. coli</i><br />
<br /><br /><br />
<img id="fig02" src="https://static.igem.org/mediawiki/2012/f/f7/Bio-el-interface-fig10.JPG"><br /><br />
Figure 2: Half fuel cells experiments 1 and 2, using LB medium for growth of <i>S. oneidensis</i> and <i>E. coli</i>. Experiment 1 (left) was performed using 500 ml of medium while experiment 2 (right) was performed using 250 ml of medium.<br />
<br /><br /><br />
<img id="fig03" src="https://static.igem.org/mediawiki/2012/4/4a/Bio-el-interface-fig11.JPG"><br /><br />
Figure 3: Half fuel cells experiments 3 and 4, using M9 medium for growth of <i>S. oneidensis</i>, <i>E. coli</i> and <i>Citrobacter freundii</i>. Experiment 3 (left) was performed using 250 ml of medium M9 with 0,4% glycerol while experiment 4 (right) was performed using 250 ml of medium M9 with 0,4% sodium acetate. In experiment 4, <i>C. freundii</i> was also tested.<br />
</p><br />
<p class="h2"><br />
Growth-based biosensor<br />
</p><br />
<p class="normal-text"><br />
We have designed and tested a growth-based arsenic biosensor with a direct electric output. In order to test the principle of this device we have transformer <i>E. coli</i> JM109 with Edinburgh 2006 J33203 arsenic promoter BioBrick linked to <i>lacZ</i> gene responsible for lactose degradation. We have then prepared 3 half-fuel cells with lactose medium (M9 with trace elements and thiamine + 1% lactose): <br /><br />
1) J33203 + <i>lacZ</i> in medium with sodium arsenate (100 parts per bilion concentration)<br /><br />
2) J33203 + <i>lacZ</i> in medium without sodium arsenate <br /><br />
3) control, WT <i>E. coli</i> in medium with sodium arsenate (100 parts per bilion concentration)<br /><br /><br />
<img src= "https://static.igem.org/mediawiki/2012/4/4e/Growth_based_biosensor.jpg" width="700"> <br /><br />
Fig 4: Growth-based arsenic biosensor: change in voltage over time using <i>E. coli</i> transformed with J33203 and lacZ and WT <i>E. coli</i> as control<br /><br /><br />
The results we have obtained are encouraging. J33203 transformed cells in presence of arsenate show faster drop in voltage compared to other samples. This is especially important compared to the J33203 cells in medium without arsenate. These results show promising prospect for growth-based biosensors. With more sophisticated measurement methods it would be possible to connect our system to a computer which would allow for automated and quantitative analysis of the data, allowing for simple and automated contamination detection. <br /><br />
Current results are encouraging but background growth is still present in the media and therefore further experiments are necessary to optimise the growth parameters. One possible improvement includes addition of <i>cscA</i> BioBrick that we have designed this year. Using sucrose instead of lactose may reduce background growth and allow for tighter control of the system. <br />
</p><br />
<br />
<p class="h2"><br />
Acknowledgements<br />
</p><br />
<p class="normal-text"><br />
We would like to thank Dr Bruce Ward and Matthew Knighton for their help with the fuel cells and for lending us their lab equipment.<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface/Bio-electric-Interface-BioBricks-Cloning"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Bioelectric-Interface/Discussion"><span class="intense-emphasis">Next&gt;&gt;</span></a></span><br />
<br /><br /><br />
</p><br />
</html><br />
{{:Edinburgh/Project/Bioelectric-Interface/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-bio-el-interface p,<br />
#page-navigation ul li#nav-bio-el-interface ul li#nav-bio-el-fuel-cells a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-bio-el-interface ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-bio-el-interface ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/6-ValenciaTeam:Edinburgh/Project/Citrobacter-Freundii/6-Valencia2012-10-26T14:46:29Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#bac2-method,<br />
#bac3-method,<br />
#bac5-method{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig1,#fig2,#fig3,#fig4,#fig5,#fig6,#fig7{<br />
width:600px;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation:<br />
<br /><br /><br />
Valencia Biocampus BioBrick Characterisation<br />
</p><br />
<p class="normal-text"><br />
In the spirit of iGEM, we have collaborated with the Valencia Biocampus team and characterised several of the BioBricks they made as part of their 'Talking Life' project.<i>C. freundii</i> and <i>E. coli</i> JM109 cells were transformed with the following three plasmids and the transformations were plated onto LB + chloramphenicol plates.<br />
</p><br />
<p class="h2"><br />
Bac2<br />
</p><br />
<p class="normal-text"><br />
Plasmid construction: groE promoter + AsRed2. This promoter is activated after a heat shock (keeping cells in a 44&deg;C waterbath for 5 minutes), as it normally controls the expression of groE, a heat shock protein that helps degrade proteins that have misfolded due to the high temperature.<br />
</p><br />
<p class="h3"><br />
Method <a class="cursor-pointer" onclick="expand('bac2-method')">(expand)</a><br />
</p><br />
<p class="normal-text" id="bac2-method"><br />
<br /><i>Colonies were picked from the Citrobacter plate and inoculated into 3ml LB liquid medium + chloramphenicol40 (1&mu;l/ml) and grown overnight at 37&deg;C on a shaker. The following day, the ODs were measured and a normalized amount of these cultures was used to inoculate bottles of M9 minimal medium (containing glucose as a carbon source) and left to grow at 37&deg;C until the culture reached an OD of 0.15-0.25. Half of the bottles were put into a 44&deg;C waterbath for 5 minutes while the other half were not. The fluorescence of the cultures was then measured every 10 minutes for 70 minutes.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('bac2-method')">Close the method.</a><br />
</p><br />
<p class="h3"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/5/5a/Lemon-fig09.JPG"><br /><br />
Figure 1 - Bac2 characterisation. The bars show standard error.<br />
<br /><br /><br />
The results in Figure 1 show that there is a significant difference between the start and end fluorescence of the heat shocked cultures, whereas the control cultures' fluorescence remained more or less the same throughout the testing period.<br />
<br /><br /><br />
The fact that the fluorescence of the heat shocked cultures is lower than that of the controls may be due to some of the cells dieing after heat shock or due to slight variation in cell number (even though every effort was made to keep cell numbers even).<br />
</p><br />
<p class="h2"><br />
Bac3<br />
</p><br />
<p class="normal-text"><br />
Plasmid construction: Anaerobiosis promoter + ZsGreen1. This promoter is activated when oxygen concentrations in the medium are low, as this is when its transcriptional regulators become active.<br />
</p><br />
<p class="h3"><br />
Method <a class="cursor-pointer" onclick="expand('bac3-method')">(expand)</a><br />
</p><br />
<p class="normal-text" id="bac3-method"><br />
<br /><i>Colonies were picked from Citrobacter and E. coli + Bac3 plates and inoculated into LB + chloramphenicol40 (1 &mu;l/ml) liquid media and grown overnight (aerobically) at 37&deg;C on a shaker. The following day, the ODs were measured and a normalized amount of these cultures was used to inoculate bottles of LB + chloramphenicol. Half the samples were topped up with LB in order to exclude any air and were incubated for two days at 37&deg;C on a shaker, while the other half were incubated under the same circumstances (without adding the extra LB) and they were uncapped and shaken in order to reareate the culture one day after inoculation.<br />
<br /><br /><br />
After two days, the fluorescence and the OD of the cultures was measured in LB. 1ml of the cultures was also transferred to Eppendorf tubes which were spun down and the LB was discarded and the cells were resuspended in water. The fluorescence and OD of these cultures was also measured. This was done to minimize any background fluorescence.<br />
</i><br />
<a class="cursor-pointer" onclick="collapse('bac3-method')">Close the method.</a><br />
</p><br />
<p class="h3"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
The fluorescence readings were divided by the relevant ODs in order to normalize the results. The resulting bar charts can be seen below.<br />
<br /><br /><br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/9/9f/Lemon-fig10.JPG"><br /><br />
Figure 2 - Anaerobiosis promoter characterisation in LB. The bars show standard error.<br />
<br /><br /><br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/1/15/Lemon-fig11.JPG"><br /><br />
Figure 3 - Anaerobiosis promoter characterisation in water. The bars show standard error.<br />
<br /><br /><br />
The results in Figures 2 and 3 clearly show that the colonies that were grown anaerobically produce a lot more fluorescence than those that were grown aerobically. This suggests that the anaerobiosis promoter is regulated in a very similar fashion in both <i>E. coli</i> and <i>C. freundii</i>. It also confirms that the BioBrick functions as expected.<br />
</p><br />
<p class="h2"><br />
Bac5<br />
</p><br />
<p class="normal-text"><br />
Plasmid construction: RecA promoter + GFP. This promoter is activated when the bacterial SOS response is needed. This response occurs when DNA damage is detected in the cell and is responsible for repairing this DNA so it can still be replicated, although the repair process is error-prone.<br />
</p><br />
<p class="h3"><br />
Method <a class="cursor-pointer" onclick="expand('bac5-method')">(expand)</a><br />
</p><br />
<p class="normal-text" id="bac5-method"><br />
<br /><i>Colonies were picked from Citrobacter and E. coli + Bac5 plates and inoculated into LB + chloramphenicol (1 &mu;l/ml) liquid media and grown overnight at 37&deg;C on a shaker. The following day, the ODs were measured and a normalized amount of these cultures was used to inoculate bottles of LB + chloramphenicol. The bottles were left to grow at 37&deg;C with shaking until the culture reached an OD of 0.15-0.25 After this, 1 ml of culture was aliquoted into cuvettes and the cuvettes were exposed to UV radiation (254 nm wavelength) at a distance of 60 cm for 20, 40 or 60 seconds (unirradiated cuvettes were used as controls). The fluorescence was measured over the course of an hour using a blue filter. <br />
<br /><br /><br />
This experiment was repeated but the distance was reduced to 10 cm.<br />
</i><br />
<a class="cursor-pointer" onclick="collapse('bac5-method')">Close the method.</a><br />
</p><br />
<p class="h3"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
The results from the first experiment (UV exposure at 60 cm over 20, 40 or 60 seconds) can be seen in Figures 4 and 5 below.<br />
<br /><br /><br />
<img id="fig4" src="https://static.igem.org/mediawiki/2012/e/ee/Lemon-fig12.JPG"><br /><br />
Figure 4 - Fluorescence of <i>E. coli</i> + Bac5 plasmid after exposure to UV (254 nm) for various periods of time at 60cm<br />
<br /><br /><br />
<img id="fig5" src="https://static.igem.org/mediawiki/2012/e/e1/Lemon-fig13.JPG"><br /><br />
Figure 5 - Fluorescence of <i>C. freundii</i> + Bac5 plasmid after exposure to UV for various periods of time at 60cm<br />
<br /><br /><br />
These results suggest that there is no real difference in the level of fluorescence or in the rate of increase of fluorescence of the irradiated and unirradiated cultures. This may be due to the fact that no detectable amount of DNA damage was done due to the UV source being too far from the cultures.<br />
<br /><br /><br />
The results of the experiment with the UV source being only 10 cm from the cuvettes can be seen in Figures 6 and 7 below.<br />
<img id="fig6" src="https://static.igem.org/mediawiki/2012/0/03/Lemon-fig14.JPG"><br /><br />
Figure 6 - Fluorescence of <i>E. coli</i> + Bac5 plasmid after exposure to UV for various periods of time at 10cm<br />
<br /><br /><br />
These results are slightly strange as we are unsure what caused such an increase in fluorescence of the unirradiated control after 20 minutes. It can be seen that the culture irradiated for 60 seconds starts to show increased fluorescence around 10 minutes after UV exposure and this level of fluorescence is maintained for a long period of time afterwards.<br />
<br /><br /><br />
The cultures irradiated for less time do not show such a quick increase in fluorescence, nor does the fluorescence reach such high levels, but it is maintained throughout the period of measurement.<br />
<br /><br /><br />
Overall, we think that these results are inconclusive as to whether or not the promoter works properly.<br />
<br /><br /><br />
<img id="fig7" src="https://static.igem.org/mediawiki/2012/0/0a/Lemon-fig15.JPG"><br /><br />
Figure 7 - Fluorescence of <i>C. freundii</i> + Bac5 plasmid after exposure to UV for various periods of time at 10cm<br />
<br /><br /><br />
The <i>C. freundii</i> results suggest that the promoter takes around 20 minutes to activate, as a marked increase in fluorescence can be detected after this time and the level of fluorescence continues to increase for a period of time.<br />
<br /><br /><br />
The culture that was irradiated for 60 seconds shows a jump in fluorescence after the irradiation, presumably because the promoter gets hyperactivated due to intense DNA damage. This culture then shows a little increase in fluorescence, after which it starts to decrease, probably due to the cells being unable to cope with the amount of DNA damage and dying.<br />
<br /><br /><br />
The culture irradiated for 40 seconds also seems to die towards the end (but the drop in fluorescence could also indicate that the DNA damage had been mostly repaired, as the doubling time for <i>E. coli</i> is ~20 minutes so after two rounds of replication the DNA may have been restored).<br />
<br /><br /><br />
The largest increase in fluorescence can be seen with the culture that had been irradiated for 20 seconds. This length of time is apparently more optimal for this experiment as it gives a good activation of the promoter without killing the cells (too much).<br />
</p><br />
<p class="normal-text"><br />
This construct seems to show some activity as there is a difference in fluorescence of irradiated and unirradiated cultures in both <i>E. coli</i> and <i>C. freundii</i> but further tests are needed to fully characterise it and to debug our tests.<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/5-Genome-sequencing"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><span class="subtle-emphasis">Next&gt;&gt;</span><br />
<br /><br /><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-6 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/2-Growth-in-sea-saltsTeam:Edinburgh/Project/Citrobacter-Freundii/2-Growth-in-sea-salts2012-10-26T14:44:18Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#failure-methods{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig01{<br />
width:600px;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation:<br />
<br /><br /><br />
Growth in sea salts<br />
</p><br />
<p class="normal-text"><br />
Since synthetic biology is a rapidly developing field, we think that it will see a lot of innovation in the years to come. We also think that the use of fresh water for large scale experiments and industrial applications will eventually become limited as fresh water supplies will be scarce, or salt water will be more accessible to people. This is why we think that a novel chassis should be able to grow in seawater/salt water. The following experiments serve to characterize the ability of <i>Citrobacter</i> to grow in water containing varying concentrations of sea salts. Note that the average salt concentration of seawater is between 20 and 40 g/l.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Methods <a class="cursor-pointer" onclick="expand('failure-methods')">(expand)</a><br /><br />
</p><br />
<p class="normal-text"><br />
<span class="intense-emphasis"><br />
As we have mentioned previously, we urge everyone to talk about their failed experiments, as if nobody talks about them, a lot of time could be wasted by different people trying to do the same thing to no avail. As such, the following experiments can be considered an example of how we started out with a failure but then modified the circumstances to get meaningful results.</span><br />
</p><br />
<p class="normal-text" id="failure-methods"><br />
<br /><br />
<i>3.1 First, we wanted to asses growth of <i>C. freundii</i> on media plates. For this purpose, M9 minimal medium was made up, using glucose as a carbon source, and varying amounts of sea salts were added to these media. Unfortunately, at higher (>40g/l) sea salt concentrations, the agar did not solidify so growth above this concentration could not be assessed. The plates that did solidify had 100 &mu;l <i>C. freundii</i> spread on them and were put into the 37&deg;C incubator overnight.<br />
<br /><br /><br />
3.2 Liquid M9 medium was then made up using varying amounts of sea salts. These media were not clear as expected but what whitish precipitates floating in the medium, so we speculate that the M9 salts did not react well to the presence of sea salts. The precipitate is probably magnesium and calcium phosphate, as M9 is very high in phosphates. Nonetheless, we inoculated these bottles with overnight cultures (grown in LB) to see if any growth would occur. After overnight incubation at 37&deg;C on a shaker, the ODs were measured (using the appropriate sea salt concentration M9 as blank for each culture to prevent interference of the precipitate with the readings).<br />
<br /><br /><br />
3.3 Next, LB medium was made up, using yeast extract (5g/l) and tryptone (10g/l) and varying concentrations of sea salts (replacing the normal NaCl). These bottles of media were inoculated with overnight cultures, incubated overnight at 37&deg;C with shaking and the ODs measured as described above.<br />
<br /><br /><br />
4.4 Finally, we wanted to compare the ability of <i>C. freundii</i> to grow in the presence in sea salts with that of <i>E. coli</i>, so we set up 250ml flasks with 25ml of LB or LB with 40g/l sea salts, inoculated them with overnight cultures of E. coli MG1655 or <i>C. freundii</i> and measured OD every 30 minutes over the course of a day.<br /></i><br />
<a class="cursor-pointer" onclick="collapse('failure-methods')">Close the method.</a><br />
<br /><br /><br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
<b>1.1</b> All the plates that were inoculated showed a lawn of cells, suggesting that <i>C. freundii</i> can grow well in the presence of sea salts. Unfortunately, the sea salts + M9 salts formed a white precipitate, so the plates could not be photographed in a way that would actually show that there were cells growing on them.<br />
<br /><br /><br />
<b>1.2</b> A graph showing the OD readings taken from bottles of M9 + varying concentrations of sea salts can be seen in Figure 1.<br />
<br /><br /><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/3/32/Lemon-fig02.JPG"><br /><br />
Figure 1 - <i>C. freundii</i> growth in M9 minimal medium + varying concentrations of sea salts<br />
<br /><br /><br />
These results show that <i>C. freundii</i> does not grow well in minimal medium + sea salts, as the OD keeps decreasing as the concentration of sea salts increases.<br />
<br /><br /><br />
<b>1.3</b> A graph showing the OD readings taken from bottles of LB + varying concentrations of sea salts incubated with <i>C. freundii</i> overnight can be seen in Figure 2.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/f/f6/Lemon-fig03.JPG"><br /><br />
Figure 2 - <i>C. freundii</i> growth in LB + varying concentrations of sea salts<br />
<br /><br /><br />
These results show that <i>C. freundii</i> can happily grow in LB + sea salts even when the salt concentration is higher than that of most seawaters. Concentrations of 10-20g/l seem to be more optimal but an OD above 1.8 is maintained throughout. This suggests that our novel chassis would indeed be able to be grown without having to waste freshwater on it.<br />
<br /><br /><br />
<b>1.4</b> Figure 3 shows the OD readings taken every 30 minutes from flasks containing either LB or LB + sea salts inoculated with either <i>E. coli</i> or <i>C. freundii.</i><br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/c/c8/Lemon-fig04.JPG"><br /><br />
Figure 3 - <i>C. freundii</i> and <i>E. coli</i> growth over time in either LB or LB with sea salts<br />
<br /><br /><br />
<b>These results show that <i>C. freundii</i> can grow with and without sea salts at a similar rate to <i>E. coli</i>, so there would be no hindrance in using <i>C. freundii</i> for synthetic biology (and any biology) work over <i>E. coli</i> in sea salt medium.</b><br />
</p><br />
<p class="h2"><br />
Conclusions<br />
</p><br />
<p class="normal-text"><br />
<ul style="list-style-type:circle;padding:10px;"><br />
<li>We extensively characterized the ability of <i>Citrobacter freundii</i> to grow in the presence of various concentrations of sea salts, both on plates and in liquid media<br /><br /></li><br />
<li>We turned a failure (M9 liquid media) into a success <br /><br /></li><br />
<li>We assessed the growth rate of <i>Citrobacter freundii</i> and <i>E. coli</i> in 40g/l sea salt concentration media <br /><br /></li><br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/1-Replicon-compatibility"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-2 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/1-Replicon-compatibilityTeam:Edinburgh/Project/Citrobacter-Freundii/1-Replicon-compatibility2012-10-26T14:41:09Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#table02-method{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig01,#table02{<br />
width:100%;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation:<br />
<br /><br /><br />
Replicon compatibility<br />
</p><br />
<p class="normal-text"><br />
To even consider a new chassis for synthetic biology (and especially iGEM), it should first of all be able to replicate the various types of plasmids that are used to insert genes/BioBricks into it. To test this, our <i>C. freundii</i> was transformed with several plasmids containing the most commonly used replicons. The transformations were done according to standard protocol and the transformants were plated out onto media as indicated in Table 1 and shown in Figure 1.<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/3/38/Lemon-table01.JPG"><br /><br />
Table 1 - Replicon compatibility media and results<br /><br /><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/7/7c/Lemon-fig01.JPG"><br /><br />
Figure 1 - Plates containing <i>E. coli</i> or <i>Citrobacter freundii</i> transformed with plasmids that have different replicons. Note that the top row shows <i>Citrobacter freundii</i> cells and the bottom row shows <i>E. coli</i> cells, except for the first plates in each row, which are switched around, for colour comparison.<br />
<br /><br /><br />
<b>These results show that all but one of the plasmids have successfully been transformed into both <i>E. coli</i> and <i>C. freundii</i>, therefore these replicons are compatible with <i>C. freundii</i>.</b><br />
<br /><br /><br />
<i>C. freundii</i> cells with the multi-host plasmid (pTG262) did not grow at all. The most probable reason is that the <i>cmlR</i> gene (which confers chloramphenicol resistance) in pTG262 is a Gram positive one (from Lactobacillus) which works much less well even in <i>E. coli</i> than the standard iGEM <i>cmlR</i> gene, so if <i>C. freundii</i> is a little more chloramphenicol-sensitive or expresses it a little worse, it would explain why no growth was seen on this plate.<br/><br />
<br /><br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
pTG262 characterisation<br />
</p><br />
<p class="normal-text"><br />
One reason why the <i>C. freundii</i> cell transformed with pTG262 did not grow may be that the <i>C. freundii</i> cells are less resistant to chloramphenicol than <i>E. coli</i>, so they were plated onto plates with varying concentrations of chloramphenicol (Table 2) to see whether they grow at all. pSB2K3 was used as a negative control, as it does not have chloramphenicol resistance.<br /><br /><br />
<img id="table02" src="https://static.igem.org/mediawiki/2012/b/be/Lemon-table02.JPG"><br /><br />
Table 2- Table indicating the amount of chloramphenicol added to each plate.<br /><br />
<a class="cursor-pointer" onclick="expand('table02-method')">Method</a><br />
</p><br />
<p class="normal-text" id="table02-method"><br />
<br /><br />
<i>The plates were incubated for two days and growth was observed on the 5 and 10 μl chloramphenicol plates. In order to assess whether growth on these plates was due to the activity of the resistance gene on the plasmid or due to some innate resistance to chloramphenicol, 20 μl of C. freundii containing the plasmid or 20 μl untransformed C. freundii were plated out onto LB agar containing 5, 6, 7, 8, 9 or 10 μl chloramphenicol and incubated at 37&deg;C overnight.</i><br />
<a class="cursor-pointer" onclick="collapse('table02-method')">Close the method.</a><br />
<br /><br /><br />
</p><br />
<p class="normal-text"><br />
The <i>C. freundii</i> + pTG262 plasmid grew on all plates to some extent whereas the no plasmid control grew only below 8 &mu;l chloramphenicol and there were fewer colonies on the plates compared to the <i>C. freundii</i> + pTG262. This suggests that the plasmid works, but very weakly.<br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<p class="h2"><br />
Conclusions<br />
</p><br />
<p class="normal-text"><br />
<ul style="list-style-type:circle;padding:10px;"><br />
<li>We characterised the compatibility of <i>Citrobacter freundii</i> with the major replicon types used by iGEM<br /><br /></li><br />
<li>We extensively characterized the pTG262 plasmid to figure out why it was not working well in <i>Citrobacter freundii</i><br /><br /></li><br />
<li>We have concluded that the other replicons are compatible with this organism<br /><br /></li><br />
<br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/0-Introduction"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/2-Growth-in-sea-salts"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-1 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-HydrolaseTeam:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase2012-10-26T14:25:52Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#CscA-primers,<br />
#CscA-method,<br />
#figure1,<br />
#figure2,<br />
#figure3{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig12{<br />
height:0px;<br />
margin:5px;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
document.getElementById('fig12').style.height="auto";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="auto";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
document.getElementById('fig12').style.height="0px";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="0px";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Sucrose Hydrolase <i> (cscA)</i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
Sucrose hydrolase is an enzyme from <i>Escherichia coli</i> O157:H7 strain Sakai which is involved in sucrose utilisation <a href="#bibliography" onclick="expand('works-cited');">(Jahreis, et al., 2002)</a>. Transforming <i>Escherichia coli</i> K12 strains with sucrose hydrolase allows the cells to grow with sucrose as a sole carbon source, something the untransformed K12 strain cannot do. This allows this gene to be used as a selectable marker.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="h3"><br />
<i>cscA</i> cloning <br />
</p><br />
<p class="normal-text"><br />
The <i>cscA</i> gene was cloned PCR with <i>cscA</i> specific primers. <a onclick="expand('figure1');">Figure 1.</a><br />
</p><br />
<p class="normal-text" id="figure1"><br />
<br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/0/06/G1.png"><br /><br />
Figure 1: DNA gel of PCR amplification with primers specific for <i> cscA </i>. The product is around 1.4-1.5 kb which corresponds to the size of <i> cscA </i> gene, around 1.5 kb.<br /><br /><br />
<a onclick="collapse('figure1');">Close figure 1.</a><br />
</p><br />
<p class="normal-text"><br />
<br />This fragment was inserted into the standard BioBrick vector pSB1C3. <a onclick="expand('figure2');">Figure 2.</a><br />
</p><br />
<p class="normal-text" id="figure2"><br />
<br /><br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/8/85/G2.png"><br /><br />
Figure 2:DNA gel of pSBIC3-<i>cscA</i> ligation digested with EcoRI in order to linearise the plasmid. The band is around 3.5 kb which corresponds to the vector pSBIC3 (around 2 kb) together with the <i>cscA</i> gene (arounf 1.5 kb)<br /><br /><br />
<a onclick="collapse('figure2');">Close figure 2.</a><br />
</p><br />
<p class="normal-text"><br />
<br />A promoter and a reporter gene were added in front of the <i>cscA</i> gene (plac-lacZ). <a onclick="expand('figure3');">Figure 3.</a><br />
</p><br />
<p class="normal-text" id="figure3"><br />
<br /><br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/e/e2/G9.png"><br /><br />
Figure 3: DNA gel of pSB1C3-plac-lacZ-cscA digested with XbaI and PstI. The clear band just above 2kb corresponds both to the size of the vector and the plac-lacZ-cscA fragment. The band around 4 kb is likely to correspond to the undigested plasmid. <br /><br /><br />
<a onclick="collapse('figure3');">Close figure 3.</a><br />
</p><br />
<br />
<p class="h3"><br />
cscA selection plasmid<br />
</p><br />
<p class="normal-text"><br />
In order to create a <i>cscA</i> selection plasmid, we wanted to replace the chloramphenicol resistance in pSB1C3 with <i>cscA</i>. The <i>cscA</i> and pSB1C3 gene were cloned using these <a class="cursor-pointer" onclick="expand('CscA-primers');">primers</a>. <a class="cursor-pointer" onclick="expand('CscA-method')">Method</a>. However, this resulted in no successful pSB1C3-cscA ligation transformants.<br />
</p><br />
<p class="normal-text" id="CscA-primers"><br />
<br /><i>Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat<br /><br />
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT<br /></i><br />
<img id="fig12" src="https://static.igem.org/mediawiki/2012/7/75/Markers-fig12.JPG"><br /><br />
<i>Figure 1: DNA gel of PCR products of pSB1C3 without chloramphenicol and <i>cscA</i>. One product is around 1.4 kb which corresponds to the size of <i>cscA</i> gene, the other is around 2.2 kb which corresponds to the pSB1C3 vector without cml resistance.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-primers');">Close the primers.</a><br /><br />
</p><br />
<p class="normal-text" id="CscA-method"><br />
<br /><i>Method: The purified <i>cscA</i> and psB1C3 PCR products were digested with NdeI and ClaI. Both products were ligated and E.coli cells transformed with the ligation.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-method');">Close the method.</a><br /><br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="h3"><br />
Plates<br />
</p><br />
<p class="normal-text"><br />
Plate characterisation showed that <i>cscA</i> is a suitable selectable marker- only cells which had the gene grew on sucrose as a sole carbon sourse (Figure 4). The drawback of this antibiotic-free selectable marker is that more time is required for the growth of the <i>cscA</i> cells on sucrose plates (overnight at 37°C+4 days at room temperature).<br />
<br /><br /><br />
<img id="fig13" src="https://static.igem.org/mediawiki/2012/2/26/Markers-fig13.JPG"><br /><br />
Figure 4: <i>cscA</i> cells (bottom row) as well as control cells (top row) were spread on LB plate, minimal plate with sucrose, minimal plate with glucose and minimal plate with no sugars. Neither the <i>cscA</i> nor the control cells grow on minimal media with no sugars and grew well on LB and minimal plate with glucose. However, <i>cscA</i> cells are growing on minimal media with sucrose while the control cells are not.<br />
</p><br />
<p class="h3"><br />
Liquid Cultures<br />
</p><br />
<p class="normal-text"><br />
In order to better quantify our results, we have decided to grow our transformants in liquid media and measure OD after overnight incubation. We set up bottles with the same media as we have used for the plates (LB, M9 minimal medium with no sugars, M9 with 1% glucose and M9 with 1% sucrose), inoculated them with <i>cscA</i> or control transformants grown overnight and incubated them overnight before measuring OD. The results can be seen in Figure 5 below.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/2/2e/EdiGEM-Fig5.png"><br />
<br /><br />
Figure 5: Comparison of growth between cells containing the sucrose hydrolase (<i>cscA</i>) selectable marker and control. LB and M9 glucose were used as positive controls, M9 with no sugars was used as a negative control.<br />
</p><br />
<p class="h2"><br />
<a name="xylitol">Citrobacter xylitol selection marker strategy</a><br />
</p><br />
<p class="normal-text"><br />
In addition to <i> E. coli</i>, we were also working with the organism <i>Citrobacter freundii</i> over summer. <br /><br /><br />
Unfortunately, we could not test our sucrose hydrolase selection system in this organism, as it can already degrade sucrose naturally. We have therefore devised the concept for an alternative sugar selection system that could be used in <i>Citrobacter freundii</i>. This sugar selection system is based on the sugar alcohol xylitol – our <a href="https://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use#liquid-media"><i>Citrobacter freundii</i> sugar use experiments</a> show that it cannot grow on this sugar as a sole carbon source, so it seems to be an ideal candidate for selectable marker design.<br />
<br /><br /><br />
As some organisms <i>can</i> use and degrade xylitol, we have found an enzyme, called <vb>xylitol dehydrogenase </b>, which oxidizes xylitol to xylulose. This gene can be found in (for example) the gram negative rod <i> Gluconobacter oxydans </i> which is also friendly to humans, as it is not known to be pathogenic and in addition it is also used in various fields of biotechnology for example in the construction of bionsensors or for vinegar, vitamin C or sorbitol production.<br />
<br /><br /><br />
The cloning strategy could be the same as was used to make the sucrose hydrolase BioBrick and assessing its effectivity could also be done following the same protocols, but of course, replacing sucrose with xylitol where needed. <br />
<br /><br /><br />
This non-antibiotic selectable marker could be coupled up with our levansucrase (<i>sacB</i> counterselectable marker to form a selection-counterselection cassette that depends entirely on the presence of sugars, rather than antibiotics.<br />
</p><br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
<ul style="padding-left:10px; list-style-type:circle;"><br />
<li>We successfully cloned the sucrose hydrolase gene and inserted it into the BioBrick vector. (<a href="http://partsregistry.org/Part:BBa_K917000">BBa_K917000</a>)<br /><br /></li><br />
<li>We extensively characterised the sucrose hydrolase gene on plates and in liquid cultures.<br /><br /></li><br />
<li>We determined its suitability as a selectable marker.</li><br/<br/><br />
<li>We have developed a conceptual sugar-based selection system for <i>Citrobacter freundii </i></li><br />
</ul><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Nitroreductase"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/DhlA"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
<br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-sucrose-hydrolase a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/NitroreductaseTeam:Edinburgh/Project/Non-antibiotic-Markers/Nitroreductase2012-10-26T14:22:59Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#pSB1C3-primers,<br />
#pSB1C3-seq,<br />
#pSB1C3-method,<br />
#Plac-lacZ-method,<br />
#PstI{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig1, #fig2, #fig3,<br />
#fig4, #fig5, #fig6{<br />
height:0px;<br />
margin:5px;<br />
}<br />
#fig1, #fig3{<br />
margin-left:240px;<br />
}<br />
#fig2, #fig5, #fig6{<br />
margin-left:300px;<br />
}<br />
#fig4{<br />
margin-left:310px;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'pSB1C3-method'){<br />
document.getElementById('fig1').style.height="auto";<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
if(x == 'Plac-lacZ-method'){<br />
document.getElementById('fig3').style.height="auto";<br />
document.getElementById('fig4').style.height="auto";<br />
document.getElementById('fig5').style.height="auto";<br />
document.getElementById('fig6').style.height="auto";<br />
}<br />
if(x == 'PstI'){<br />
document.getElementById('fig7').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'pSB1C3-method'){<br />
document.getElementById('fig1').style.height="0px";<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
if(x == 'Plac-lacZ-method'){<br />
document.getElementById('fig3').style.height="0px";<br />
document.getElementById('fig4').style.height="0px";<br />
document.getElementById('fig5').style.height="0px";<br />
document.getElementById('fig6').style.height="0px";<br />
}<br />
if(x == 'PstI'){<br />
document.getElementById('fig7').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Nitroreductase (<i>nfsI</i>)<br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
Nitroreductase is an <i>Enterobacter cloacae</i> enzyme which reduces nitrogen containing compounds <a href="#bibliography" onclick="expand('works-cited');">(Nicklin & Bruce, 1998)</a>. Other nitroreductases were found to convert nitro drugs such as metronidazole into their active forms, which is an essential part of their toxicity <a href="#bibliography" onclick="expand('works-cited');">(Nillius, Muller, & Muller, 2011)</a>. Bearing this in mind, we decided to look into nitroreductase's potential as a counter-selectable marker.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="h3"><br />
pSB1C3-nitroreductase (<a href="http://partsregistry.org/Part:BBa_K917004">BBa_K917004</a>)<br />
</p><br />
<p class="normal-text"><br />
The <i>nfsI</i> gene was cloned using these <a class="cursor-pointer" onclick="expand('pSB1C3-primers');">primers</a> and inserted into the standard BioBrick vector pSB1C3. This construct was confirmed through <a class="cursor-pointer" onclick="expand('pSB1C3-seq');">sequencing</a>.<br />
<a class="cursor-pointer" onclick="expand('pSB1C3-method')">Method</a>.<br />
</p><br />
<p class="normal-text" id="pSB1C3-primers"><br />
<br /><i>Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat<br /><br />
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT<br /></i><br />
<a class="cursor-pointer" onclick="collapse('pSB1C3-primers');">Close the primers.</a><br />
</p><br />
<p class="normal-text" id="pSB1C3-seq"><br />
<i>Sequencing results:<br /><br />
aacttataaatattcttaggcttatctctagggaggatttctggaattcgcggccgcttctagagcaccaggagttgttctggatatgatttctgtcgccctgaaacggcactccaccaaggcgttcgaccc<br />
cgctaaaaaactgaccgcatacgatccggaaaagatcaaacccctgctgcaataccgtccgtccaacaccctgtcccagccgtggcactttattgtccttgcaccgaggaaggtaaaccttgcgtggtttcc<br />
tctgccgaaagcacttacgtcttctacgatcgcaaaacgctggacgcttctctcgtggtggtgttctgcgcgaaaaccgcttcggatgatgccttcatggaacgcttggtggatcatgaagaacccgatggc<br />
cggt</i><br />
<br /><br />
<a class="cursor-pointer" onclick="collapse('pSB1C3-seq');">Close the sequencing results.</a><br />
</p><br />
<p class="normal-text" id="pSB1C3-method"><br />
<i>Method: The nitroreductase PCR product was purified and digested with EcoRI HQ and SpeI together with pSB1C3. These were ligated, E.coli cells transformed with the ligation and the white colonies (RFP disruption) were miniprepped. Detailed methods can be found in methods section.</i><br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/9/9e/Markers-fig01.JPG"><br /><br />
Figure 1: DNA gel of PCR product of BS-nitred with primers specific for nitroreductase. The product is around 0.6-0.7 kb which corresponds to the size of nitroreductase gene, around 0.6 kb.<br /><br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/d/d3/Markers-fig02.JPG"><br /><br />
Figure 2: DNA gel of pSB1C3-nitroreductase ligation. The band is around 2.5-2.6 kb which corresponds to the vector pSB1C3 (around 2 kb) together with the nitroreductase (0.6 kb). Sample 2 was confirmed with sequencing.<br /><br />
<a class="cursor-pointer" onclick="collapse('pSB1C3-method')">Close the method.</a><br />
</p><br />
<p class="h3"><br />
<br />Plac-lacZ-nitroreductase (<a href="http://partsregistry.org/Part:BBa_K917005">BBa_K917005</a>)<br />
</p><br />
<p class="normal-text"><br />
A promoter and a reporter gene were then added in front of the nitroreductase gene (plac-lacZ).<br />
<a class="cursor-pointer" onclick="expand('Plac-lacZ-method')">Method</a>.<br />
</p><br />
<p class="normal-text" id="Plac-lacZ-method"><br />
<i>Method: The sequence confirmed pSB1C3- nitroreductase was digested with EcoRI HQ and XbaI while Edinbrick1 was digested with EcoRI HQ and SpeI. These were ligated together. The ligations were transformed into cells and the transformants plated on LB+chloramphenicol+IPTG+Xgal plate. The blue colonies (contain lacZ) were used for the following experiments. Colony PCR screen of pooled blue plac-lacZ-nitroreductase transformants with lacZ forward primer and reverse nitroreductase primer showed a band corresponding to lacZ-nitroreductase.</i><br /><br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/4/42/Markers-fig03.JPG"><br /><br />
<i>Figure 3: DNA gel with Colony PCR products of pooled blue plac-lacZ-nitroreductase transformants with lacZ forward primer and reverse nitroreductase primer resulted in in bands around 1.2-1.3 kb which correspond to nitroreductase (0.6 kb) plus lacZ (0.6 kb).<br />
<br /><br /><br />
To confirm the presence of plac-lacZ-nitroreductase in pSB1C3, the samples in the smallest pool were minipreped, digested with EcoRI and SpeI to check the size of the insert.<br />
</i><br /><br />
<img id="fig4" src="https://static.igem.org/mediawiki/2012/a/a0/Markers-fig04.JPG"><br /><br />
<i>Figure 4: DNA gel with plac-lacZ-nitroreductase which was digested with EcoRI HQ and SpeI. The biggest band is likely to correspond to pSB1C3 around 2.2-2.3 kb, the middle band is likely to correspond to plac-lacZ-nitroreductase around 1.5 kb and the smallest fragment is unknown.</i><br /><br />
<img id="fig5" src="https://static.igem.org/mediawiki/2012/5/5a/Markers-fig05.JPG"><br /><br />
<i>Figure 5: DNA gel with plac-lacZ-nitroreductase which was digested with EcoRI HQ to linearise the DNA. There are two distinctive bands, one around 3.0 kb and one around 3.6 kb likely to correspond to pSB1C3 with plac-lacZ-nitroreductase and plac-lacZ.</i><br /><br />
This DNA was further purified to give a single plasmid corresponding to plac-lacZ-nitroreductase. <br /><br />
<img id="fig6" src="https://static.igem.org/mediawiki/2012/a/a8/G8.png"><br /><br />
Figure 6: DNA gel of plac-lacZ-nitroreductase digested with XbaI and PstI. The band around 1.2 kb corresponds to the plac-lacZ-nitroreductase fragment while the band at 2 kb corresponds to the vector. The band just above 3 kb is likely to be the undigested plasmid.<br />
<br />
<a class="cursor-pointer" onclick="collapse('Plac-lacZ-method')">Close the method.</a><br /><br />
</p><br />
<p class="h3"><br />
<br />PstI restriction site <a class="cursor-pointer" onclick="expand('PstI');">(expand)</a><br />
</p><br />
<p class="normal-text" id="PstI"><br />
<i>The original <a href="http://www.ncbi.nlm.nih.gov/nuccore/M63808.1">sequence</a> used for primer design has a PstI restriction site, but our sequencing results suggests that there is no such site. The sequence confirmed pSB1C3-nitroreductase was digested with PstI and run alongside an undigested sample.</i><br /><br />
<img id="fig7" src="https://static.igem.org/mediawiki/2012/0/00/Markers-fig06.JPG"><br /><br />
<i>Figure 7: DNA gel with pSB1C3-nitroreductase undigested and digested with PstI. Only one band at around 3 kb is visible corresponding to the linearized plasmid confirming that there is no PstI restriction site.</i><br />
<a class="cursor-pointer" onclick="collapse('PstI')">Close the method.</a><br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="h3"><br />
Specific activity- BS-nitred<br />
</p><br />
<p class="normal-text"><br />
Before cloning the nitroreductase gene into the BioBrick vector, 3 different plasmids containing 3 nitroreductase genes with different promoters (and a control containing no nitroreductase gene) were used to test nitroreductase specific activity. The method is detailed in the methods section.<br />
<br /><br /><br />
The change of NADH concentration was estimated by the change of OD340 absorbance per minute, background is subtracted and specific activity calculated. The results are presented in the diagram below. The experiment was done in triplicate. The control only had DMSO instead of DNBA substrate(which was used dissolved in DMSO) showed no change in absorbance (data not shown). <br /><br />
<img id="fig8" src="https://static.igem.org/mediawiki/2012/7/76/Specific_activity_nitroreductase.jpg"><br /><br />
Figure 8: Comparison of the specific activity of 3 nitroreductase genes in different vectors with different promoters and control. Error bars show the standard error of the mean. <br />
<br /><br /><br />
BS-nitred was used further for characterisation experiments as it showed the highest specific activity.<br />
<br />
</p><br />
<p class="h3"><br />
Specific activity- plac-lacZ-nitroreductase in pSB1C3<br />
</p><br />
<p class="normal-text"><br />
Specific activity was assessed in the BioBricked nitroreductase using the same method.The results are shown in the diagram below. The experiment was done in triplicate. <br /><br />
<img id="fig9" src="https://static.igem.org/mediawiki/2012/9/97/Data_3.jpg"><br /><br />
Figure 9: Comparison of the specific activity of the BioBricked nitroreductase gene and control under induced and uninduced conditions (+ and - IPTG respectively). Error bars show the standard error of the mean. <br />
<br /><br /><br />
This graph shows that only the plac-lacZ-nitroreductase with IPTG induction shows nitroreductase activity. In addition, this activity is similar to the nitroreductase in the BlueScript vector(diagram above). <br /><br />
</p><br />
<p class="h3"><br />
<br /><a name="plates">Plates</a><br />
</p><br />
<p class="normal-text"><br />
The following characterization results are produced from the pre-BioBrick form of nitroreductase (nitroreductase in BlueScript vector with lac promoter). Due to the similarity of the vectror, the identical regulation and very similar specific activity (previous section), we believe that the BioBricked plac-lacZ-nitroreductase will behave very similarly.<br /><br />
To determine the relative toxicity of different compounds, 5 ul of DMSO, MTZ and DNBA were added at three distinct spots on a freshly spread plate and the amount of clearing was measured (in centimeters).<br /><br /><br />
<img id="table1" src="https://static.igem.org/mediawiki/2012/4/43/Markers-table1.JPG"><br />
<br /><br /><br />
DMSO was determined to be non-toxic, DNBA showed small difference between the different strains while MTZ distinctively more toxic to BS-nitred and BS-contol.<br />
<br /><br /><br />
Numerous plate experiments with MTZ concentration ranging from 0 ug/ml to 300 ug/ml and various concentrations of DNBA and NFT were made to determine concentrations at which BS-control was growing but where BS-nitred’s growth is inhibited. Similar growth patterns were observed in DNBA and NFT plates. All metronidazole experiments showed inhibited growth of BS-nitred in comparison to BS-control however the inhibition was never 100 %, which is required for nitroreductase to be used as a counterselectable marker.<br /><br /><br />
<img id="fig10" src="https://static.igem.org/mediawiki/2012/5/5a/Markers-fig08.JPG"><br /><br /><br />
Figure 10: Overnight plates with 100 ug/ml MTZ concentration with and without IPTG with different nitroreductase strains and control. BS-nitred’s growth was inhibited in comparison with BS-control however there are still some BS-nitred colonies growing.<br /><br /><br />
<img id="fig11" src="https://static.igem.org/mediawiki/2012/2/2d/Markers-fig09.JPG"><br /><br /><br />
Figure 11: Comparison of growth of BS-contol and BS-nitred at 90 ug/ml metronidazole. BS-nitred’s growth is clearly inhibited in comparison to BS-control however growth inhibition is not absolute. <br />
We could not find a concentration of metronidazole at which nitroreductase containing cells’ growth was inhibited while control cells were growing. We determined that this gene is not suitable as a counter-selectable marker on plates.<br />
</p><br />
<p class="h3"><br />
<br />Liquid cultures<br />
</p><br />
<p class="normal-text"><br />
The growth of nitroreductase-containing and control strains was assessed in liquid medium as well. The cells were grown in aerobic or anaerobic conditions with and without MTZ, in triplicate. <br /><br />
<img id="fig10" src="https://static.igem.org/mediawiki/2012/e/e4/Markers-fig10.JPG"><br /><br />
Figure 10: Comparison of growth patterns of BS-nitred and BS-control in 150 ug/ml metronidazole in aerobic cultures. Initial OD600 was extracted and error bars are standard error of the mean.<br /><br />
<img id="fig11" src="https://static.igem.org/mediawiki/2012/a/a8/Markers-fig11.JPG"><br /><br />
Figure 11: Comparison of growth patterns of BS-nitred and BS-control in 150 ug/ml metronidazole in anaerobic cultures. Initial OD600 was extracted and error bars are standard error of the mean.<br />
<br /><br /><br />
The results in aerobic cultures are promising since nitroreductase-containing cells have not grown while the control cells are growing.<br />
Once we obtained the BioBricked version of <i>nfsI</i>, we proceeded to testing this construct to show that it has similar activity to the gene in the BlueScript vector. Transformants and controls were incubated overnight in LB bottles containing either no, or 150ug/ml, metronidazole and OD readings were taken the following day. These results can be seen in Figure 12 below.<br />
<br /><br /><br />
<img src="https://static.igem.org/mediawiki/2012/5/54/EdiGEM-Fig12.png"><br />
<br /><br />
Figure 12: Comparison of growth between cells transformed with pSB1C3 plasmids containing either <i>nfsI</i> or control. 150 ug/ml metronidazole was added to bottles that contain it. <br />
</p><br />
<p class="h2"><br />
<i> Citrobacter freundii </i> characterisation<br />
</p><br />
<p class="normal-text"><br />
We tried to see whether this construct would work in <i>Citrobacter freundii </i>, but we did not find a metronidazole concentration that inhibited its growth (we tried adding metronidazole up the concentration of 350ug/ml but this still gave an OD reading of 0.766). <br />
<br /><br /><br />
We have measured nitroreductase activity in the <i>nfsI</i> and control transformants and have found that the specific activity of nitroreductase was 14U/mg in the <i>nfsI</i> transformant, which is much higher than the specific activity we found in <i> E. coli </i> this is consistent with the finding that the Lac promoter is much stronger in <i> Citrobacter freundii </i>, as it is unregulated.<br />
<br /><br /><br />
Since the nitroreductase enzyme itself seems to be working fine, it could mean that <i> Citrobacter freundii </i> is inherently resistant to activated metronidazole, so this is not a good counter-selectable marker option for <i> Citrobacter freundii </i>.<br />
<br /><br /><br />
This is not necessarily a problem, as we have shown that our other counterselectable marker, <i>sacB</i> works very well in <i> Citrobacter freundii </i>, so that gene could instead be used for counterselection in this organism.<br />
</p><br />
<p class="h2"><br />
Conclusions<br />
</p><br />
<p class="normal-text"><br />
<ul style="list-style-type:circle;padding:10px;"><br />
<li>We successfully cloned the nitroreductase gene and inserted it into the BioBrick vector.<br /><br /></li><br />
<li>We extensively characterized the nitroreductase gene on plates and in liquid cultures.<br /><br /></li><br />
<li>We troubleshooted the plac-lacZ-nitroreductase clone and managed to purify it. <br /><br /></li><br />
<li>We are developing novel (to the best of our knowledge) counter-selection system which may have advantages over currently used systems.<br /><br /></li><br />
<li>We determined that nitroreductase is most suitable as a counter-selectable marker for <i>E. coli</i>in liquid aerobic cultures at 150 ug/ml metronidazole.</li><br />
</ul><br />
<br /><br /><br />
</p><br />
<p class="normal-text" style="text-align:center"><br />
<br /><br /><br />
<a href="https://2012.igem.org/wiki/index.php?title=Team:Edinburgh/Project/Non-antibiotic-Markers"><span class="intense-emphasis">&lt;&lt;Prev</span></a><span style="color:white;">___</span><a href="https://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase"><span class="intense-emphasis">Next&gt;&gt;</span></a><br />
<br /><br /><br />
</p><br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-nitroreductase a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/4-Lac-promoterTeam:Edinburgh/Project/Citrobacter-Freundii/4-Lac-promoter2012-10-26T13:24:45Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#fig01{<br />
width:100%;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation:<br />
<br /><br /><br />
Lac promoter characterisation<br />
</p><br />
<p class="normal-text"><br />
As the lac promoter is often used in synthetic biology, we wanted to test the its activity out in <i>C. freundii</i> by measuring the fluorescence of the RFP gene tied to this promoter. The reason for doing this is because it is not yet known whether our strain of <i>C. freundii</i> has a lacI gene. If the lacI gene is present on the host’s chromosome, we expect the fluorescence to be much lower when the cells are grown in media that contain no IPTG than in the ones that contain IPTG as the promoter will not be on. If there is no lacI gene, or if the <i>C. freundii</i> lacI cannot inhibit the <i>E. coli</i> Lac promoter, we expect the fluorescence in all 3 bottles will fall into a similar range.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Method<br />
</p><br />
<p class="normal-text"><br />
Three different sets of E. coli and <i>C. freundii</i> containing the pSB1C3 + Plac-RFP plasmid were grown overnight in LB+chloramphenicol, their OD was measured in order to normalize the number of cells and the normalized dilutions were used to inoculate 2.5ml M9 media that contained chloramphenicol and either no IPTG or 1, 2, 3, 4 or 5 &mu;l IPTG. These bottles were then incubated at 37&deg;C for 24 hours. The overnight LB cultures were inoculated into M9 in order to minimize background fluorescence to get clearer results.<br />
<br /><br /><br />
The fluorescence of the cultures was measured just after inoculation (using a green filter with the fluorimeter) and it was fairly even within the two species, averaging 1669.88 FSU for E. coli and 1235.91 FSU for <i>C. freundii</i>. Their fluorescence and OD was again measured after 24 hours in order to quantify RFP expression. These readings were normalized by dividing the fluorescence with the OD and the averages of the three sets were calculated. </p><br />
<p class="h2" style="padding-left:50px;"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/6/64/Lemon-fig08.JPG"><br /><br />
Figure 1 - Graphs showing RFP fluorescence when cells were grown in M9 with or without IPTG<br />
<br /><br /><br />
In Figure 1 above, the peaks that can be seen in <i>C. freundii</i> at 2 and 4 &mu;l IPTG are due very high fluorescence readings in one of the sets, which have skewed these averages somewhat. These results do, however, show that there is a significant difference in RFP expression in <i>E. coli</i> with and without IPTG, while no significant difference in the levels of RFP expression is observable in <i>C. freundii</i>. This suggests that <i>E. coli</i> has got a native LacI gene that represses the Lac promoter on the plasmid, while <i>C. freundii</i> lacks a native LacI gene, or that <i>C. freundii</i> can’t regulate the <i>E. coli</i> Lac promoter, which results in the RFP gene being constitutively expressed in <i>C. freundii</i>.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Genome sequencing<br />
</p><br />
<p class="normal-text"><br />
The genomes of two <i>C. freundii</i> strains (the type strain, ATCC 8090 and another strain our lab had, called SBS 197) were sequenced in Newcastle by Dr Wendy Smith and Prof Anil Wipat with IonTorrent Sequencing. We hoped that these sequences would help elucidate the mystery of the constitutive lac promoter.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Is an unregulated Plac promoter a bad thing?<br />
</p><br />
<p class="normal-text"><br />
Not necessarily, as regulation can still be obtained if the <i>E. coli</i> lacI gene is supplied in addition to the Plac construct. By controlling lacI expression levels, expression can be controlled without IPTG, as in the repressilator, toggle switch and other devices, without worrying about endogenous lacI.<br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-4 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacBTeam:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacB2012-10-26T13:21:38Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#plasmid,<br />
#method,<br />
#sequencing{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig17,<br />
#fig18,<br />
#fig19{<br />
height:0px;<br />
margin:5px;<br />
}<br />
#fig20,<br />
#fig21,<br />
#fig22{<br />
width:100%;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="auto";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="auto";<br />
document.getElementById('fig19').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="0px";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="0px";<br />
document.getElementById('fig19').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Levansucrase <i>(sacB) </i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
SacB is the levansucrase enzyme from <i>Bacillus subtilis</i> <a href="#bibliography" onclick="expand('works-cited');">(Gay, Coq, Strinmetz, Ferrari, & Hoch, 1983)</a> which converts sucrose into fructose polymers which are lethal to <i>Esherichia coli</i> <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. This part was deposited into the Registry by Team Edinburgh 2010 and can be used as a counter selectable marker <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. Our aim is to improve the part by assessing its counter selection efficiency.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="normal-text"><br />
The plac-RFP fragment was obtained from the standard BioBrick <a class="cursor-pointer" onclick="expand('plasmid');">plasmid</a> and inserted in front of the sacB BioBrick. <a class="cursor-pointer" onclick="expand('method');">Method</a>. The construct was confirmed with <a class="cursor-pointer" onclick="expand('sequencing');">sequencing</a>.<br />
</p><br />
<p class="normal-text" id="plasmid"><br />
<br /><i>PCR of pSB1K3 plasmid (Kanamycin resistance) with psBNX3 insF2 forward primer (specific for BioBrick prefix) and dsred r2 reverse primer (specific for RFP) was prepared in order to obtain the plac-RFP fragment.</i><br /><br />
<img id="fig17" src="https://static.igem.org/mediawiki/2012/3/3b/Markers-fig17.JPG"><br /><br />
<i>Figure 1: DNA gel of the PCR product from pSB1K3 amplification with primers specific to the BioBrick prefix and RFP. The band is abound 1 kb which corresponds to the expected size of plac-RFP.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('plasmid');">Close the plasmid.</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><i>The plac-RFP PCR product was purified and digested with EcoRI HQ and SpeI. The <i>sacB</i> BioBrick deposited in 2010 <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a> was digested with EcoRI and XbaI. These were ligated together after purification. <i>E.coli</i> cells were transformed with the ligation. The red transformants were minipreped, digested with EcoRI HQ in order to linearise them and with EcoRI HQ and PstI in order to check the size of the insert.</i><br /><br />
<img id="fig18" src="https://static.igem.org/mediawiki/2012/4/4c/Markers-fig18.JPG"><br /><br />
<i>Figure 2: DNA gel of miniprepped red clones of linearized plac-RFP-SacB ligation transformants. The band is around 4.5 kb which corresponds to pSB1C3 (2kb)+ +</i><br /><br />
<img id="fig19" src="https://static.igem.org/mediawiki/2012/1/10/Markers-fig19.JPG"><br /><br />
<i>Figure 3: The same clones were digested with EcoRI HQ and PstI to check the size of the insert. The band is around 2.5 kb which corresponds to SacB (1.5 kb)+ plac-rfp (1kb).</i><br /><br />
<a class="cursor-pointer" onclick="collapse('method');">Close the method.</a><br /><br />
</p><br />
<p class="normal-text" id="sequencing"><br />
<br /><i>Sequencing results<br />Forward primer:<br /><br />
Ctttaaaaaaaatcccttagctttcgctaaggtgatttctggaattcgcggccgcttctagagcaatac<br />
gcaaaccgtttcaccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactgga<br />
aagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacact<br />
ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagataaaga<br />
ggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcttatgga<br />
aggttccgttaactgtcactagttcgaaatcgaaggtgaatgtgaaggtcgtccgtactaaggtaccca<br />
gactgctaaactgaaagttactaaag<br />
<br /><br /><br />
Reverse primer:<br /><br />
aggggccttaaacataaacttttcggttttagaaaagggcagggtggtgacaccttgcccttttttgcc<br />
ggactgcagctactagtaatttatttgttaactgttaattgtccttgttcaaggatgctgtctttgaca<br />
acagatgttttcttgcctttgatgttcagcaggaagcttggcgcaaacgttgattgtttgtctgcgtaa<br />
aatcctctgtttgtcatatagcttgtaatcacgacattgtttcctttcgcttgaggtacagcgaagtgt<br />
gagtaattaaaggttacatcgttaggatcaagatccatttttaacacatggcctgttttgttcagcggc<br />
ttgtatgggccatttaaagaattagaaactttaccaagcatgttaatatcgttagacttatttccgtca<br />
atccttatttttgatccgcgggagtcatttaacaggtaccatttgccgttcattttattttcgttcgcg<br />
cgtctatttctttttgttactttgttttatgcaatcacgttttcattccttttttaattttgtatcatcgt</i><br /><br />
<a class="cursor-pointer" onclick="collapse('sequencing');">Close the sequencing results.</a><br /><br />
</p><br />
<p class="normal-text"><br />
<br />The idea of placing <i>sacB</i> under the control of the lac promoter is to create kanamycin-independent control. Moreover, by changing the IPTG levels, the level of selection can be controlled.<br />
<br /><br /><br />
RFP is added to ensure that cells which have lost the cassette (should be white because of loss of RFP) can be distinguished from cells which have lost SacB function (should be red as RFP is still present). This would allow us to assess the counter-selection efficiency of SacB.<br /><br />
We also prepared a Kan-plac-RFP-sacB selection-counterselection cassette. <br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="normal-text"><br />
The growth of SacB (bottom) and a control (top) were tested by adding 1.3 g solid sucrose plus 0.5 ml sterile water into a well in the middle of the plate. <br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/7/79/SAM_3111.JPG"><br /><br />
Figure 1: A quick test of SacB transformants' growth in the presence of sucrose. The growth of SacB (bottom) is inhibited near the well in comparison to the control (top). <br />
</p><br />
<p class="h3"><br />
<i>Citrobacter freundii</i><br />
</p><br />
<p class="normal-text"><br />
<i>SacB</i> and control (pSB1C3 only) transformants were streaked onto LB plates (with either cml40 or cml15) and solid sucrose was added to the regions indicated by the crosses or circles in Figure 2. The plates were incubated at 37&deg;C overnight.<br />
<br /><br /><br />
<img id="fig20" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114357.jpg" border="0"/><br />
<br /><br />
Figure 2: A quick test of <i>sacB</i> and control’s ability to grow in the presence of sucrose. The zone of clearance indicates that the cells containing <i>sacB</i> are inhibited by sucrose while the controls are unaffected. The control on the plate on the right is purple due to both expressing the RFP gene and turning blue because of the X-gal on the plate.<br />
<br /><br /><br />
The bottom streak on plate on the left in Figure 1 contains cells that have the selection-counterselection cassette so this test shows that the counterselection component of the cassette is working. <br />
<br /><br /><br />
We also tested the selection component of this cassette by streaking the cells onto plates containing both chloramphenicol and kanamycin and incubated overnight. These results can be seen in Figure 3.<br />
<br /><br /><br />
<img id="fig21" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121019_114629.jpg" border="0"/><br />
<br /><br />
Figure 3: Plate showing that the kanamycin resistance component of the selection-counterselection cassette works. The control did not grow at all, even after 4 days, as it was inhibited by the kanamycin, while the cells containing the cassette show growth. Growth is weaker because we have found that using the concentration of chloramphenicol we normally use (cml40) in combination with the sacB in <i>Citrobacter freundii</i> causes slower growth, presumably because levansucrase expression is unregulated in these bacteria which puts a strain on the cell.<br />
</p><br />
<p class="h3"><br />
Sugar-dependent selection-counterselection cassette concept<br />
</p><br />
<p class="normal-text"><br />
The reason we did not use our sucrose hydrolase gene for the selection component of the selection-counterselection cassette was because both it and levansucrase depend on the same substrate – sucrose – for their function, so this would have not yielded good results.<br />
<br /><br /><br />
We have found that <i> Citrobacter freundii </i> can use sucrose as a sole carbon source without the need for the sucrose hydrolase gene – this means that if we want to develop a non-antibiotic resistance-dependent selection-counterselection cassette for this organism, we need to use a different sugar. One sugar that, according to our findings, <i>Citrobacter freundii </i> cannot use is xylitol – see our ‘Xylitol dehydrogenase’ section for more details on this. We could therefore combine this gene with the levansucrase gene to obtain an antibiotic resistance-independent selection-counterselection cassette that dependent entirely on sugars.<br />
</p><br />
<p class="h3"><br />
Levans<br />
</p><br />
<p class="normal-text"><br />
We have found that under sublethal doses of sucrose, the <i>E. coli </i> cells start to secrete a lot of gloopy substance, which we believe to be levans (Figure 4), the fructose polymers formed because of the levansucrase activity. <br />
<br /><br /><br />
<img id="fig22" src="http://i1056.photobucket.com/albums/t366/edigem12/October%20results%20Reka/IMG_20121018_132400.jpg" border="0"/><br />
<br /><br />
Figure 4: Secretion of levans outside of the cell – it is only present on the lower two colonies but is absent in the two controls above.<br />
<br /><br /><br />
We find this important to mention, as levans have got several applications in various fields <a href="#bibliography" onclick="expand('works-cited');">(Kang <i>et al.</i>, 2009)</a>.<br />
<br /><br /><br />
<ul id="list"><br />
<li>Food<br />
<ul><br />
<li>has prebiotic effects</li><br />
<li>provides dietary fibres</li><br />
<li>reduces serum cholesterol levels </li><br />
<li>it can be used as a food additive in the following ways: a stabilizer, an emulsifier, a formulation aid, surface-finishing agent, an encapsulating agent, and a carrier of flavours and fragrances </li><br />
</ul><br />
</li><br />
<li>Pharmaceutical industry <br />
<ul><br />
<li>can be used as a coating material for drugs </li><br />
<li>has anti-tumour properties <i>in vitro</i></li><br />
<li>can be used as a blood plasma volume expander</li><br />
<li>has anti-diabetic effects <a href="#bibliography" onclick="expand('works-cited');">(Dahech <i>et al.</i>, 2011)</a></li><br />
<li>levan derivatives are shown to be anti-AIDS agents</li><br />
</ul><br />
</li><br />
<li>Cosmetics<br />
<ul><br />
<li>good as a cell-proliferating agent</li><br />
<li>skin moisturising agent</li><br />
<li>reduces skin irritation</li><br />
</ul><br />
</li><br />
<li>Industry<br />
<ul><br />
<li>it can be used in a two-phase liquid good for the separation of biological samples</li><br />
<li>it can be used an environmentally friendly adhesive</li><br />
<li>it can be used as a temporary adhesive in water-soluble form</li><br />
<li>it can be used as a water-resistant adhesive for a long period of time in cross-linked form</li><br />
<li>it can form a water-resistant film</li><br />
<li>it acts as a cryoprotectant for the preservation of animal cells and fish</li><br />
</ul><br />
</li><br />
</ul><br />
</p><br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
We prepared a plac-RFP-SacB construct which can be used for assessing counter-selection efficiency. (<a href="http://partsregistry.org/Part:BBa_K917002">BBa_K917002</a>)<br /><br /><br />
We placed <i>sacB</i> under the lac promoter which allows IPTG dependent control rather than kanamycin dependent control and IPTG concentration-dependent control of the levels of selection.<br />
<br /><br /><br />
We added RFP to allow distinguishing loss of the counter-selection cassette form loss of SacB fuction.<br /><br /><br />
We prepared and characterized a Kan-plac-RFP-sacB selection-counterselection cassette in both <i>E. coli</i> and <i> Citrobacter freundii </i> (<a href="http://partsregistry.org/Part:BBa_K917010">BBa_K917010</a>)<br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-Plac-RFP-SacB a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
<br />
#list{<br />
list-style-type:circle;<br />
}<br />
#list li{<br />
margin-left:20px;<br />
padding-bottom:10px;<br />
}<br />
#list li ul{<br />
list-style-type:square;<br />
}<br />
#list li ul li{<br />
margin-left:50px;<br />
padding:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/AttributionsTeam:Edinburgh/Attributions2012-10-26T11:41:45Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<html><br />
<style type="text/css"><br />
/* header edit */<br />
#attributions-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#attributions-page a,<br />
#attributions-page a:visited{<br />
color: #000;<br />
}<br />
#attributions-page a:hover{<br />
cursor: default;<br />
color: #000;<br />
}<br />
/* attributions page */<br />
#attributions-middle{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
border-radius: 20px;<br />
width:1083px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
margin-top:20px;<br />
}<br />
#sponsors a img{<br />
width:16%;<br />
padding-left:0.8%;<br />
padding-top:60px;<br />
padding-bottom:60px;<br />
float:left;<br />
}<br />
#sponsors a#sponsor-UoE img{<br />
width:12%;<br />
padding:2%;<br />
}<br />
#sponsors a#sponsor-SELEX img{<br />
padding-top:40px;<br />
padding-bottom:80px;<br />
}<br />
#sponsors a#sponsor-MSD img{<br />
padding-top:30px;<br />
padding-bottom:90px;<br />
}<br />
.normal-text{<br />
font: normal 14px/20px verdana, calibri, tahoma, sans-serif;<br />
}<br />
</style><br />
<br />
<div id="attributions-middle"><br />
<div class="text"><br />
<p class="h2"><br />
We would like to thank all the people who guided us through this tough but rewarding summer:<br />
<br /><br /><br />
</p><br />
<p class="normal-text"><br />
<b>Dr. Chris French</b> for his support in every step, for teaching us that there are shortcuts in science, for all the work on getting the biobricks right and for so many other things!<br />
<br /><br /><br />
<b>Eugene Fletcher</b> for all the help in the lab and for being our sequencing guru,<br />
<br /><br /><br />
<b>Dr. David Radford</b> for showing us the lawful evil way of doing experiments!<br />
<br /><br /><br />
<b>Dr. Jane Calvert</b> for being an amazing guide in the world of human practices, for being there for us every week, for the enthusiasm and for liking our (sometimes not so good) ideas,<br />
<br /><br /><br />
<b>Dr. Pablo Schyfter</b> for teaching us that you should look at everything from all possible angles, for contradicting Jane and for teaching us to always ask 'Where is the Why?',<br />
<br /><br /><br />
<b>Dr. Louise Horsfall</b> for her very inspiring views on the relationship between the public and science,<br />
<br /><br /><br />
<b>Dr. Claire Marris</b> for giving us food for thought on regulations and legislation,<br />
<br /><br /><br />
<b>John Wilson-Kanamori</b> and <b>Donal Stewart</b> for their help in trying to make some sense of our models,<br />
<br /><br /><br />
<b>Donal Stewart</b> for the nice java tool that helped us visualise the model.<br />
<br /><br /><br />
<b>John Innes</b> for his interesting views on life, the universe and everything and for the stimulating conversations,<br />
<br /><br /><br />
<b>Dr. Wendy Smith</b> for showing us around the Centre for Bacterial Cell Biology and walking us through every step that leads from raw DNA to getting its genome sequence<br />
<br /><br /><br />
<b>Dr. Anil Wipat</b> for showing us what to do with said sequence<br />
<br /><br /><br />
<b>Dr. Bruce Ward</b> and <b>Matthew Knighton</b> for their help with the fuel cells and for lending us their lab equipment.<br />
<br /><br /><br />
<b>Dr. Chris Mowat</b> for his help with haem staining protocol and general advice on work with <i>S. oneidensis</i><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /attributions-middle --><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/AttributionsTeam:Edinburgh/Attributions2012-10-25T22:11:07Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<html><br />
<style type="text/css"><br />
/* header edit */<br />
#attributions-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#attributions-page a,<br />
#attributions-page a:visited{<br />
color: #000;<br />
}<br />
#attributions-page a:hover{<br />
cursor: default;<br />
color: #000;<br />
}<br />
/* attributions page */<br />
#attributions-middle{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
border-radius: 20px;<br />
width:1083px;<br />
margin-left:auto;<br />
margin-right:auto;<br />
margin-top:20px;<br />
}<br />
#sponsors a img{<br />
width:16%;<br />
padding-left:0.8%;<br />
padding-top:60px;<br />
padding-bottom:60px;<br />
float:left;<br />
}<br />
#sponsors a#sponsor-UoE img{<br />
width:12%;<br />
padding:2%;<br />
}<br />
#sponsors a#sponsor-SELEX img{<br />
padding-top:40px;<br />
padding-bottom:80px;<br />
}<br />
#sponsors a#sponsor-MSD img{<br />
padding-top:30px;<br />
padding-bottom:90px;<br />
}<br />
.normal-text{<br />
font: normal 14px/20px verdana, calibri, tahoma, sans-serif;<br />
}<br />
</style><br />
<br />
<div id="attributions-middle"><br />
<div class="text"><br />
<p class="h2"><br />
We would like to thank our generous sponsors...<br />
<br /><br /><br />
</p><br />
<p id="sponsors" class="normal-text"><br />
<a href="http://www.ed.ac.uk/home" id="sponsor-UoE"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b6/Edi-sponsor-logo-University_of_Edinburgh.png" /><br />
</a><br />
<a href="http://www.sulsa.ac.uk/" id="sponsor-SULSA"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Sulsa-logo.png" /><br />
</a><br />
<a href="http://www.wellcome.ac.uk/" id="sponsor-WT"><br />
<img src="https://static.igem.org/mediawiki/2012/8/82/Edi-sponsor-logo-Wellcome-trust.png" /><br />
</a><br />
<a href="http://www.mathworks.co.uk/index.html" id="sponsor-MathWorks"><br />
<img src="https://static.igem.org/mediawiki/2012/3/33/Edi-sponsor-logo-mathworks.PNG" /><br />
</a><br />
<a href="http://www.selexgalileo.com/SelexGalileo/EN//index.sdo" id="sponsor-SELEX"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b5/Edi-sponsor-logo_SELEX_Galileo.jpg" /><br />
</a><br />
<a href="http://www.msd-uk.com/" id="sponsor-MSD"><br />
<img src="https://static.igem.org/mediawiki/2012/c/c7/Sponsors-MSD.png" /><br />
</a><br />
</p><br />
<p class="h2"><br />
... and all the people who guided us through this tough but rewarding summer:<br />
<br /><br /><br />
</p><br />
<p class="normal-text"><br />
<b>Dr. Chris French</b> for his support in every step, for teaching us that there are shortcuts in science, for all the work on getting the biobricks right and for so many other things!<br />
<br /><br /><br />
<b>Eugene Fletcher</b> for all the help in the lab and for being our sequencing guru,<br />
<br /><br /><br />
<b>Dr. David Radford</b> for showing us the lawful evil way of doing experiments!<br />
<br /><br /><br />
<b>Dr. Jane Calvert</b> for being an amazing guide in the world of human practices, for being there for us every week, for the enthusiasm and for liking our (sometimes not so good) ideas,<br />
<br /><br /><br />
<b>Dr. Pablo Schyfter</b> for teaching us that you should look at everything from all possible angles, for contradicting Jane and for teaching us to always ask 'Where is the Why?',<br />
<br /><br /><br />
<b>Dr. Louise Horsfall</b> for her very inspiring views on the relationship between the public and science,<br />
<br /><br /><br />
<b>Dr. Claire Marris</b> for giving us food for thought on regulations and legislation,<br />
<br /><br /><br />
<b>John Wilson-Kanamori</b> and <b>Donal Stewart</b> for their help in trying to make some sense of our models,<br />
<br /><br /><br />
<b>Donal Stewart</b> for the nice java tool that helped us visualise the model.<br />
<br /><br /><br />
<b>John Innes</b> for his interesting views on life, the universe and everything and for the stimulating conversations,<br />
<br /><br /><br />
<b>Dr. Wendy Smith</b> for showing us around the Centre for Bacterial Cell Biology and walking us through every step that leads from raw DNA to getting its genome sequence<br />
<br /><br /><br />
<b>Dr. Anil Wipat</b> for showing us what to do with said sequence<br />
<br /><br /><br />
<b>Dr. Bruce Ward</b> and <b>Matthew Knighton</b> for their help with the fuel cells and for lending us their lab equipment.<br />
<br /><br /><br />
<b>Dr. Chris Mowat</b> for his help with haem staining protocol and general advice on work with <i>S. oneidensis</i><br />
</p><br />
</div><!-- /text --><br />
</div><!-- /attributions-middle --><br />
</html></div>RNagyhttp://2012.igem.org/Team:EdinburghTeam:Edinburgh2012-10-25T22:07:08Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
{{Team:Edinburgh/css/home-page-structure.css}}<br />
{{Team:Edinburgh/css/home-page-style.css}}<br />
<br />
<html><br />
<div id="page-middle"><br />
<div id="page-navigation"><br />
<div style="margin-top:10px;"><br />
<img style="width:65px;float:left;" src="https://static.igem.org/mediawiki/2012/c/c1/EdiGEM_gold_medal.png"><br />
</div><br />
<div class="text" id="awards" style="padding:0px;margin:0px;margin-bottom:10px;"><br />
<p class="normal-text"><br />
<span class="intense-emphasis">EdiGEM received a Gold Medal at the European Jamboree and advanced to the World Championship.</span><br /><br /><br />
</p><br />
</div><!-- /awards --><br />
<div class="text" id="sponsors"><br />
<p class="h2" style="padding-top:0px;padding-bottom:10px;">Funded by:</p><br />
<a href="http://www.msd-uk.com/" id="sponsor-MSD"><br />
<img src="https://static.igem.org/mediawiki/2012/c/c7/Sponsors-MSD.png" /><br />
</a> <br />
<p class="h2" style="padding-top:0px;padding-bottom:10px;">Supported by:</p><br />
<a href="http://www.wellcome.ac.uk/" id="sponsor-WT"><br />
<img src="https://static.igem.org/mediawiki/2012/8/82/Edi-sponsor-logo-Wellcome-trust.png" /><br />
</a> <br />
<a href="http://www.sulsa.ac.uk/" id="sponsor-SULSA"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Sulsa-logo.png" /><br />
</a> <br />
<a href="http://www.mathworks.co.uk/index.html" id="sponsor-MathWorks"><br />
<img src="https://static.igem.org/mediawiki/2012/3/33/Edi-sponsor-logo-mathworks.PNG" /><br />
</a><br />
<a href="http://www.selexgalileo.com/SelexGalileo/EN//index.sdo" id="sponsor-SELEX"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b5/Edi-sponsor-logo_SELEX_Galileo.jpg" /><br />
</a><br />
<a href="http://www.erasynbio.net/" id="sponsor-erasynbio"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d9/EdiGEM-Sponsor-erasynbio.png" /><br />
</a><br />
<a href="http://www.ed.ac.uk/home" id="sponsor-UoE"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b6/Edi-sponsor-logo-University_of_Edinburgh.png" /><br />
</a><br />
<br />
<p class="normal-text" style="font: normal 9px/11px verdana, tahoma, calibri, sans-serif;padding-top:5px;"><br />
<i>This iGEM team has been funded by the MSD Scottish Life Sciences Fund.<br />
The opinions expressed by this iGEM team are those of the team members and do not necessarily represent those of MSD.</i><br />
</p><br />
</div><!-- /sponsors --><br />
</div><!-- /page-navigation --><br />
<div id="page-content"><br />
<div class="home-page-div" id="edi-twitter-widget"><span class="plainlinks"><br />
<script charset="utf-8" src="http://widgets.twimg.com/j/2/widget.js"></script><br />
<script><br />
new TWTR.Widget({<br />
version: 2,<br />
type: 'profile',<br />
rpp: 10,<br />
interval: 30000,<br />
width: 225,<br />
height: 593,<br />
theme: {<br />
shell: {<br />
background: '#182e46',<br />
color: '#f2f2f2'<br />
},<br />
tweets: {<br />
background: '#f2f2f2',<br />
color: '#000',<br />
links: '#248c25',<br />
}<br />
},<br />
features: {<br />
scrollbar: true,<br />
loop: false,<br />
live: false,<br />
behavior: 'all'<br />
}<br />
}).render().setUser('EdiGEM12').start();<br />
</script><br />
</span></div><!-- /edinburgh-twitter-widget --><br />
<div id="home-page-text"><br />
<div class="text"><br />
<p class="h1" id="home-page-project-title" style="padding-top:3px;"><br />
Tools that Make Synthetic Biology Easier and Safer<br />– Questioning Legacy and Friendliness.<br />
</p><br />
<p class="normal-text" style="font-size:14px;"><br />
<br /><br /><br />
Welcome to the official wiki of EdiGEM - the Edinburgh team for iGEM 2012!<br />
<br /><br /><br />
We aim is to design new biological systems that will make synthetic biology more accessible and friendly. Our team plans to achieve this by constructing a bio-electric interface, designing new selectable and counterselectable markers and characterising Citrobacter freundii to start a dialogue on what a synthetic-biology specific chassis should look like. To find more about our project have a look at the <a href="https://2012.igem.org/Team:Edinburgh/Project"><b>Project page</b></a>. Or, alternatively, watch the video abstract below.<br />
<br /><br /><br />
However, if you are short for time, you may want to have a look at <span class="plainlinks"><a href="http://dl.dropbox.com/u/108285418/EdiGEM%20-%20iGEM%20Edinburgh%202012.pdf"><b>EdiGEM's Concise Project Description</b></a></span>.<br />
</p><br />
<p class="h2"><br />
<a name="project-abstract-anchor">Project Abstract</a><br />
</p><br />
<div id="project-abstract-video"><br />
<iframe width="560" height="315" src="http://www.youtube.com/embed/wnd77MsyMi4" frameborder="0" allowfullscreen></iframe><br />
</div><br />
</div><!-- /text --><br />
</div> <!-- /home-page-text --><br />
</div><!-- /page-content --><br />
</div><!-- /middle --><br />
</html></div>RNagyhttp://2012.igem.org/Team:EdinburghTeam:Edinburgh2012-10-25T22:04:43Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
{{Team:Edinburgh/css/home-page-structure.css}}<br />
{{Team:Edinburgh/css/home-page-style.css}}<br />
<br />
<html><br />
<div id="page-middle"><br />
<div id="page-navigation"><br />
<div style="margin-top:10px;"><br />
<img style="width:65px;float:left;" src="https://static.igem.org/mediawiki/2012/c/c1/EdiGEM_gold_medal.png"><br />
</div><br />
<div class="text" id="awards" style="padding:0px;margin:0px;margin-bottom:10px;"><br />
<p class="normal-text"><br />
<span class="intense-emphasis">EdiGEM received a Gold Medal at the European Jamboree and advanced to the World Championship.</span><br /><br /><br />
</p><br />
</div><!-- /awards --><br />
<div class="text" id="sponsors"><br />
<p class="h2" style="padding-top:0px;padding-bottom:10px;">Sponsors:</p><br />
<a href="http://www.msd-uk.com/" id="sponsor-MSD"><br />
<img src="https://static.igem.org/mediawiki/2012/c/c7/Sponsors-MSD.png" /><br />
</a> <br />
<a href="http://www.wellcome.ac.uk/" id="sponsor-WT"><br />
<img src="https://static.igem.org/mediawiki/2012/8/82/Edi-sponsor-logo-Wellcome-trust.png" /><br />
</a> <br />
<a href="http://www.sulsa.ac.uk/" id="sponsor-SULSA"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Sulsa-logo.png" /><br />
</a> <br />
<a href="http://www.mathworks.co.uk/index.html" id="sponsor-MathWorks"><br />
<img src="https://static.igem.org/mediawiki/2012/3/33/Edi-sponsor-logo-mathworks.PNG" /><br />
</a><br />
<a href="http://www.selexgalileo.com/SelexGalileo/EN//index.sdo" id="sponsor-SELEX"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b5/Edi-sponsor-logo_SELEX_Galileo.jpg" /><br />
</a><br />
<a href="http://www.erasynbio.net/" id="sponsor-erasynbio"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d9/EdiGEM-Sponsor-erasynbio.png" /><br />
</a><br />
<a href="http://www.ed.ac.uk/home" id="sponsor-UoE"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b6/Edi-sponsor-logo-University_of_Edinburgh.png" /><br />
</a><br />
<br />
<p class="normal-text" style="font: normal 9px/11px verdana, tahoma, calibri, sans-serif;padding-top:5px;"><br />
<i>This iGEM team has been funded by the MSD Scottish Life Sciences Fund.<br />
The opinions expressed by this iGEM team are those of the team members and do not necessarily represent those of MSD.</i><br />
</p><br />
</div><!-- /sponsors --><br />
</div><!-- /page-navigation --><br />
<div id="page-content"><br />
<div class="home-page-div" id="edi-twitter-widget"><span class="plainlinks"><br />
<script charset="utf-8" src="http://widgets.twimg.com/j/2/widget.js"></script><br />
<script><br />
new TWTR.Widget({<br />
version: 2,<br />
type: 'profile',<br />
rpp: 10,<br />
interval: 30000,<br />
width: 225,<br />
height: 593,<br />
theme: {<br />
shell: {<br />
background: '#182e46',<br />
color: '#f2f2f2'<br />
},<br />
tweets: {<br />
background: '#f2f2f2',<br />
color: '#000',<br />
links: '#248c25',<br />
}<br />
},<br />
features: {<br />
scrollbar: true,<br />
loop: false,<br />
live: false,<br />
behavior: 'all'<br />
}<br />
}).render().setUser('EdiGEM12').start();<br />
</script><br />
</span></div><!-- /edinburgh-twitter-widget --><br />
<div id="home-page-text"><br />
<div class="text"><br />
<p class="h1" id="home-page-project-title" style="padding-top:3px;"><br />
Tools that Make Synthetic Biology Easier and Safer<br />– Questioning Legacy and Friendliness.<br />
</p><br />
<p class="normal-text" style="font-size:14px;"><br />
<br /><br /><br />
Welcome to the official wiki of EdiGEM - the Edinburgh team for iGEM 2012!<br />
<br /><br /><br />
We aim is to design new biological systems that will make synthetic biology more accessible and friendly. Our team plans to achieve this by constructing a bio-electric interface, designing new selectable and counterselectable markers and characterising Citrobacter freundii to start a dialogue on what a synthetic-biology specific chassis should look like. To find more about our project have a look at the <a href="https://2012.igem.org/Team:Edinburgh/Project"><b>Project page</b></a>. Or, alternatively, watch the video abstract below.<br />
<br /><br /><br />
However, if you are short for time, you may want to have a look at <span class="plainlinks"><a href="http://dl.dropbox.com/u/108285418/EdiGEM%20-%20iGEM%20Edinburgh%202012.pdf"><b>EdiGEM's Concise Project Description</b></a></span>.<br />
</p><br />
<p class="h2"><br />
<a name="project-abstract-anchor">Project Abstract</a><br />
</p><br />
<div id="project-abstract-video"><br />
<iframe width="560" height="315" src="http://www.youtube.com/embed/wnd77MsyMi4" frameborder="0" allowfullscreen></iframe><br />
</div><br />
</div><!-- /text --><br />
</div> <!-- /home-page-text --><br />
</div><!-- /page-content --><br />
</div><!-- /middle --><br />
</html></div>RNagyhttp://2012.igem.org/Team:EdinburghTeam:Edinburgh2012-10-25T22:02:50Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
{{Team:Edinburgh/css/home-page-structure.css}}<br />
{{Team:Edinburgh/css/home-page-style.css}}<br />
<br />
<html><br />
<div id="page-middle"><br />
<div id="page-navigation"><br />
<div style="margin-top:10px;"><br />
<img style="width:65px;float:left;" src="https://static.igem.org/mediawiki/2012/c/c1/EdiGEM_gold_medal.png"><br />
</div><br />
<div class="text" id="awards" style="padding:0px;margin:0px;margin-bottom:10px;"><br />
<p class="normal-text"><br />
<span class="intense-emphasis">EdiGEM received a Gold Medal at the European Jamboree and advanced to the World Championship.</span><br /><br /><br />
</p><br />
</div><!-- /awards --><br />
<div class="text" id="sponsors"><br />
<p class="h2" style="padding-top:0px;padding-bottom:10px;">Sponsors:</p><br />
<a href="http://www.msd-uk.com/" id="sponsor-MSD"><br />
<img src="https://static.igem.org/mediawiki/2012/c/c7/Sponsors-MSD.png" /><br />
</a> <br />
<a href="http://www.wellcome.ac.uk/" id="sponsor-WT"><br />
<img src="https://static.igem.org/mediawiki/2012/8/82/Edi-sponsor-logo-Wellcome-trust.png" /><br />
</a> <br />
<a href="http://www.ed.ac.uk/home" id="sponsor-UoE"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b6/Edi-sponsor-logo-University_of_Edinburgh.png" /><br />
</a><br />
<a href="http://www.sulsa.ac.uk/" id="sponsor-SULSA"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Sulsa-logo.png" /><br />
</a><br />
<br />
<a href="http://www.mathworks.co.uk/index.html" id="sponsor-MathWorks"><br />
<img src="https://static.igem.org/mediawiki/2012/3/33/Edi-sponsor-logo-mathworks.PNG" /><br />
</a><br />
<a href="http://www.selexgalileo.com/SelexGalileo/EN//index.sdo" id="sponsor-SELEX"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b5/Edi-sponsor-logo_SELEX_Galileo.jpg" /><br />
</a><br />
<a href="http://www.erasynbio.net/" id="sponsor-erasynbio"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d9/EdiGEM-Sponsor-erasynbio.png" /><br />
</a><br />
<br />
<p class="normal-text" style="font: normal 9px/11px verdana, tahoma, calibri, sans-serif;padding-top:5px;"><br />
<i>This iGEM team has been funded by the MSD Scottish Life Sciences Fund.<br />
The opinions expressed by this iGEM team are those of the team members and do not necessarily represent those of MSD.</i><br />
</p><br />
</div><!-- /sponsors --><br />
</div><!-- /page-navigation --><br />
<div id="page-content"><br />
<div class="home-page-div" id="edi-twitter-widget"><span class="plainlinks"><br />
<script charset="utf-8" src="http://widgets.twimg.com/j/2/widget.js"></script><br />
<script><br />
new TWTR.Widget({<br />
version: 2,<br />
type: 'profile',<br />
rpp: 10,<br />
interval: 30000,<br />
width: 225,<br />
height: 593,<br />
theme: {<br />
shell: {<br />
background: '#182e46',<br />
color: '#f2f2f2'<br />
},<br />
tweets: {<br />
background: '#f2f2f2',<br />
color: '#000',<br />
links: '#248c25',<br />
}<br />
},<br />
features: {<br />
scrollbar: true,<br />
loop: false,<br />
live: false,<br />
behavior: 'all'<br />
}<br />
}).render().setUser('EdiGEM12').start();<br />
</script><br />
</span></div><!-- /edinburgh-twitter-widget --><br />
<div id="home-page-text"><br />
<div class="text"><br />
<p class="h1" id="home-page-project-title" style="padding-top:3px;"><br />
Tools that Make Synthetic Biology Easier and Safer<br />– Questioning Legacy and Friendliness.<br />
</p><br />
<p class="normal-text" style="font-size:14px;"><br />
<br /><br /><br />
Welcome to the official wiki of EdiGEM - the Edinburgh team for iGEM 2012!<br />
<br /><br /><br />
We aim is to design new biological systems that will make synthetic biology more accessible and friendly. Our team plans to achieve this by constructing a bio-electric interface, designing new selectable and counterselectable markers and characterising Citrobacter freundii to start a dialogue on what a synthetic-biology specific chassis should look like. To find more about our project have a look at the <a href="https://2012.igem.org/Team:Edinburgh/Project"><b>Project page</b></a>. Or, alternatively, watch the video abstract below.<br />
<br /><br /><br />
However, if you are short for time, you may want to have a look at <span class="plainlinks"><a href="http://dl.dropbox.com/u/108285418/EdiGEM%20-%20iGEM%20Edinburgh%202012.pdf"><b>EdiGEM's Concise Project Description</b></a></span>.<br />
</p><br />
<p class="h2"><br />
<a name="project-abstract-anchor">Project Abstract</a><br />
</p><br />
<div id="project-abstract-video"><br />
<iframe width="560" height="315" src="http://www.youtube.com/embed/wnd77MsyMi4" frameborder="0" allowfullscreen></iframe><br />
</div><br />
</div><!-- /text --><br />
</div> <!-- /home-page-text --><br />
</div><!-- /page-content --><br />
</div><!-- /middle --><br />
</html></div>RNagyhttp://2012.igem.org/Team:EdinburghTeam:Edinburgh2012-10-25T22:01:21Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
{{Team:Edinburgh/css/home-page-structure.css}}<br />
{{Team:Edinburgh/css/home-page-style.css}}<br />
<br />
<html><br />
<div id="page-middle"><br />
<div id="page-navigation"><br />
<div style="margin-top:10px;"><br />
<img style="width:65px;float:left;" src="https://static.igem.org/mediawiki/2012/c/c1/EdiGEM_gold_medal.png"><br />
</div><br />
<div class="text" id="awards" style="padding:0px;margin:0px;margin-bottom:10px;"><br />
<p class="normal-text"><br />
<span class="intense-emphasis">EdiGEM received a Gold Medal at the European Jamboree and advanced to the World Championship.</span><br /><br /><br />
</p><br />
</div><!-- /awards --><br />
<div class="text" id="sponsors"><br />
<p class="h2" style="padding-top:0px;padding-bottom:10px;">Sponsors:</p><br />
<a href="http://www.msd-uk.com/" id="sponsor-MSD"><br />
<img src="https://static.igem.org/mediawiki/2012/c/c7/Sponsors-MSD.png" /><br />
</a> <br />
<a href="http://www.ed.ac.uk/home" id="sponsor-UoE"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b6/Edi-sponsor-logo-University_of_Edinburgh.png" /><br />
</a><br />
<a href="http://www.sulsa.ac.uk/" id="sponsor-SULSA"><br />
<img src="https://static.igem.org/mediawiki/2012/6/69/Sulsa-logo.png" /><br />
</a><br />
<a href="http://www.wellcome.ac.uk/" id="sponsor-WT"><br />
<img src="https://static.igem.org/mediawiki/2012/8/82/Edi-sponsor-logo-Wellcome-trust.png" /><br />
</a><br />
<a href="http://www.mathworks.co.uk/index.html" id="sponsor-MathWorks"><br />
<img src="https://static.igem.org/mediawiki/2012/3/33/Edi-sponsor-logo-mathworks.PNG" /><br />
</a><br />
<a href="http://www.selexgalileo.com/SelexGalileo/EN//index.sdo" id="sponsor-SELEX"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b5/Edi-sponsor-logo_SELEX_Galileo.jpg" /><br />
</a><br />
<a href="http://www.erasynbio.net/" id="sponsor-erasynbio"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d9/EdiGEM-Sponsor-erasynbio.png" /><br />
</a><br />
<br />
<p class="normal-text" style="font: normal 9px/11px verdana, tahoma, calibri, sans-serif;padding-top:5px;"><br />
<i>This iGEM team has been funded by the MSD Scottish Life Sciences Fund.<br />
The opinions expressed by this iGEM team are those of the team members and do not necessarily represent those of MSD.</i><br />
</p><br />
</div><!-- /sponsors --><br />
</div><!-- /page-navigation --><br />
<div id="page-content"><br />
<div class="home-page-div" id="edi-twitter-widget"><span class="plainlinks"><br />
<script charset="utf-8" src="http://widgets.twimg.com/j/2/widget.js"></script><br />
<script><br />
new TWTR.Widget({<br />
version: 2,<br />
type: 'profile',<br />
rpp: 10,<br />
interval: 30000,<br />
width: 225,<br />
height: 593,<br />
theme: {<br />
shell: {<br />
background: '#182e46',<br />
color: '#f2f2f2'<br />
},<br />
tweets: {<br />
background: '#f2f2f2',<br />
color: '#000',<br />
links: '#248c25',<br />
}<br />
},<br />
features: {<br />
scrollbar: true,<br />
loop: false,<br />
live: false,<br />
behavior: 'all'<br />
}<br />
}).render().setUser('EdiGEM12').start();<br />
</script><br />
</span></div><!-- /edinburgh-twitter-widget --><br />
<div id="home-page-text"><br />
<div class="text"><br />
<p class="h1" id="home-page-project-title" style="padding-top:3px;"><br />
Tools that Make Synthetic Biology Easier and Safer<br />– Questioning Legacy and Friendliness.<br />
</p><br />
<p class="normal-text" style="font-size:14px;"><br />
<br /><br /><br />
Welcome to the official wiki of EdiGEM - the Edinburgh team for iGEM 2012!<br />
<br /><br /><br />
We aim is to design new biological systems that will make synthetic biology more accessible and friendly. Our team plans to achieve this by constructing a bio-electric interface, designing new selectable and counterselectable markers and characterising Citrobacter freundii to start a dialogue on what a synthetic-biology specific chassis should look like. To find more about our project have a look at the <a href="https://2012.igem.org/Team:Edinburgh/Project"><b>Project page</b></a>. Or, alternatively, watch the video abstract below.<br />
<br /><br /><br />
However, if you are short for time, you may want to have a look at <span class="plainlinks"><a href="http://dl.dropbox.com/u/108285418/EdiGEM%20-%20iGEM%20Edinburgh%202012.pdf"><b>EdiGEM's Concise Project Description</b></a></span>.<br />
</p><br />
<p class="h2"><br />
<a name="project-abstract-anchor">Project Abstract</a><br />
</p><br />
<div id="project-abstract-video"><br />
<iframe width="560" height="315" src="http://www.youtube.com/embed/wnd77MsyMi4" frameborder="0" allowfullscreen></iframe><br />
</div><br />
</div><!-- /text --><br />
</div> <!-- /home-page-text --><br />
</div><!-- /page-content --><br />
</div><!-- /middle --><br />
</html></div>RNagyhttp://2012.igem.org/File:Sulsa-logo.pngFile:Sulsa-logo.png2012-10-25T22:00:52Z<p>RNagy: </p>
<hr />
<div></div>RNagyhttp://2012.igem.org/Team:EdinburghTeam:Edinburgh2012-10-25T21:59:54Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
{{Team:Edinburgh/css/home-page-structure.css}}<br />
{{Team:Edinburgh/css/home-page-style.css}}<br />
<br />
<html><br />
<div id="page-middle"><br />
<div id="page-navigation"><br />
<div style="margin-top:10px;"><br />
<img style="width:65px;float:left;" src="https://static.igem.org/mediawiki/2012/c/c1/EdiGEM_gold_medal.png"><br />
</div><br />
<div class="text" id="awards" style="padding:0px;margin:0px;margin-bottom:10px;"><br />
<p class="normal-text"><br />
<span class="intense-emphasis">EdiGEM received a Gold Medal at the European Jamboree and advanced to the World Championship.</span><br /><br /><br />
</p><br />
</div><!-- /awards --><br />
<div class="text" id="sponsors"><br />
<p class="h2" style="padding-top:0px;padding-bottom:10px;">Sponsors:</p><br />
<a href="http://www.msd-uk.com/" id="sponsor-MSD"><br />
<img src="https://static.igem.org/mediawiki/2012/c/c7/Sponsors-MSD.png" /><br />
</a> <br />
<a href="http://www.ed.ac.uk/home" id="sponsor-UoE"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b6/Edi-sponsor-logo-University_of_Edinburgh.png" /><br />
</a><br />
<a href="http://www.sulsa.ac.uk/" id="sponsor-SULSA"><br />
<img src="https://static.igem.org/mediawiki/2012/f/f7/Edi-sponsor-logo-SULSA.jpg" /><br />
</a><br />
<a href="http://www.wellcome.ac.uk/" id="sponsor-WT"><br />
<img src="https://static.igem.org/mediawiki/2012/8/82/Edi-sponsor-logo-Wellcome-trust.png" /><br />
</a><br />
<a href="http://www.mathworks.co.uk/index.html" id="sponsor-MathWorks"><br />
<img src="https://static.igem.org/mediawiki/2012/3/33/Edi-sponsor-logo-mathworks.PNG" /><br />
</a><br />
<a href="http://www.selexgalileo.com/SelexGalileo/EN//index.sdo" id="sponsor-SELEX"><br />
<img src="https://static.igem.org/mediawiki/2012/b/b5/Edi-sponsor-logo_SELEX_Galileo.jpg" /><br />
</a><br />
<a href="http://www.erasynbio.net/" id="sponsor-erasynbio"><br />
<img src="https://static.igem.org/mediawiki/2012/d/d9/EdiGEM-Sponsor-erasynbio.png" /><br />
</a><br />
<br />
<p class="normal-text" style="font: normal 9px/11px verdana, tahoma, calibri, sans-serif;padding-top:5px;"><br />
<i>This iGEM team has been funded by the MSD Scottish Life Sciences Fund.<br />
The opinions expressed by this iGEM team are those of the team members and do not necessarily represent those of MSD.</i><br />
</p><br />
</div><!-- /sponsors --><br />
</div><!-- /page-navigation --><br />
<div id="page-content"><br />
<div class="home-page-div" id="edi-twitter-widget"><span class="plainlinks"><br />
<script charset="utf-8" src="http://widgets.twimg.com/j/2/widget.js"></script><br />
<script><br />
new TWTR.Widget({<br />
version: 2,<br />
type: 'profile',<br />
rpp: 10,<br />
interval: 30000,<br />
width: 225,<br />
height: 593,<br />
theme: {<br />
shell: {<br />
background: '#182e46',<br />
color: '#f2f2f2'<br />
},<br />
tweets: {<br />
background: '#f2f2f2',<br />
color: '#000',<br />
links: '#248c25',<br />
}<br />
},<br />
features: {<br />
scrollbar: true,<br />
loop: false,<br />
live: false,<br />
behavior: 'all'<br />
}<br />
}).render().setUser('EdiGEM12').start();<br />
</script><br />
</span></div><!-- /edinburgh-twitter-widget --><br />
<div id="home-page-text"><br />
<div class="text"><br />
<p class="h1" id="home-page-project-title" style="padding-top:3px;"><br />
Tools that Make Synthetic Biology Easier and Safer<br />– Questioning Legacy and Friendliness.<br />
</p><br />
<p class="normal-text" style="font-size:14px;"><br />
<br /><br /><br />
Welcome to the official wiki of EdiGEM - the Edinburgh team for iGEM 2012!<br />
<br /><br /><br />
We aim is to design new biological systems that will make synthetic biology more accessible and friendly. Our team plans to achieve this by constructing a bio-electric interface, designing new selectable and counterselectable markers and characterising Citrobacter freundii to start a dialogue on what a synthetic-biology specific chassis should look like. To find more about our project have a look at the <a href="https://2012.igem.org/Team:Edinburgh/Project"><b>Project page</b></a>. Or, alternatively, watch the video abstract below.<br />
<br /><br /><br />
However, if you are short for time, you may want to have a look at <span class="plainlinks"><a href="http://dl.dropbox.com/u/108285418/EdiGEM%20-%20iGEM%20Edinburgh%202012.pdf"><b>EdiGEM's Concise Project Description</b></a></span>.<br />
</p><br />
<p class="h2"><br />
<a name="project-abstract-anchor">Project Abstract</a><br />
</p><br />
<div id="project-abstract-video"><br />
<iframe width="560" height="315" src="http://www.youtube.com/embed/wnd77MsyMi4" frameborder="0" allowfullscreen></iframe><br />
</div><br />
</div><!-- /text --><br />
</div> <!-- /home-page-text --><br />
</div><!-- /page-content --><br />
</div><!-- /middle --><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-useTeam:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use2012-10-24T11:48:39Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#method{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig01, fig02{<br />
width:100%;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation<br />
<br /><br /><br />
Sugar use<br />
</p><br />
<p class="normal-text"><br />
An ideal chassis should be able to use various sugars as carbon sources. In order to show that <i>C. freundii</i> is capable of using a variety of carbon sources, we have tested its growth on M9 minimal media plates containing different types of sugars. In addition to plates, we have also assessed its growth in liquid media containing these and other sugars.<br />
<br /><br /><br />
While it has not yet been tested by our team, others in the C. French lab has shown that <i>C. freundii</i> grows well on media that contain cellobiose as the sole carbon source, whereas <i>E. coli</i> cannot use cellobiose. Cellobiose is a major component of biomass, so <i>C. freundii</i> can be used well for biomass degradation experiments.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Method <a class="cursor-pointer" onclick="expand('method')">(expand)</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><br />
<i>Small wells were cut in the middle of the plates and 150 μl of 20% sugar solution (glucose, sucrose, lactose, or glycerol) was added to each well. To some plates, powdered sucrose or glucose was added instead. The plates were then streaked with four strains ( E. coli, E. coli + sucrose hydrolase gene, C. freundii NCIMB and C. freundii SBS197) and incubated overnight at 37&deg;C.<br />
<br /><br /><br />
A final test involved adding the various sugars to the M9 medium in the bottle as opposed to either adding it to the plate before pouring the agar on top or adding them into the well on the plate. 5x100ml M9 medium bottles were prepared as before and autoclaved. The sugars (1ml) and thiamine hydrochloride (3.4 ml) were added to the bottles prior to the agar getting poured, with two bottles having no sugar added to them. After the agar had set, the plates were inoculated as before. One of the no sugar plates had solid citrate added to its middle, as before with the solid glucose and sucrose, to test the growth of C. freundii on this medium that gives it its name.<br /><br/><br />
<br />
For the liquid cultures, M9 minimal medium was used, supplemented with various sugars at a 1% final concentration and chloramphenicol20. The bottles were inoculated with cells containing pSB1C3 grown overnight, and incubated overnight at 37&deg;C</i><br />
<a class="cursor-pointer" onclick="collapse('method')">Close the method.</a><br />
<br /><br /><br />
<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Results - Plates<br />
</p><br />
<p class="normal-text"><br />
The results of these experiments can be seen in Figures 1 and 2 below.<br />
<br /><br /><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/4/4a/Lemon-fig05.JPG"><br /><br />
Figure 1 - M9 plates with sugars added to wells in the middle of the plates<br />
<br /><br /><br />
<img id="fig02" src="https://static.igem.org/mediawiki/2012/9/99/Lemon-fig06.JPG"><br /><br />
<img id="fig03" src="https://static.igem.org/mediawiki/2012/8/8b/Lemon-fig07.JPG"><br /><br />
Figure 2 - Sugars were added to the agar before the plates were poured<br />
<br /><br /><br />
<b>From these results, it can be seen that C. freundii SBS197 grows less well on lactose, sucrose and citrate but both strains grow equally well on glycerol and glucose. </b>The <i>E. coli</i> + sucrose hydrolase cells grew well on sucrose even without there being any arsenic (the inducer of the sucrose hydrolase gene) on the plate. For some reason, all bacteria grew weakly on the lactose plates, this might mean that our lactose stock quality needs to be checked.<br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-3 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-useTeam:Edinburgh/Project/Citrobacter-Freundii/3-Sugar-use2012-10-24T11:45:12Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#method{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig01, fig02{<br />
width:100%;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation<br />
<br /><br /><br />
Sugar use<br />
</p><br />
<p class="normal-text"><br />
An ideal chassis should be able to use various sugars as carbon sources. In order to show that <i>C. freundii</i> is capable of using a variety of carbon sources, we have tested its growth on M9 minimal media plates containing different types of sugars. In addition to plates, we have also assessed its growth in liquid media containing these and other sugars.<br />
<br /><br /><br />
While it has not yet been tested by our team, others in the C. French lab has shown that <i>C. freundii</i> grows well on media that contain cellobiose as the sole carbon source, whereas <i>E. coli</i> cannot use cellobiose. Cellobiose is a major component of biomass, so <i>C. freundii</i> can be used well for biomass degradation experiments.<br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Method <a class="cursor-pointer" onclick="expand('method')">(expand)</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><br />
<i>Small wells were cut in the middle of the plates and 150 μl of 20% sugar solution (glucose, sucrose, lactose, or glycerol) was added to each well. To some plates, powdered sucrose or glucose was added instead. The plates were then streaked with four strains ( E. coli, E. coli + sucrose hydrolase gene, C. freundii NCIMB and C. freundii SBS197) and incubated overnight at 37&deg;C.<br />
<br /><br /><br />
A final test involved adding the various sugars to the M9 medium in the bottle as opposed to either adding it to the plate before pouring the agar on top or adding them into the well on the plate. 5x100ml M9 medium bottles were prepared as before and autoclaved. The sugars (1ml) and thiamine hydrochloride (3.4 ml) were added to the bottles prior to the agar getting poured, with two bottles having no sugar added to them. After the agar had set, the plates were inoculated as before. One of the no sugar plates had solid citrate added to its middle, as before with the solid glucose and sucrose, to test the growth of C. freundii on this medium that gives it its name.<br /></i><br />
<a class="cursor-pointer" onclick="collapse('method')">Close the method.</a><br />
<br /><br /><br />
</p><br />
<p class="h2" style="padding-left:50px;"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
The results of these experiments can be seen in Figures 1 and 2 below.<br />
<br /><br /><br />
<img id="fig01" src="https://static.igem.org/mediawiki/2012/4/4a/Lemon-fig05.JPG"><br /><br />
Figure 1 - M9 plates with sugars added to wells in the middle of the plates<br />
<br /><br /><br />
<img id="fig02" src="https://static.igem.org/mediawiki/2012/9/99/Lemon-fig06.JPG"><br /><br />
<img id="fig03" src="https://static.igem.org/mediawiki/2012/8/8b/Lemon-fig07.JPG"><br /><br />
Figure 2 - Sugars were added to the agar before the plates were poured<br />
<br /><br /><br />
<b>From these results, it can be seen that C. freundii SBS197 grows less well on lactose, sucrose and citrate but both strains grow equally well on glycerol and glucose. </b>The <i>E. coli</i> + sucrose hydrolase cells grew well on sucrose even without there being any arsenic (the inducer of the sucrose hydrolase gene) on the plate. For some reason, all bacteria grew weakly on the lactose plates, this might mean that our lactose stock quality needs to be checked.<br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-3 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacBTeam:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacB2012-10-24T11:13:17Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#plasmid,<br />
#method,<br />
#sequencing{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig17,<br />
#fig18,<br />
#fig19{<br />
height:0px;<br />
margin:5px;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="auto";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="auto";<br />
document.getElementById('fig19').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="0px";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="0px";<br />
document.getElementById('fig19').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Levansucrase <i>(sacB) </i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
SacB is the levansucrase enzyme from <i>Bacillus subtilis</i> <a href="#bibliography" onclick="expand('works-cited');">(Gay, Coq, Strinmetz, Ferrari, & Hoch, 1983)</a> which converts sucrose into fructose polymers which are lethal to <i>Esherichia coli</i> <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. This part was deposited into the Registry by Team Edinburgh 2010 and can be used as a counter selectable marker <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. Our aim is to improve the part by assessing its counter selection efficiency.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="normal-text"><br />
The plac-RFP fragment was obtained from the standard BioBrick <a class="cursor-pointer" onclick="expand('plasmid');">plasmid</a> and inserted in front of the sacB BioBrick. <a class="cursor-pointer" onclick="expand('method');">Method</a>. The construct was confirmed with <a class="cursor-pointer" onclick="expand('sequencing');">sequencing</a>.<br />
</p><br />
<p class="normal-text" id="plasmid"><br />
<br /><i>PCR of pSB1K3 plasmid (Kanamycin resistance) with psBNX3 insF2 forward primer (specific for BioBrick prefix) and dsred r2 reverse primer (specific for RFP) was prepared in order to obtain the plac-RFP fragment.</i><br /><br />
<img id="fig17" src="https://static.igem.org/mediawiki/2012/3/3b/Markers-fig17.JPG"><br /><br />
<i>Figure 1: DNA gel of the PCR product from pSB1K3 amplification with primers specific to the BioBrick prefix and RFP. The band is abound 1 kb which corresponds to the expected size of plac-RFP.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('plasmid');">Close the plasmid.</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><i>The plac-RFP PCR product was purified and digested with EcoRI HQ and SpeI. The <i>sacB</i> BioBrick deposited in 2010 <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a> was digested with EcoRI and XbaI. These were ligated together after purification. <i>E.coli</i> cells were transformed with the ligation. The red transformants were minipreped, digested with EcoRI HQ in order to linearise them and with EcoRI HQ and PstI in order to check the size of the insert.</i><br /><br />
<img id="fig18" src="https://static.igem.org/mediawiki/2012/4/4c/Markers-fig18.JPG"><br /><br />
<i>Figure 2: DNA gel of miniprepped red clones of linearized plac-RFP-SacB ligation transformants. The band is around 4.5 kb which corresponds to pSB1C3 (2kb)+ +</i><br /><br />
<img id="fig19" src="https://static.igem.org/mediawiki/2012/1/10/Markers-fig19.JPG"><br /><br />
<i>Figure 3: The same clones were digested with EcoRI HQ and PstI to check the size of the insert. The band is around 2.5 kb which corresponds to SacB (1.5 kb)+ plac-rfp (1kb).</i><br /><br />
<a class="cursor-pointer" onclick="collapse('method');">Close the method.</a><br /><br />
</p><br />
<p class="normal-text" id="sequencing"><br />
<br /><i>Sequencing results<br />Forward primer:<br /><br />
Ctttaaaaaaaatcccttagctttcgctaaggtgatttctggaattcgcggccgcttctagagcaatac<br />
gcaaaccgtttcaccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactgga<br />
aagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacact<br />
ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagataaaga<br />
ggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcttatgga<br />
aggttccgttaactgtcactagttcgaaatcgaaggtgaatgtgaaggtcgtccgtactaaggtaccca<br />
gactgctaaactgaaagttactaaag<br />
<br /><br /><br />
Reverse primer:<br /><br />
aggggccttaaacataaacttttcggttttagaaaagggcagggtggtgacaccttgcccttttttgcc<br />
ggactgcagctactagtaatttatttgttaactgttaattgtccttgttcaaggatgctgtctttgaca<br />
acagatgttttcttgcctttgatgttcagcaggaagcttggcgcaaacgttgattgtttgtctgcgtaa<br />
aatcctctgtttgtcatatagcttgtaatcacgacattgtttcctttcgcttgaggtacagcgaagtgt<br />
gagtaattaaaggttacatcgttaggatcaagatccatttttaacacatggcctgttttgttcagcggc<br />
ttgtatgggccatttaaagaattagaaactttaccaagcatgttaatatcgttagacttatttccgtca<br />
atccttatttttgatccgcgggagtcatttaacaggtaccatttgccgttcattttattttcgttcgcg<br />
cgtctatttctttttgttactttgttttatgcaatcacgttttcattccttttttaattttgtatcatcgt</i><br /><br />
<a class="cursor-pointer" onclick="collapse('sequencing');">Close the sequencing results.</a><br /><br />
</p><br />
<p class="normal-text"><br />
<br />The idea of placing <i>sacB</i> under the control of the lac promoter is to create kanamycin-independent control. Moreover, by changing the IPTG levels, the level of selection can be controlled.<br />
<br /><br /><br />
RFP is added to ensure that cells which have lost the cassette (should be white because of loss of RFP) can be distinguished from cells which have lost SacB function (should be red as RFP is still present). This would allow us to assess the counter-selection efficiency of SacB.<br /><br />
We also prepared a Kan-plac-RFP-sacB selection-counterselection cassette. <br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="normal-text"><br />
The growth of SacB (bottom) and a control (top) were tested by adding 1.3 g solid sucrose plus 0.5 ml sterile water into a well in the middle of the plate. <br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/7/79/SAM_3111.JPG"><br /><br />
Figure 1: A quick test of SacB transformants' growth in the presence of sucrose. The growth of SacB (bottom) is inhibited near the well in comparison to the control (top). <br />
</p><br />
<br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
We prepared a plac-RFP-SacB construct which can be used for assessing counter-selection efficiency. (<a href="http://partsregistry.org/Part:BBa_K917002">BBa_K917002</a>)<br /><br /><br />
We placed <i>sacB</i> under the lac promoter which allows IPTG dependent control rather than kanamycin dependent control and IPTG concentration-dependent control of the levels of selection.<br />
<br /><br /><br />
We added RFP to allow distinguishing loss of the counter-selection cassette form loss of SacB fuction.<br /><br /><br />
We prepared and characterized a Kan-plac-RFP-sacB selection-counterselection cassette in both <i>E. coli</i> and <i> Citrobacter freundii </i> (<a href="http://partsregistry.org/Part:BBa_K917010">BBa_K917010</a>)<br />
<br />
</p><br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-Plac-RFP-SacB a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacBTeam:Edinburgh/Project/Non-antibiotic-Markers/Plac-RFP-SacB2012-10-24T11:12:45Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#plasmid,<br />
#method,<br />
#sequencing{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig17,<br />
#fig18,<br />
#fig19{<br />
height:0px;<br />
margin:5px;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="auto";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="auto";<br />
document.getElementById('fig19').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
if(x == 'plasmid'){<br />
document.getElementById('fig17').style.height="0px";<br />
}<br />
if(x == 'method'){<br />
document.getElementById('fig18').style.height="0px";<br />
document.getElementById('fig19').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Levansucrase <i>(sacB) </i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
SacB is the levansucrase enzyme from <i>Bacillus subtilis</i> <a href="#bibliography" onclick="expand('works-cited');">(Gay, Coq, Strinmetz, Ferrari, & Hoch, 1983)</a> which converts sucrose into fructose polymers which are lethal to <i>Esherichia coli</i> <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. This part was deposited into the Registry by Team Edinburgh 2010 and can be used as a counter selectable marker <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a>. Our aim is to improve the part by assessing its counter selection efficiency.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="normal-text"><br />
The plac-RFP fragment was obtained from the standard BioBrick <a class="cursor-pointer" onclick="expand('plasmid');">plasmid</a> and inserted in front of the sacB BioBrick. <a class="cursor-pointer" onclick="expand('method');">Method</a>. The construct was confirmed with <a class="cursor-pointer" onclick="expand('sequencing');">sequencing</a>.<br />
</p><br />
<p class="normal-text" id="plasmid"><br />
<br /><i>PCR of pSB1K3 plasmid (Kanamycin resistance) with psBNX3 insF2 forward primer (specific for BioBrick prefix) and dsred r2 reverse primer (specific for RFP) was prepared in order to obtain the plac-RFP fragment.</i><br /><br />
<img id="fig17" src="https://static.igem.org/mediawiki/2012/3/3b/Markers-fig17.JPG"><br /><br />
<i>Figure 1: DNA gel of the PCR product from pSB1K3 amplification with primers specific to the BioBrick prefix and RFP. The band is abound 1 kb which corresponds to the expected size of plac-RFP.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('plasmid');">Close the plasmid.</a><br /><br />
</p><br />
<p class="normal-text" id="method"><br />
<br /><i>The plac-RFP PCR product was purified and digested with EcoRI HQ and SpeI. The <i>sacB</i> BioBrick deposited in 2010 <a href="#bibliography" onclick="expand('works-cited');">(French & Kowal, 2010)</a> was digested with EcoRI and XbaI. These were ligated together after purification. <i>E.coli</i> cells were transformed with the ligation. The red transformants were minipreped, digested with EcoRI HQ in order to linearise them and with EcoRI HQ and PstI in order to check the size of the insert.</i><br /><br />
<img id="fig18" src="https://static.igem.org/mediawiki/2012/4/4c/Markers-fig18.JPG"><br /><br />
<i>Figure 2: DNA gel of miniprepped red clones of linearized plac-RFP-SacB ligation transformants. The band is around 4.5 kb which corresponds to pSB1C3 (2kb)+ +</i><br /><br />
<img id="fig19" src="https://static.igem.org/mediawiki/2012/1/10/Markers-fig19.JPG"><br /><br />
<i>Figure 3: The same clones were digested with EcoRI HQ and PstI to check the size of the insert. The band is around 2.5 kb which corresponds to SacB (1.5 kb)+ plac-rfp (1kb).</i><br /><br />
<a class="cursor-pointer" onclick="collapse('method');">Close the method.</a><br /><br />
</p><br />
<p class="normal-text" id="sequencing"><br />
<br /><i>Sequencing results<br />Forward primer:<br /><br />
Ctttaaaaaaaatcccttagctttcgctaaggtgatttctggaattcgcggccgcttctagagcaatac<br />
gcaaaccgtttcaccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactgga<br />
aagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacact<br />
ttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagataaaga<br />
ggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcttatgga<br />
aggttccgttaactgtcactagttcgaaatcgaaggtgaatgtgaaggtcgtccgtactaaggtaccca<br />
gactgctaaactgaaagttactaaag<br />
<br /><br /><br />
Reverse primer:<br /><br />
aggggccttaaacataaacttttcggttttagaaaagggcagggtggtgacaccttgcccttttttgcc<br />
ggactgcagctactagtaatttatttgttaactgttaattgtccttgttcaaggatgctgtctttgaca<br />
acagatgttttcttgcctttgatgttcagcaggaagcttggcgcaaacgttgattgtttgtctgcgtaa<br />
aatcctctgtttgtcatatagcttgtaatcacgacattgtttcctttcgcttgaggtacagcgaagtgt<br />
gagtaattaaaggttacatcgttaggatcaagatccatttttaacacatggcctgttttgttcagcggc<br />
ttgtatgggccatttaaagaattagaaactttaccaagcatgttaatatcgttagacttatttccgtca<br />
atccttatttttgatccgcgggagtcatttaacaggtaccatttgccgttcattttattttcgttcgcg<br />
cgtctatttctttttgttactttgttttatgcaatcacgttttcattccttttttaattttgtatcatcgt</i><br /><br />
<a class="cursor-pointer" onclick="collapse('sequencing');">Close the sequencing results.</a><br /><br />
</p><br />
<p class="normal-text"><br />
<br />The idea of placing <i>sacB</i> under the control of the lac promoter is to create kanamycin-independent control. Moreover, by changing the IPTG levels, the level of selection can be controlled.<br />
<br /><br /><br />
RFP is added to ensure that cells which have lost the cassette (should be white because of loss of RFP) can be distinguished from cells which have lost SacB function (should be red as RFP is still present). This would allow us to assess the counter-selection efficiency of SacB.<br /><br />
We also prepared a Kan-plac-RFP-sacB selection-counterselection cassette. <br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="normal-text"><br />
The growth of SacB (bottom) and a control (top) were tested by adding 1.3 g solid sucrose plus 0.5 ml sterile water into a well in the middle of the plate. <br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/7/79/SAM_3111.JPG"><br /><br />
Figure 1: A quick test of SacB transformants' growth in the presence of sucrose. The growth of SacB (bottom) is inhibited near the well in comparison to the control (top). <br />
</p><br />
<br />
<p class="h2"><br />
Conclusion:<br />
</p><br />
<p class="normal-text"><br />
We prepared a plac-RFP-SacB construct which can be used for assessing counter-selection efficiency. (<a href="http://partsregistry.org/Part:BBa_K917002">BBa_K917002</a>)<br /><br /><br />
We placed <i>sacB</i> under the lac promoter which allows IPTG dependent control rather than kanamycin dependent control and IPTG concentration-dependent control of the levels of selection.<br />
<br /><br /><br />
We added RFP to allow distinguishing loss of the counter-selection cassette form loss of SacB fuction.<br /><br /><br />
We prepared and characterized a Kan-plac-RFP-sacB selection-counterselection cassette in both <i>E. coli</i> and <i> Citrobacter freundii </i> (<a href="http://partsregistry.org/Part:BBa_K917010">BBa_K917010</a>)<br />
<br />
</p><br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-Plac-RFP-SacB a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-HydrolaseTeam:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase2012-10-24T10:53:36Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#CscA-primers,<br />
#CscA-method,<br />
#figure1,<br />
#figure2,<br />
#figure3{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig12{<br />
height:0px;<br />
margin:5px;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
document.getElementById('fig12').style.height="auto";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="auto";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
document.getElementById('fig12').style.height="0px";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="0px";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Sucrose Hydrolase <i> (cscA)</i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
Sucrose hydrolase is an enzyme from <i>Escherichia coli</i> O157:H7 strain Sakai which is involved in sucrose utilisation <a href="#bibliography" onclick="expand('works-cited');">(Jahreis, et al., 2002)</a>. Transforming <i>Escherichia coli</i> K12 strains with sucrose hydrolase allows the cells to grow with sucrose as a sole carbon source, something the untransformed K12 strain cannot do. This allows this gene to be used as a selectable marker.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="h3"><br />
<i>cscA</i> cloning <br />
</p><br />
<p class="normal-text"><br />
The <i>cscA</i> gene was cloned PCR with <i>cscA</i> specific primers. <a onclick="expand('figure1');">Figure 1.</a><br />
</p><br />
<p class="normal-text" id="figure1"><br />
<br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/0/06/G1.png"><br /><br />
Figure 1: DNA gel of PCR amplification with primers specific for <i> cscA </i>. The product is around 1.4-1.5 kb which corresponds to the size of <i> cscA </i> gene, around 1.5 kb.<br /><br /><br />
<a onclick="collapse('figure1');">Close figure 1.</a><br />
</p><br />
<p class="normal-text"><br />
<br />This fragment was inserted into the standard BioBrick vector pSB1C3. <a onclick="expand('figure2');">Figure 2.</a><br />
</p><br />
<p class="normal-text" id="figure2"><br />
<br /><br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/8/85/G2.png"><br /><br />
Figure 2:DNA gel of pSBIC3-<i>cscA</i> ligation digested with EcoRI in order to linearise the plasmid. The band is around 3.5 kb which corresponds to the vector pSBIC3 (around 2 kb) together with the <i>cscA</i> gene (arounf 1.5 kb)<br /><br /><br />
<a onclick="collapse('figure2');">Close figure 2.</a><br />
</p><br />
<p class="normal-text"><br />
<br />A promoter and a reporter gene were added in front of the <i>cscA</i> gene (plac-lacZ). <a onclick="expand('figure3');">Figure 3.</a><br />
</p><br />
<p class="normal-text" id="figure3"><br />
<br /><br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/e/e2/G9.png"><br /><br />
Figure 3: DNA gel of pSB1C3-plac-lacZ-cscA digested with XbaI and PstI. The clear band just above 2kb corresponds both to the size of the vector and the plac-lacZ-cscA fragment. The band around 4 kb is likely to correspond to the undigested plasmid. <br /><br /><br />
<a onclick="collapse('figure3');">Close figure 3.</a><br />
</p><br />
<br />
<p class="h3"><br />
cscA selection plasmid<br />
</p><br />
<p class="normal-text"><br />
The <i>cscA</i> and pSB1C3 gene were cloned using these <a class="cursor-pointer" onclick="expand('CscA-primers');">primers</a>. <a class="cursor-pointer" onclick="expand('CscA-method')">Method</a>. pSB1C3-cscA ligation transformants are to be checked for the success of this cloning procedure.<br />
</p><br />
<p class="normal-text" id="CscA-primers"><br />
<br /><i>Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat<br /><br />
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT<br /></i><br />
<img id="fig12" src="https://static.igem.org/mediawiki/2012/7/75/Markers-fig12.JPG"><br /><br />
<i>Figure 1: DNA gel of PCR products of pSB1C3 without chloramphenicol and <i>cscA</i>. One product is around 1.4 kb which corresponds to the size of <i>cscA</i> gene, the other is around 2.2 kb which corresponds to the pSB1C3 vector without cml resistance.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-primers');">Close the primers.</a><br /><br />
</p><br />
<p class="normal-text" id="CscA-method"><br />
<br /><i>Method: The purified <i>cscA</i> and psB1C3 PCR products were digested with NdeI and ClaI. Both products were ligated and E.coli cells transformed with the ligation.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-method');">Close the method.</a><br /><br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="h3"><br />
Plates<br />
</p><br />
<p class="normal-text"><br />
Plate characterisation showed that <i>cscA</i> is a suitable selectable marker- only cells which had the gene grew on sucrose as a sole carbon sourse (Figure 4). The drawback of this antibiotic-free selectable marker is that more time is required for the growth of the <i>cscA</i> cells on sucrose plates (overnight at 37°C+4 days at room temperature).<br />
<br /><br /><br />
<img id="fig13" src="https://static.igem.org/mediawiki/2012/2/26/Markers-fig13.JPG"><br /><br />
Figure 4: <i>cscA</i> cells (bottom row) as well as control cells (top row) were spread on LB plate, minimal plate with sucrose, minimal plate with glucose and minimal plate with no sugars. Neither the <i>cscA</i> nor the control cells grow on minimal media with no sugars and grew well on LB and minimal plate with glucose. However, <i>cscA</i> cells are growing on minimal media with sucrose while the control cells are not.<br />
</p><br />
<p class="h2"><br />
Conclusions:<br />
</p><br />
<p class="normal-text"><br />
We successfully cloned the sucrose hydrolase gene and inserted it into the BioBrick vector. (<a href="http://partsregistry.org/Part:BBa_K917000">BBa_K917000</a>)<br /><br /><br />
We extensively characterised the sucrose hydrolase gene on plates and in liquid cultures.<br /><br /><br />
We determined its suitability as a selectable marker.<br />
</p><br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-sucrose-hydrolase a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-HydrolaseTeam:Edinburgh/Project/Non-antibiotic-Markers/Sucrose-Hydrolase2012-10-24T10:33:28Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
{{Team:Edinburgh/css/navigation-structure.css}}<br />
{{Team:Edinburgh/css/navigation-style.css}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#CscA-primers,<br />
#CscA-method,<br />
#figure1,<br />
#figure2,<br />
#figure3{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig12{<br />
height:0px;<br />
margin:5px;<br />
}<br />
</style><br />
<br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
document.getElementById('fig12').style.height="auto";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="auto";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="auto";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="auto";<br />
}<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
document.getElementById('fig12').style.height="0px";<br />
if(x == 'figure1'){<br />
document.getElementById('fig1').style.height="0px";<br />
}<br />
if(x == 'figure2'){<br />
document.getElementById('fig2').style.height="0px";<br />
}<br />
if(x == 'figure3'){<br />
document.getElementById('fig3').style.height="0px";<br />
}<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
Alternative selectable and counter-selectable markers:<br />
<br /><br /><br />
Sucrose Hydrolase <i> (cscA)</i><br />
</p><br />
<p class="h2"><br />
Background<br />
</p><br />
<p class="normal-text"><br />
Sucrose hydrolase is an enzyme from <i>Escherichia coli</i> O157:H7 strain Sakai which is involved in sucrose utilisation <a href="#bibliography" onclick="expand('works-cited');">(Jahreis, et al., 2002)</a>. Transforming <i>Escherichia coli</i> K12 strains with sucrose hydrolase allows the cells to grow with sucrose as a sole carbon source, something the untransformed K12 strain cannot do. This allows this gene to be used as a selectable marker.<br />
</p><br />
<p class="h2"><br />
Cloning<br />
</p><br />
<p class="h3"><br />
<i>cscA</i> cloning <br />
</p><br />
<p class="normal-text"><br />
The <i>cscA</i> gene was cloned PCR with <i>cscA</i> specific primers. <a onclick="expand('figure1');">Figure 1.</a><br />
</p><br />
<p class="normal-text" id="figure1"><br />
<br /><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/0/06/G1.png"><br /><br />
Figure 1: DNA gel of PCR amplification with primers specific for <i> cscA </i>. The product is around 1.4-1.5 kb which corresponds to the size of <i> cscA </i> gene, around 1.5 kb.<br /><br /><br />
<a onclick="collapse('figure1');">Close figure 1.</a><br />
</p><br />
<p class="normal-text"><br />
<br />This fragment was inserted into the standard BioBrick vector pSB1C3. <a onclick="expand('figure2');">Figure 2.</a><br />
</p><br />
<p class="normal-text" id="figure2"><br />
<br /><br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/8/85/G2.png"><br /><br />
Figure 2:DNA gel of pSBIC3-<i>cscA</i> ligation digested with EcoRI in order to linearise the plasmid. The band is around 3.5 kb which corresponds to the vector pSBIC3 (around 2 kb) together with the <i>cscA</i> gene (arounf 1.5 kb)<br /><br /><br />
<a onclick="collapse('figure2');">Close figure 2.</a><br />
</p><br />
<p class="normal-text"><br />
<br />A promoter and a reporter gene were added in front of the <i>cscA</i> gene (plac-lacZ). <a onclick="expand('figure3');">Figure 3.</a><br />
</p><br />
<p class="normal-text" id="figure3"><br />
<br /><br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/e/e2/G9.png"><br /><br />
Figure 3: DNA gel of pSB1C3-plac-lacZ-cscA digested with XbaI and PstI. The clear band just above 2kb corresponds both to the size of the vector and the plac-lacZ-cscA fragment. The band around 4 kb is likely to correspond to the undigested plasmid. <br /><br /><br />
<a onclick="collapse('figure3');">Close figure 3.</a><br />
</p><br />
<br />
<p class="h3"><br />
cscA selection plasmid<br />
</p><br />
<p class="normal-text"><br />
The <i>cscA</i> and pSB1C3 gene were cloned using these <a class="cursor-pointer" onclick="expand('CscA-primers');">primers</a>. <a class="cursor-pointer" onclick="expand('CscA-method')">Method</a>. pSB1C3-cscA ligation transformants are to be checked for the success of this cloning procedure.<br />
</p><br />
<p class="normal-text" id="CscA-primers"><br />
<br /><i>Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat<br /><br />
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT<br /></i><br />
<img id="fig12" src="https://static.igem.org/mediawiki/2012/7/75/Markers-fig12.JPG"><br /><br />
<i>Figure 1: DNA gel of PCR products of pSB1C3 without chloramphenicol and <i>cscA</i>. One product is around 1.4 kb which corresponds to the size of <i>cscA</i> gene, the other is around 2.2 kb which corresponds to the pSB1C3 vector without cml resistance.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-primers');">Close the primers.</a><br /><br />
</p><br />
<p class="normal-text" id="CscA-method"><br />
<br /><i>Method: The purified <i>cscA</i> and psB1C3 PCR products were digested with NdeI and ClaI. Both products were ligated and E.coli cells transformed with the ligation.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('CscA-method');">Close the method.</a><br /><br />
</p><br />
<p class="h2"><br />
Characterisation<br />
</p><br />
<p class="h3"><br />
Plates<br />
</p><br />
<p class="normal-text"><br />
Plate characterisation showed that <i>cscA</i> is a suitable selectable marker- only cells which had the gene grew on sucrose as a sole carbon sourse (Figure 4). The drawback of this antibiotic-free selectable marker is that more time is required for the growth of the <i>cscA</i> cells on sucrose plates (overnight at 37°C+4 days at room temperature).<br />
<br /><br /><br />
<img id="fig13" src="https://static.igem.org/mediawiki/2012/2/26/Markers-fig13.JPG"><br /><br />
Figure 4: <i>cscA</i> cells (bottom row) as well as control cells (top row) were spread on LB plate, minimal plate with sucrose, minimal plate with glucose and minimal plate with no sugars. Neither the <i>cscA</i> nor the control cells grow on minimal media with no sugars and grew well on LB and minimal plate with glucose. However, <i>cscA</i> cells are growing on minimal media with sucrose while the control cells are not.<br />
</p><br />
<p class="h2"><br />
Conclusion:<br />
</p><br />
<p class="normal-text"><br />
We successfully cloned the sucrose hydrolase gene and inserted it into the BioBrick vector. (<a href="http://partsregistry.org/Part:BBa_K917000">BBa_K917000</a>)<br /><br /><br />
We extensively characterised the sucrose hydrolase gene on plates and in liquid cultures.<br /><br /><br />
We determined its suitability as a selectable marker.<br />
</p><br />
<br />
</html><br />
{{:Edinburgh/Project/Non-antibiotic-Markers/Methods-and-Bibliography}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-markers p,<br />
#page-navigation ul li#nav-markers ul li#nav-markers-sucrose-hydrolase a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-markers ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-markers ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagyhttp://2012.igem.org/Team:Edinburgh/Project/Citrobacter-Freundii/6-ValenciaTeam:Edinburgh/Project/Citrobacter-Freundii/6-Valencia2012-10-22T18:18:04Z<p>RNagy: </p>
<hr />
<div>{{:Team:Edinburgh/header}}<br />
<br />
<html><br />
<style type="text/css"><br />
/* wiki edit */<br />
#content{<br />
background-image:none;<br />
}<br />
/* header edit */<br />
#project-page a{<br />
display:block;<br />
background-color: #f2f2f2;<br />
border-top-right-radius: 10px;<br />
border-top-left-radius: 10px;<br />
}<br />
#project-page a,<br />
#project-page a:visited{<br />
color: #000;<br />
}<br />
#project-page a:hover{<br />
color: #002BB8;<br />
}<br />
/* actual page */<br />
#page-content{<br />
background-color:#fff;<br />
border:1px solid #ccc;<br />
}<br />
#bac2-method,<br />
#bac3-method,<br />
#bac5-method{<br />
height:0px;<br />
position: relative;<br />
top:-9000px;<br />
}<br />
#fig1,#fig2,#fig3,#fig4,#fig5,#fig6,#fig7{<br />
width:600px;<br />
}<br />
</style><br />
<script language="JavaScript"><br />
function expand(x){<br />
document.getElementById(x).style.height="auto";<br />
document.getElementById(x).style.top="0px";<br />
}<br />
function collapse(x){<br />
document.getElementById(x).style.height="0px";<br />
document.getElementById(x).style.top="-9000px";<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Edinburgh/Project/navigation}}<br />
<br />
<html><br />
<div id="page-content"><br />
<div class="text"><br />
<p class="h1"><br />
<i>Citrobacter freundii</i> Characterisation<br />
<br /><br /><br />
Valencia Biocampus BioBrick Characterisation<br />
</p><br />
<p class="normal-text"><br />
In the spirit of iGEM, we have collaborated with the Valencia Biocampus team and characterised several of the BioBricks they made as part of their 'Talking Life' project.<i>C. freundii</i> and <i>E. coli</i> JM109 cells were transformed with the following three plasmids and the transformations were plated onto LB + chloramphenicol plates.<br />
</p><br />
<p class="h2"><br />
Bac2<br />
</p><br />
<p class="normal-text"><br />
Plasmid construction: groE promoter + AsRed2. This promoter is activated after a heat shock (keeping cells in a 44&deg;C waterbath for 5 minutes), as it normally controls the expression of groE, a heat shock protein that helps degrade proteins that have misfolded due to the high temperature.<br />
</p><br />
<p class="h3"><br />
Method <a class="cursor-pointer" onclick="expand('bac2-method')">(expand)</a><br />
</p><br />
<p class="normal-text" id="bac2-method"><br />
<br /><i>Colonies were picked from the Citrobacter plate and inoculated into 3ml LB liquid medium + chloramphenicol40 (1&mu;l/ml) and grown overnight at 37&deg;C on a shaker. The following day, the ODs were measured and a normalized amount of these cultures was used to inoculate bottles of M9 minimal medium (containing glucose as a carbon source) and left to grow at 37&deg;C until the culture reached an OD of 0.15-0.25. Half of the bottles were put into a 44&deg;C waterbath for 5 minutes while the other half were not. The fluorescence of the cultures was then measured every 10 minutes for 70 minutes.</i><br /><br />
<a class="cursor-pointer" onclick="collapse('bac2-method')">Close the method.</a><br />
</p><br />
<p class="h3"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
<img id="fig1" src="https://static.igem.org/mediawiki/2012/5/5a/Lemon-fig09.JPG"><br /><br />
Figure 1 - Bac2 characterisation. The bars show standard error.<br />
<br /><br /><br />
The results in Figure 1 show that there is a significant difference between the start and end fluorescence of the heat shocked cultures, whereas the control cultures' fluorescence remained more or less the same throughout the testing period.<br />
<br /><br /><br />
The fact that the fluorescence of the heat shocked cultures is lower than that of the controls may be due to some of the cells dieing after heat shock or due to slight variation in cell number (even though every effort was made to keep cell numbers even).<br />
</p><br />
<p class="h2"><br />
Bac3<br />
</p><br />
<p class="normal-text"><br />
Plasmid construction: Anaerobiosis promoter + ZsGreen1. This promoter is activated when oxygen concentrations in the medium are low, as this is when its transcriptional regulators become active.<br />
</p><br />
<p class="h3"><br />
Method <a class="cursor-pointer" onclick="expand('bac3-method')">(expand)</a><br />
</p><br />
<p class="normal-text" id="bac3-method"><br />
<br /><i>Colonies were picked from Citrobacter and E. coli + Bac3 plates and inoculated into LB + chloramphenicol40 (1 &mu;l/ml) liquid media and grown overnight (aerobically) at 37&deg;C on a shaker. The following day, the ODs were measured and a normalized amount of these cultures was used to inoculate bottles of LB + chloramphenicol. Half the samples were topped up with LB in order to exclude any air and were incubated for two days at 37&deg;C on a shaker, while the other half were incubated under the same circumstances (without adding the extra LB) and they were uncapped and shaken in order to reareate the culture one day after inoculation.<br />
<br /><br /><br />
After two days, the fluorescence and the OD of the cultures was measured in LB. 1ml of the cultures was also transferred to Eppendorf tubes which were spun down and the LB was discarded and the cells were resuspended in water. The fluorescence and OD of these cultures was also measured. This was done to minimize any background fluorescence.<br />
</i><br />
<a class="cursor-pointer" onclick="collapse('bac3-method')">Close the method.</a><br />
</p><br />
<p class="h3"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
The fluorescence readings were divided by the relevant ODs in order to normalize the results. The resulting bar charts can be seen below.<br />
<br /><br /><br />
<img id="fig2" src="https://static.igem.org/mediawiki/2012/9/9f/Lemon-fig10.JPG"><br /><br />
Figure 2 - Anaerobiosis promoter characterisation in LB. The bars show standard error.<br />
<br /><br /><br />
<img id="fig3" src="https://static.igem.org/mediawiki/2012/1/15/Lemon-fig11.JPG"><br /><br />
Figure 3 - Anaerobiosis promoter characterisation in water. The bars show standard error.<br />
<br /><br /><br />
The results in Figures 2 and 3 clearly show that the colonies that were grown anaerobically produce a lot more fluorescence than those that were grown aerobically. This suggests that the anaerobiosis promoter is regulated in a very similar fashion in both <i>E. coli</i> and <i>C. freundii</i>. It also confirms that the BioBrick functions as expected.<br />
</p><br />
<p class="h2"><br />
Bac5<br />
</p><br />
<p class="normal-text"><br />
Plasmid construction: RecA promoter + GFP. This promoter is activated when the bacterial SOS response is needed. This response occurs when DNA damage is detected in the cell and is responsible for repairing this DNA so it can still be replicated, although the repair process is error-prone.<br />
</p><br />
<p class="h3"><br />
Method <a class="cursor-pointer" onclick="expand('bac5-method')">(expand)</a><br />
</p><br />
<p class="normal-text" id="bac5-method"><br />
<br /><i>Colonies were picked from Citrobacter and E. coli + Bac5 plates and inoculated into LB + chloramphenicol (1 &mu;l/ml) liquid media and grown overnight at 37&deg;C on a shaker. The following day, the ODs were measured and a normalized amount of these cultures was used to inoculate bottles of LB + chloramphenicol. The bottles were left to grow at 37&deg;C with shaking until the culture reached an OD of 0.15-0.25 After this, 1 ml of culture was aliquoted into cuvettes and the cuvettes were exposed to UV radiation (254 nm wavelength) at a distance of 60 cm for 20, 40 or 60 seconds (unirradiated cuvettes were used as controls). The fluorescence was measured over the course of an hour using a blue filter. <br />
<br /><br /><br />
This experiment was repeated but the distance was reduced to 10 cm.<br />
</i><br />
<a class="cursor-pointer" onclick="collapse('bac5-method')">Close the method.</a><br />
</p><br />
<p class="h3"><br />
Results<br />
</p><br />
<p class="normal-text"><br />
The results from the first experiment (UV exposure at 60 cm over 20, 40 or 60 seconds) can be seen in Figures 4 and 5 below.<br />
<br /><br /><br />
<img id="fig4" src="https://static.igem.org/mediawiki/2012/e/ee/Lemon-fig12.JPG"><br /><br />
Figure 4 - Fluorescence of <i>E. coli</i> + Bac5 plasmid after exposure to UV (254 nm) for various periods of time at 60cm<br />
<br /><br /><br />
<img id="fig5" src="https://static.igem.org/mediawiki/2012/e/e1/Lemon-fig13.JPG"><br /><br />
Figure 5 - Fluorescence of <i>C. freundii</i> + Bac5 plasmid after exposure to UV for various periods of time at 60cm<br />
<br /><br /><br />
These results suggest that there is no real difference in the level of fluorescence or in the rate of increase of fluorescence of the irradiated and unirradiated cultures. This may be due to the fact that no detectable amount of DNA damage was done due to the UV source being too far from the cultures.<br />
<br /><br /><br />
The results of the experiment with the UV source being only 10 cm from the cuvettes can be seen in Figures 6 and 7 below.<br />
<img id="fig6" src="https://static.igem.org/mediawiki/2012/0/03/Lemon-fig14.JPG"><br /><br />
Figure 6 - Fluorescence of <i>E. coli</i> + Bac5 plasmid after exposure to UV for various periods of time at 10cm<br />
<br /><br /><br />
These results are slightly strange as we are unsure what caused such an increase in fluorescence of the unirradiated control after 20 minutes. It can be seen that the culture irradiated for 60 seconds starts to show increased fluorescence around 10 minutes after UV exposure and this level of fluorescence is maintained for a long period of time afterwards.<br />
<br /><br /><br />
The cultures irradiated for less time do not show such a quick increase in fluorescence, nor does the fluorescence reach such high levels, but it is maintained throughout the period of measurement.<br />
<br /><br /><br />
Overall, we think that these results are inconclusive as to whether or not the promoter works properly.<br />
<br /><br /><br />
<img id="fig7" src="https://static.igem.org/mediawiki/2012/0/0a/Lemon-fig15.JPG"><br /><br />
Figure 7 - Fluorescence of <i>C. freundii</i> + Bac5 plasmid after exposure to UV for various periods of time at 10cm<br />
<br /><br /><br />
The <i>C. freundii</i> results suggest that the promoter takes around 20 minutes to activate, as a marked increase in fluorescence can be detected after this time and the level of fluorescence continues to increase for a period of time.<br />
<br /><br /><br />
The culture that was irradiated for 60 seconds shows a jump in fluorescence after the irradiation, presumably because the promoter gets hyperactivated due to intense DNA damage. This culture then shows a little increase in fluorescence, after which it starts to decrease, probably due to the cells being unable to cope with the amount of DNA damage and dying.<br />
<br /><br /><br />
The culture irradiated for 40 seconds also seems to die towards the end (but the drop in fluorescence could also indicate that the DNA damage had been mostly repaired, as the doubling time for <i>E. coli</i> is ~20 minutes so after two rounds of replication the DNA may have been restored).<br />
<br /><br /><br />
The largest increase in fluorescence can be seen with the culture that had been irradiated for 20 seconds. This length of time is apparently more optimal for this experiment as it gives a good activation of the promoter without killing the cells (too much).<br />
</p><br />
<p class="h3"><br />
Conclusion<br />
</p><br />
<p class="normal-text"><br />
This construct seems to show some activity as there is a difference in fluorescence of irradiated and unirradiated cultures in both <i>E. coli</i> and <i>C. freundii</i> but further tests are needed to fully characterise it and to debug our tests.<br />
</p><br />
</div><!-- /text --><br />
</div><!-- /page-content --><br />
</div><!-- /page-middle --><br />
</html><br />
<br />
<html><br />
<style type="text/css"><br />
/* navigation edit*/<br />
#page-navigation ul li#nav-lemon p,<br />
#page-navigation ul li#nav-lemon ul li#nav-lemon-6 a{<br />
color:#ccc;<br />
cursor:default;<br />
}<br />
#page-navigation ul li#nav-lemon ul{<br />
height:auto;<br />
}<br />
#page-navigation ul li#nav-lemon ul li{<br />
top:0px;left:0px;<br />
}<br />
</style><br />
</html></div>RNagy