http://2012.igem.org/wiki/index.php?title=Special:Contributions/Louise123&feed=atom&limit=50&target=Louise123&year=&month=2012.igem.org - User contributions [en]2024-03-28T16:03:05ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/Team:WestminsterTeam:Westminster2013-08-09T18:58:22Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
height:475px;<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink active">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<!--img src="https://static.igem.org/mediawiki/2012/4/4d/Westminster_team.png" alt="Welcome" title="Welcome to our home!" /---><br />
<div style="float:left;padding-left:30px;padding-top:50px; width:380px"><br />
<h1 style="text-align:left;border:none; color:#fff; position:relative;bottom:0px; left:0px; margin:0px; padding:0px 0px 20px 0px;">Fighting cancer from the inside out</h1><br />
<div style="color:white; text-align:justify;">Cancer recurrence is one of the fears that almost every patient undergoing chemotherapy develops. Recent findings suggest that only a small fraction of the tumor cells, called Cancer Stem Cells (CSC) are able to drive the growth of the tumor. CSC also show an increased drug resistance, and could remain unaffected after chemotherapy, eventually resulting in the formation of a new tumor.<br/><br/><br />
The Westminster iGEM 2012 team aims to combat cancer recurrence by using one key feature of CSCs – increased Aldehyde Dehydrogenase (ALDH) activity. We have used the promoters of 4 different ALDH isoforms present in aggressive forms of cancer to design 3 constucts that will allow us to identify, isolate and eliminate CSC, offering a novel tool for the study of these cells and a potential new anti-cancer therapy for the future.</div><br />
<br />
<br />
</div><br />
<div style="float:left; width:500px; padding-left:50px; padding-top:150px; text-align:center"><br />
<img src="https://static.igem.org/mediawiki/2012/8/8a/Tumor.png" alt="Tumor" width="218" height="179" /><br />
</div><br />
<br />
</div><!-- #home-main-image --><br />
<br />
<br />
<br />
<div id="three-column"><br />
<br />
<div class="col"><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d7/IntegratedDNALogo.jpg" width="146" height="61"/><br />
</div><br />
<div class="col"><br />
<img src="https://static.igem.org/mediawiki/igem.org/b/b9/GeneiousLogo.jpg" width="136" height="54"/><br />
</div><br />
<div class="col"><br />
<img src="https://static.igem.org/mediawiki/igem.org/a/af/MathWorksLogo.jpg" width="202" height="40"/><br />
</div><br />
<div class="col"><br />
<img src="https://static.igem.org/mediawiki/igem.org/8/8e/AutodeskLogo.jpg" width="161" height="41"/><br />
</div><br />
<div class="col"><br />
<img src="https://static.igem.org/mediawiki/igem.org/c/c7/UniversityWestminsterLogo.jpg"/><br />
</div><br />
<br />
</div><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html><br />
<br />
[[iGEM 2013]]</div>Louise123http://2012.igem.org/File:Publication1.jpgFile:Publication1.jpg2013-08-09T16:39:24Z<p>Louise123: </p>
<hr />
<div>[[File:Publication1.jpg]]</div>Louise123http://2012.igem.org/File:Publication1.jpgFile:Publication1.jpg2013-08-09T16:36:04Z<p>Louise123: </p>
<hr />
<div></div>Louise123http://2012.igem.org/Team:Westminster/AttributionsTeam:Westminster/Attributions2013-08-09T15:30:59Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
#home-main-text ul li <br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2012/4/43/Tickmark.png');<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink active">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/1/15/AttributionsWmin.jpg" alt="Welcome" width="965" height="518" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h2>Attributions & Acknowledgements</h2><br />
<p>All work has been done by the team members unless stated otherwise.</p> <br />
<p>A big thank you to our PhD Advisors: Andrew Duncan Jenks - who did the mammalian transfecion work; Myrsini Tsimon, Rhyan Puno, Eustace Fernando and Amrutha Chilumuri - who were there for us, giving precious advice during the brainstorming sessions and in the lab. We are particularly thankful to Howard Boland, who was with us in every part of the project, sharing his passion for synthetic biology and art and supporting in moments when things weren´t working.</p><br />
<p> We also deeply thank our Academic Advisor, Dr. Mark Clements, for his enthusiasm, energy and infinite patience. You inspired us all and made the learning process very enjoyable! We are also grateful to Dr. Anatoliy Markiv and Dr. Sterghios Moschos for their help during the first brainstorming sessions, and to Dr. Miriam Dwek for sharing her knowledge and opinions with us in a wonderful interview. </p><br />
<br />
<p>Many thanks to our sponsors: the University of Westminster, University of Westminster Students' Union, Autodesk, Geneious, IDT and Mathworks for your support - the iSTEM would not have been possible without you!</p><br />
<br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html><br />
hello</div>Louise123http://2012.igem.org/Team:Westminster/JudgingTeam:Westminster/Judging2012-11-12T19:12:48Z<p>Louise123: </p>
<hr />
<div><html><br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
#home-main-text ul li <br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2012/4/43/Tickmark.png');<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink active">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<!--div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4d/Westminster_team.png" alt="Welcome" title="Welcome to our home!" /><br />
</div--><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>Which requirements have we met?</h1><p> <br />
<h2>Requirements for a Bronze Medal:</h2><br />
<ul><br />
<li> Register the team.</li><br />
<li>Successfully complete and submit this iGEM 2012 Judging form.</li><br />
<li>Create and share a Description of the team's project using the iGEM wiki and the team's parts using the Registry of Standard Biological Parts.</li><br />
<li>Plan to present a Poster and Talk at the iGEM Jamboree.</li><br />
<li>Enter information detailing at least one new standard BioBrick Part or Device in the Registry of Standard Biological Parts. Including:<br />
<ul><br />
<li>Primary nucleaic acid sequence.</li><br />
<li>Description of function.</li><br />
<li>Authorship.</li><br />
<li>Safety notes, if relevant.</li><br />
<li>Acknowedgment of sources and references.<br /><br />
</li><br />
</ul><br />
</li><br />
<li>Submit DNA for at least one new BioBrick Part or Device to the Registry.<br /><br />
</p><br />
<br /><br />
</li><br />
</ul><br />
<br />
<h2>Requirements for a Silver Medal:</h2><br />
<ul><br />
Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device.</li><br />
Enter this information and other documentation on both the iGEM 2012 wiki and the Registry.</li><br />
<br />
</ul><br />
<br />
<h2>Additional Requirements for a Gold Medal (one OR more):</h2><br />
<ul><br />
Develop and document a new technical standard that supports the: (check all that apply)<br />
<ul><br />
Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as safety, security, ethics, or ownership, sharing, and innovation.<br /><br />
</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ProtocolsTeam:Westminster/Protocols2012-11-12T19:09:59Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink active">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/e/e9/Hima.png" alt="Welcome" width="965" height="700" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>AMPLIFICATION OF GENOMIC DNA</h1><br />
<h2>Cell Lysis</h2><br />
<p>We used Stratagene kit for lysing human cells and extracting DNA.</p><br />
<br />
<p>• Pellet up to a maximum of 1x 10^6 cells for 30 sec. in microfuge. If more than 1X 10^6 cells are used, the reagent volumes will have to be increased accordingly. For adherent cells, a trypsin treatment is generally used prior to this step to free the cells into suspension. Be careful to perform the trypsin step in a timely manner so that5 the cells do not remain in undiluted trypsin for a long period of time.</p><br />
<p>• Aspirate media and wash cells with 500 μl of 1x PBS.</p><br />
<p>• Pellet cells 30 sec. in microfuge at 14, 000 rpm.</p><br />
<p>• Aspirate PBS and resuspend cells in 500 μl of PBS. Repeat spin and aspiration steps.</p><br />
<p>• Resuspend cells in 100 μl PBS and 200μl sterile water.</p><br />
<p>• Lyse cells by heating to 950C for 10-15 minutes.<p><br />
<p>• Allow the cells to cool briefly by setting at room temperature for 5 min. And add 10 μl of 10 mg/ml Proteinase K to each sample. Quick vortex to mix.</p><br />
<p>• Incubate at 55°C for one hour.</p><br />
<p>• Inactivate Proteinase K by heating to 95°c for 10 minutes.</p><br />
<p>• Spin down condensation.</p><br />
<p>• Store at -20°c.<br />
</p><br />
<h2>PCR Amplification</h2><br />
<p>Biolabs Phusion High- Fidelity DNA polymerase was used for all PCR amplifications. The reactions and conditions are given below. </p> <img src="https://static.igem.org/mediawiki/2012/4/4c/Phusion.png" alt="Phusion" title="Reaction Conditions" /> <br />
<h3>Conditions:</h3><br />
<img src="https://static.igem.org/mediawiki/2012/4/4d/Phusion_conditions.png" alt="Phusion" title="Reaction Conditions" /> <br />
<p>PCR amplification with linkers required an additional 50 μM Mg2+ in the mastermix.</p><br />
<h2>USER Amplification</h2><br />
<h3>Procedure</h3><br />
<p>The USER mix components are mixed (Table in materials).The PCR product must be purified before used in USER cloning<br />
<p>● 2 µl of the USER mix is transferred to PCR tubes.</p><br />
<p>● The PCR products is added in equal amounts of each and incubated for 40 minutes at 37°C and for 30 min at 25°C.</p> <img src="https://static.igem.org/mediawiki/2012/b/bf/New_User.png" alt="USER" title="USER Mix" /> <br />
<h2>Site-Directed Mutagenesis</h2><br />
<p>• Purify template plasmid DNA from a dam+ Escherichia coli strain (to ensure that all GATC sites are methylated for later digestion with DpnI).</p><br />
<p>• Design forward and reverse primers that will bind to the region of DNA you want to mutate but that contain the modifications you wish to make. See the CAD tool PrimerX.</p><br />
<p>• Run a primer-extension reaction with a proof-reading, non-displacing polymerase such as Pfu DNA polymerase. This results in nicked circular strands of the plasmid.</p><br />
<p>• Cut up the template DNA with DpnI.</p><br />
<p>• Transform the circular nicked DNA into a highly competent strain such as XL1-Blue. These cells will repair the nicks and not restrict the unmodified product DNA.</p><br />
<p>• Select colonies with the correct DNA.<br />
</p><br />
<h2>Purification of PCR Products</h2><br />
<p>QIAquick PCR Purification Kit Protocol using a micro centrifuge was followed for purification of PCR products.</p><br />
<h3>Procedure</h3><br />
<p>• Add 5 volumes of Buffer PB to 1 volume of the PCR sample and mix. It is not necessary to remove mineral oil or kerosene.</p><br />
<p>• Place a QIAquick spin column in a provided 2 ml collection tube.</p><br />
<p>• To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60 s.</p><br />
<p>• Discard flow-through. Place the QIAquick column back into the same tube. To wash, add 0.75 ml Buffer PE to the QIAquick column and centrifuge for 30–60 s.</p><br />
<p>• Discard flow-through and place the QIAquick column back in the same tube. Centrifuge the column for an additional 1 min.</p><br />
<p>• Residual ethanol from Buffer PE is completely removed by an additional centrifugation.</p><br />
<p>• Add 30 μl of double distilled nuclease free water to elute the DNA and centrifuge again.</p><br />
<p>• Collect the flow through. <br />
</p><br />
<h1>ANALYSIS OF DNA</h1><br />
<h2>Gel Electrophoresis</h2><br />
<p>• Depending on the expected size of the fragments to be analysed, the percentage of gel is determined. For fragments more than 1.2 kb, a 1% gel and fragments less than 1.2kb 2% gel is used.</p><br />
<p>• To make a 1% gel, 0.7g of agarose is added to 70 ml of TAE buffer.</p><br />
<p>• The agarose is melted in a microwave until the solution becomes clear.</p><br />
<p>• The solution is cooled down until it can be held for 5 continuous seconds.</p><br />
<p>• 1 µl of ethidium bromide is added to the solution.<br />
</p><br />
<h2>Electrophoresis Setting</h2><br />
<p>• Ensure electrophoresis chamber is clean and dry, tape the sides (with Autoclave tape, NOT standard masking tape) to make watertight. Slot in the desired comb.</p><br />
<p>• Add gel solution to the chamber, and wait to set. The comb can then be removed from the chamber.</p><br />
<p>• Fill the electrophoresis apparatus half-full with 1x TAE buffer solution avoiding air bubbles.</p><br />
<p>• The gel is loaded with the samples, a negative sample, and the DNA ladder.</p><br />
<p>• Connect the electrodes to the apparatus. Set DC voltage at 100V and run for around 60 minutes (or until DNA separates sufficiently)</p><br />
<p>• View the gel in a gel exposer.<br />
<br />
</p><br />
<h2>Gel Extraction</h2><br />
<p> We used the QIAgen quick gel extraction kit; the protocol is adapted from the QIAquick Gel Extraction Kit Protocol.</p><br />
<h3>Protocol</h3><br />
<p>• The gel is exposed to blue-light to illuminate the DNA fragments (stained by ethidium bromide).</p><br />
<p>• The desired DNA band is identified and physically removed with a knife, cleaned with ethanol.( ensure to wipe the ethanol off the knife to avoid degradation of DNA)</p><br />
<p>• Add 3 volumes of buffer QG to 1 volume of gel. E.g.add 300 μl of Buffer QG to each slice of gel (volume of the slice is 100 μl, and weighs approximately 100 mg).</p><br />
<p>• Incubate at 52°C for 10 min (or until fully dissolved). To aid solvation, mix by vortexing the tube every 2–3 min during the incubation. When the gel is fully dissolved, ensure that the color of the mixture is yellow, same as that of the QG buffer.</p><br />
<p>• Add 1 gel volume of isopropanol to the sample and mix.</p><br />
<p>• Place a QIAquick spin column in a provided 2 ml collection tube.</p><br />
<p>• Apply each sample of DNA fragment to a QIAquick column, and centrifuge for 1 min at 13000 rpm.</p><br />
<p>• Discard flow-through and place QIAquick column back in the same collection tube. </p><br />
<p>• To wash, add 0.75 ml of Buffer PE to QIAquick column and centrifuge for 1 min.</p><br />
<p>• Spin the column again to get rid of any residual ethanol.</p><br />
<p>• Add 30 ml of nuclease free water at the centre of the column and keep for 1 minute.</p><br />
<p>• Place the column in a collection tube and spin for 1 minute at 13000 rpm. Collect the flow through.<br />
</p><br />
<h1>TRANSFORMATION OF BACTERIAL CELLS</h1><br />
<h2>Preparation of Antiobiotic Resistant Plates</h2><br />
<p>• 6.2 g of LB agar is dissolved in distilled water and dissolved.</p><br />
<p>• This is autoclaved and sealed for future uses.</p><br />
<p>• Agar is melted in microwave for 5 minutes, or until dissolves.</p> <br />
<p>• Respective volume of required antibiotic is added to the solution after it has started cooling down.</p> <br />
<p>• 20-20 ml of this is evenly poured into plates and allowed to cool.<br />
<br />
</p><br />
<h2>Transformation</h2><br />
<p>• DHα5 competent cells are taken out from -80°c and thawed in ice for 5 minutes.</p><br />
<p>• 1 ml of SOC is incubated at 37°C.</p><br />
<p>• 1 µl of required plasmid/part is added to the competent cells and subjected to heat shock at 42°c, in a water bath for 1 minute to enable transformation.</p><br />
<p>• Placed back in ice for 5 minutes.</p><br />
<p>• 250 µl of preheated SOC is added to this and placed in a shaker at 37°C, 200 rpm for 16 hours.</p><br />
<p>• The broth from the shaker is poured on to prepared plates with corresponding antibiotic resistance, under sterile conditions.</p><br />
<p>• 8 glass beads are added to the plates and slowly shaken to ensure even spreading.</p><br />
<p>• The glass beads are recycled.</p><br />
<p>• The plates are incubated overnight at 37°C.</p><br />
<h2>E.coli Cell Culture</h2><br />
<p>• This is the method for overnight preparation of a 10ml cell culture of antibiotic-resistant E. coli. The plasmid incorporated in the bacteria ensures that it is resistant to a corresponding antibiotic, thus the growth media will have to be provided with a suitable volume of the antibiotic.</p><br />
<p>• The plasmids we used in our lab were mostly resistant to chloramphenicol, Ampicillin, and Kanamycin.</p><br />
<p>• The media was inoculated( with a sterile loop) with a single colony of the tarnsformant, under sterile conditions and placed in an incubator for 16 hours, at 37°c.</p><br />
<p>• Before further extraction, a glycerol stock of the culture was made using 1ml of media and an appropriate volume of glycerol and stored at -80°c for viability.<br />
</p><br />
<h2>Extraction of DNA</h2><br />
<p>We used QIAprep Spin Mini Prep Kit, the protocol is adapted from the QIAprep Mini Prep Handbook QIAprep Mini Prep Handbook.</p><br />
<p>• Resuspend pelleted bacterial cells in 250 μl Buffer P1 and transfer to a microcentrifuge tube. Ensure that RNase A has been added to Buffer P1. No cell clumps should be visible after resuspension of the pellet. If LyseBlue reagent has been added to Buffer P1, vigorously shake the buffer bottle to ensure LyseBlue particles are completely dissolved. The bacteria should be resuspended completely by vortexing or pipetting up and down until no cell clumps remain.</p><br />
<p>• Add 250 μl Buffer P2 and mix thoroughly by inverting the tube 4–6 times. Mix gently by inverting the tube. Do not vortex, as this will result in shearing of genomic DNA. If necessary, continue inverting the tube until the solution becomes viscous and slightly clear. Do not allow the lysis reaction to proceed for more than 5 min.</p><br />
<p>• Add 350 μl Buffer N3 and mix immediately and thoroughly by inverting the tube 4–6 times. To avoid localized precipitation, mix the solution thoroughly, immediately after addition of Buffer N3. Large culture volumes (e.g. ≥5 ml) may require inverting up to 10 times. The solution should become cloudy.</p><br />
<p>• Centrifuge for 10 min at 13,000 rpm (~17,900 x g) in a table-top microcentrifuge. A compact white pellet will form.</p><br />
<p>• Apply the supernatants from step 4 to the QIAprep spin column by decanting or pipetting.</p><br />
<p>• Centrifuge for 30–60 s. Discard the flow-through.</p><br />
<p>• Recommended: Wash the QIAprep spin column by adding 0.5 ml Buffer PB and centrifuging for 30–60 s. Discard the flow-through. This step is necessary to remove trace nuclease activity.</p><br />
<p>• Wash QIAprep spin column by adding 0.75 ml Buffer PE and centrifuging for 30–60s.</p><br />
<p>• Discard the flow-through, and centrifuge for an additional 1 min to remove residual wash buffer. Important: Residual wash buffer will not be completely removed unless the flow-through is discarded before this additional centrifugation. Residual ethanol from Buffer PE may inhibit subsequent enzymatic reactions.</p><br />
<p>• Place the QIAprep column in a clean 1.5 ml microcentrifuge tube. To elute DNA, add 30 μl double distilled nuclease free water to the centre of each QIAprep spin column, let stand for 1 min, and centrifuge for 1 min.</p><br />
<h1>MAMMALIAN CELL CULTURE</h1><br />
<h2>Thawing</h2><br />
<p>• MG63 cells were derived from banked stocks at the ATCC (American type culture collection). The epithelial breast cancer cell line MCF7 used was a gift from Dr Miriam Dwek (University of Westminster)</p><br />
<p>• Vials were quickly defrosted in a 37 ˚C water bath.</p><br />
<p>• Re-suspended in 5 ml of complete media.</p><br />
<p>• Centrifuged at 1000 rpm for 3 mins.</p><br />
<p>• Supernatant was poured off and cells were re-suspended in 10 ml complete media and seeded in a 75 cm2 tissue culture flask.<br />
</p><br />
<h2>Passaging Cells</h2><br />
<p>Upon reaching the required confluency (70-90 %) cells were passaged as follows:</p><br />
<p>● Media discarded using a sterile pipette </p><br />
<p>● Washed once with Dulbecco’s phosphate buffered saline (DPBS) free from calcium and magnesium </p><br />
<p>● To detach cells from flask 2 ml of EDTA-trypsin was added and incubated at 37 ˚C for 2 minutes </p><br />
<p>● Upon cell detachment EDTA-trypsin was neutralised with 4 ml of complete media </p><br />
<p>● Centrifuged at 1000 rpm for 3 mins.</p><br />
<p>● Supernatant was discarded and cells re-suspended in complete media and seeded in to a fresh flask. Depending upon the cell line cells were passaged either at 1:3 or 1:6.<br />
</p><br />
<h2>Freezing</h2><br />
<p>● Cells trypsinised (as in passaging procedure above).</p><br />
<p>● Centrifuged at 1000 rpm for 3 mins.</p><br />
<p>● Supernatant poured off and cells re-suspended in FBS + 10 % DMSO and kept at -80 °C for 24 hours then transferred to liquid nitrogen. <br />
</p><br />
<h2>Transfection of Cells (PEI Procedure)</h2><br />
<p>All cell culture and transfection was carried in complete media Dulbecco’s modified eagles media (DMEM) supplemented with 10 % foetal bovine serum (FBS). No antibiotics were used</p><br />
<p>• One day prior to transfection 250000 MCF7 cells were seeded per well of a 24 well plate.</p><br />
<p>• For each transfection reagents were prepared as follows:</p><br />
<p> a) Plasmid mixed with PEI.</p><br />
<p> b) 100 µl (10% of growth media volume) 0.15M NaCl was added to plasmid-PEI mixture</p><br />
<p> c) Transfection reagent mixture was vortexed and incubated at room temperature for 10 mins.</p><br />
<p>• Prior to transfection media from each well was replaced and PEI-plasmid-NaCl mixture was added dropwise to cells.</p><br />
<p>• Cells were incubated overnight at 37ᵒC.</p><br />
<p>• Media replaced</p><br />
<p>• Cells allowed to recover for 48hrs then trypsinised and anlaysed as follows:</p><br />
<p> a) Media removed </p><br />
<p> b) Cells washed once with PBS </p><br />
<p> c) Trypsinised with 0.21 mM trypsin containing 4.81 mM EDTA </p><br />
<p> d) Trypsin was neutralized with complete media and cells centrifuged at 2000 rpm for 3 mins </p><br />
<p> e) Cells washed once in ice cold PBS containing 1% foetal bovine serum (FBS). </p><br />
<p> f) Cells re-suspended in 1% FBS containing 1μg/ml propidium iodide.</p><br />
<p> g) Cells analysed using CyAn™ ADP flow cytometer (DakoCytomation)<br />
</p> <br />
<p>In order to distinguish between alive and dead cells propidum iodide was used and data was analysed using the summit v4.3 software. Cell lines were gated according to an unstained sample and lasers were adjusted accordingly. Unstained cells were used to set gates for cell size and internal complexity, dead cells were removed along with doublets.</p><br />
<h2>Aldehyde Dehydrogenase (ALDH) Staining</h2><br />
<p>● Upon reaching a suitable confluency (70 - 90 %) cells were trypsinised and then neutralised using complete media (as in passaging procedure).</p><br />
<p>● Counted using a haemocytometer.</p><br />
<p>● Centrifuged at 1000 rpm for 3 mins.</p><br />
<p>● Resuspended in 0.5 ml of ALDEFLUOR buffer.</p><br />
<p>● An appropriate volume of cells is transferred to a separate eppendorf so each sample contains 5 x 105 cells (diluted in ALDEFLUOR buffer).</p> <br />
<p>● 2.5 μl of the ALDH activated reagent was mixed with sample.</p><br />
<p>● 250 μl of sample was immediately removed and mixed in a separate eppendorf with 2.5 μl of the ALDH inhibitor diethylaminobenzaldehyde (DEAB) to act as a negative control.<p><br />
<p>● Samples were then incubated at 37 °C for 50 mins.</p><br />
<p>● Centrifuged at 2000 rpm for 5 mins and re-suspended in 0.5 ml ALDH buffer and analysed using a flow cytometer.<br />
<br />
</p><br />
<h1>MICROSCOPY</h1><br />
<p>● A 10X PBS dilution is made from PBS and MilliQ water.</p><br />
<p>● The coverslips are transferred to a 24-well plate (2 coverslip/well).</p><br />
<p>● The coverslips are washed by adding 1 ml diluted PBS to the wells. The PBS is discarded. This is done twice.</p><br />
<p>● 400 μl Formaldehyde is added to each well under the fume hood, and incubated for 12 min at RT. The liquid is transferred to the waste bin. </p><br />
<p>● The coverslips are washed 3 times with the diluted PBS.</p><br />
<p>● The coverslips are dipped in MilliQ water before laid on lint-free paper for drying.</p><br />
<p>● 4 drops each of 4 μl Vectashield is placed on a glass slide.</p><br />
<p>● When a coverslip is completely dry, it is placed on a drop of Vectashield on the glass slide. The procedure is repeated for each coverslip.</p><br />
<p>● The coverslips are fixated with transparent nail polish.<br />
</p><br />
<br />
<br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-10-27T01:42:08Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif";color:red'>PROJECT DESIGN: WEEK 1 (16 July 16 2012)<o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>The first <span class=GramE>criteria for the project is</span><br />
to identify the most prevalent ALDH isoforms which have been identified in the<br />
literature as being markers of cancer stem cells. ALDH1A1 was identified as the<br />
most prevalent isoform and ALDH1A3 and ALDH 3A1 have also been identified. ALDH2<br />
has been selected as a control as its expression may be up-regulated by<br />
introducing alcohol. <o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>WEEK 2<o:p></o:p></span></b></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>This week a protocol for identifying the promoter<br />
sequences of the ALDH isoforms has been designed. <o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>PROTOCOL<o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>1. Identify the start of the protein sequence (the<br />
promoter will be upstream of the start site). <o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>2. Locate the TATA box within the region up-stream of the<br />
protein sequence.<o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>3. Select 1000bp up-stream of the protein start site to<br />
include the TATA box.<o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>4. Compare selected promoter sequence with commercial<br />
sequences. <o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>5. Analyse sequences for illegal sites.<o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>(6. Later we identified the European Promoter Database<br />
and compared selected sequences to sequences there and were able to select sequences<br />
which excluded illegal sites. <o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>Primers to amplify the ALDH promoters were designed as<br />
follows:<o:p></o:p></span></p><br />
<br />
<table class=MsoTableGrid border=1 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-border-alt:solid windowtext .5pt;<br />
mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes'><br />
<td width=111 valign=top style='width:83.4pt;border:solid windowtext 1.0pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>pALDH1A1-FWD<o:p></o:p></span></p><br />
</td><br />
<td width=505 valign=top style='width:378.7pt;border:solid windowtext 1.0pt;<br />
border-left:none;mso-border-left-alt:solid windowtext .5pt;mso-border-alt:<br />
solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><b style='mso-bidi-font-weight:normal'><span style='font-size:12.0pt;<br />
font-family:"Arial","sans-serif";color:red'>GTTTCTTCGAATTCGCGGCCGCTTCTAGAG</span></b><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'>CATCATATGACTTTTTTCAAC<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p>&nbsp;</o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1'><br />
<td width=111 valign=top style='width:83.4pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>pALDH1A1-RWD<o:p></o:p></span></p><br />
</td><br />
<td width=505 valign=top style='width:378.7pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><b style='mso-bidi-font-weight:normal'><span style='font-size:12.0pt;<br />
font-family:"Arial","sans-serif";color:#4F81BD;mso-themecolor:accent1'>GTTTCTTCCTGCAGCGGCCGCTACTAGTA</span></b><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'>TTCTGATTCGGCTCCTGGAA<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p>&nbsp;</o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2'><br />
<td width=111 valign=top style='width:83.4pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>pALDH2-FWD<o:p></o:p></span></p><br />
</td><br />
<td width=505 valign=top style='width:378.7pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><b style='mso-bidi-font-weight:normal'><span style='font-size:12.0pt;<br />
font-family:"Arial","sans-serif";color:red'>GTTTCTTCGAATTCGCGGCCGCTTCTAGAG</span></b><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'>CAGAGAAGGAAGGGAGTCTTGGTTATC<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p>&nbsp;</o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3'><br />
<td width=111 valign=top style='width:83.4pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>pALDH2-RWD<o:p></o:p></span></p><br />
</td><br />
<td width=505 valign=top style='width:378.7pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><b style='mso-bidi-font-weight:normal'><span style='font-size:12.0pt;<br />
font-family:"Arial","sans-serif";color:#4F81BD;mso-themecolor:accent1'>GTTTCTTCCTGCAGCGGCCGCTACTAGTA</span></b><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'>CTGATGCTCCAGGTGAAGAGACC<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p>&nbsp;</o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:4'><br />
<td width=111 valign=top style='width:83.4pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>pALDH1A3-FWD<o:p></o:p></span></p><br />
</td><br />
<td width=505 valign=top style='width:378.7pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><b style='mso-bidi-font-weight:normal'><span style='font-size:12.0pt;<br />
font-family:"Arial","sans-serif";color:red'>GTTTCTTCGAATTCGCGGCCGCTTCTAGAG</span></b><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'>ATCGAGGTATAATTTATGC<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p>&nbsp;</o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:5'><br />
<td width=111 valign=top style='width:83.4pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>pALDH1A3-RWD<o:p></o:p></span></p><br />
</td><br />
<td width=505 valign=top style='width:378.7pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><b style='mso-bidi-font-weight:normal'><span style='font-size:12.0pt;<br />
font-family:"Arial","sans-serif";color:#4F81BD;mso-themecolor:accent1'>GTTTCTTCCTGCAGCGGCCGCTACTAGTA</span></b><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'>TCCCTGGCCCGAGGCGCCCTA<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><b style='mso-bidi-font-weight:normal'><span style='font-size:12.0pt;<br />
font-family:"Arial","sans-serif";color:red'><o:p>&nbsp;</o:p></span></b></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:6'><br />
<td width=111 valign=top style='width:83.4pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>pALDH3A1-Com-FWD<o:p></o:p></span></p><br />
</td><br />
<td width=505 valign=top style='width:378.7pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><b style='mso-bidi-font-weight:normal'><span style='font-size:12.0pt;<br />
font-family:"Arial","sans-serif";color:red'>GTTTCTTCGAATTCGCGGCCGCTTCTAGAG</span></b><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'>TATAGGCGTGAGCCACCG<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p>&nbsp;</o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:7'><br />
<td width=111 valign=top style='width:83.4pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>pALDH3A1-RWD<o:p></o:p></span></p><br />
</td><br />
<td width=505 valign=top style='width:378.7pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><b style='mso-bidi-font-weight:normal'><span style='font-size:12.0pt;<br />
font-family:"Arial","sans-serif";color:#4F81BD;mso-themecolor:accent1'>GTTTCTTCCTGCAGCGGCCGCTACTAGTA</span></b><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'>CGGCCTCGCTGATCTTGC<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p>&nbsp;</o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:8;mso-yfti-lastrow:yes'><br />
<td width=111 valign=top style='width:83.4pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>pALDH3A1-Com-RWD<o:p></o:p></span></p><br />
</td><br />
<td width=505 valign=top style='width:378.7pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><b style='mso-bidi-font-weight:normal'><span style='font-size:12.0pt;<br />
font-family:"Arial","sans-serif";color:#4F81BD;mso-themecolor:accent1'>GTTTCTTCCTGCAGCGGCCGCTACTAGTA</span></b><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'>GACAGAGAGCACCTGCAGCT<o:p></o:p></span></p><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p>&nbsp;</o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'><o:p>&nbsp;</o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>WEEK3<o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>Search for template DNA to construct experimental parts<br />
has begun. Search of the Registry found no parts which could be used for our<br />
design. We have contacted DTU-Denmark 2011 <span class=SpellE>iGEM</span> team<br />
to obtain some of their parts directly. Parts requested from DTU are on<br />
plasmids BBa_K678049 and BBa_K678056. <span class=GramE>Serrano labs has</span><br />
also been identified as a source of mammalian parts and MTA transfer is being<br />
set up to allow us to receive the parts. <o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>WEEK 4<o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>This week was spent designing construct 3 of our project,<br />
the construct for selectively killing Cancer stem cells based on their<br />
expression of ALDH. Protocols for user cloning were also studied this week. <o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>WEEK 5<o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>Constructs using the DTU parts have been designed. <o:p></o:p></span></p><br />
<br />
<br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>Friday was spent at the UK team meet-up.<o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>WEEK 6<o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>Protocols for the lab have been put together and orders<br />
for reagents and consumables ordered. <span style='mso-spacerun:yes'> </span><o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>WEEK 7<o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span class=GramE><span style='font-size:12.0pt;line-height:<br />
115%;font-family:"Arial","sans-serif"'>Design of linker primers using PHUSER<br />
site (<a href="http://www.cbs.dtu.dk/services/PHUSER/">http://www.cbs.dtu.dk/services/PHUSER/</a>).</span></span><span<br />
style='font-size:12.0pt;line-height:115%;font-family:"Arial","sans-serif"'> Mutagenic<br />
primers were also designed for the DTU parts which we intend to use. <o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>Linker primers are as follows:<o:p></o:p></span></p><br />
<br />
<table class=MsoTableGrid border=1 cellspacing=0 cellpadding=0<br />
style='border-collapse:collapse;border:none;mso-border-alt:solid windowtext .5pt;<br />
mso-yfti-tbllook:1184;mso-padding-alt:0cm 5.4pt 0cm 5.4pt'><br />
<tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>ALDH<br />
linker- FW<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border:solid windowtext 1.0pt;<br />
border-left:none;mso-border-left-alt:solid windowtext .5pt;mso-border-alt:<br />
solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>gggtttaau</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>gtttcttcgaattcgcggccgc</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:1'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>ALDH<br />
linker- RV<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>atggtggcggu</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>ttcttcctgcagcggccg</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:2'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>m-CHERRY-FW<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>accgccaccau</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>ggtgagcaagggcgagga</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:3'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>m-CHERRY-RV<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>agttcttgu</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>acagctcgtccatgccgc</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:4'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>SV-40-<br />
FW<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>caagaacu</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>tgtttattgcagcttata</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:5'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>SV-40-RV<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>agacatgau</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>aagatacattgatgagttt</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:6'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>HYGROMYCIN-FW<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>atcatgtcu</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>gccagcaggcagaagtatgcaaagc</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:7'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>HYGROMYCIN-RV<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>agtagttu</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>cttcctgcagcggccgct</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:8'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>pSB1C3-FW<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>aaactacu</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>agtagcggccgctgcagt</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:9'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>pSB1C3-RV<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>ggtcttaau</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>ctctagaagcggccgcga</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:10'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>Neomycin-FW<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>aaacctgu</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>ggaatgtgtgtcagttag</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
<tr style='mso-yfti-irow:11;mso-yfti-lastrow:yes'><br />
<td width=168 valign=top style='width:125.9pt;border:solid windowtext 1.0pt;<br />
border-top:none;mso-border-top-alt:solid windowtext .5pt;mso-border-alt:solid windowtext .5pt;<br />
padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>Neomycin-RV<o:p></o:p></span></p><br />
</td><br />
<td width=448 valign=top style='width:336.2pt;border-top:none;border-left:<br />
none;border-bottom:solid windowtext 1.0pt;border-right:solid windowtext 1.0pt;<br />
mso-border-top-alt:solid windowtext .5pt;mso-border-left-alt:solid windowtext .5pt;<br />
mso-border-alt:solid windowtext .5pt;padding:0cm 5.4pt 0cm 5.4pt'><br />
<p class=MsoNormal style='margin-bottom:0cm;margin-bottom:.0001pt;line-height:<br />
normal'><span class=SpellE><span style='font-size:12.0pt;font-family:"Arial","sans-serif";<br />
color:red'>agaacatgau</span><span style='font-size:12.0pt;font-family:"Arial","sans-serif"'>aagatacattgatgagtttgg</span></span><span<br />
style='font-size:12.0pt;font-family:"Arial","sans-serif"'><o:p></o:p></span></p><br />
</td><br />
</tr><br />
</table><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'><span style='mso-spacerun:yes'> </span><o:p></o:p></span></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'><o:p>&nbsp;</o:p></span></p><br />
<br />
<p><b>WETLAB WEEK 1 (12 September 2012)</b></p><br />
<P> After months of planning we are finally in the lab!<P> <br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we have had in the lab we were<br />
able to amplify the promoter regions which we had designed and we have sent them to<br />
iGEM registry. These parts are currently being sequenced. </p><br />
<P> Parts produced by the group<P><br />
<P> ALDH1A1 promoter BBa_K940000<P><br />
<P> ALDH2 promoter BBa_K940001<P><br />
<P> ALDH1A3 promoter BBa_K940002<p><br />
<p> ALDG3A1 promoter BBa_K940003<p><br />
<br />
<br />
<p class=MsoNormal><b style='mso-bidi-font-weight:normal'><span<br />
style='font-size:12.0pt;line-height:115%;font-family:"Arial","sans-serif"'>Post<br />
European Regional in Amsterdam<o:p></o:p></span></b></p><br />
<br />
<p class=MsoNormal><span style='font-size:12.0pt;line-height:115%;font-family:<br />
"Arial","sans-serif"'>In order to test the project idea, a new approach has<br />
been taken. Parts from Serrano will be used to construct the project plasmids<br />
for experiment 1 and 2. Parts will be assembled using restriction-ligation. <o:p></o:p></span></p><br />
<br />
<br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-10-27T00:38:04Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1 (12 September 2012)</b></p><br />
<P> After months of planning we are finally in the lab!<P> <br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we have had in the lab we were<br />
able to amplify the promoter regions which we had designed and we have sent them to<br />
iGEM registry. These parts are currently being sequenced. </p><br />
<P> Parts produced by the group<P><br />
<P> ALDH1A1 promoter BBa_K940000<P><br />
<P> ALDH2 promoter BBa_K940001<P><br />
<P> ALDH1A3 promoter BBa_K940002<p><br />
<p> ALDG3A1 promoter BBa_K940003<p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-10-27T00:13:04Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<br />
<p>PROJECT DESIGN: WEEK 1 (16 July 20120<p><br />
<br />
<p>The first criteria for the project is to identify the most prevalent ALDH isoforms which have been identified in the literature as being markers of cancer stem cells. ALDH1A1 was identified as the most prevalent isoform and ALDH1A3 and ALDH 3A1 have also been identified. ALDH2 has been selected as a control as its expression may be up-regulated by introducing alcohol.<p><br />
<br />
<p><b>WEEK 2</b></p><br />
<br />
<p>This week a protocol for identifying the promoter sequences of the ALDH isoforms has been designed.<p><br />
<br />
<br />
<p><b>WETLAB WEEK 1 (12 September 2012)</b></p><br />
<P> After months of planning we are finally in the lab!<P> <br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we have had in the lab we were<br />
able to amplify the promoter regions which we had designed and we have sent them to<br />
iGEM registry. These parts are currently being sequenced. </p><br />
<P> Parts produced by the group<P><br />
<P> ALDH1A1 promoter BBa_K940000<P><br />
<P> ALDH2 promoter BBa_K940001<P><br />
<P> ALDH1A3 promoter BBa_K940002<p><br />
<p> ALDG3A1 promoter BBa_K940003<p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-10-27T00:11:34Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<br />
<p>PROJECT DESIGN: WEEK 1 (16 July 20120<p><br />
<br />
<pPThe first criteria for the project is to identify the most prevalent ALDH isoforms which have been identified in the literature as being markers of cancer stem cells. ALDH1A1 was identified as the most prevalent isoform and ALDH1A3 and ALDH 3A1 have also been identified. ALDH2 has been selected as a control as its expression may be up-regulated by introducing alcohol.<p><br />
<br />
<p><b>WEEK 2</b></p><br />
<br />
<p>This week a protocol for identifying the promoter sequences of the ALDH isoforms has been designed.<p><br />
<br />
<br />
<p><b>WETLAB WEEK 1 (12 September 2012)</b></p><br />
<P> After months of planning we are finally in the lab!<P> <br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we have had in the lab we were<br />
able to amplify the promoter regions which we had designed and we have sent them to<br />
iGEM registry. These parts are currently being sequenced. </p><br />
<P> Parts produced by the group<P><br />
<P> ALDH1A1 promoter BBa_K940000<P><br />
<P> ALDH2 promoter BBa_K940001<P><br />
<P> ALDH1A3 promoter BBa_K940002<p><br />
<p> ALDG3A1 promoter BBa_K940003<p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/File:AttributionsWmin.jpgFile:AttributionsWmin.jpg2012-09-28T15:50:11Z<p>Louise123: uploaded a new version of &quot;File:AttributionsWmin.jpg&quot;</p>
<hr />
<div></div>Louise123http://2012.igem.org/Team:Westminster/OutreachTeam:Westminster/Outreach2012-09-27T03:58:16Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink active">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<iframe width="965" height="543" src="http://www.youtube.com/embed/nehmMHG7E3A" frameborder="0" allowfullscreen></iframe><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<br />
<h1>SURVEY</h1><br />
<p><br />
Statistical analysis was done based on the survey data that was collected to determine the acceptance of genetically modified products in various fields (environment and medical) from individuals with different knowledge of biology ranging from negligible to a more advanced level. Our survey result from approximately one hundred people demonstrates that most people including those with base level knowledge of biology were very much interested in using genetically modified organisms in various fields like food, environment and medicine. In addition to this, people were also eager to use synthetic biology in the cure of cancer since our project was mainly focused on the application of synthetic biology in cancer therapy. Although this was the first year for our university to initiate creating awareness about synthetic biology to the public, we were very surprised to know that currently in the 21st century there is decreasing number of people without some knowledge of biology. We hope to fill these gap in the future via iGEM.<br />
</p><br />
<p>The survey questions and the graphical representations of their answers are shown below:</p><br />
<p>1. Do you think biology is interesting? </p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a2/Question_1.png" alt="Survey Answers" width="292" height="161" title="Answer to Question 1" /><br />
<p>2. What level of scientific or biology education do you have? </p><br />
<img src="https://static.igem.org/mediawiki/2012/b/bb/Question2.png" alt="Survey Answers" width="395" height="202" title="Answer to Question 2" /><br />
<p>3. How would you classify bacteria? </p><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Question3.png" alt="Survey Answers" width="379" height="189" title="Answer to Question 3" /><br />
<p>4. The human body is composed of a larger number of bacterial cells than human cells? </p><br />
<img src="https://static.igem.org/mediawiki/2012/6/61/Question4.png" alt="Survey Answers" width="319" height="182" title="Answer to Question 4" /><br />
<p>5. Do you know products like bread, beer and many medications are made using microorganisms? </p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Question_5.png" alt="Survey Answers" width="364" height="188" title="Answer to Question 5" /><br />
<p>6. Imagine a certain breed of panda is becoming extinct. Scientists have genetically modified some of the genes in these pandas to allow them to survive, even under harsh conditions, thus preventing their extinction. Do you feel this is a justifiable use of genetic modification?</p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b8/Question6.png" alt="Survey Answers" width="345" height="174" title="Answer to Question 6" /><br />
<p>7. A nuclear explosion in Japan has caused a lot of devastation and radiation debris. An iGEM team from the University of Osaka has created an organism that can de-toxify this debris. Do you feel this is a justifiable use of genetic modification?</p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b3/Question7.png" alt="Survey Answers" width="370" height="172" title="Answer to Question 7" /><br />
<p>8. Imagine that your relative is severely ill with cancer. The doctor tells you the treatment options are either regular cancer medicine, eg chemotherapy or a new genetically modified medicine. If the regular medicine had a 40% chance of working, while the genetically modified drug had a 60% success rate. Which would you prefer?</p><br />
<img src="https://static.igem.org/mediawiki/2012/6/6a/Question8.png" alt="Survey Answers" width="390" height="181" title="Answer to Question 8" /><br />
<p>9. Do you think genetically modified products like the products from three previous questions are ethically right if they benefit society?</p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a4/Question9.png" alt="Survey Answers" width="350" height="168" title="Answer to Question 9" /><br />
<p>10. Do you think there should be a place for genetic engineered products to enter the market place in the next 5 years?</p><br />
<img src="https://static.igem.org/mediawiki/2012/3/33/Question10.png" alt="Survey Answers" width="407" height="166" title="Answer to Question 10" /><br />
<br />
<br />
<h1>IGEM SOCIETY </h1><br />
<p>This year (2012) was the first time that our University of Westminster participates in the iGEM competition. We encountered many difficulties being the fresh new team, and decided to organise an iGEM society to share everything we were learning with the students that may become part of our 2013 Westminster iGEM team. We organised an iSTEM project presentation and will hold an Induction Session in early October to expose the student community to the SynBio field and the iGEM!</p><br />
<br />
<h1>FRESHERS' FAIR </h1><br />
<p><br />
During the fresher’s day at our University, we had a presentation stand through which we could introduce synthetic biology, the iGEM competition and our new Westminster iGEM society to the new students. We were wonderfully received by many enthusiastic students, 94 of which expressed their wish to attend our iSTEM official presentation before the Jamboree and talks on the topic of synthetic biology. Our iGEM public engagement posters were displayed both in the foyer TV and our stand, attracting many students that were curious about our project or wanted to be part of a future iGEM team (and half of them were not studying Biology, but other courses varying from Electrical Engineering to Politics!) It was a great experience to meet them all and communicate our ideas and the potential of SynBio, as well as increasing the student`s awareness of the iGEM competition. </p><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/5/52/Freshers.jpg" alt="Freshers" width="336" height="268" title="Answer to Question 10" /><br />
<br />
<br />
<h1>INTERVIEW</h1><br />
<p> <br />
We interviewed Dr. Miriam Dwek, who is the head of the Against Breast Cancer Unit at the University of Westminster. She talked with us about her research and her views on our project, and gave us useful advice.<br />
</p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/OutreachTeam:Westminster/Outreach2012-09-27T03:55:27Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink active">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<iframe width="965" height="543" src="http://www.youtube.com/embed/nehmMHG7E3A" frameborder="0" allowfullscreen></iframe><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<br />
<h1>SURVEY</h1><br />
<p><br />
Statistical analysis was done based on the survey data that was collected to determine the acceptance of genetically modified products in various fields (environment and medical) from individuals with different knowledge of biology ranging from negligible to a more advanced level. Our survey result from approximately one hundred people demonstrates that most people including those with base level knowledge of biology were very much interested in using genetically modified organisms in various fields like food, environment and medicine. In addition to this, people were also eager to use synthetic biology in the cure of cancer since our project was mainly focused on the application of synthetic biology in cancer therapy. Although this was the first year for our university to initiate creating awareness about synthetic biology to the public, we were very surprised to know that currently in the 21st century there is decreasing number of people without some knowledge of biology. We hope to fill these gap in the future via iGEM<br />
</p><br />
<p>The survey questions and the graphical representations of their answers are shown below:</p><br />
<p>1. Do you think biology is interesting? </p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a2/Question_1.png" alt="Survey Answers" width="292" height="161" title="Answer to Question 1" /><br />
<p>2. What level of scientific or biology education do you have? </p><br />
<img src="https://static.igem.org/mediawiki/2012/b/bb/Question2.png" alt="Survey Answers" width="395" height="202" title="Answer to Question 2" /><br />
<p>3. How would you classify bacteria? </p><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Question3.png" alt="Survey Answers" width="379" height="189" title="Answer to Question 3" /><br />
<p>4. The human body is composed of a larger number of bacterial cells than human cells? </p><br />
<img src="https://static.igem.org/mediawiki/2012/6/61/Question4.png" alt="Survey Answers" width="319" height="182" title="Answer to Question 4" /><br />
<p>5. Do you know products like bread, beer and many medications are made using microorganisms? </p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a6/Question_5.png" alt="Survey Answers" width="364" height="188" title="Answer to Question 5" /><br />
<p>6. Imagine a certain breed of panda is becoming extinct. Scientists have genetically modified some of the genes in these pandas to allow them to survive, even under harsh conditions, thus preventing their extinction. Do you feel this is a justifiable use of genetic modification?</p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b8/Question6.png" alt="Survey Answers" width="345" height="174" title="Answer to Question 6" /><br />
<p>7. A nuclear explosion in Japan has caused a lot of devastation and radiation debris. An iGEM team from the University of Osaka has created an organism that can de-toxify this debris. Do you feel this is a justifiable use of genetic modification?</p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b3/Question7.png" alt="Survey Answers" width="370" height="172" title="Answer to Question 7" /><br />
<p>8. Imagine that your relative is severely ill with cancer. The doctor tells you the treatment options are either regular cancer medicine, eg chemotherapy or a new genetically modified medicine. If the regular medicine had a 40% chance of working, while the genetically modified drug had a 60% success rate. Which would you prefer?</p><br />
<img src="https://static.igem.org/mediawiki/2012/6/6a/Question8.png" alt="Survey Answers" width="390" height="181" title="Answer to Question 8" /><br />
<p>9. Do you think genetically modified products like the products from three previous questions are ethically right if they benefit society?</p><br />
<img src="https://static.igem.org/mediawiki/2012/a/a4/Question9.png" alt="Survey Answers" width="350" height="168" title="Answer to Question 9" /><br />
<p>10. Do you think there should be a place for genetic engineered products to enter the market place in the next 5 years?</p><br />
<img src="https://static.igem.org/mediawiki/2012/3/33/Question10.png" alt="Survey Answers" width="407" height="166" title="Answer to Question 10" /><br />
<br />
<br />
<h1>IGEM SOCIETY </h1><br />
<p>This year (2012) was the first time that our University of Westminster participates in the iGEM competition. We encountered many difficulties being the fresh new team, and decided to organise an iGEM society to share everything we were learning with the students that may become part of our 2013 Westminster iGEM team. We organised an iSTEM project presentation and will hold an Induction Session in early October to expose the student community to the SynBio field and the iGEM!</p><br />
<br />
<h1>FRESHERS' FAIR </h1><br />
<p><br />
During the fresher’s day at our University, we had a presentation stand through which we could introduce synthetic biology, the iGEM competition and our new Westminster iGEM society to the new students. We were wonderfully received by many enthusiastic students, 94 of which expressed their wish to attend our iSTEM official presentation before the Jamboree and talks on the topic of synthetic biologt. Our iGEM public engagement posters were displayed both in the foyer TV and our stand, attracting many students that were curious about our project or wanted to be part of a future iGEM team (and half of them were not studying Biology, but other courses varying from Electrical Engineering to Politics!) It was a great experience to meet them all and communicate our ideas and the potential of SynBio, as well as increasing the student`s awareness of the iGEM competition. </p><br />
<br />
<img src="https://static.igem.org/mediawiki/2012/5/52/Freshers.jpg" alt="Freshers" width="336" height="268" title="Answer to Question 10" /><br />
<br />
<br />
<h1>INTERVIEW</h1><br />
<p> <br />
We interviewed Dr. Miriam Dwek, who is the head of the Against Breast Cancer Unit at the University of Westminster. She talked with us about her research and her views on our project, and gave us useful advice.<br />
</p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ProblemTeam:Westminster/Problem2012-09-27T03:52:09Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink active">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/f/f3/Cancerrr.jpg" alt="Welcome" width="965" height="518" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --> <br />
<br />
<div id="home-main-text"><br />
<h1>The Problem</h1><br />
<h2>Cancer</h2><br />
<p>Cancer remains one of the biggest killers in the world. There are currently about 12.7 million sufferers of cancer around the world, and the number is expected to have doubled by 2030. Around one in four deaths in the UK is caused by cancer, and it is estimated that one in three people will develop a form of cancer in their lifetime. (Cancer Research UK)</p><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/1/18/Cancer_occurrence_rates_edit.png" alt="Occurence rates" title="Occurrence Rates" /><br />
</a><br />
<h2>Cancer Recurrence</h2><br />
<p>Even though cancer treatment and management techniques have improved over the years, cancer recurrence continues to be a problem and source of concern amongst sufferers, their families and medical professionals. The American Cancer Society approximates that about 20% of all breast cancer survivors will develop a recurrent breast cancer. Several reasons have been given for recurrence, one of which is that not all cancer cells are killed during cancer treatment, so these cancer cells are then able to regenerate new tumors. </p><br />
<h2>Unavailability of Early Diagnostic Tests</h2><br />
<p>Even with extensive research into cancer and its surrounding phenomena, there is still an unavailability of diagnostic tests that catch some cancers before they start to exhibit serious symptoms. Cancers like bowel and pancreatic cancers can usually not be detected until a patient develops a very big tumor or experiences some bleeding in their stool. It would be ideal to have blood or even non-invasive urine tests that can detect biomarkers for these cancers at the early stages and prevent them from metastasizing. </p><br />
<h2>Tracking Metastasis</h2><br />
<p>Even when cancers have been detected in the late stages, medical experts experience problems with detecting areas to which the cancer has spread. </p><br />
<h2>Current Tools for Cancer Research</h2><br />
<p>Currently, the Aldefluor assay is commonly used to identify and isolate cancer stem cells.This is a chemical assay used to detect high levels of ALDH expression in cells. Our project aims to build a molecular system which would offer greater sensitivity by targeting distinct ALDH isoforms. </p><br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
<br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T03:44:16Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1 (12 September 2012)</b></p><br />
<P> After months of planning we are finally in the lab!<P> <br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we have had in the lab we were<br />
able to amplify the promoter regions which we had designed and we have sent them to<br />
iGEM registry. These parts are currently being sequenced. </p><br />
<P> Parts produced by the group<P><br />
<P> ALDH1A1 promoter BBa_K940000<P><br />
<P> ALDH2 promoter BBa_K940001<P><br />
<P> ALDH1A3 promoter BBa_K940002<p><br />
<p> ALDG3A1 promoter BBa_K940003<p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/PartsTeam:Westminster/Parts2012-09-27T03:40:57Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink active">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6e/Submission.jpg" alt="Submission" title="Submission" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>Parts</h1><br />
<P> The following Biobrick parts have been submitted to the registry.<P><br />
<br />
<p>Our parts are designed for use in mammalian system. The parts have been designed specifically to be used in cells which have high ALDH expression.<p> <br />
<br />
<p>The following parts have been submitted: </p><br />
<ul><br />
<P>ALDH1A1 <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940000"> BBa_K940000</a></li><br />
<P>ALDH 2 <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940001"> BBa_K940001</a></li><br />
<p>ALDH1A3 <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940002">Bba_K940002 </a></li><br />
<P>ALDH3A1 <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940003">ALDH3A1 – BBa_K940003</a></li><br />
</ul><br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
<br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/PartsTeam:Westminster/Parts2012-09-27T03:36:39Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink active">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6e/Submission.jpg" alt="Submission" title="Submission" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>Parts</h1><br />
<P> The following Biobrick parts have been submitted to the registry.<P><br />
<br />
<p>Our parts are designed for use in mammalian system. The parts have been designed specifically to be used in cells which have high ALDH expression.<p> <br />
<br />
<p>The following parts have been submitted: </p><br />
<ul><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940000">ALDH1A1 – BBa_K940000</a></li><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940001">ALDH2 – BBa_K940001</a></li><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940002">ALDH 1A3 – Bba_K940002 </a></li><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940003">ALDH3A1 – BBa_K940003</a></li><br />
</ul><br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
<br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T03:28:23Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1 (12 September 2012)</b></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we have had in the lab we were<br />
able to amplify the promoter regions which we had designed and we have sent them to<br />
iGEM registry. These parts are currently being sequenced. </p><br />
<P> Parts produced by the group<P><br />
<P> ALDH1A1 promoter BBa_K940000<P><br />
<P> ALDH2 promoter BBa_K940001<P><br />
<P> ALDH1A3 promoter BBa_K940002<p><br />
<p> ALDG3A1 promoter BBa_K940003<p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T03:26:49Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1</b></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we have had in the lab we were<br />
able to amplify the promoter regions which we had designed and we have sent them to<br />
iGEM registry. These parts are currently being sequenced. </p><br />
<P> Parts produced by the group<P><br />
<P> ALDH1A1 promoter BBa_K940000<P><br />
<P> ALDH2 promoter BBa_K940001<P><br />
<P> ALDH1A3 promoter BBa_K940002<p><br />
<p> ALDG3A1 promoter BBa_K940003<p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T03:23:40Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB 12 September 2012<P><br />
<p><b>WEEK 1</b></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we have had in the lab we were<br />
able to amplify the promoter regions which we had designed and we have sent them to<br />
iGEM registry. These parts are currently being sequenced. </p><br />
<P> Parts produced by the group<P><br />
<P> ALDH1A1 promoter BBa_K940000<P><br />
<P> ALDH2 promoter BBa_K940001<P><br />
<P> ALDH1A3 promoter BBa_K940002<p><br />
<p> ALDG3A1 promoter BBa_K940003<p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T03:20:49Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1</b></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we have had in the lab we were<br />
able to amplify the promoter regions which we had designed and we have sent them to<br />
iGEM registry. These parts are currently being sequenced. </p><br />
<P> Parts produced by the group<P><br />
<P> ALDH1A1 promoter BBa_K940000<P><br />
<P> ALDH2 promoter BBa_K940001<P><br />
<P> ALDH1A3 promoter BBa_K940002<p><br />
<p> ALDG3A1 promoter BBa_K940003<p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/OverviewTeam:Westminster/Overview2012-09-27T03:10:09Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
height:685px;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/Overview-diagram.jpg" alt="Overview" width="965" height="682" title="Overview" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>Background</h><br />
<h2>The Cancer Stem Cell Theory</h2><br />
<p>Many tumours contain a sub-population of self-renewing and expanding stem cells known as cancer stem cells whose symmetric division result in tumour growth. These cancer stem cells can be identified using molecular determinants or markers which have properties such as self-renewal, clonogenicity, multipotentiality, and longevity. Recent studies have increasingly implied the importance of Aldehyde dehydrogenase enzyme as a marker for cancer stem cells owing to their ability to detoxify potential cytotoxins, thus making them resistant to chemotherapy. </p><br />
<h2>Our Project</h2><br />
<p>Our iGEM project taps into the cancer stem cell theory. We have set out to synthesise a genetic construct that can identify, isolate and destroy cancer stem cells. Three different genetic constructs which serve different purposes are to be synthesised. A number of isoforms of ALDH exist, and three of the most common occurring form in cancer will be isolated. The isoforms selected are ALDH1A1, ALDH1A3 and ALDH3A1. These isoforms show increased activity in recurrent forms of cancer. We have also identified ALDH2, which will be used as the control isoform, as this form is involved in ethanol metabolism and it will be easily induced by the addition of ethanol. </p><br />
<p>The second part of our project was to create constructs to selectively isolate cancer stem cells in a range of cancer cell lines. This will provide a powerful tool for researchers in the field of cancer Biology. <p><br />
<h2>Assembly System</h2><br />
<p> We have opted to use the Plug and Play system of assembly created by DTU-Denmark for the 2011 iGEM competition. In addition, we have designed our final constructs to conform to biobrick standard parts. We feel that this could offer an opportunity to incorporate Plug-n-Play to the Biobrick system.<p><br />
<p> Due to the scarcity of available mammalian in the registry, we had to source parts from outside the parts registry. We were fortunate to obtain parts from DTU-Denmark which they had made in 2011. These parts were not available in the Parts Registry. We also contacted Serrano labs and were fortunate to receive some mammalian biobrick parts from them. </p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
<br />
<br />
</div><!-- #the-content --><br />
<br />
<br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/OverviewTeam:Westminster/Overview2012-09-27T03:00:08Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
height:685px;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/4/41/Overview-diagram.jpg" alt="Overview" width="965" height="682" title="Overview" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>Background</h><br />
<h2>The Cancer Stem Cell Theory</h2><br />
<p>Many tumours contain a sub-population of self-renewing and expanding stem cells known as cancer stem cells whose symmetric division result in tumour growth. These cancer stem cells can be identified using molecular determinants or markers which have properties such as self-renewal, clonogenicity, multipotentiality, and longevity. Recent studies have increasingly implied the importance of Aldehyde dehydrogenase enzyme as a marker for cancer stem cells owing to their ability to detoxify potential cytotoxins, thus making them resistant to chemotherapy. </p><br />
<h2>Our Project</h2><br />
<p>Our iGEM project taps into the cancer stem cell theory. We have set out to synthesise a genetic construct that can identify, isolate and destroy cancer stem cells. Three different genetic constructs which serve different purposes are to be synthesised. A number of isoforms of ALDH exist, and three of the most common occurring form in cancer will be isolated. The isoforms selected are ALDH1A1, ALDH1A3 and ALDH3A1. These isoforms show increased activity in recurrent forms of cancer. We have also identified ALDH2, which will be used as the control isoform, as this form is involved in ethanol metabolism and it will be easily induced by the addition of ethanol. </p><br />
<p>The second part of our project was to create constructs to selectively isolate cancer stem cells in a range of cancer cell lines. This will provide a powerful tool for researchers in the field of cancer Biology. <p><br />
<h2>Assembly System</h2><br />
<p> One challenge we had was finding parts for mammalian expression. We have opted to use the Plug and Play system of assembly created by DTU-Denmark for the 2011 iGEM competition. In addition, we have designed all our constructs to conform to biobrick standard parts. Due to the scarcity of available mammalian in the registry, we had to source parts from outside the parts registry. We were fortunate to obtain parts from DTU-Denmark which they had made in 2011, as they were not available in the Parts Registry. For this reason, we contacted the Serrano labs and had them send us their entire eukaryotic promoter database. The aim was to use and modify these parts to function in a way that will identify putative cancer stem cells. </p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
<br />
<br />
</div><!-- #the-content --><br />
<br />
<br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ModelingTeam:Westminster/Modeling2012-09-27T02:36:24Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink active">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/7/79/Model.png" alt="Welcome" width="965" height="518" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<br />
<div id="home-main-text"><br />
<br />
<p><b>Modelling of PEI transfection</b></p><br />
<br />
<p><span style='color:red'>Introduction</span></p><br />
<p>Effective delivery of DNA to cultured mammalian cell requires that the DNA be complexed with a transfection agent. A number of commercial transfection reagents are available and are routinely used in mammalian transfection. It is crucial that each cell line or transfection condition is tested to ensure successful optimal expression. We present here, the use of PEI (polyethylenimine) for effective transfection of MCF7 cell line. Transfection has been optimised using an eGFP plasmid. <p><br />
<p><span style='color:red'>What is<br />
PEI?</span></p><br />
<p>Poly (<span class=SpellE>ethylalenimine</span>) was<br />
identified as a transfection reagent in 1995. It is a linear cationic polymer<br />
which condenses negatively charged DNA molecules to produce positively charged<br />
particles. These positively charged complexes interact with negatively charged<br />
cell surface residues and are internalised via endocytosis. </p><br />
<p><span style='color:red'>How is the DNA released in the cell?</span></p><br />
<p>Once inside the cell, the amine groups of the PEI polymer accept<br />
protons to become more positively charged. This causes an influx of counter<br />
ions resulting in osmotic swelling. Osmotic swelling leads to bursting of the<br />
vesicle, and release of the DNA-PEI complex. The PEI unpacks from the DNA in<br />
the cytoplasm allowing the DNA to diffuse to the nucleus. </p><br />
<p><span style='color:red'>Why isn’t PEI more widely used?</span></p><br />
<p>PEI is extremely cytotoxic. It causes disruption<br />
of the cell membrane which then leads to immediate cell death or it may disrupts<br />
the mitochondrial membrane which leads to delayed death of cells. </span></p><br />
<p><p><span style='color:red'>If PEI is toxic, why suggest its use?</span></p><br />
<p>The high cost of mammalian cell culture is<br />
possibly one of the restricting factors encouraging iGEM teams and other<br />
researchers from working with mammalian cells. PEI is a very cheap transfection<br />
reagent, which works! &nbsp;</span></p><br />
<p><span style='color:red'>Protocol for preparing the PEI-DNA<br />
mixture and transfection of MCF7 cells (As performed by Andrew Jenks)</span></p><br />
<p>All cell culture and transfection was<br />
carried in complete media Dulbecco’s modified eagles media (DMEM) supplemented<br />
with 10 % foetal bovine serum (FBS). No antibiotics were used, cells were<br />
transiently transfected. </p><br />
<p>Procedure </p><br />
<p>On the day prior to transfection 250000 MCF7 cells were<br />
seeded per well of a 24 well plate.</p><br />
<p>For each transfection, reagents were prepared as follows:</p><br />
<p>Plasmid mixed with PEI.PEI volumes<br />
used were either 0 µl, 3 µl, 6 µl, 9 µl, 12 µl and 15 µl. Plasmid concentration<br />
was either at 0 µg, 0.36 µg, 0.7 µg, 1.46 µg, 2.92 µg and 5.84 µg. Combinations<br />
of the PEI and plasmid was used. </span></p><br />
<p>100 µl (10% of growth media volume) of<br />
0.15M NaCl was added to the plasmid-PEI mixture</span></p><br />
<p>Transfection reagent mixture was vortexed and incubated at room temperature for 10 mins</span></p><br />
<p>The 24 well plate was removed from the incubator. Prior to transfection, old media was removed from each well and replaced<br />
with fresh media. Prior to transfection, the old media from each well was<br />
replaced with fresh media. The PEI-plasmid-NaCl mixture was the added dropwise with even distribution<br />
to cells. Cells were incubated overnight at 37&#7506;C. The following day, cells were assessed for cell health<br />
and the media replaced. After this the cells were allowed to recover for 48hrs before beingtrypsinised</span>.</p><br />
<p>Cells were analysed by flow <span class=SpellE>cytometery</span> as follows:</p><br />
<p>Media was removed and the cells were washed once with PBS.<br />
Cells were then <span class=SpellE>trypsinised</span> with 0.21mM trypsin<br />
containing 4.81 <span class=SpellE>mM</span> EDTA. The trypsin was then neutralized<br />
with the addition of complete media and cells were centrifuged at 2000 rpm for<br />
3 <span class=SpellE>mins</span></p><br />
<p>Cells were then washed once in ice cold PBS containing 1% foetal<br />
bovine serum (FBS) <span class=GramE>and &nbsp;re</span>-suspended in 1% FBS containing<br />
1ug/ml <span class=SpellE>propidium</span> iodide.</p><br />
<p>Cells were analysed using <span class=SpellE>CyAn</span>™<br />
ADP flow cytometer (<span class=SpellE>DakoCytomation</span>). In order<br />
to distinguish between alive and dead cells <span class=SpellE>propidum</span> iodide was used and data was analysed using the summit v4.3 software. Cell lines<br />
were gated according to an unstained sample and lasers were adjusted<br />
accordingly. Unstained cells were used to set gates for cell size and internal<br />
complexity, dead cells were removed along with doublets.</p><br />
<p style='line-height:normal;'><b><span style='font-size:10.0pt;<br />
font-family:Arial;color:red;<br />
'>RESULTS:</span></b></p><br />
<p style='line-height:normal'><span style='font-size:10.0pt;font-family:Arial;"Times New Roman";color:black;'>Results of the transfection using the PEI and plasmid concentrations was<br />
as follows:</span></p><br />
<p style='line-height:normal'><b><span lang=EN-US<br />
style='font-size:10.0pt;font-family:Arial;<br />
color:black;'><img width=384 height=227<br />
src="https://static.igem.org/mediawiki/2012/6/6f/Modelling_002.png" v:shapes="Picture_x0020_3"></span></b></p><br />
<p>6 µl of PEI with 1.46 µg of plasmid gave the highest level of<br />
transfection. 43% of cells were transfected. This is highly favourable in<br />
comparison to other transfection reagents. Increasing the DNA concentration did<br />
not improve transfection. </p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b1/Transfection_wmin.png" alt="transfections" title="transfections" width="800" height="479" /><br />
<br />
<p><span lang=PT>References: <br />
<p>Boussif, O et al. (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: Polyethylenimine. National Acad Science, 92 (16).<p><br />
<br />
<p>Akin, A. et al. (2004). Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. The Journal of gene medicine, 7 (5). <P><br />
<br />
<p>Werth, S (2006). A low molecular weight fraction of polyethylenimine (PEI) displays increased transfection efficiency of DNA and siRNA in fresh or lyophilized complexes. Journal of Controlled Release, 11 (2) 257-270. <p><br />
<br />
</span></a></p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ModelingTeam:Westminster/Modeling2012-09-27T02:33:14Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink active">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/7/79/Model.png" alt="Welcome" width="965" height="518" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<br />
<div id="home-main-text"><br />
<br />
<p><b>Modelling of PEI transfection</b></p><br />
<br />
<p><span style='color:red'>Introduction</span></p><br />
<p>Effective delivery of DNA to cultured mammalian cell requires that the DNA be complexed with a transfection agent. A number of commercial transfection reagents are available and are routinely used in mammalian transfection. It is crucial that each cell line or transfection condition is tested to ensure successful optimal expression. We present here, the use of PEI (polyethylenimine) for effective transfection of MCF7 cell line. Transfection has been optimised using an eGFP plasmid. <p><br />
<p><span style='color:red'>What is<br />
PEI?</span></p><br />
<p>Poly (<span class=SpellE>ethylalenimine</span>) was<br />
identified as a transfection reagent in 1995. It is a linear cationic polymer<br />
which condenses negatively charged DNA molecules to produce positively charged<br />
particles. These positively charged complexes interact with negatively charged<br />
cell surface residues and are internalised via endocytosis. </p><br />
<p><span style='color:red'>How is the DNA released in the cell?</span></p><br />
<p>Once inside the cell, the amine groups of the PEI polymer accept<br />
protons to become more positively charged. This causes an influx of counter<br />
ions resulting in osmotic swelling. Osmotic swelling leads to bursting of the<br />
vesicle, and release of the DNA-PEI complex. The PEI unpacks from the DNA in<br />
the cytoplasm allowing the DNA to diffuse to the nucleus. </p><br />
<p><span style='color:red'>Why isn’t PEI more widely used?</span></p><br />
<p>PEI is extremely cytotoxic. It causes disruption<br />
of the cell membrane which then leads to immediate cell death or it may disrupts<br />
the mitochondrial membrane which leads to delayed death of cells. </span></p><br />
<p><p><span style='color:red'>If PEI is toxic, why suggest its use?</span></p><br />
<p>The high cost of mammalian cell culture is<br />
possibly one of the restricting factors encouraging iGEM teams and other<br />
researchers from working with mammalian cells. PEI is a very cheap transfection<br />
reagent, which works! &nbsp;</span></p><br />
<p><span style='color:red'>Protocol for preparing the PEI-DNA<br />
mixture and transfection of MCF7 cells (As performed by Andrew Jenks)</span></p><br />
<p>All cell culture and transfection was<br />
carried in complete media Dulbecco’s modified eagles media (DMEM) supplemented<br />
with 10 % foetal bovine serum (FBS). No antibiotics were used, cells were<br />
transiently transfected. </p><br />
<p>Procedure </p><br />
<p>On the day prior to transfection 250000 MCF7 cells were<br />
seeded per well of a 24 well plate.</p><br />
<p>For each transfection, reagents were prepared as follows:</p><br />
<p class=MsoListParagraphCxSpFirst><span<br />
lang=EN-US style='font-family:Calibri;'>a)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Plasmid mixed with PEI.PEI volumes<br />
used were either 0 µl, 3 µl, 6 µl, 9 µl, 12 µl and 15 µl. Plasmid concentration<br />
was either at 0 µg, 0.36 µg, 0.7 µg, 1.46 µg, 2.92 µg and 5.84 µg. Combinations<br />
of the PEI and plasmid was used. </span></p><br />
<p>100 µl (10% of growth media volume) of<br />
0.15M NaCl was added to the plasmid-PEI mixture</span></p><br />
<p>Transfection reagent mixture was vortexed and incubated at room temperature for 10 mins</span></p><br />
<p>The 24 well plate was removed from the incubator. Prior to transfection, old media was removed from each well and replaced<br />
with fresh media. Prior to transfection, the old media from each well was<br />
replaced with fresh media. The PEI-plasmid-NaCl mixture was the added dropwise with even distribution<br />
to cells. Cells were incubated overnight at 37&#7506;C. The following day, cells were assessed for cell health<br />
and the media replaced. After this the cells were allowed to recover for 48hrs before beingtrypsinised</span>.</p><br />
<p>Cells were analysed by flow <span class=SpellE>cytometery</span> as follows:</p><br />
<p>Media was removed and the cells were washed once with PBS.<br />
Cells were then <span class=SpellE>trypsinised</span> with 0.21mM trypsin<br />
containing 4.81 <span class=SpellE>mM</span> EDTA. The trypsin was then neutralized<br />
with the addition of complete media and cells were centrifuged at 2000 rpm for<br />
3 <span class=SpellE>mins</span></p><br />
<p>Cells were then washed once in ice cold PBS containing 1% foetal<br />
bovine serum (FBS) <span class=GramE>and &nbsp;re</span>-suspended in 1% FBS containing<br />
1ug/ml <span class=SpellE>propidium</span> iodide.</p><br />
<p>Cells were analysed using <span class=SpellE>CyAn</span>™<br />
ADP flow cytometer (<span class=SpellE>DakoCytomation</span>). In order<br />
to distinguish between alive and dead cells <span class=SpellE>propidum</span> iodide was used and data was analysed using the summit v4.3 software. Cell lines<br />
were gated according to an unstained sample and lasers were adjusted<br />
accordingly. Unstained cells were used to set gates for cell size and internal<br />
complexity, dead cells were removed along with doublets.</p><br />
<p style='line-height:normal;'><b><span style='font-size:10.0pt;<br />
font-family:Arial;color:red;<br />
'>RESULTS:</span></b></p><br />
<p style='line-height:normal'><span style='font-size:10.0pt;font-family:Arial;"Times New Roman";color:black;'>Results of the transfection using the PEI and plasmid concentrations was<br />
as follows:</span></p><br />
<p style='line-height:normal'><b><span lang=EN-US<br />
style='font-size:10.0pt;font-family:Arial;<br />
color:black;'><img width=384 height=227<br />
src="https://static.igem.org/mediawiki/2012/6/6f/Modelling_002.png" v:shapes="Picture_x0020_3"></span></b></p><br />
<p>6 µl of PEI with 1.46 µg of plasmid gave the highest level of<br />
transfection. 43% of cells were transfected. This is highly favourable in<br />
comparison to other transfection reagents. Increasing the DNA concentration did<br />
not improve transfection. </p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b1/Transfection_wmin.png" alt="transfections" title="transfections" width="800" height="479" /><br />
<br />
<p><span lang=PT>References: <br />
<p>Boussif, O et al. (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: Polyethylenimine. National Acad Science, 92 (16).<p><br />
<br />
<p>Akin, A. et al. (2004). Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. The Journal of gene medicine, 7 (5). <P><br />
<br />
<p>Werth, S (2006). A low molecular weight fraction of polyethylenimine (PEI) displays increased transfection efficiency of DNA and siRNA in fresh or lyophilized complexes. Journal of Controlled Release, 11 (2) 257-270. <p><br />
<br />
</span></a></p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ModelingTeam:Westminster/Modeling2012-09-27T02:30:43Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink active">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/7/79/Model.png" alt="Welcome" width="965" height="518" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<br />
<div id="home-main-text"><br />
<br />
<p><b>Modelling of PEI transfection</b></p><br />
<br />
<p><span style='color:red'>Introduction</span></p><br />
<p>Effective delivery of DNA to cultured mammalian cell requires that the DNA be complexed with a transfection agent. A number of commercial transfection reagents are available and are routinely used in mammalian transfection. It is crucial that each cell line or transfection condition is tested to ensure successful optimal expression. We present here, the use of PEI (polyethylenimine) for effective transfection of MCF7 cell line. Transfection has been optimised using an eGFP plasmid. <p><br />
<p><span style='color:red'>What is<br />
PEI?</span></p><br />
<p>Poly (<span class=SpellE>ethylalenimine</span>) was<br />
identified as a transfection reagent in 1995. It is a linear cationic polymer<br />
which condenses negatively charged DNA molecules to produce positively charged<br />
particles. These positively charged complexes interact with negatively charged<br />
cell surface residues and are internalised via endocytosis. </p><br />
<p><span style='color:red'>How is the DNA released in the cell?</span></p><br />
<p>Once inside the cell, the amine groups of the PEI polymer accept<br />
protons to become more positively charged. This causes an influx of counter<br />
ions resulting in osmotic swelling. Osmotic swelling leads to bursting of the<br />
vesicle, and release of the DNA-PEI complex. The PEI unpacks from the DNA in<br />
the cytoplasm allowing the DNA to diffuse to the nucleus. </p><br />
<p><span style='color:red'>Why isn’t PEI more widely used?</span></p><br />
<p>PEI is extremely cytotoxic. It causes disruption<br />
of the cell membrane which then leads to immediate cell death or it may disrupts<br />
the mitochondrial membrane which leads to delayed death of cells. </span></p><br />
<p><p><span style='color:red'>If PEI is toxic, why suggest its use?</span></p><br />
<p>The high cost of mammalian cell culture is<br />
possibly one of the restricting factors encouraging iGEM teams and other<br />
researchers from working with mammalian cells. PEI is a very cheap transfection<br />
reagent, which works! &nbsp;</span></p><br />
<p><span style='color:red'>Protocol for preparing the PEI-DNA<br />
mixture and transfection of MCF7 cells (As performed by Andrew Jenks)</span></p><br />
<p>All cell culture and transfection was<br />
carried in complete media Dulbecco’s modified eagles media (DMEM) supplemented<br />
with 10 % foetal bovine serum (FBS). No antibiotics were used, cells were<br />
transiently transfected. </p><br />
<p>Procedure </p><br />
<p>On the day prior to transfection 250000 MCF7 cells were<br />
seeded per well of a 24 well plate.</p><br />
<p>For each transfection, reagents were prepared as follows:</p><br />
<p class=MsoListParagraphCxSpFirst><span<br />
lang=EN-US style='font-family:Calibri;'>a)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Plasmid mixed with PEI.PEI volumes<br />
used were either 0 µl, 3 µl, 6 µl, 9 µl, 12 µl and 15 µl. Plasmid concentration<br />
was either at 0 µg, 0.36 µg, 0.7 µg, 1.46 µg, 2.92 µg and 5.84 µg. Combinations<br />
of the PEI and plasmid was used. </span></p><br />
<p>100 µl (10% of growth media volume) of<br />
0.15M NaCl was added to the plasmid-PEI mixture</span></p><br />
<p>Transfection reagent mixture was vortexed and incubated at room temperature for 10 mins</span></p><br />
<p>The 24 well plate was removed from the incubator. Prior to transfection, old media was removed from each well and replaced<br />
with fresh media. Prior to transfection, the old media from each well was<br />
replaced with fresh media. The PEI-plasmid-<span class=SpellE>NaCl</span> mixture was the added <span class=SpellE>dropwise</span> with even distribution<br />
to cells. Cells were incubated overnight at 37&#7506;C. The following day, cells were assessed for cell health<br />
and the media replaced. After this the cells were allowed to recover for <span<br />
class=GramE>48hrs&nbsp; before</span> being <span class=SpellE>trypsinised</span>. </p><br />
<p>Cells were analysed by flow <span class=SpellE>cytometery</span> as follows:</p><br />
<p>Media was removed and the cells were washed once with PBS.<br />
Cells were then <span class=SpellE>trypsinised</span> with 0.21mM trypsin<br />
containing 4.81 <span class=SpellE>mM</span> EDTA. The trypsin was then neutralized<br />
with the addition of complete media and cells were centrifuged at 2000 rpm for<br />
3 <span class=SpellE>mins</span></p><br />
<p>Cells were then washed once in ice cold PBS containing 1% foetal<br />
bovine serum (FBS) <span class=GramE>and &nbsp;re</span>-suspended in 1% FBS containing<br />
1ug/ml <span class=SpellE>propidium</span> iodide.</p><br />
<p>Cells were analysed using <span class=SpellE>CyAn</span>™<br />
ADP flow cytometer (<span class=SpellE>DakoCytomation</span>). In order<br />
to distinguish between alive and dead cells <span class=SpellE>propidum</span> iodide was used and data was analysed using the summit v4.3 software. Cell lines<br />
were gated according to an unstained sample and lasers were adjusted<br />
accordingly. Unstained cells were used to set gates for cell size and internal<br />
complexity, dead cells were removed along with doublets.</p><br />
<p style='line-height:normal;'><b><span style='font-size:10.0pt;<br />
font-family:Arial;color:red;<br />
'>RESULTS:</span></b></p><br />
<p style='line-height:normal'><span style='font-size:10.0pt;font-family:Arial;"Times New Roman";color:black;'>Results of the transfection using the PEI and plasmid concentrations was<br />
as follows:</span></p><br />
<p style='line-height:normal'><b><span lang=EN-US<br />
style='font-size:10.0pt;font-family:Arial;<br />
color:black;'><img width=384 height=227<br />
src="https://static.igem.org/mediawiki/2012/6/6f/Modelling_002.png" v:shapes="Picture_x0020_3"></span></b></p><br />
<p>6 µl of PEI with 1.46 µg of plasmid gave the highest level of<br />
transfection. 43% of cells were transfected. This is highly favourable in<br />
comparison to other transfection reagents. Increasing the DNA concentration did<br />
not improve transfection. </p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b1/Transfection_wmin.png" alt="transfections" title="transfections" width="800" height="479" /><br />
<br />
<p><span lang=PT>References: <br />
<p>Boussif, O et al. (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: Polyethylenimine. National Acad Science, 92 (16).<p><br />
<br />
<p>Akin, A. et al. (2004). Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. The Journal of gene medicine, 7 (5). <P><br />
<br />
<p>Werth, S (2006). A low molecular weight fraction of polyethylenimine (PEI) displays increased transfection efficiency of DNA and siRNA in fresh or lyophilized complexes. Journal of Controlled Release, 11 (2) 257-270. <p><br />
<br />
</span></a></p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ModelingTeam:Westminster/Modeling2012-09-27T02:24:40Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink active">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/7/79/Model.png" alt="Welcome" width="965" height="518" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<br />
<div id="home-main-text"><br />
<br />
<p><b>Modelling of PEI transfection</b></p><br />
<br />
<p><span style='color:red'>Introduction</span></p><br />
<p>Effective delivery of DNA to cultured mammalian cell requires that the DNA be complexed with a transfection agent. A number of commercial transfection reagents are available and are routinely used in mammalian transfection. It is crucial that each cell line or transfection condition is tested to ensure successful optimal expression. We present here, the use of PEI (polyethylenimine) for effective transfection of MCF7 cell line. Transfection has been optimised using an eGFP plasmid. <p><br />
<p><span style='color:red'>What is<br />
PEI?</span></p><br />
<p>Poly (<span class=SpellE>ethylalenimine</span>) was<br />
identified as a transfection reagent in 1995. It is a linear cationic polymer<br />
which condenses negatively charged DNA molecules to produce positively charged<br />
particles. These positively charged complexes interact with negatively charged<br />
cell surface residues and are internalised via endocytosis. </p><br />
<p><span style='color:red'>How is the DNA released in the cell?</span></p><br />
<p>Once inside the cell, the amine groups of the PEI polymer accept<br />
protons to become more positively charged. This causes an influx of counter<br />
ions resulting in osmotic swelling. Osmotic swelling leads to bursting of the<br />
vesicle, and release of the DNA-PEI complex. The PEI unpacks from the DNA in<br />
the cytoplasm allowing the DNA to diffuse to the nucleus. </p><br />
<p><span style='color:red'>Why isn’t PEI more widely used?</span></p><br />
<p>PEI is extremely cytotoxic. It causes disruption<br />
of the cell membrane which then leads to immediate cell death or it may disrupts<br />
the mitochondrial membrane which leads to delayed death of cells. </span></p><br />
<p><p><span style='color:red'>If PEI is toxic, why suggest its use?</span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'>The high cost of mammalian cell culture is<br />
possibly one of the restricting factors encouraging iGEM teams and other<br />
researchers from working with mammalian cells. PEI is a very cheap transfection<br />
reagent, which works! &nbsp;</span></p><br />
<p><span style='color:red'>Protocol for preparing the PEI-DNA<br />
mixture and transfection of MCF7 cells (As performed by Andrew Jenks)</span></p><br />
<p>All cell culture and transfection was<br />
carried in complete media Dulbecco’s modified eagles media (DMEM) supplemented<br />
with 10 % foetal bovine serum (FBS). No antibiotics were used, cells were<br />
transiently transfected. </p><br />
<p>Procedure </p><br />
<p>On the day prior to transfection 250000 MCF7 cells were<br />
seeded per well of a 24 well plate.</p><br />
<p>For each transfection, reagents were prepared as follows:</p><br />
<p class=MsoListParagraphCxSpFirst><span<br />
lang=EN-US style='font-family:Calibri;'>a)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Plasmid mixed with PEI.PEI volumes<br />
used were either 0 µl, 3 µl, 6 µl, 9 µl, 12 µl and 15 µl. Plasmid concentration<br />
was either at 0 µg, 0.36 µg, 0.7 µg, 1.46 µg, 2.92 µg and 5.84 µg. Combinations<br />
of the PEI and plasmid was used. </span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>b)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>100 µl (10% of growth media volume) of<br />
0.15M <span class=SpellE>NaCl</span> was added to plasmid-PEI mixture</span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>c)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Transfection reagent mixture was <span<br />
class=SpellE>vortexed</span> and incubated at room temperature for 10 <span<br />
class=SpellE>mins</span>.</span></p><br />
<p>The 24 well <span class=GramE>plate</span> was removed from the<br />
incubator. Prior to transfection, old media was removed from each well and replaced<br />
with fresh media. Prior to transfection, the old media from each well was<br />
replaced with fresh media. The PEI-plasmid-<span class=SpellE>NaCl</span> mixture was the added <span class=SpellE>dropwise</span> with even distribution<br />
to cells. Cells were incubated overnight at 37&#7506;C. The following day, cells were assessed for cell health<br />
and the media replaced. After this the cells were allowed to recover for <span<br />
class=GramE>48hrs&nbsp; before</span> being <span class=SpellE>trypsinised</span>. </p><br />
<p>Cells were analysed by flow <span class=SpellE>cytometery</span> as follows:</p><br />
<p>Media was removed and the cells were washed once with PBS.<br />
Cells were then <span class=SpellE>trypsinised</span> with 0.21mM trypsin<br />
containing 4.81 <span class=SpellE>mM</span> EDTA. The trypsin was then neutralized<br />
with the addition of complete media and cells were centrifuged at 2000 rpm for<br />
3 <span class=SpellE>mins</span></p><br />
<p>Cells were then washed once in ice cold PBS containing 1% foetal<br />
bovine serum (FBS) <span class=GramE>and &nbsp;re</span>-suspended in 1% FBS containing<br />
1ug/ml <span class=SpellE>propidium</span> iodide.</p><br />
<p>Cells were analysed using <span class=SpellE>CyAn</span>™<br />
ADP flow cytometer (<span class=SpellE>DakoCytomation</span>). In order<br />
to distinguish between alive and dead cells <span class=SpellE>propidum</span> iodide was used and data was analysed using the summit v4.3 software. Cell lines<br />
were gated according to an unstained sample and lasers were adjusted<br />
accordingly. Unstained cells were used to set gates for cell size and internal<br />
complexity, dead cells were removed along with doublets.</p><br />
<p style='line-height:normal;'><b><span style='font-size:10.0pt;<br />
font-family:Arial;color:red;<br />
'>RESULTS:</span></b></p><br />
<p style='line-height:normal'><span style='font-size:10.0pt;font-family:Arial;"Times New Roman";color:black;'>Results of the transfection using the PEI and plasmid concentrations was<br />
as follows:</span></p><br />
<p style='line-height:normal'><b><span lang=EN-US<br />
style='font-size:10.0pt;font-family:Arial;<br />
color:black;'><img width=384 height=227<br />
src="https://static.igem.org/mediawiki/2012/6/6f/Modelling_002.png" v:shapes="Picture_x0020_3"></span></b></p><br />
<p>6 µl of PEI with 1.46 µg of plasmid gave the highest level of<br />
transfection. 43% of cells were transfected. This is highly favourable in<br />
comparison to other transfection reagents. Increasing the DNA concentration did<br />
not improve transfection. </p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b1/Transfection_wmin.png" alt="transfections" title="transfections" width="800" height="479" /><br />
<br />
<p><span lang=PT>References: <br />
<p>Boussif, O et al. (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: Polyethylenimine. National Acad Science, 92 (16).<p><br />
<br />
<p>Akin, A. et al. (2004). Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. The Journal of gene medicine, 7 (5). <P><br />
<br />
<p>Werth, S (2006). A low molecular weight fraction of polyethylenimine (PEI) displays increased transfection efficiency of DNA and siRNA in fresh or lyophilized complexes. Journal of Controlled Release, 11 (2) 257-270. <p><br />
<br />
</span></a></p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ModelingTeam:Westminster/Modeling2012-09-27T02:21:47Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink active">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/7/79/Model.png" alt="Welcome" width="965" height="518" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<br />
<div id="home-main-text"><br />
<br />
<p><b>Modelling of PEI transfection</b></p><br />
<br />
<p><span style='color:red'>Introduction</span></p><br />
<p>Effective delivery of DNA to cultured mammalian cell requires that the DNA be complexed with a transfection agent. A number of commercial transfection reagents are available and are routinely used in mammalian transfection. It is crucial that each cell line or transfection condition is tested to ensure successful optimal expression. We present here, the use of PEI (polyethylenimine) for effective transfection of MCF7 cell line. Transfection has been optimised using an eGFP plasmid. <p><br />
<p><span style='color:red'>What is<br />
PEI?</span></p><br />
<p>Poly (<span class=SpellE>ethylalenimine</span>) was<br />
identified as a transfection reagent in 1995. It is a linear cationic polymer<br />
which condenses negatively charged DNA molecules to produce positively charged<br />
particles. These positively charged complexes interact with negatively charged<br />
cell surface residues and are internalised via endocytosis. </p><br />
<p><span style='color:red'>How is the DNA released in the cell?</span></p><br />
<p>Once inside the cell, the amine groups of the PEI polymer accept<br />
protons to become more positively charged. This causes an influx of counter<br />
ions resulting in osmotic swelling. Osmotic swelling leads to bursting of the<br />
vesicle, and release of the DNA-PEI complex. The PEI unpacks from the DNA in<br />
the cytoplasm allowing the DNA to diffuse to the nucleus. </p><br />
<p><span style='color:red'>Why isn’t PEI more widely used?</span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'>PEI is extremely cytotoxic. It causes disruption<br />
of the cell membrane which then leads to immediate cell death or it may disrupts<br />
the mitochondrial membrane which leads to delayed death of cells. </span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:red'><p><span style='color:red'>If PEI is toxic, why suggest its use?</span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'>The high cost of mammalian cell culture is<br />
possibly one of the restricting factors encouraging iGEM teams and other<br />
researchers from working with mammalian cells. PEI is a very cheap transfection<br />
reagent, which works! &nbsp;</span></p><br />
<p><span style='color:red'>Protocol for preparing the PEI-DNA<br />
mixture and transfection of MCF7 cells (As performed by Andrew Jenks)</span></p><br />
<p>All cell culture and transfection was<br />
carried in complete media Dulbecco’s modified eagles media (DMEM) supplemented<br />
with 10 % foetal bovine serum (FBS). No antibiotics were used, cells were<br />
transiently transfected. </p><br />
<p>Procedure </p><br />
<p>On the day prior to transfection 250000 MCF7 cells were<br />
seeded per well of a 24 well plate.</p><br />
<p>For each transfection, reagents were prepared as follows:</p><br />
<p class=MsoListParagraphCxSpFirst><span<br />
lang=EN-US style='font-family:Calibri;'>a)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Plasmid mixed with PEI.PEI volumes<br />
used were either 0 µl, 3 µl, 6 µl, 9 µl, 12 µl and 15 µl. Plasmid concentration<br />
was either at 0 µg, 0.36 µg, 0.7 µg, 1.46 µg, 2.92 µg and 5.84 µg. Combinations<br />
of the PEI and plasmid was used. </span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>b)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>100 µl (10% of growth media volume) of<br />
0.15M <span class=SpellE>NaCl</span> was added to plasmid-PEI mixture</span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>c)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Transfection reagent mixture was <span<br />
class=SpellE>vortexed</span> and incubated at room temperature for 10 <span<br />
class=SpellE>mins</span>.</span></p><br />
<p>The 24 well <span class=GramE>plate</span> was removed from the<br />
incubator. Prior to transfection, old media was removed from each well and replaced<br />
with fresh media. Prior to transfection, the old media from each well was<br />
replaced with fresh media. The PEI-plasmid-<span class=SpellE>NaCl</span> mixture was the added <span class=SpellE>dropwise</span> with even distribution<br />
to cells. Cells were incubated overnight at 37&#7506;C. The following day, cells were assessed for cell health<br />
and the media replaced. After this the cells were allowed to recover for <span<br />
class=GramE>48hrs&nbsp; before</span> being <span class=SpellE>trypsinised</span>. </p><br />
<p>Cells were analysed by flow <span class=SpellE>cytometery</span> as follows:</p><br />
<p>Media was removed and the cells were washed once with PBS.<br />
Cells were then <span class=SpellE>trypsinised</span> with 0.21mM trypsin<br />
containing 4.81 <span class=SpellE>mM</span> EDTA. The trypsin was then neutralized<br />
with the addition of complete media and cells were centrifuged at 2000 rpm for<br />
3 <span class=SpellE>mins</span></p><br />
<p>Cells were then washed once in ice cold PBS containing 1% foetal<br />
bovine serum (FBS) <span class=GramE>and &nbsp;re</span>-suspended in 1% FBS containing<br />
1ug/ml <span class=SpellE>propidium</span> iodide.</p><br />
<p>Cells were analysed using <span class=SpellE>CyAn</span>™<br />
ADP flow cytometer (<span class=SpellE>DakoCytomation</span>). In order<br />
to distinguish between alive and dead cells <span class=SpellE>propidum</span> iodide was used and data was analysed using the summit v4.3 software. Cell lines<br />
were gated according to an unstained sample and lasers were adjusted<br />
accordingly. Unstained cells were used to set gates for cell size and internal<br />
complexity, dead cells were removed along with doublets.</p><br />
<p style='line-height:normal;'><b><span style='font-size:10.0pt;<br />
font-family:Arial;color:red;<br />
'>RESULTS:</span></b></p><br />
<p style='line-height:normal'><span style='font-size:10.0pt;font-family:Arial;"Times New Roman";color:black;'>Results of the transfection using the PEI and plasmid concentrations was<br />
as follows:</span></p><br />
<p style='line-height:normal'><b><span lang=EN-US<br />
style='font-size:10.0pt;font-family:Arial;<br />
color:black;'><img width=384 height=227<br />
src="https://static.igem.org/mediawiki/2012/6/6f/Modelling_002.png" v:shapes="Picture_x0020_3"></span></b></p><br />
<p>6 µl of PEI with 1.46 µg of plasmid gave the highest level of<br />
transfection. 43% of cells were transfected. This is highly favourable in<br />
comparison to other transfection reagents. Increasing the DNA concentration did<br />
not improve transfection. </p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b1/Transfection_wmin.png" alt="transfections" title="transfections" width="800" height="479" /><br />
<br />
<p><span lang=PT>References: <br />
Boussif, O et al. (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: Polyethylenimine. National Acad Science, 92 (16).<br />
<br />
Akin, A. et al. (2004). Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. The Journal of gene medicine, 7 (5). <br />
<br />
Werth, S (2006). A low molecular weight fraction of polyethylenimine (PEI) displays increased transfection efficiency of DNA and siRNA in fresh or lyophilized complexes. Journal of Controlled Release, 11 (2) 257-270. <br />
<br />
</span></a></p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ModelingTeam:Westminster/Modeling2012-09-27T02:20:18Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink active">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/7/79/Model.png" alt="Welcome" width="965" height="518" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<br />
<div id="home-main-text"><br />
<br />
<p><b>Modelling of PEI transfection</b></p><br />
<br />
<p><span style='color:red'>Introduction</span></p><br />
<p>Effective delivery of DNA to cultured mammalian cell requires that the DNA be complexed with a transfection agent. A number of commercial transfection reagents are available and are routinely used in mammalian transfection. It is crucial that each cell line or transfection condition is tested to ensure successful optimal expression. We present here, the use of PEI (polyethylenimine) for effective transfection of MCF7 cell line. Transfection has been optimised using an eGFP plasmid. <p><br />
<p><span style='color:red'>What is<br />
PEI?</span></p><br />
<p>Poly (<span class=SpellE>ethylalenimine</span>) was<br />
identified as a transfection reagent in 1995. It is a linear cationic polymer<br />
which condenses negatively charged DNA molecules to produce positively charged<br />
particles. These positively charged complexes interact with negatively charged<br />
cell surface residues and are internalised via endocytosis. </p><br />
<p><span style='color:red'>How is the DNA released in the cell?</span></p><br />
<p>Once inside the cell, the amine groups of the PEI polymer accept<br />
protons to become more positively charged. This causes an influx of counter<br />
ions resulting in osmotic swelling. Osmotic swelling leads to bursting of the<br />
vesicle, and release of the DNA-PEI complex. The PEI unpacks from the DNA in<br />
the cytoplasm allowing the DNA to diffuse to the nucleus. </p><br />
<p><span style='color:red'>Why isn’t PEI more widely used?</span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'>PEI is extremely cytotoxic. It causes disruption<br />
of the cell membrane which then leads to immediate cell death or it may disrupts<br />
the mitochondrial membrane which leads to delayed death of cells. </span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:red'><p><span style='color:red'>If PEI is toxic, why suggest its use?</span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'>The high cost of mammalian cell culture is<br />
possibly one of the restricting factors encouraging iGEM teams and other<br />
researchers from working with mammalian cells. PEI is a very cheap transfection<br />
reagent, which works! &nbsp;</span></p><br />
<p><span style='color:red'>Protocol for preparing the PEI-DNA<br />
mixture and transfection of MCF7 cells (As performed by Andrew Jenks)</span></p><br />
<p>All cell culture and transfection was<br />
carried in complete media Dulbecco’s modified eagles media (DMEM) supplemented<br />
with 10 % foetal bovine serum (FBS). No antibiotics were used, cells were<br />
transiently transfected. </p><br />
<p>Procedure </p><br />
<p>On the day prior to transfection 250000 MCF7 cells were<br />
seeded per well of a 24 well plate.</p><br />
<p>For each transfection, reagents were prepared as follows:</p><br />
<p class=MsoListParagraphCxSpFirst><span<br />
lang=EN-US style='font-family:Calibri;'>a)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Plasmid mixed with PEI.PEI volumes<br />
used were either 0 µl, 3 µl, 6 µl, 9 µl, 12 µl and 15 µl. Plasmid concentration<br />
was either at 0 µg, 0.36 µg, 0.7 µg, 1.46 µg, 2.92 µg and 5.84 µg. Combinations<br />
of the PEI and plasmid was used. </span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>b)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>100 µl (10% of growth media volume) of<br />
0.15M <span class=SpellE>NaCl</span> was added to plasmid-PEI mixture</span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>c)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Transfection reagent mixture was <span<br />
class=SpellE>vortexed</span> and incubated at room temperature for 10 <span<br />
class=SpellE>mins</span>.</span></p><br />
<p>The 24 well <span class=GramE>plate</span> was removed from the<br />
incubator. Prior to transfection, old media was removed from each well and replaced<br />
with fresh media. Prior to transfection, the old media from each well was<br />
replaced with fresh media. The PEI-plasmid-<span class=SpellE>NaCl</span> mixture was the added <span class=SpellE>dropwise</span> with even distribution<br />
to cells. Cells were incubated overnight at 37&#7506;C. The following day, cells were assessed for cell health<br />
and the media replaced. After this the cells were allowed to recover for <span<br />
class=GramE>48hrs&nbsp; before</span> being <span class=SpellE>trypsinised</span>. </p><br />
<p>Cells were analysed by flow <span class=SpellE>cytometery</span> as follows:</p><br />
<p>Media was removed and the cells were washed once with PBS.<br />
Cells were then <span class=SpellE>trypsinised</span> with 0.21mM trypsin<br />
containing 4.81 <span class=SpellE>mM</span> EDTA. The trypsin was then neutralized<br />
with the addition of complete media and cells were centrifuged at 2000 rpm for<br />
3 <span class=SpellE>mins</span></p><br />
<p>Cells were then washed once in ice cold PBS containing 1% foetal<br />
bovine serum (FBS) <span class=GramE>and &nbsp;re</span>-suspended in 1% FBS containing<br />
1ug/ml <span class=SpellE>propidium</span> iodide.</p><br />
<p>Cells were analysed using <span class=SpellE>CyAn</span>™<br />
ADP flow cytometer (<span class=SpellE>DakoCytomation</span>). In order<br />
to distinguish between alive and dead cells <span class=SpellE>propidum</span> iodide was used and data was analysed using the summit v4.3 software. Cell lines<br />
were gated according to an unstained sample and lasers were adjusted<br />
accordingly. Unstained cells were used to set gates for cell size and internal<br />
complexity, dead cells were removed along with doublets.</p><br />
<p style='line-height:normal;'><b><span style='font-size:10.0pt;<br />
font-family:Arial;color:red;<br />
'>RESULTS:</span></b></p><br />
<p style='line-height:normal'><span style='font-size:10.0pt;font-family:Arial;"Times New Roman";color:black;'>Results of the transfection using the PEI and plasmid concentrations was<br />
as follows:</span></p><br />
<p style='line-height:normal'><b><span lang=EN-US<br />
style='font-size:10.0pt;font-family:Arial;<br />
color:black;'><img width=384 height=227<br />
src="https://static.igem.org/mediawiki/2012/6/6f/Modelling_002.png" v:shapes="Picture_x0020_3"></span></b></p><br />
<p>6 µl of PEI with 1.46 µg of plasmid gave the highest level of<br />
transfection. 43% of cells were transfected. This is highly favourable in<br />
comparison to other transfection reagents. Increasing the DNA concentration did<br />
not improve transfection. </p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b1/Transfection_wmin.png" alt="transfections" title="transfections" width="800" height="479" /><br />
<br />
<p><span lang=PT>References: <br />
Boussif, O et al. (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: Polyethylenimine. National Acad Science, 92 (16).<br />
Akin, A. et al. (2004). Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. The Journal of gene medicine, 7 (5). <br />
Werth, S (2006). A low molecular weight fraction of polyethylenimine (PEI) displays increased transfection efficiency of DNA and siRNA in fresh or lyophilized complexes. Journal of Controlled Release, 11 (2) 257-270. <br />
</span></a></p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ModelingTeam:Westminster/Modeling2012-09-27T02:16:48Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink active">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/7/79/Model.png" alt="Welcome" width="965" height="518" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<br />
<div id="home-main-text"><br />
<br />
<p><b>Modelling of PEI transfection</b></p><br />
<br />
<p><span style='color:red'>Introduction</span></p><br />
<p>Effective delivery of DNA to cultured mammalian cell requires that the DNA be complexed with a transfection agent. A number of commercial transfection reagents are available and are routinely used in mammalian transfection. It is crucial that each cell line or transfection condition is tested to ensure successful optimal expression. We present here, the use of PEI (polyethylenimine) for effective transfection of MCF7 cell line. Transfection has been optimised using an eGFP plasmid. <p><br />
<p><span style='color:red'>What is<br />
PEI?</span></p><br />
<p>Poly (<span class=SpellE>ethylalenimine</span>) was<br />
identified as a transfection reagent in 1995. It is a linear cationic polymer<br />
which condenses negatively charged DNA molecules to produce positively charged<br />
particles. These positively charged complexes interact with negatively charged<br />
cell surface residues and are internalised via endocytosis. </p><br />
<p><span style='color:red'>How is the DNA released in the cell?</span></p><br />
<p>Once inside the cell, the amine groups of the PEI polymer accept<br />
protons to become more positively charged. This causes an influx of counter<br />
ions resulting in osmotic swelling. Osmotic swelling leads to bursting of the<br />
vesicle, and release of the DNA-PEI complex. The PEI unpacks from the DNA in<br />
the cytoplasm allowing the DNA to diffuse to the nucleus. </p><br />
<p><span style='color:red'>Why isn’t PEI more widely used?</span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'>PEI is extremely cytotoxic. It causes disruption<br />
of the cell membrane which then leads to immediate cell death or it may disrupts<br />
the mitochondrial membrane which leads to delayed death of cells. </span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:red'>If it is toxic to cells, why suggest its use?</span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'>The high cost of mammalian cell culture is<br />
possibly one of the restricting factors encouraging iGEM teams and other<br />
researchers from working with mammalian cells. PEI is a very cheap transfection<br />
reagent, which works! &nbsp;</span></p><br />
<p><span style='color:red'>Protocol for preparing the PEI-DNA<br />
mixture and transfection of MCF7 cells (As performed by Andrew Jenks)</span></p><br />
<p>All cell culture and transfection was<br />
carried in complete media Dulbecco’s modified eagles media (DMEM) supplemented<br />
with 10 % foetal bovine serum (FBS). No antibiotics were used, cells were<br />
transiently transfected. </p><br />
<p>Procedure </p><br />
<p>On the day prior to transfection 250000 MCF7 cells were<br />
seeded per well of a 24 well plate.</p><br />
<p>For each transfection, reagents were prepared as follows:</p><br />
<p class=MsoListParagraphCxSpFirst><span<br />
lang=EN-US style='font-family:Calibri;'>a)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Plasmid mixed with PEI.PEI volumes<br />
used were either 0 µl, 3 µl, 6 µl, 9 µl, 12 µl and 15 µl. Plasmid concentration<br />
was either at 0 µg, 0.36 µg, 0.7 µg, 1.46 µg, 2.92 µg and 5.84 µg. Combinations<br />
of the PEI and plasmid was used. </span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>b)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>100 µl (10% of growth media volume) of<br />
0.15M <span class=SpellE>NaCl</span> was added to plasmid-PEI mixture</span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>c)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Transfection reagent mixture was <span<br />
class=SpellE>vortexed</span> and incubated at room temperature for 10 <span<br />
class=SpellE>mins</span>.</span></p><br />
<p>The 24 well <span class=GramE>plate</span> was removed from the<br />
incubator. Prior to transfection, old media was removed from each well and replaced<br />
with fresh media. Prior to transfection, the old media from each well was<br />
replaced with fresh media. The PEI-plasmid-<span class=SpellE>NaCl</span> mixture was the added <span class=SpellE>dropwise</span> with even distribution<br />
to cells. Cells were incubated overnight at 37&#7506;C. The following day, cells were assessed for cell health<br />
and the media replaced. After this the cells were allowed to recover for <span<br />
class=GramE>48hrs&nbsp; before</span> being <span class=SpellE>trypsinised</span>. </p><br />
<p>Cells were analysed by flow <span class=SpellE>cytometery</span> as follows:</p><br />
<p>Media was removed and the cells were washed once with PBS.<br />
Cells were then <span class=SpellE>trypsinised</span> with 0.21mM trypsin<br />
containing 4.81 <span class=SpellE>mM</span> EDTA. The trypsin was then neutralized<br />
with the addition of complete media and cells were centrifuged at 2000 rpm for<br />
3 <span class=SpellE>mins</span></p><br />
<p>Cells were then washed once in ice cold PBS containing 1% foetal<br />
bovine serum (FBS) <span class=GramE>and &nbsp;re</span>-suspended in 1% FBS containing<br />
1ug/ml <span class=SpellE>propidium</span> iodide.</p><br />
<p>Cells were analysed using <span class=SpellE>CyAn</span>™<br />
ADP flow cytometer (<span class=SpellE>DakoCytomation</span>). In order<br />
to distinguish between alive and dead cells <span class=SpellE>propidum</span> iodide was used and data was analysed using the summit v4.3 software. Cell lines<br />
were gated according to an unstained sample and lasers were adjusted<br />
accordingly. Unstained cells were used to set gates for cell size and internal<br />
complexity, dead cells were removed along with doublets.</p><br />
<p style='line-height:normal;'><b><span style='font-size:10.0pt;<br />
font-family:Arial;color:red;<br />
'>RESULTS:</span></b></p><br />
<p style='line-height:normal'><span style='font-size:10.0pt;font-family:Arial;"Times New Roman";color:black;'>Results of the transfection using the PEI and plasmid concentrations was<br />
as follows:</span></p><br />
<p style='line-height:normal'><b><span lang=EN-US<br />
style='font-size:10.0pt;font-family:Arial;<br />
color:black;'><img width=384 height=227<br />
src="https://static.igem.org/mediawiki/2012/6/6f/Modelling_002.png" v:shapes="Picture_x0020_3"></span></b></p><br />
<p>6 µl of PEI with 1.46 µg of plasmid gave the highest level of<br />
transfection. 43% of cells were transfected. This is highly favourable in<br />
comparison to other transfection reagents. Increasing the DNA concentration did<br />
not improve transfection. </p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b1/Transfection_wmin.png" alt="transfections" title="transfections" width="800" height="479" /><br />
<br />
<p><span lang=PT>References: <br />
Boussif, O et al. (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: Polyethylenimine. National Acad Science, 92 (16).<br />
Akin, A. et al. (2004). Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. The Journal of gene medicine, 7 (5). <br />
Werth, S (2006). A low molecular weight fraction of polyethylenimine (PEI) displays increased transfection efficiency of DNA and siRNA in fresh or lyophilized complexes. Journal of Controlled Release, 11 (2) 257-270. <br />
</span></a></p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ModelingTeam:Westminster/Modeling2012-09-27T01:49:57Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink active">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/7/79/Model.png" alt="Welcome" width="965" height="518" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<br />
<div id="home-main-text"><br />
<br />
<p><b>Modelling of PEI transfection</b></p><br />
<p><span style='color:red'>What is<br />
PEI?</span></p><br />
<p>Poly (<span class=SpellE>ethylalenimine</span>) was<br />
identified as a transfection reagent in 1995. It is a linear cationic polymer<br />
which condenses negatively charged DNA molecules to produce positively charged<br />
particles. These positively charged complexes interact with negatively charged<br />
cell surface residues and are internalised via endocytosis. </p><br />
<p><span style='color:red'>How is the DNA released in the cell?</span></p><br />
<p>Once inside the cell, the amine groups of the PEI polymer accept<br />
protons to become more positively charged. This causes an influx of counter<br />
ions resulting in osmotic swelling. Osmotic swelling leads to bursting of the<br />
vesicle, and release of the DNA-PEI complex. The PEI unpacks from the DNA in<br />
the cytoplasm allowing the DNA to diffuse to the nucleus. </p><br />
<p><span style='color:red'>Why isn’t PEI more widely used?</span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'>PEI is extremely cytotoxic. It causes disruption<br />
of the cell membrane which then leads to immediate cell death or it may disrupts<br />
the mitochondrial membrane which leads to delayed death of cells. </span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:red'>If it is toxic to cells, why suggest <span<br />
class=GramE>it’s</span> use?</span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'>The high cost of mammalian cell culture is<br />
possibly one of the restricting factors encouraging iGEM teams and other<br />
researchers from working with mammalian cells. PEI is a very cheap transfection<br />
reagent, which works! &nbsp;</span></p><br />
<p><span style='color:red'>Protocol for preparing the PEI-DNA<br />
mixture and transfection of MCF7 cells (As performed by Andrew Jenks)</span></p><br />
<p>All cell culture and transfection was<br />
carried in complete media Dulbecco’s modified eagles media (DMEM) supplemented<br />
with 10 % foetal bovine serum (FBS). No antibiotics were used, cells were<br />
transiently transfected. </p><br />
<p>Procedure </p><br />
<p>On the day prior to transfection 250000 MCF7 cells were<br />
seeded per well of a 24 well plate.</p><br />
<p>For each transfection, reagents were prepared as follows:</p><br />
<p class=MsoListParagraphCxSpFirst><span<br />
lang=EN-US style='font-family:Calibri;'>a)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Plasmid mixed with PEI.PEI volumes<br />
used were either 0 µl, 3 µl, 6 µl, 9 µl, 12 µl and 15 µl. Plasmid concentration<br />
was either at 0 µg, 0.36 µg, 0.7 µg, 1.46 µg, 2.92 µg and 5.84 µg. Combinations<br />
of the PEI and plasmid was used. </span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>b)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>100 µl (10% of growth media volume) of<br />
0.15M <span class=SpellE>NaCl</span> was added to plasmid-PEI mixture</span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>c)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Transfection reagent mixture was <span<br />
class=SpellE>vortexed</span> and incubated at room temperature for 10 <span<br />
class=SpellE>mins</span>.</span></p><br />
<p>The 24 well <span class=GramE>plate</span> was removed from the<br />
incubator. Prior to transfection, old media was removed from each well and replaced<br />
with fresh media. Prior to transfection, the old media from each well was<br />
replaced with fresh media. The PEI-plasmid-<span class=SpellE>NaCl</span> mixture was the added <span class=SpellE>dropwise</span> with even distribution<br />
to cells. Cells were incubated overnight at 37&#7506;C. The following day, cells were assessed for cell health<br />
and the media replaced. After this the cells were allowed to recover for <span<br />
class=GramE>48hrs&nbsp; before</span> being <span class=SpellE>trypsinised</span>. </p><br />
<p>Cells were analysed by flow <span class=SpellE>cytometery</span> as follows:</p><br />
<p>Media was removed and the cells were washed once with PBS.<br />
Cells were then <span class=SpellE>trypsinised</span> with 0.21mM trypsin<br />
containing 4.81 <span class=SpellE>mM</span> EDTA. The trypsin was then neutralized<br />
with the addition of complete media and cells were centrifuged at 2000 rpm for<br />
3 <span class=SpellE>mins</span></p><br />
<p>Cells were then washed once in ice cold PBS containing 1% foetal<br />
bovine serum (FBS) <span class=GramE>and &nbsp;re</span>-suspended in 1% FBS containing<br />
1ug/ml <span class=SpellE>propidium</span> iodide.</p><br />
<p>Cells were analysed using <span class=SpellE>CyAn</span>™<br />
ADP flow cytometer (<span class=SpellE>DakoCytomation</span>). In order<br />
to distinguish between alive and dead cells <span class=SpellE>propidum</span> iodide was used and data was analysed using the summit v4.3 software. Cell lines<br />
were gated according to an unstained sample and lasers were adjusted<br />
accordingly. Unstained cells were used to set gates for cell size and internal<br />
complexity, dead cells were removed along with doublets.</p><br />
<p style='line-height:normal;'><b><span style='font-size:10.0pt;<br />
font-family:Arial;color:red;<br />
'>RESULTS:</span></b></p><br />
<p style='line-height:normal'><span style='font-size:10.0pt;font-family:Arial;"Times New Roman";color:black;'>Results of the transfection using the PEI and plasmid concentrations was<br />
as follows:</span></p><br />
<p style='line-height:normal'><b><span lang=EN-US<br />
style='font-size:10.0pt;font-family:Arial;<br />
color:black;'><img width=384 height=227<br />
src="https://static.igem.org/mediawiki/2012/6/6f/Modelling_002.png" v:shapes="Picture_x0020_3"></span></b></p><br />
<p>6 µl of PEI with 1.46 µg of plasmid gave the highest level of<br />
transfection. 43% of cells were transfected. This is highly favourable in<br />
comparison to other transfection reagents. Increasing the DNA concentration did<br />
not improve transfection. </p><br />
<img src="https://static.igem.org/mediawiki/2012/b/b1/Transfection_wmin.png" alt="transfections" title="transfections" width="800" height="479" /><br />
<br />
<p><span lang=PT>References: <br />
Boussif, O et al. (1995) A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: Polyethylenimine. National Acad Science, 92 (16).<br />
Akin, A. et al. (2004). Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. The Journal of gene medicine, 7 (5). <br />
Werth, S (2006). A low molecular weight fraction of polyethylenimine (PEI) displays increased transfection efficiency of DNA and siRNA in fresh or lyophilized complexes. Journal of Controlled Release, 11 (2) 257-270. <br />
</span></a></p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/JudgingTeam:Westminster/Judging2012-09-27T01:00:45Z<p>Louise123: </p>
<hr />
<div><html><br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
#home-main-text ul li <br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2012/4/43/Tickmark.png');<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink active">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<!--div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4d/Westminster_team.png" alt="Welcome" title="Welcome to our home!" /><br />
</div--><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>Which requirements have we met?</h1><p> <br />
<h2>Requirements for a Bronze Medal:</h2><br />
<ul><br />
<li> Register the team.</li><br />
<li>Successfully complete and submit this iGEM 2012 Judging form.</li><br />
<li>Create and share a Description of the team's project using the iGEM wiki and the team's parts using the Registry of Standard Biological Parts.</li><br />
<li>Plan to present a Poster and Talk at the iGEM Jamboree.</li><br />
<li>Enter information detailing at least one new standard BioBrick Part or Device in the Registry of Standard Biological Parts. Including:<br />
<ul><br />
<li>Primary nucleaic acid sequence.</li><br />
<li>Description of function.</li><br />
<li>Authorship.</li><br />
<li>Safety notes, if relevant.</li><br />
<li>Acknowedgment of sources and references.<br /><br />
</li><br />
</ul><br />
</li><br />
<li>Submit DNA for at least one new BioBrick Part or Device to the Registry.<br /><br />
</p><br />
<br /><br />
</li><br />
</ul><br />
<br />
<h2>Requirements for a Silver Medal:</h2><br />
<ul><br />
Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device.</li><br />
Enter this information and other documentation on both the iGEM 2012 wiki and the Registry.</li><br />
<br />
</ul><br />
<br />
<h2>Additional Requirements for a Gold Medal (one OR more):</h2><br />
<ul><br />
Develop and document a new technical standard that supports the: (check all that apply)<br />
<ul><br />
Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as <br /><br />
safety, security, ethics, or ownership, sharing, and innovation.<br /><br />
</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/JudgingTeam:Westminster/Judging2012-09-27T00:59:43Z<p>Louise123: </p>
<hr />
<div><html><br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
#home-main-text ul li <br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2012/4/43/Tickmark.png');<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink active">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<!--div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4d/Westminster_team.png" alt="Welcome" title="Welcome to our home!" /><br />
</div--><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>Which requirements have we met?</h1><p> <br />
<h2>Requirements for a Bronze Medal:</h2><br />
<ul><br />
<li> Register the team.</li><br />
<li>Successfully complete and submit this iGEM 2012 Judging form.</li><br />
<li>Create and share a Description of the team's project using the iGEM wiki and the team's parts using the Registry of Standard Biological Parts.</li><br />
<li>Plan to present a Poster and Talk at the iGEM Jamboree.</li><br />
<li>Enter information detailing at least one new standard BioBrick Part or Device in the Registry of Standard Biological Parts. Including:<br />
<ul><br />
<li>Primary nucleaic acid sequence.</li><br />
<li>Description of function.</li><br />
<li>Authorship.</li><br />
<li>Safety notes, if relevant.</li><br />
<li>Acknowedgment of sources and references.<br /><br />
</li><br />
</ul><br />
</li><br />
<li>Submit DNA for at least one new BioBrick Part or Device to the Registry.<br /><br />
</p><br />
<br /><br />
</li><br />
</ul><br />
<br />
<h2>Requirements for a Silver Medal:</h2><br />
<ul><br />
Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device.</li><br />
<li>Enter this information and other documentation on both the iGEM 2012 wiki and the Registry.</li><br />
<br />
</ul><br />
<br />
<h2>Additional Requirements for a Gold Medal (one OR more):</h2><br />
<ul><br />
<li>Develop and document a new technical standard that supports the: (check all that apply)<br />
<ul><br />
<li>Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as <br /><br />
safety, security, ethics, or ownership, sharing, and innovation.<br /><br />
</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T00:52:57Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1</b></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we had in the lab we were<br />
able to amplify the promoter regions which we had designed and sent them to<br />
iGEM registry. The parts are currently being sequenced and the sequencing<br />
information will be added to the registry of parts. Lab work may continue after<br />
wiki freeze as it would be good to test the plug-n-play assembly. </p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T00:50:56Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1</b></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>TUESDAY</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>WEDNESDAY</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we had in the lab we were<br />
able to amplify the promoter regions which we had designed and sent them to<br />
iGEM registry. The parts are currently being sequenced and the sequencing<br />
information will be added to the registry of parts. Lab work may continue after<br />
wiki freeze as it would be good to test the plug-n-play assembly. </p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T00:48:11Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1</b></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='background:red;'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>TUESDAY</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>WEDNESDAY</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we had in the lab we were<br />
able to amplify the promoter regions which we had designed and sent them to<br />
iGEM registry. The parts are currently being sequenced and the sequencing<br />
information will be added to the registry of parts. Lab work may continue after<br />
wiki freeze as it would be good to test the plug-n-play assembly. </p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T00:45:43Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1</b></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='background:red;<br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='background:red;'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span> </p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>TUESDAY</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>WEDNESDAY</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we had in the lab we were<br />
able to amplify the promoter regions which we had designed and sent them to<br />
iGEM registry. The parts are currently being sequenced and the sequencing<br />
information will be added to the registry of parts. Lab work may continue after<br />
wiki freeze as it would be good to test the plug-n-play assembly. </p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T00:44:24Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1</b></p><br />
<p><span style='background:red;<br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='background:red;'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span> </p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>TUESDAY</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>WEDNESDAY</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we had in the lab we were<br />
able to amplify the promoter regions which we had designed and sent them to<br />
iGEM registry. The parts are currently being sequenced and the sequencing<br />
information will be added to the registry of parts. Lab work may continue after<br />
wiki freeze as it would be good to test the plug-n-play assembly. </p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T00:41:24Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1</b></p><br />
<p><span style='background:red;<br />
<p><span style='color:red'>Wednesday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='background:red;'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>TUESDAY</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>WEDNESDAY</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we had in the lab we were<br />
able to amplify the promoter regions which we had designed and sent them to<br />
iGEM registry. The parts are currently being sequenced and the sequencing<br />
information will be added to the registry of parts. Lab work may continue after<br />
wiki freeze as it would be good to test the plug-n-play assembly. </p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T00:39:39Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1</b></p><br />
<p><span style='background:red;<br />
<p><span style='color:red'>Monday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='background:red;'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
<p><span style='color:red'>Friday</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>TUESDAY</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>WEDNESDAY</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we had in the lab we were<br />
able to amplify the promoter regions which we had designed and sent them to<br />
iGEM registry. The parts are currently being sequenced and the sequencing<br />
information will be added to the registry of parts. Lab work may continue after<br />
wiki freeze as it would be good to test the plug-n-play assembly. </p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ResultsTeam:Westminster/Results2012-09-27T00:38:10Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink active">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink active">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/0/02/Lab2.png" alt="Welcome" width="965" height="550" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>WIKI Notebook & Results</h1><br />
<br />
<p><b>WETLAB WEEK 1</b></p><br />
<p><span style='background:red;<br />
<p><span style='color:red'>Monday</span></p><br />
<p><span style='color:red'>AIM:</span> The primers for<br />
amplification of the ALDH promoter sequences have arrived. These primers have<br />
the <span class=SpellE>Biobrick</span> overhangs. Primers were diluted to 100mM<br />
and working concentrations of primers was made up at 10mM. The first set of<br />
primers to amplify the four ALDH isoforms was set up. </p><br />
<p>PCR was set up using <span class=SpellE>Pfu</span> polymerase. Template used was whole cells (mammalian). Cells were thawed, spun<br />
down and the supernatant removed and re-suspended in 50uL DMSO. We attempted to<br />
amplify the following promoter sequences: ALDH1A1, ALDH2, ALDH1A3, ALDH3A1 (1)<br />
and <span class=GramE>ALDH3A1(</span>2). </p><br />
<p>The cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
30 cycles with 98<sup>0</sup>C for 10 seconds, 54<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 30 seconds. Final extension was at 72<sup>0</sup>C<br />
for 10 minutes and then PCR was held at 4<sup>0</sup>C. </p><br />
<p><span style='color:red'>RESULTS: </span>No bands were seen<br />
on the gel. </p><br />
<p><span style='color:red'>ANALYSIS: </span>It is possible that<br />
the DNA template (addition of whole cells) did not become available in the<br />
reaction. Other cellular components during <span class=SpellE>lysis</span> of<br />
the cells may also have had an impact on the efficiency of the PCR reaction. We<br />
have located a protocol for crude extraction of mammalian DNA and will repeat<br />
the PCR using extracted DNA. </p><br />
<p>The extraction protocol was performed. (<span class=GramE>see</span> protocols) Sample 1 was used as DNA template in the next PCR reaction. </p><br />
<p><span class=SpellE>Nanodrop</span> readings were as follows:</p><br />
<p>Sample 1: 42.1ng/<span style='font-family:"Times New Roman"'>µ</span>L<br />
with purity ration 260/280 = 1.47</p><br />
<p>Sample 2: 50.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.30</p><br />
<p>Sample 3: 46.4ng/<span style='font-family:"Times New Roman"'> µ</span>L with purity ration 260/280 = 1.28</p><br />
<p><span style='background:red;'>Thursday</span></p><br />
<p><span style='color:red'>AIM:</span> Amplification of ALDH<br />
promoters. A PCR reaction was carried out as before with the same reaction mix<br />
and PCR conditions as Wednesday. <span class=GramE>amplify</span> ALDH1A1 and<br />
ALDH2. </p><br />
<p><span style='color:red'>RESULTS: </span><span<br />
style='color:black;'>Amplification of ALDH1A1 was<br />
successful using the ALDH1A1-Fw and ALDH-<span class=SpellE>Rv</span> primers.<br />
The band size was as expected. ALDH 2 was also amplified using ALDH2-Fw and<br />
ALDH2-Rv primers.&nbsp; </span></p><br />
<p><span lang=EN-US><img width=362 height=197<br />
src="https://static.igem.org/mediawiki/2012/e/ee/Result_002.png" ></span></p><br />
<p><span style='color:red'>ANALYSIS: </span><span<br />
style='color:black;'>We are pleased with developments thus<br />
far. Difficulties in amplification of ALDH3A1 using our the <span class=GramE>ALDH3A1(</span>1)<br />
and ALDH3A1(2) primers was anticipated. Initial analysis in selecting an<br />
ALDH3A1 promoter region revealed a number of different options. Additionally,<br />
it was difficult to find commercial sequences which matched the gene sequence<br />
identified in NCBI. Subsequent to ordering the primers, the Eukaryotic Promoter<br />
Database was discovered. Primers for the EPD experimentally designed ALDH3A1<br />
promoter have been ordered and will be tested when they arrive.&nbsp; ALDH1A1 was initially designed to be<br />
quite large and also includes an illegal site. An experimentally tested ALDH1A1<br />
promoter has been identified on EPD. There is significant overlap between this<br />
EPD promoter sequence and the one we had designed. A new forward EPD designed<br />
primer was ordered which would give a smaller promoter and also eliminate the<br />
illegal site. </span></p><br />
<p><span style='color:black;<br />
background:red;'>FRIDAY</span></p><br />
<p><span style='color:red'>&nbsp;</span>We have decided to try a touchdown<br />
PCR reaction in order to try to amplify the other parts, particularly ALDH1A1.<br />
Touchdown PCR is a faster but a more crude method of amplification in<br />
comparison to gradient PCR. After setting up the first PCR, we realised we had<br />
made a mistake (Touchdown 1). A second touchdown (Touchdown 2) was set up and<br />
run soon after with the corrections. We managed to get bands for all four<br />
promotes. These were cut from the gel, gel extracted, cut with EP (and ES for<br />
ALDH2), ligated and transformed into competent E coli. </p><br />
<p>Touchdown 1 cycle conditions were as follows:</p><br />
<p>Initial denaturation at 98<sup>0</sup>C for 30 seconds then<br />
10 cycles with 98<sup>0</sup>C for 10 seconds, 62<sup>0</sup>C for 30 seconds<br />
(annealing) and 72<sup>0</sup>C for 1 minute 10 seconds, and annealing<br />
temperature decreasing by 1<sup>0</sup>C for each cycle. Second amplification<br />
cycle was 20 cycles of 98<sup>0</sup>C for 30 seconds, 52<sup>0</sup>C for 10<br />
seconds (annealing) and 72<sup>0</sup>C for 1 minute 10 seconds. Final<br />
extension was at 72<sup>0</sup>C for 10 minutes and then PCR was held at 4<sup>0</sup>C.<br />
NOTE: In the second cycle (20 cycles) denaturation time at 98<sup>0</sup>C<br />
should have been 10 seconds and annealing time should have been 30 seconds.<br />
This correction was included in Touchdown 2. Additionally, DNA template<br />
concentration was increased in Touchdown 2, by increasing the volume from 1<span<br />
style='font-family:"Times New Roman"'>µ</span>L per reaction to 5<span<br />
style='font-family:"Times New Roman"'> µ</span>L per reaction</p><br />
<p><span style='color:red'>RESULTS: </span>Spurious bands were<br />
obtained in the touchdown 1, but ALDH1A1 and ALDH2 were amplified.&nbsp; Touchdown 2 gave good results for ALDH2.<br />
For ALDH 1A3 and number of bands were seen. A faint band was observed at the<br />
expected size and this is the band which was cut from the gel. ALDH1A1 from gel<br />
1, ALDH2 from gel 2 and ALDH3A1 from gel 2 were also cut from the gel and gel<br />
purified. Extracted DNA was run on a gel to verify the gel extraction process. &nbsp;Gel extracted DNA was digested with EP<br />
and ALDH2 was restricted with ES. The backbone was restricted with EP and ES <span<br />
class=SpellE>aswell</span>. Restriction digests were saved till the next day. </p><br />
<p>GEL 1-Touchdown 1</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/6/62/Result_004.png"/></span></p><br />
<p>Gel 2-Touchdown 2</p><br />
<p><span lang=EN-US><img width=453 height=237<br />
src="https://static.igem.org/mediawiki/2012/c/c0/Result_006.png" v:shapes="Picture_x0020_2"></span></p><br />
<p><b>WEEK 2</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The linker primers and the EPD primers have arrived today. &nbsp;Touchdown PCR to amplify the promoter<br />
parts was set up. The touchdown PCR was as before. The forward <span<br />
class=GramE>ALDH1A1(</span>EPD) primer was paired with the reverse primer<br />
ALDH1A1-RV. The EPD designed primers for ALDH3A1 were tested. </p><br />
<p><span lang=EN-US><img width=400 height=224<br />
src="https://static.igem.org/mediawiki/2012/7/74/Result_008.png" /></span></p><br />
<p><span style='color:red'>RESULTS: </span>It worked a dream!<br />
We have got lovely bands for <span class=GramE>ALDH1A1(</span>EPD), ALDH2 and<br />
ALDH3A1 (EPD). However the band observed for ALDH1A3 was almost twice the<br />
expected size. The size expected was around 900bp and the size seen on the gel<br />
is around 1500bp. Parts cut from the gel were ALDH1A1 (EPD), ALDH3A1 (EPD) and<br />
ALDH2 (<span class=SpellE>Wmin</span>). DNA was gel extracted and purified. DNA<br />
was then run on a gel to verify the extraction process. An overnight digestion<br />
was set up to create the <span class=SpellE>Biobrick</span> overhang parts. Only<br />
the ALDH1A3 digest from previously was kept. The other digests were discarded<br />
at this point. </p><br />
<p><span style='color:red'>Tuesday</span></p><br />
<p>Today the restricted parts were cloned to the pSB1C3<br />
backbone and transformed to <i>E. coli. &nbsp;</i>Parts cloned were the ALDH1A1 (EPD),<br />
ALDH2, ALDH1A3 and ALDH3A1. Transformed <i>E.<br />
coli </i>was plated to chloramphenicol plates which were incubated overnight at<br />
37<sup>0</sup>C. &nbsp;More plated and<br />
broth were made up ready for use. The parts required from DTU Denmark and Serrano<br />
are being arranged for delivery to us. </p><br />
<p>The following promoter parts have been mad ready. </p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span lang=EN-US><img width=350 height=219<br />
src="https://static.igem.org/mediawiki/2012/a/a8/Result_010.png" v:shapes="Picture_x0020_6"></span></p><br />
<p><span style='color:red'>Wednesday</span></p><br />
<p>The linker primers were hydrated ready for use. We are still<br />
waiting for the parts from DTU and Serrano. There have been a number of issues<br />
with delivery but we are hoping to have them sorted and the parts delivered by<br />
Friday. Colony PCR was done to confirm the inserts ligated yesterday. </p><br />
<p><span lang=EN-US><img width=329 height=343<br />
src="https://static.igem.org/mediawiki/2012/5/52/Result_012.png" v:shapes="Picture_x0020_1"></span></p><br />
<p><span style='color:red'>RESULTS: </span>Only some of the <span<br />
class=GramE>colony PCR have</span> worked. This may be due to suboptimal primer<br />
annealing temperatures. Colony PCR was carried out as 10µL volumes an annealing<br />
temperature was 58<sup>0</sup>C using the <span class=SpellE>Pfu</span> polymerase. All colonies were inoculated to LB broth and grown overnight at 37<sup>0</sup>C<br />
in a shaking incubator. </p><br />
<p><span style='color:red'>Thursday</span></p><br />
<p>Two samples of each of the LB cultures were selected and<br />
plasmid extracted using the <span class=SpellE>QIAprep</span> kit. PCR was then<br />
done on the extracted plasmid in order to confirm DNA insert. This was done as<br />
we had not managed to get good bands for <span class=GramE>all the</span> colony PCR’s. The PCR results were variable. Again, this may have been due to<br />
annealing temperatures used in PCR. The samples were analysed on the <span<br />
class=SpellE>nanodrop</span>. <span class=SpellE>Nanodrop</span> results were<br />
as follows:</p><br />
<p>But it has now been found that the concentrations we have<br />
are too low to send for sequencing and still have enough for sending to iGEM<br />
parts registry. An attempt to concentrate the samples was made by putting the<br />
samples in a spin vacuum. Disaster!!! I have mixed up the lids! Colonies were<br />
quickly re-picked and inoculated to LB for growth overnight. </p><br />
<p><span style='color:red'>Friday</span></p><br />
<p>The parts have arrived from DTU Denmark. PCR has been set up<br />
using <span class=SpellE>Pfu</span> Turbo. DNA template used was as follows:</p><br />
<p>ALDH1A1 <span style='color:red'>(BBa_K940000) </span>extracted<br />
plasmid</p><br />
<p><span class=SpellE><span class=GramE>mCherry</span></span> <span<br />
style='color:red'>(</span><span lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN style='color:black;'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>terminator </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>hygromycin </span><span<br />
lang=EN style='color:red;'>(BBa_K678049) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>ALDH2 </span><span<br />
style='color:red'>(BBa_K940000) </span><span style='color:black;'>extracted plasmid</span></p><br />
<p><span lang=EN style='color:black;'>Neomycin </span><span<br />
style='color:red'>(</span><span<br />
lang=EN style='color:red;'>BBa_K678067) </span><span lang=EN<br />
style='color:black;<br />
'>DTU</span></p><br />
<p><span lang=EN style='color:black;'>Biobrick<br />
backbone </span><span lang=EN style='color:red;'>(pSB1C3)</span><span lang=EN<br />
style='color:black;<br />
'> unrestricted </span></p><br />
<p><span style='color:red'>RESULTS: </span>Unfortunately we did<br />
not get any bands. Plasmid was visible on the gels which were run. This may<br />
indicate that the plasmid concentration was too high for the PCR reaction. Plasmid<br />
extraction was done using <span class=SpellE>QIAplasmid</span> prep kit. PCR<br />
was done on the extracted plasmid, but again the PCR was not very successful.</p><br />
<p><span lang=EN-US><img width=439 height=163<br />
src="https://static.igem.org/mediawiki/2012/f/f5/Result_014.png" v:shapes="Picture_x0020_3"></span></p><br />
<p><span style='color:red'>NEXT STEPS: </span>Plasmid template was diluted 1/1000<br />
and another PCR set up using the <span class=SpellE>Pfu</span>. <span<br />
class=SpellE>Hygromycin</span> is the only part which was amplified. Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>&nbsp;was</span></span></sup> included in the<br />
reaction mix this time. DTU had reported success when they used Mg<sup>2<span<br />
class=GramE>+ <span style='vertical-align:baseline'>.</span></span></sup> We<br />
were able to amplify <span class=SpellE>hygromycin</span>. </p><br />
<p><span lang=EN-US><img width=471 height=182<br />
src="https://static.igem.org/mediawiki/2012/6/69/Result_016.png" v:shapes="Picture_x0020_7"></span></p><br />
<p><b>WEEK 3</b></p><br />
<p><span style='color:red'>Monday</span></p><br />
<p>The plasmid previously extracted was analysed on the <span<br />
class=SpellE>nanodrop</span>. The samples were made ready for sequencing and<br />
for sending to iGEM. </p><br />
<p><span class=SpellE>Nanodrop</span> results were as follows:</p><br />
<p><span class=GramE>ALDH1A1(</span>1): 64.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.13</p><br />
<p><span class=GramE>ALDH1A1(</span>2): 348.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280<br />
=2.20</p><br />
<p><span class=GramE>ALDH2(</span>1): 59ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.08</p><br />
<p><span class=GramE>ALDH2(</span>2): 66.8ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
1.80</p><br />
<p><span class=GramE>ALDH1A3(</span>2): 166.9ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.17</p><br />
<p><span class=GramE>ADH1A3(</span>2): 44.5ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 174.2ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.20</p><br />
<p><span class=GramE>ADH1A3(</span>2): 201.4ng/<span<br />
style='font-family:"Times New Roman"'>µ</span>L with purity ration 260/280 =<br />
2.22</p><br />
<p>PCR using <span class=SpellE>Taq</span> polymerase was set<br />
up. We may be able to amplify the parts using this different polymerase.<br />
Unfortunately such products could not be used for user cloning. <span<br />
class=SpellE>Taq</span> PCR was set up according to manufacturer protocol. PCR<br />
was run overnight. </p><br />
<p><span style='color:red'>TUESDAY</span></p><br />
<p><span style='color:black;'>The overnight<br />
PCR was analysed. </span></p><br />
<p><span style='color:black;'>Promoter<br />
parts were sent for sequencing. The parts were also packaged and sent to iGEM<br />
registry. </span></p><br />
<p>ALDH1A1 &#8211; <span style='color:red'>BBa_K940000</span></p><br />
<p>ALDH2 &#8211; <span style='color:red'>BBa_K940001</span></p><br />
<p>ALDH 1A3 &#8211; <span style='color:red'>Bba_K940002</span></p><br />
<p>ALDH3A1 &#8211; <span style='color:red'>BBa_K940003</span></p><br />
<p><span style='color:red'>WEDNESDAY</span></p><br />
<p>CONCLUSION:</p><br />
<p>Unfortunately we have not been able to achieve all that we set out<br />
to do in the lab. In the two and a half weeks which we had in the lab we were<br />
able to amplify the promoter regions which we had designed and sent them to<br />
iGEM registry. The parts are currently being sequenced and the sequencing<br />
information will be added to the registry of parts. Lab work may continue after<br />
wiki freeze as it would be good to test the plug-n-play assembly. </p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/TeamTeam:Westminster/Team2012-09-27T00:22:04Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
border:none;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
height:685px;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
<br />
div#team<br />
{<br />
margin:0 auto;<br />
width:850px;<br />
padding-top:20px;<br />
}<br />
div.member <br />
{<br />
width: 400px;<br />
float:left;<br />
padding: 10px;<br />
<br />
}<br />
div.member img<br />
{<br />
float:left;<br />
padding-right:5px;<br />
<br />
<br />
}<br />
div.member img<br />
{<br />
float:left;<br />
}<br />
.clear <br />
{<br />
clear:left;<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink active">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/f/f9/Teamigem2012-3.jpg" alt="Welcome" width="900" height="650" title="Welcome to our home!" /><br />
</div><!-- #home-main-image --><br />
<br />
<br />
<br />
<br />
<div id="team"><br />
<h1>The Team</h1><br />
<div class="member"><br />
<h2>Silvia Berciano</h2><br />
<img src="https://static.igem.org/mediawiki/2012/e/e5/Team_silvia.png" alt="Silvia" width="160" height="183" /><br />
<div>Silvia is a third year Molecular Biology & Genetics student with a background in Electronic Engineering and Industrial Design. Her hobbies include traveling, drawing, watching Game of Thrones and most recently trying to find the best ice cream in London. Her main academic fields of interest are Epigenetics, Nutrigenomics, Synthetic Biology and Bioinformatics.</div><br />
</div><br />
<br />
<div class="member"><br />
<h2>Karin Ford</h2><br />
<img src="https://static.igem.org/mediawiki/2012/b/bc/Team_karin.png" alt="Karin" width="136" height="190" /><br />
<div>Karin is a third year undergraduate in Molecular Biology and Genetics. This is her second degree, the first being in modern languages. Aside from this she has a keen interest in the arts - all aspects. Karin particularly enjoys photography, theatre, and classical music. Her current academic interests lie in synthetic biology and molecular therapeutics, hence her great interest in iGEM and our present project on human cancer stem cells. </div><br />
</div><br />
<br />
<div class="member clear"><br />
<h2>Radek Kwasniak</h2><br />
<img src="https://static.igem.org/mediawiki/2012/2/29/Team_radek.jpg" alt="Radek" width="164" height="189" /><br />
<div>Radek is graduating this year with a MSc in Applied Microbiology and Biotechnology. <br />
Apart from finding a cure for cancer using synthetic biology, he enjoys <br />
travelling, reading books on evolutionary biology and martial arts.</div><br />
</div><br />
<br />
<div class="member"><br />
<h2>Moyin Odugbemi</h2><br />
<img src="https://static.igem.org/mediawiki/2012/e/ee/Team_moyin.png" width="152" height="186" /><br />
<div>Currently studying Applied Microbiology and Biotechnology, Moyin's main academic interests are Biochemical engineering and the Pseudomonas species. She has a background in pure Biochemistry. When she's not being a scientist, she likes to read, hang out in parks, people watch and write. Having personally encountered cancer, she believes strongly that this project is pivotal to developing a cure and saving millions of lives.&nbsp;</div><br />
</div><br />
<br />
<div class="member clear"><br />
<h2>Hima Puthussery</h2><br />
<img src="https://static.igem.org/mediawiki/2012/c/cd/Team_hima.png" alt="Hima" width="156" height="197"/><br />
<div>Hima is currently staring at synthetic biology with a new found enthusiasm, trying to figure out how well to play with it. Her background is a combination of Biotechnology, Chemistry and Zoology, further supplemented by applied microbiology. She loves poetry, arts and climbing- and would love to make a bacteria do all this! She really believes we all are in a large fermenter, constantly evolving, adapting and producing metabolites that we alone can define.</div><br />
</div><br />
<br />
<div class="member"><br />
<h2>Louise Usher</h2><br />
<img src="https://static.igem.org/mediawiki/2012/b/b6/Team_louise.jpg" alt="Louis" width="162" height="185" /><br />
<div>Louise is doing a MSc in Microbiology and Plant Pathology. She loves <br />
working in the LAB and have found iGEM to be great exposure to molecular biology and synthetic biology. Here hobbies include travelling, reading, flying kites and eating out.</div><br />
</div><br />
<br />
<div class="member clear"><br />
<h2>Shanmuga Priya Subramaniam</h2><br />
<img src="https://static.igem.org/mediawiki/2012/1/1c/Team_shanmuga.png" alt="Shanmuga" width="160" height="184" /></a><br />
<div>Priya has just finished her MSc. Medical Microbiology. Her main motivation to join in iGEM team was learning more microbiology and molecular biology laboratory techniques. She also thinks that the cancer project is really challenging and she is excited about its potential future applications.</div><br />
</div><br />
<br />
<div class="member"><br />
<h2>Ana Sokolovic</h2><br />
<img src="https://static.igem.org/mediawiki/2012/d/d0/Team_ana.png" alt="Ana" width="196" height="175" /></a><br />
<div >Ana is an undergraduate and is about to start her third year of her Graphic Communication Design course (BA Honours). Her hobbies include drawing, playing guitar, socialising, watching movies, reading, and gaming.&nbsp;</div><br />
</div><br />
<br />
<div class="member clear"><br />
<h2>Shreenil Odedra</h2><br />
<img src="https://static.igem.org/mediawiki/2012/3/35/Shreenil.png" alt="Shreenil" width="160" height="184" /></a><br />
<div>Shreenil is an undergraduate and is about to start his third year of his <br />
bioscience degree. He has interest in cancer biology and his hobbies include art, music, internet, social networking, short film, reading and gaming.</div><br />
</div><br />
<br />
<div class="member"><br />
<h2>Caroline Champion</h2><br />
<img src="https://static.igem.org/mediawiki/2012/4/4b/CarolineChampion.jpg" alt="Caroline" width="120" height="175" /></a><br />
<div >Caroline is a 2nd year Biological Sciences student, with a passion for Physiology and Environmental science. I joined the iGEM team to get a better understanding of molecular biology and the get hands on with the practical application of the <br />
theory the team plan to apply in brining our "Biobricks" to life.&nbsp;</div><br />
</div><br />
<br />
</div><br />
<br />
</div><!-- #the-content --><br />
<br />
<br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:WestminsterTeam:Westminster2012-09-27T00:19:24Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
height:475px;<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink active">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<!--img src="https://static.igem.org/mediawiki/2012/4/4d/Westminster_team.png" alt="Welcome" title="Welcome to our home!" /---><br />
<div style="float:left;padding-left:30px;padding-top:50px; width:380px"><br />
<h1 style="text-align:left;border:none; color:#fff; position:relative;bottom:0px; left:0px; margin:0px; padding:0px 0px 20px 0px;">Fighting cancer from the inside out</h1><br />
<div style="color:white; text-align:justify;">Cancer recurrence is one of the fears that almost every patient undergoing chemotherapy develops. Recent findings suggest that only a small fraction of the tumor cells, called Cancer Stem Cells (CSC) are able to drive the growth of the tumor. CSC also show an increased drug resistance, and could remain unaffected after chemotherapy, eventually resulting in the formation of a new tumor.<br/><br/><br />
The Westminster iGEM 2012 team aims to combat cancer recurrence by using one key feature of CSCs – increased Aldehyde Dehydrogenase (ALDH) activity. We have used the promoters of 4 different ALDH isoforms present in aggressive forms of cancer to design 3 constucts that will allow us to identify, isolate and eliminate CSC, offering a novel tool for the study of these cells and a potential new anti-cancer therapy for the future.</div><br />
<br />
<br />
</div><br />
<div style="float:left; width:500px; padding-left:50px; padding-top:150px; text-align:center"><br />
<img src="https://static.igem.org/mediawiki/2012/8/8a/Tumor.png" alt="Tumor" width="218" height="179" /><br />
</div><br />
<br />
</div><!-- #home-main-image --><br />
<br />
<br />
<br />
<div id="three-column"><br />
<br />
<div class="col"><br />
<img src="https://static.igem.org/mediawiki/igem.org/d/d7/IntegratedDNALogo.jpg" width="146" height="61"/><br />
</div><br />
<div class="col"><br />
<img src="https://static.igem.org/mediawiki/igem.org/b/b9/GeneiousLogo.jpg" width="136" height="54"/><br />
</div><br />
<div class="col"><br />
<img src="https://static.igem.org/mediawiki/igem.org/a/af/MathWorksLogo.jpg" width="202" height="40"/><br />
</div><br />
<div class="col"><br />
<img src="https://static.igem.org/mediawiki/igem.org/8/8e/AutodeskLogo.jpg" width="161" height="41"/><br />
</div><br />
<div class="col"><br />
<img src="https://static.igem.org/mediawiki/igem.org/c/c7/UniversityWestminsterLogo.jpg"/><br />
</div><br />
<br />
</div><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/PartsTeam:Westminster/Parts2012-09-26T23:24:24Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink active">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/6/6e/Submission.jpg" alt="Submission" title="Submission" /><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>Parts</h1><br />
<br />
<p>The following parts have been submitted: </p><br />
<ul><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940000">ALDH1A1 – BBa_K940000</a></li><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940001">ALDH2 – BBa_K940001</a></li><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940002">ALDH 1A3 – Bba_K940002 </a></li><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940003">ALDH3A1 – BBa_K940003</a></li><br />
</ul><br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
<br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/File:Submission.jpgFile:Submission.jpg2012-09-26T23:22:10Z<p>Louise123: </p>
<hr />
<div></div>Louise123http://2012.igem.org/Team:Westminster/PartsTeam:Westminster/Parts2012-09-26T23:18:51Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink active">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<!--div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4d/Westminster_team.png" alt="Welcome" title="Welcome to our home!" /><br />
</div--><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>Parts</h1><br />
<br />
<p>The following parts have been submitted: </p><br />
<ul><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940000">ALDH1A1 – BBa_K940000</a></li><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940001">ALDH2 – BBa_K940001</a></li><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940002">ALDH 1A3 – Bba_K940002 </a></li><br />
<li><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K940003">ALDH3A1 – BBa_K940003</a></li><br />
</ul><br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
<br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/AttributionsTeam:Westminster/Attributions2012-09-26T23:14:33Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
#home-main-text ul li <br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2012/4/43/Tickmark.png');<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink active">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<!--div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4d/Westminster_team.png" alt="Welcome" title="Welcome to our home!" /><br />
</div--><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h2>Attributions</h2><br />
<p>All work has been done by the team except contributions mentioned here. </p> <p>Many thanks to our sponsors: University of Westminster, University of Westminster Students' Union, Autodesk, Geneious, IDT and Mathworks</p><br />
<p>Andrew Duncan Jenks did the mammalian transfecion work, Myrsini Tsimon, Rhyan Puno and Eustace Fernando gave advice during the lab work. </p><br />
<br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/AttributionsTeam:Westminster/Attributions2012-09-26T23:13:50Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
#home-main-text ul li <br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2012/4/43/Tickmark.png');<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink active">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<!--div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4d/Westminster_team.png" alt="Welcome" title="Welcome to our home!" /><br />
</div--><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h2>Attributions</h2><br />
<p>All work has been done by the team except contributions mentioned here. </p> <p>Many thanks to our sponsors: University of Westminster, University of Westminster Students' Union, Autodesk, Geneious, IDT and Mathworks</p><br />
<p>Anderew Duncan Jenks did the mammalian transfecion work, Myrsini Tsimon, Rhyan Puno and Eustace Fernando gave advice during the lab work. </p><br />
<br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/JudgingTeam:Westminster/Judging2012-09-26T23:07:42Z<p>Louise123: </p>
<hr />
<div><html><br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
#home-main-text ul li <br />
{<br />
list-style-image: url('https://static.igem.org/mediawiki/2012/4/43/Tickmark.png');<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink active">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<!--div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4d/Westminster_team.png" alt="Welcome" title="Welcome to our home!" /><br />
</div--><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<h1>Which requirements have we met?</h1><p> <br />
<h2>Requirements for a Bronze Medal:</h2><br />
<ul><br />
<li> Register the team.</li><br />
<li>Successfully complete and submit this iGEM 2012 Judging form.</li><br />
<li>Create and share a Description of the team's project using the iGEM wiki and the team's parts using the Registry of Standard Biological Parts.</li><br />
<li>Plan to present a Poster and Talk at the iGEM Jamboree.</li><br />
<li>Enter information detailing at least one new standard BioBrick Part or Device in the Registry of Standard Biological Parts. Including:<br />
<ul><br />
<li>Primary nucleaic acid sequence.</li><br />
<li>Description of function.</li><br />
<li>Authorship.</li><br />
<li>Safety notes, if relevant.</li><br />
<li>Acknowedgment of sources and references.<br /><br />
</li><br />
</ul><br />
</li><br />
<li>Submit DNA for at least one new BioBrick Part or Device to the Registry.<br /><br />
</p><br />
<br /><br />
</li><br />
</ul><br />
<br />
<h2>Requirements for a Silver Medal:</h2><br />
<ul><br />
<li>Demonstrate that at least one new BioBrick Part or Device of your own design and construction works as expected; characterize the operation of your new part/device.</li><br />
<li>Enter this information and other documentation on both the iGEM 2012 wiki and the Registry.</li><br />
<br />
</ul><br />
<br />
<h2>Additional Requirements for a Gold Medal (one OR more):</h2><br />
<ul><br />
<li>Develop and document a new technical standard that supports the: (check all that apply)<br />
<ul><br />
<li>Outline and detail a new approach to an issue of Human Practice in synthetic biology as it relates to your project, such as <br /><br />
safety, security, ethics, or ownership, sharing, and innovation.<br /><br />
</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/OutreachTeam:Westminster/Outreach2012-09-26T23:07:22Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink active">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<div id="home-main-image"><br />
<iframe width="965" height="543" src="http://www.youtube.com/embed/nehmMHG7E3A" frameborder="0" allowfullscreen></iframe><br />
</div><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<br />
<h1>SURVEY</h1><br />
<p><br />
Statistical analysis was done based on the survey data that was collected to determine the acceptance of genetically modified products in various fields (environment and medical) from individuals with different knowledge of biology ranging from negligible to a more advanced level. Our survey result from approximately one hundred people demonstrates that most people including those with base level knowledge of biology were very much interested in using genetically modified organisms in various fields like food, environment and medicine. In addition to this, people were also eager to use synthetic biology in the cure of cancer since our project was mainly focused on the application of synthetic biology in cancer therapy. Although this was the first year for our university to initiate creating awareness about synthetic biology to the public, we were very surprised to know that currently in the 21st century there is decreasing number of people without some knowledge of biology. We hope to fill these gap in the near future years via iGEM<br />
</p><br />
<br />
<br />
<h1>IGEM SOCIETY </h1><br />
<p>This year (2012) was the first year for University of Westminster to actively participate in the thriving iGEM competition. We encountered many difficulties being the fresh new team, as a result we organised an iGEM society to promote synthetic biology, develop greater awareness of science education and attract more students towards future iGEM teams. The main aim of iGEM society is to promote the knowledge of synthetic biology and iGEM competition in our university. We held a stall during our Fresher’s fair through which we introduced synthetic biology to as many students as possible which attracted them to participate in iGEM society. This method of communication was most effective as even before the fresh minds get busy and commence with their academics, made unimaginable number of students to get participated in the society. To further progress, keeping our new society’s development live and active, we had consistently kept in touch with all the members with regular meetings, events and social networking. During these meetings, we discussed about different ideas for the betterment of the current iGEM team and also implemented new ideas for the future team. Furthermore, we also had a presentation of our project to the members of the society. These events actually created more attention about us in our campus which can be very beneficial for the future team. We initiated society members to form new groups among them with varied interest and ideas to research & develop one or more new ideas for forthcoming iGEM team’s project.<br />
</p><br />
<br />
<h1>FRESHERS' FAIR </h1><br />
<p><br />
During the fresher’s day of our university, we had a presentation stand through which we could introduce synthetic biology, iGEM competition and iGEM society. Survey was also performed simultaneously in order to involve thoughts of students from a diversity of background. We made our iGEM poster viewable in foyer television to attract roaming and lost students to visit our stall for more information. We also made some posters to explain synthetic biology and iGEM competition. Posters explained the basic idea and encouraged many students to join in iGEM society. We think our posters made many students more aware of synthetic biology and iGEM competition itself.<br />
</p><br />
<br />
<br />
<h1>INTERVIEW</h1><br />
<p> <br />
We spoke with Dr. Miriam Dwek, who is the head of the Against Breast Cancer Unit at the University of Westminster. She spoke about her research, what she thinks about our work and gave some advice on overselling.<br />
</p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123http://2012.igem.org/Team:Westminster/ModelingTeam:Westminster/Modeling2012-09-26T23:06:49Z<p>Louise123: </p>
<hr />
<div><html><br />
<br />
<head><br />
<br />
<meta http-equiv="content-type" content="text/php; charset=utf-8" /><br />
<br />
<style type="text/css"><br />
@import url 'http://yui.yahooapis.com/2.9.0/build/reset/reset-min.css';<br />
ul {<br />
list-style: none;<br />
}<br />
body {<br />
font-family: "HelveticaNeue-Light", "Helvetica Neue Light", "Helvetica Neue", Helvetica, Arial, "Lucida Grande", sans-serif; <br />
font-weight: 300;<br />
/* background: url("http://www.westminsterigem.com/files/theme/body-bg.png") repeat #ffffff;*/<br />
background-color:#FFF;<br />
color: #666666;<br />
<br />
}<br />
h1 {<br />
color: #ff0000;<br />
font-size: 18pt;<br />
margin-bottom: 0.5em;<br />
<br />
<br />
}<br />
p {<br />
<br />
}<br />
a {<br />
<br />
}<br />
#p-logo {<br />
background: #444444;<br />
}<br />
div#top-section,<br />
div#content {<br />
box-shadow: 0px 0px 17px -4px #666666;<br />
padding:0px;<br />
margin-top:0px;<br />
<br />
}<br />
div#wrapper {<br />
position: relative;<br />
width: 100%;<br />
font-size: 12pt;<br />
margin: 0 auto;<br />
background: #ffffff;<br />
background-attachment: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
<br />
padding:0px;<br />
margin-top:0px;<br />
top:0px;<br />
<br />
}<br />
div#header {<br />
height: 120px;<br />
width: 100%;<br />
background-color:#000;<br />
background: url('https://static.igem.org/mediawiki/2012/2/2e/Bg-tumours.png');<br />
background-repeat: no-repeat;<br />
z-index:10;<br />
position:relative;<br />
top:0px;<br />
left:0px;<br />
}<br />
div#header div#logo {<br />
position: relative;<br />
width: 260px;<br />
right:10px;<br />
top:-9px;<br />
float:right;<br />
<br />
margin-bottom: 0px;<br />
/*<br />
height: 0px;<br />
margin: 0 auto;*/<br />
}<br />
div#header div#logo a {<br />
float:left;<br />
display:block;<br />
margin-left:10px;<br />
<br />
}<br />
<br />
<br />
div#navigation {<br />
width: 850px;<br />
height: 27px;<br />
background:rgba(0,0,0,.5);<br />
float:left;<br />
position:relative;<br />
top:54px;<br />
}<br />
ul#navigation-list {<br />
height: 27px;<br />
line-height: 27px;<br />
overflow: auto;<br />
}<br />
ul#navigation-list > li {<br />
float: left;<br />
margin-top:-5px;<br />
}<br />
ul#navigation-list > li > ul {<br />
position: absolute;<br />
display: none;<br />
background: #000000;<br />
z-index: 100000;<br />
}<br />
ul#navigation-list > li > ul.submenu {<br />
margin: 0;<br />
}<br />
ul#navigation-list > li > ul.submenu li {<br />
padding: 2px 0px;<br />
}<br />
ul#navigation-list a.navlink {<br />
color: #ffffff;<br />
font-weight: normal;<br />
display: block;<br />
padding: 0px 10px;<br />
text-decoration: none;<br />
}<br />
ul#navigation-list a.navlink.active,<br />
ul#navigation-list a.navlink:hover {<br />
color: #ff0000;<br />
}<br />
div#home-main-image {<br />
text-align: center;<br />
background-color: #410000;<br />
<br />
border-bottom:1px #000 solid;<br />
}<br />
div#the-content {<br />
position:relative;<br />
top:-19px;<br />
<br />
}<br />
div#home-main-image img {<br />
/*width: 885px;<br />
height: 300px;<br />
margin-bottom: 20px;<br />
border-radius: 20px;<br />
*/<br />
}<br />
div.text-box {<br />
background: #444444;<br />
color: #ffffff;<br />
padding: 15px 20px;<br />
border-radius: 10px;<br />
<br />
}<br />
div#footer-box {<br />
border-radius: 0 0 5px 5px;<br />
}<br />
#bodyContent {<br />
}<br />
#three-column <br />
{<br />
margin:0 auto;<br />
width:850px;<br />
margin-top:50px;<br />
<br />
}<br />
<br />
.col <br />
{<br />
text-align:justify; float:left; margin:5px;<br />
}<br />
.col h1<br />
{<br />
font-size:14px;<br />
color:#000;<br />
<br />
}<br />
/* hide native rubbish*/<br />
#top-section {display:none; position:absolute; left:0px; top:-200px;}<br />
#top-section a { color:#FFF; }<br />
.firstHeading {display:none; position:absolute; left:0px; top:-200px;}<br />
.annoying-gap {<br />
padding:0px;<br />
margin:0px;<br />
line-height:0;<br />
}<br />
<br />
#contentSub, #siteSub {display:none;}<br />
<br />
#control-btn<br />
{<br />
<br />
width: 20px;<br />
height: 20px;<br />
position:absolute;<br />
top:0px;<br />
left:5px;<br />
<br />
line-height: 0px;<br />
<br />
<br />
}<br />
.btn-cog {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d4/Control-panel-sml.png') #000 no-repeat 2px 2px;<br />
}<br />
.btn-close {<br />
background: url('https://static.igem.org/mediawiki/2012/d/d0/Close-btn.png') #000 no-repeat 2px 2px;<br />
}<br />
.right-menu li a, .left-menu li a {background: none}<br />
<br />
#home-main-text {<br />
padding:20px 40px 20px 40px;<br />
text-align: justify; <br />
}<br />
.diary-date {<br />
font-weight: bold;<br />
width:100%;<br />
<br />
}<br />
</style><br />
<br />
<script type="text/javascript" src="http://code.jquery.com/jquery-1.8.2.min.js"></script><br />
<script type="text/javascript"><br />
$('document').ready(function() {<br />
<br />
// menu<br />
$('li.submenu-holder').hover(function() {<br />
$(this).children('ul.submenu').stop(true).fadeIn('fast');<br />
}, function() {<br />
$(this).children('ul.submenu').stop(true).fadeOut('fast');<br />
});<br />
<br />
// hide standard team basics<br />
$('#top-section').hide(); <br />
$('#bodyContent p:first').addClass("annoying-gap"); <br />
<br />
<br />
$('#control-btn').click( function(){<br />
<br />
if ($('#control-btn').hasClass("btn-cog"))<br />
{<br />
showTopMenu();<br />
$('#control-btn').animate({left: "-20px"});<br />
$('#control-btn').addClass("btn-close");<br />
$('#control-btn').removeClass("btn-cog");<br />
} else<br />
{<br />
hideTopMenu();<br />
$('#control-btn').animate({left: "0px"});<br />
$('#control-btn').addClass("btn-cog");<br />
$('#control-btn').removeClass("btn-close");<br />
}<br />
});<br />
<br />
});<br />
<br />
<br />
<br />
<br />
var $bar;<br />
function hideTopMenu()<br />
{<br />
$bar.slideUp('fast');<br />
<br />
}<br />
function showTopMenu()<br />
{<br />
if ($bar==null)<br />
{<br />
$bar = $("#top-section").clone();<br />
$($bar.find("#search-controls")).remove();<br />
$($bar.find("#p-logo")).remove();<br />
$("#wrapper").prepend($bar);<br />
$bar.css("position", "absolute");<br />
$bar.css("top", "0px");<br />
$bar.css("left", "0px");<br />
$bar.css("background", "none");<br />
$bar.css("background", "rgba(0,0,0,.5)");<br />
$bar.css("height", "20px");<br />
$bar.css("border", "none");<br />
$bar.css("z-index", "100");<br />
$bar.css("color", "#000");<br />
<br />
<br />
}<br />
$bar.slideDown('fast');<br />
<br />
$('#control-btn').mouseover( function(){<br />
<br />
});<br />
} <br />
</script><br />
</head><br />
<br />
<body><br />
<div id="wrapper"><br />
<br />
<div id="header"><br />
<div id="control-btn" class="btn-cog"></div><br />
<br />
<div id="navigation"><br />
<ul id="navigation-list"><br />
<li><a href="https://2012.igem.org/Team:Westminster" class="navlink">Home</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Team" class="navlink">Team</a></li><br />
<li class="submenu-holder"><br />
<a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Project</a><br />
<br />
<ul class="submenu"><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Overview"class="navlink">Overview</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Problem"class="navlink">The Problem</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Experiments"class="navlink">Experiments</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Protocols"class="navlink">Protocols</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Results"class="navlink">Results</a></li><br />
<br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Safety"class="navlink">Safety</a></li><br />
<li class="submenu-button"><a href="https://2012.igem.org/Team:Westminster/Journal"class="navlink">Journal</a></li><br />
<br />
<br />
</ul><br />
</li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Parts"class="navlink">Parts</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Modeling"class="navlink active">Modeling</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Outreach"class="navlink">Outreach</a></li><br />
<li><a href="https://2012.igem.org/Team:Westminster/Judging"class="navlink">Judging Criteria</a></li><br />
<br />
<br />
<li><a href="https://2012.igem.org/Team:Westminster/Attributions"class="navlink">Attributions</a></li><br />
</ul><!-- #navigation-list --><br />
</div><!-- #navigation --><br />
<div id="logo"><br />
<a href="http://www.igem.org" title="iGEM homepage"><img src="https://static.igem.org/mediawiki/igem.org/d/dc/Igem-small-white.png" alt="iGEM logo" width="55" height="44" /></a><br />
<a href="https://2012.igem.org/Team:Westminster"><br />
<img src="https://static.igem.org/mediawiki/2012/a/ae/Logo-white.png" alt="iSTEM - intelligent synthetic tumour eliminating machine" width="172" height="66" title="iSTEM - intelligent synthetic tumour eliminating machine" /><br />
</a><br />
</div><!-- #logo --><br />
</div><!-- #header --><br />
<br />
<div id="the-content"><br />
<!--div id="home-main-image"><br />
<img src="https://static.igem.org/mediawiki/2012/4/4d/Westminster_team.png" alt="Welcome" title="Welcome to our home!" /><br />
</div--><!-- #home-main-image --><br />
<br />
<div id="home-main-text"><br />
<br />
<p><b>Modelling of PEI transfection</b></p><br />
<p><span style='color:red'>What is<br />
PEI?</span></p><br />
<p>Poly (<span class=SpellE>ethylalenimine</span>) was<br />
identified as a transfection reagent in 1995. It is a linear cationic polymer<br />
which condenses negatively charged DNA molecules to produce positively charged<br />
particles. These positively charged complexes interact with negatively charged<br />
cell surface residues and are internalised via endocytosis. </p><br />
<p><span style='color:red'>How is the DNA released in the cell?</span></p><br />
<p>Once inside the cell, the amine groups of the PEI polymer accept<br />
protons to become more positively charged. This causes an influx of counter<br />
ions resulting in osmotic swelling. Osmotic swelling leads to bursting of the<br />
vesicle, and release of the DNA-PEI complex. The PEI unpacks from the DNA in<br />
the cytoplasm allowing the DNA to diffuse to the nucleus. </p><br />
<p><span style='color:red'>Why isn’t PEI more widely used?</span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'>PEI is extremely cytotoxic. It causes disruption<br />
of the cell membrane which then leads to immediate cell death or it may disrupts<br />
the mitochondrial membrane which leads to delayed death of cells. </span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:red'>If it is toxic to cells, why suggest <span<br />
class=GramE>it’s</span> use?</span></p><br />
<p style='line-height:14.4pt;background:white'><span style='font-size:10.0pt;<br />
font-family:Arial;color:black'>The high cost of mammalian cell culture is<br />
possibly one of the restricting factors encouraging iGEM teams and other<br />
researchers from working with mammalian cells. PEI is a very cheap transfection<br />
reagent, which works! &nbsp;</span></p><br />
<p><span style='color:red'>Protocol for preparing the PEI-DNA<br />
mixture and transfection of MCF7 cells (As performed by Andrew Jenks)</span></p><br />
<p>All cell culture and transfection was<br />
carried in complete media Dulbecco’s modified eagles media (DMEM) supplemented<br />
with 10 % foetal bovine serum (FBS). No antibiotics were used, cells were<br />
transiently transfected. </p><br />
<p>Procedure </p><br />
<p>On the day prior to transfection 250000 MCF7 cells were<br />
seeded per well of a 24 well plate.</p><br />
<p>For each transfection, reagents were prepared as follows:</p><br />
<p class=MsoListParagraphCxSpFirst><span<br />
lang=EN-US style='font-family:Calibri;'>a)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Plasmid mixed with PEI.PEI volumes<br />
used were either 0 µl, 3 µl, 6 µl, 9 µl, 12 µl and 15 µl. Plasmid concentration<br />
was either at 0 µg, 0.36 µg, 0.7 µg, 1.46 µg, 2.92 µg and 5.84 µg. Combinations<br />
of the PEI and plasmid was used. </span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>b)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>100 µl (10% of growth media volume) of<br />
0.15M <span class=SpellE>NaCl</span> was added to plasmid-PEI mixture</span></p><br />
<p class=MsoListParagraphCxSpMiddle><span<br />
lang=EN-US style='font-family:Calibri;'>c)<span style='font:7.0pt "Times New Roman"'>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></span><span lang=EN-US style='font-family:Calibri;<br />
'>Transfection reagent mixture was <span<br />
class=SpellE>vortexed</span> and incubated at room temperature for 10 <span<br />
class=SpellE>mins</span>.</span></p><br />
<p>The 24 well <span class=GramE>plate</span> was removed from the<br />
incubator. Prior to transfection, old media was removed from each well and replaced<br />
with fresh media. Prior to transfection, the old media from each well was<br />
replaced with fresh media. The PEI-plasmid-<span class=SpellE>NaCl</span> mixture was the added <span class=SpellE>dropwise</span> with even distribution<br />
to cells. Cells were incubated overnight at 37&#7506;C. The following day, cells were assessed for cell health<br />
and the media replaced. After this the cells were allowed to recover for <span<br />
class=GramE>48hrs&nbsp; before</span> being <span class=SpellE>trypsinised</span>. </p><br />
<p>Cells were analysed by flow <span class=SpellE>cytometery</span> as follows:</p><br />
<p>Media was removed and the cells were washed once with PBS.<br />
Cells were then <span class=SpellE>trypsinised</span> with 0.21mM trypsin<br />
containing 4.81 <span class=SpellE>mM</span> EDTA. The trypsin was then neutralized<br />
with the addition of complete media and cells were centrifuged at 2000 rpm for<br />
3 <span class=SpellE>mins</span></p><br />
<p>Cells were then washed once in ice cold PBS containing 1% foetal<br />
bovine serum (FBS) <span class=GramE>and &nbsp;re</span>-suspended in 1% FBS containing<br />
1ug/ml <span class=SpellE>propidium</span> iodide.</p><br />
<p>Cells were analysed using <span class=SpellE>CyAn</span>™<br />
ADP flow cytometer (<span class=SpellE>DakoCytomation</span>). In order<br />
to distinguish between alive and dead cells <span class=SpellE>propidum</span> iodide was used and data was analysed using the summit v4.3 software. Cell lines<br />
were gated according to an unstained sample and lasers were adjusted<br />
accordingly. Unstained cells were used to set gates for cell size and internal<br />
complexity, dead cells were removed along with doublets.</p><br />
<p style='line-height:normal;'><b><span style='font-size:10.0pt;<br />
font-family:Arial;color:red;<br />
'>RESULTS:</span></b></p><br />
<p style='line-height:normal'><span style='font-size:10.0pt;font-family:Arial;"Times New Roman";color:black;'>Results of the transfection using the PEI and plasmid concentrations was<br />
as follows:</span></p><br />
<p style='line-height:normal'><b><span lang=EN-US<br />
style='font-size:10.0pt;font-family:Arial;<br />
color:black;'><img width=384 height=227<br />
src="https://static.igem.org/mediawiki/2012/6/6f/Modelling_002.png" v:shapes="Picture_x0020_3"></span></b></p><br />
<p>6 µl of PEI with 1.46 µg of plasmid gave the highest level of<br />
transfection. 43% of cells were transfected. This is highly favourable in<br />
comparison to other transfection reagents. Increasing the DNA concentration did<br />
not improve transfection. </p><br />
<p><span lang=PT>Boussif, O et al.<br />
(1995) A versatile vector for gene and oligonucleotide transfer into cells in<br />
culture and in vivo: Polyethylenimine </span><a<br />
href="http://www.pnas.org/content/92/16/7297.full.pdf+html"><span lang=PT>http://www.pnas.org/content/92/16/7297.full.pdf+html</span></a></p><br />
<br />
</div><!-- #home-main-text --><br />
<br />
</div><!-- #the-content --><br />
<br />
</div><!-- #wrapper --><br />
<br />
<br />
</body><br />
<br />
</html></div>Louise123