http://2012.igem.org/wiki/index.php?title=Special:Contributions/Fougee&feed=atom&limit=50&target=Fougee&year=&month=2012.igem.org - User contributions [en]2024-03-28T22:13:48ZFrom 2012.igem.orgMediaWiki 1.16.0http://2012.igem.org/Team:Bielefeld-Germany/AcknowledgementsTeam:Bielefeld-Germany/Acknowledgements2012-11-16T13:28:39Z<p>Fougee: </p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<div id=page-title><br />
<span id=page-title-text><br />
Acknowledgements<br />
</span><br />
</div><br />
<br />
</html><br />
<html><br />
<div id="grey_bg"><br />
</html><br />
<br />
<br />
<div style="text-align:justify;"><br />
The idea for this project arose from countless discussions, researchs and presentations in team meetings (done by team members). So was the complete planning, and realization done by the students of iGEM Bielefeld Team 2012 with some tips from the advisers to avoid problems that came up in the years before. The whole lab work was executed by the student members of the team (and really everyone had their part to do to the last day).To get this big project organized we divided the team in small sub teams (operating units):<br />
<br />
<center><br />
{|class="wikitable"<br />
| '''Sponsoring''' and fancy stuff || '''Kevin Jarosch, Robert Braun, Moritz Müller'''<br />
|-<br />
| '''Human practice''' and east-German-accent-PR-bitch || '''Robert Braun''' (Rooobert!) & all the others<br />
|-<br />
| Chief of Lab, cloning princess and jack of all trades || '''Isabel Huber''' (Hubba, Hubba!)<br />
|-<br />
| '''Cloning bacterial laccases''' || '''Isabel Huber, Hakan Geyik'''<br />
|-<br />
| '''Cloning fungal laccases''' || '''Isabel Huber, Julia Schirmacher'''<br />
|-<br />
| '''Generating cDNA''' and putting a "Sch" in front of everyone || '''Saskia Scheibler, Agatha Walla''' (Sagatha)<br />
|-<br />
| '''Shuttle vector''', yeast and methanol metabolism || '''Julia Schirmacher''' (Juschi)<br />
|-<br />
| '''Cellulose binding domain''' and endless cloning || '''Moritz Müller''' (mo)<br />
|-<br />
| '''Site directed mutagenesis''' and owner of the "finger of guilt" || '''Moritz Müller'''<br />
|-<br />
| '''Sequencing''', technical issues and call center || '''Derya Kirasi'''<br />
|-<br />
| '''Cultivation of cells and capturing of proteins''' || '''Kevin Jarosch, Gabriele Kleiner, Miriam Fougeras'''<br />
|-<br />
| '''Immobilization''' and shift work || '''Malak Fawaz''', '''Nadine Legros'''<br />
|-<br />
| '''Activity Test''' and baking || '''Saskia Scheibler, Agatha Walla'''<br />
|-<br />
| '''MALDI''' and schedule fights|| '''Julia Voss''' (Juvoss)<br />
|-<br />
| '''Substrate Analysis''' and funky pictures || '''Hakan Geyik, Sebastian Wiebe'''<br />
|-<br />
| '''Modeling''' and mate-tea || '''Sebastian Wiebe'''<br />
|-<br />
| '''Wiki design''' and wake up calls in the middle of the night|| '''Julia Voss'''<br />
|}<br />
</center><br />
<br />
Everyone participated and helped in Human practices. Robert Braun was just head and contact. In public(interviews and newspaper) our team was represented by Kevin Jarosch und Robert Braun, but everyone had its part and represented its own opinion. All funds for the project were solicited by the sponsoring team (for sure team members and advisers gave suggestions where to ask).<br />
<br />
However there are some people without whom we could not have done all this work. People who gave us advise, helped us out with materials or simply cheered us up during some long days in the lab.<br />
(This page is constantly updated just to make sure we won't forget anyone.)<br />
<br />
*Our Instructor Dr. Jörn Kalinowski for providing us with an own laboratory room and supporting us with paper work, scientific guidance and financing. Furthermore we could use all of his equipment and materials.<br />
*We want to thank Prof. Dr. Alfred Pühler for promoting our work and always answering our questions.<br />
*Prof. Dr. rer. nat. Erwin Flaschel for providing us with lab space. We were able to use all the fermentation equipment we needed in his Fermentation Engineering lab. As well, he helped us with the sponsoring.<br />
*Our Instructor Dr. Christian Rückert always gave great advice for our scientific problems. He helped us with ordering materials, drove for us to the Teacher´s workshop in Paris and gave a lot of helpful suggestions.<br />
*Nils Lübke and Timo Wolf as former iGEM team members helped us with their experience, listened to our endless discussions and problems during our weekly team meetings and adviced us on our public relations work.<br />
*Dominik Cholewa aided us with his knowledge considering our large-scale fermentations and various purification methods.<br />
*Thomas Hug helped us with questions about Pichia pastoris vector design and fermentation.<br />
*Michael Limberg who is sharing a lab with us and is therefore always our first try when having a question.<br />
*Dr. Marcus Persicke for measuring our LC-MS preparations and his advises <br />
*Maurice Telaar gave us pMTE cp46 His and helped us with questions about purification<br />
*Nikolas Kessler as a former iGEM team member gave us guidance especially with web and graphic design.<br />
*Armin Neshat as a former iGEM team member helped us with our everyday questions and ordered all our chemicals and primers.<br />
*Prof. Dr. Uwe Bornscheuer, leader of the working group from the Institute of Biochemistry, Dept. of Biotechnology & Enzyme Catalysis at Ernst-Moritz-Arndt-University in Greifswald (Germany), send us the sequences and plasmids containing four sequences of different laccases of ''Trametes versicolor'' and the sequence of one ''Pycnoporus cinnabarinus'' laccase. <br />
*Prof. Dr. Thomas Noll helped us finding sponsors by mediating contacts.<br />
<!--*Dr. Werner Selbitschka for inviting us to and organizing the CeBiTec symposium. </li>--><br />
*Thorsten Seidel for advice with GFP-linkers, helping us with ''A. thaliana'' and supplying us with some "spare parts".<br />
*Patrick Treffon for providing us with lovely ''A. thaliana'' plants.<br />
*Marten Moore for providing us with some ''A. thaliana'' cDNA for some pre-tests.<br />
*Katharina Thiedig for giving help and advice in Site Directed Mutagensis and with Clonemanager. <br />
*Nina Probst for blessing us with some actin primers.<br />
*Lovely Kordula Puls for supplying us with as well lovely ''Volvox carteri'' to present it at our Street Science day.<br />
*All members of the Coryne AG for sharing the lab and equipment with us as well as helping us with our everyday questions.<br />
*All members of the Fermentation Engineering AG for sharing the lab and equipment with us as well as helping us with our everyday questions.<br />
*Michael Epp for our "A Case for Laccase" video.<br />
*Jonas Aretz for mentoring us in the first month of the project.<br />
*Dr. Petra Lutter for answering so many questions about modelling and helping us with the sponsoring.<br />
*Prof. Dr. Dietmar Kuck for giving ideas of stable degradation products regarding the MS/MS of estradiol and ethinyl-estradiol<br />
<br />
</div><br />
<br />
<html><br />
</div><br />
</html><br />
<br />
<br />
<br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/comparisonTeam:Bielefeld-Germany/Results/comparison2012-10-27T03:52:04Z<p>Fougee: /* Substrate Analysis */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Comparison of the four produced bacterial laccases<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
=== Activity Tests ===<br />
<br />
To optimize the application of our enzymes [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863010 TTHL] in a waste water treatment plant the obtained results were compared and further analyzed. All laccases show an optima at pH 5. However BPUL distinguishes from the other enzymes by showing a significantly higher enzyme activity. At pH 7 respectively the maximal activity is as well seen in the BPUL sample. At pH 5 ECOL, BPUL, BHAL, TTHL and TVEL0 show an average activity of 10-15 U mg<sup>-1</sup>. Though at pH 7 the enzymes activities were calculated to not exceed 2 U mg<sup>-1</sup>, respectively. This indicates that at pH values of around 7 BPUL is the best choice for our filter and if other enzymes are desired or needed an higher amount has to be used.<br />
[[File:Bielefeld2012 pH5 comparison.jpg|left|360px|thumb|'''Figure 1:''' Comparison of our produced enzymes and TVEL0 regarding their activity in a pH of 5. BPUL clearly shows the highest specific enzyme activity of 38 U mg<sup>-1</sup>. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
[[File:Bielefeld2012 pH7 comparison.jpg|right|360px|thumb|'''Figure 2:''' Comparison of our produced enzymes and TVEL0 regarding their activity in a pH of 7. BPUL clearly shows the highest specific enzyme activity of 11 U mg<sup>-1</sup>. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld2012 comparison Temp Units.jpg|left|360px|thumb|'''Figure 3:''' Comparison of our produced enzymes [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863010 TTHL] and TVEL0 regarding their activity at 10°C. BPUL clearly shows the highest specific enzyme activity of 37 U mg<sup>-1</sup>. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
Regarding the temperature characterizations BPUL is observed to show an enzyme activity of 37 U mg<sup>-1</sup>. ECOL, BPUL, BHAL, TTHL and TVEL0 show an activity of 2 to 13 U mg<sup>-1</sup>. Thus BPUL and also TTHL are very feasible for an application even in cold environments. For a usage of BHAL and ECOL a longer incubation time of the laccases and the substrates needs to take place to ensure a proper degradations of microcontaminents.<br />
<br />
<br style="clear: both" /><br />
<br />
==Substrate Analysis==<br />
The measurements were made to test whether the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 4. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 5. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|left|'''Figure 4:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|right|'''Figure 5:''' Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added. The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br style="clear: both" /><br />
<br />
== Immobilization ==<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|350px|thumb|right|'''Fig. 6:''' The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
An immobilization experiment was carried out using TVEL0, purified laccases from ''Escherichia coli'' BL21 DE3 (named ECOL), [http://www.dsmz.de/catalogues/details/culture/DSM-27.html|thumb|300px|left| ''Bacillus pumilus'' DSM 27 (ATCC7061)] (named BPUL), [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL) with a bead concentration of 0.12 g and over an incubation period of 14 hours. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant: The results showed that the four different purified laccases bind very well to the beads. ECOL and BPUL were perfectly immobilized (99% and 97% respectively) and showed a higher binding ability than the standard laccase TVEL0. 79 % of BHAL and TTHL could be immobilized on the CPC-beads (see Fig. 6).<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
[[File:Bielefeld2012-Immob.jpg|400px|right|thumb|'''Fig.7:''' Percentage of specific enzyme activity of immobilized BPUL and ECOL relative to the nonimmobilized laccases. Immobilized BPUL preserved 44 % of its activity, whereas ECOL didn't show a significant activity after immobilization.]]<br />
<br />
After the successful immobilization, the second step was to test the activity of the immobilized laccases. The specific enzyme activity of immobilized laccases from ECOL and BPUL was measured using [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics ABTS as substrate] and compared to that of nonimmobilized laccases (Fig. 7). The results showed that immobilized BPUL preserved 44 % of its activity, whereas ECOL didn't show a significant activity after immobilization. However, further tests using "Thermo Biomate 3 UV-Vis Spektrophotometer" showed a 21% activity of ECOL after immobilization (results not shown).<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
[[File:Bielefeld2012-Beadsbild.jpg|500px|right|thumb|'''Fig. 8:''' Enzymatic activity of the immobilized laccases BPUL, BHAL and TTHL illustrated by the oxidation of ABTS. BPUL shows a very high activity whereas the activity of BHAL and TTHL isn't so high, probably due to the low laccase concentration (4 μg ml<sup>-1</sup>). Yet, BHAL shows a higher activity than TTHL.]]<br />
<br />
<br />
Nevertheless, due to the variable concentration of the four purified laccases, it wasn't possible to achieve a reasonable comparison in their activity after immobilization. The concentration of purified BHAL and TTHL was too low (4 μg ml<sup>-1</sup>) to yield comparable results. Yet, all laccases showed indeed an activity (see Fig. 8)<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/comparisonTeam:Bielefeld-Germany/Results/comparison2012-10-27T03:51:14Z<p>Fougee: /* Immobilization */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Comparison of the four produced bacterial laccases<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
<br />
=== Activity Tests ===<br />
<br />
To optimize the application of our enzymes [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863010 TTHL] in a waste water treatment plant the obtained results were compared and further analyzed. All laccases show an optima at pH 5. However BPUL distinguishes from the other enzymes by showing a significantly higher enzyme activity. At pH 7 respectively the maximal activity is as well seen in the BPUL sample. At pH 5 ECOL, BPUL, BHAL, TTHL and TVEL0 show an average activity of 10-15 U mg<sup>-1</sup>. Though at pH 7 the enzymes activities were calculated to not exceed 2 U mg<sup>-1</sup>, respectively. This indicates that at pH values of around 7 BPUL is the best choice for our filter and if other enzymes are desired or needed an higher amount has to be used.<br />
[[File:Bielefeld2012 pH5 comparison.jpg|left|360px|thumb|'''Figure 1:''' Comparison of our produced enzymes and TVEL0 regarding their activity in a pH of 5. BPUL clearly shows the highest specific enzyme activity of 38 U mg<sup>-1</sup>. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
[[File:Bielefeld2012 pH7 comparison.jpg|right|360px|thumb|'''Figure 2:''' Comparison of our produced enzymes and TVEL0 regarding their activity in a pH of 7. BPUL clearly shows the highest specific enzyme activity of 11 U mg<sup>-1</sup>. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br style="clear: both" /><br />
<br />
[[File:Bielefeld2012 comparison Temp Units.jpg|left|360px|thumb|'''Figure 3:''' Comparison of our produced enzymes [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863010 TTHL] and TVEL0 regarding their activity at 10°C. BPUL clearly shows the highest specific enzyme activity of 37 U mg<sup>-1</sup>. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
Regarding the temperature characterizations BPUL is observed to show an enzyme activity of 37 U mg<sup>-1</sup>. ECOL, BPUL, BHAL, TTHL and TVEL0 show an activity of 2 to 13 U mg<sup>-1</sup>. Thus BPUL and also TTHL are very feasible for an application even in cold environments. For a usage of BHAL and ECOL a longer incubation time of the laccases and the substrates needs to take place to ensure a proper degradations of microcontaminents.<br />
<br />
<br style="clear: both" /><br />
<br />
==Substrate Analysis==<br />
The measurements were made to test whether the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 4. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 5. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|left|'''Figure 4: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|right|'''Figure 5: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br style="clear: both" /><br />
<br />
== Immobilization ==<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|350px|thumb|right|'''Fig. 6:''' The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
An immobilization experiment was carried out using TVEL0, purified laccases from ''Escherichia coli'' BL21 DE3 (named ECOL), [http://www.dsmz.de/catalogues/details/culture/DSM-27.html|thumb|300px|left| ''Bacillus pumilus'' DSM 27 (ATCC7061)] (named BPUL), [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] (named BHAL) and from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] (named TTHL) with a bead concentration of 0.12 g and over an incubation period of 14 hours. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant: The results showed that the four different purified laccases bind very well to the beads. ECOL and BPUL were perfectly immobilized (99% and 97% respectively) and showed a higher binding ability than the standard laccase TVEL0. 79 % of BHAL and TTHL could be immobilized on the CPC-beads (see Fig. 6).<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
[[File:Bielefeld2012-Immob.jpg|400px|right|thumb|'''Fig.7:''' Percentage of specific enzyme activity of immobilized BPUL and ECOL relative to the nonimmobilized laccases. Immobilized BPUL preserved 44 % of its activity, whereas ECOL didn't show a significant activity after immobilization.]]<br />
<br />
After the successful immobilization, the second step was to test the activity of the immobilized laccases. The specific enzyme activity of immobilized laccases from ECOL and BPUL was measured using [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics ABTS as substrate] and compared to that of nonimmobilized laccases (Fig. 7). The results showed that immobilized BPUL preserved 44 % of its activity, whereas ECOL didn't show a significant activity after immobilization. However, further tests using "Thermo Biomate 3 UV-Vis Spektrophotometer" showed a 21% activity of ECOL after immobilization (results not shown).<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
[[File:Bielefeld2012-Beadsbild.jpg|500px|right|thumb|'''Fig. 8:''' Enzymatic activity of the immobilized laccases BPUL, BHAL and TTHL illustrated by the oxidation of ABTS. BPUL shows a very high activity whereas the activity of BHAL and TTHL isn't so high, probably due to the low laccase concentration (4 μg ml<sup>-1</sup>). Yet, BHAL shows a higher activity than TTHL.]]<br />
<br />
<br />
Nevertheless, due to the variable concentration of the four purified laccases, it wasn't possible to achieve a reasonable comparison in their activity after immobilization. The concentration of purified BHAL and TTHL was too low (4 μg ml<sup>-1</sup>) to yield comparable results. Yet, all laccases showed indeed an activity (see Fig. 8)<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/cbcTeam:Bielefeld-Germany/Results/cbc2012-10-27T03:49:17Z<p>Fougee: /* Since Regionals */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Cellulose Binding Domain <br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
</html><br />
__TOC__<br />
<br />
<br />
==Introduction==<br />
<div style="text-align:justify;"><br />
In the field of cheap protein-extraction, cellulose binding domains (CBD) have made themselves a name. A lot of publications are available providing capture of a protein from the cell-lysate with a CBD-tag as a cheap purification strategy. Also enhanced segregation with CBD-tagged proteins have been observed. In this project the idea is different, the binding of our self-produced proteins to cellulose via a protein-domain-tag is taking advantage of the binding capacity of binding domains not only for purification reasons (it is still a great benefit), but also as an immobilization procedure for our laccases for later application.<br />
<br />
[[Image:Bielefeld2012 Osaka3.jpg|500px|thumb|right|'''Figure 1:''' Graphical sequence-alignment of <partinfo>K392014</partinfo> and the [http://www.ncbi.nlm.nih.gov/nuccore/AB041993 ''xyn10A'' gene of ''C.josui'']]]<br />
To make a purification and immobilization-tag out of a protein domain, there are a lot of decisions and characterizations to do.<br />
<br />
Starting with the choice of the binding domain, the first limitation is accessibility. The first place to look at is of course the [http://partsregistry.org Partsregistry]. A promising Cellulose binding motif of the ''C. josui'' ''xyn10A'' gene (<partinfo>BBa_K392014</partinfo>) was found and ordered for the project right from the spot. After some research concerning the sequence of that BioBrick, it turned out that the part is not the CBD of the Xylanase as it should be, but the glycosyl hydrolase domain of the protein (Figure 1). This result made the part useless for the project ([http://partsregistry.org/Part:BBa_K392014:Experience complete review]) and it was the only binding domain in the [http://partsregistry.org Partsregistry] that fitted to the project.<br />
<br />
Accessible organisms were searched via NCBI for binding-domains, -proteins and -motifs and work groups were asked if they could help out. The results of the database research were only two chitin/carbohydrate binding modules within the ''Bacillus halodurans'' genome (that strain was ordered for its laccase <partinfo>BBa_K863020</partinfo>). One is in the [http://www.ncbi.nlm.nih.gov/nucleotide/289656506?report=genbank&log$=nuclalign&blast_rank=1&RID=0JPT9WMS01N Cochin chitinase gene] and the other in a [http://www.ncbi.nlm.nih.gov/protein/BAB05022.1 chitin binding protein].<br />
<br />
[[Image:Bielefeld2012_p714.jpg|200px|thumb|left|'''Figure 2:''' Plasmid-map of p714 with CBDcex; Origin: Fermentation group of Bielefeld University]][[Image:Bielefeld2012_p570.jpg|220px|thumb|left|'''Figure 3:''' Plasmid-map of p570 with CBDclos; Origin: Fermentation group of Bielefeld University]]<br />
<br />
Meanwhile the Fermentation group of our university offered the use of two plasmids (p570 & p671), containing cellulose binding domains. The cellulose binding domain of the [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase gene] (CBDcex) and the cellulose binding domain of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (''cbpA'')] (CBDclos). The decision was made to use these two domains. Staying within the cellulose binding domain-family and leave other protein domains like carbohydrate binding domains aside would keep the results comparable. For example, changing to a different binding material would change the binding capacities of both domains in the same way. Also both are bacterial CBDs and no post-translational modification and glycosylation had to be dealt with.<br />
<br />
To get to know more about these two domains, their properties and their proteins, the NCBI databases were consulted. [http://blast.ncbi.nlm.nih.gov/ BLAST] was used to identify the cellulose binding domains and ExPASy-tools were used for further analyses.<br />
<br><br><br />
<br />
[[Image:Bielefeld2012_pfam00553.jpg|150px|thumb|left|'''Figure 5:''' Predicted structure of the CBM_2-family made with Cn3D]]<br />
[[Image:Bielefeld2012_cfimiexo.jpg|450px|thumb|right|'''Figure 6:''' Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase]]]<br />
<br />
The CBD of the ''Cellulomonas fimi'' ATCC 484 exoglucanase gene (Figure 6) is a 100 amino acid long domain, close to the C-terminal ending of the protein with a theoretical pI of 8.07 and a molecular weight of 10.3 kDa. It is classified to be stable and belongs to the Cellulose Binding Modul family 2 (pfam00553/cl02709; Figure 5). Two tryptophane residues are involved in cellulose binding in this family which is only found in bacteria. Also, a CBM49 carbohydrate binding domain is found within the protein domain, where [http://www.ncbi.nlm.nih.gov/pubmed/17322304?dopt=Abstract binding studies] have shown, that it binds to crystalline cellulose, which could be a possible target for immobilization.<br />
<br />
[[Image:Bielefeld2012_ccellubp.jpg|450px|thumb|left|'''Figure 7:''' Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein (Cbp A)]]]<br />
[[Image:Bielefeld2012_pfam00942.jpg|150px|thumb|right|'''Figure 8:''' Predicted structure of the CBM_3-family made with Cn3D]]<br />
<br />
The CBD of the [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (''cbpA'')] on the other hand is a N-terminal domain with 92 amino acids, theoretical pI of 4.56 and is also classified as stable. It belongs to the Cellulose Binding Module family 3 (pfam00942/cl03026; Figure 8) and is part of a very large cellulose binding protein with four other carbohydrate binding modules and a lot of docking interfaces for the proteins in its amino acid sequence (Figure 7).<br />
<br />
==The Binding Assay==<br />
<br />
[[image:Bielefeld2012_GFP.jpg|300px|thumb|right|'''Figure 9:''' ''Aequorea victoria'' green fluorescent protein in action]]<br />
To measure the capacity and strength of the bonding between the cellulose binding domains and different types of cellulose many different assays have been made. One of the simplest and most often used is the fusion of the CBD to a reporter-protein, especially [http://www.ncbi.nlm.nih.gov/pubmed/22305911a green or red fluorescent protein (GFP/RFP)] is very common. The place of the CBD is measured through the fluorescence of the fused GFP and quantification can easily been done.<br />
<br />
[http://www.ncbi.nlm.nih.gov/pubmed/18573384 Protocol]:<br />
* Harvest the ''E coli''-cells producing the fusion-protein of CBD and GFP and centifuge 10 minutes at top speed.<br />
* Re-suspend the cell-pellet in 50 mM Tris-HCl-Buffer (pH 8.0).<br />
* Break down cells via sonication.<br />
* Centrifuge at top speed for 20 minutes to get rid of the cell-debris. <br />
* Take the supernatant and measure the emission at 511 nm (excitation at 501 nm) (<partinfo>E0040</partinfo>)<br />
* Mix a definite volume of lysate with a definite volume or mass of e.g. crystalline cellulose (CC) or reactivated amorphous cellulose (RAC)<br />
* Wait 15 (RAC) to 30 (CC) minutes <br />
* Take supernatant and measure the emission at 511 nm again. <br />
* The difference between the first an the second measurement is the relative quantity of what has bound to the cellulose.<br />
<br />
==Cloning of the Cellulose Binding Domains==<br />
<br />
The cloning of the CBDs should fit to the cloning of our laccases, so the BioBricks were designed with a T7-promoter and the B0034 RBS to have a similar method of cultivation. After investigating the restriction-sites it was found, that at least for the characterization of the CBDs a quick in-frame assembly of the CBDs and a GFP would be possible, because neither the CBDs nor the GFP (<partinfo>I13522</partinfo>) of the Partsregistry inherits a ''Age''I- or ''Ngo''MIV-site, which makes Freiburg-assembly possible. To do so, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] for the constructs <partinfo>BBa_K863101</partinfo> (CBDcex(T7)), carrying the CBDcex domain from the ''C. fimi'' exoglucanase and <partinfo>BBa_K863111</partinfo> (CBDclos(T7)), carrying the CBDclos domain from the ''C.cellulovorans'' binding protein were designed. The protein-BLAST of the two CBDs gave an exact picture of which bases belong to the binding domains and which do not. To be sure not to disturb the folding anyway 6 to 12 bases up and downstream of the domains as conserved sequences were kept. Even if the [http://partsregistry.org/Part:BBa_K863101 CBDcex]is an C-terminal domain both domains were made N-terminal, so the BioBricks can carry all regulatory parts and the linked protein can easily be exchanged. This would also be nice for other people using this part.<br />
<br />
<center><br />
{|class="wikitable"<br />
| CBDcex_T7RBS|| 80 || TGAATTCGCGGCCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGGGT<br />CCGGCCGGGTGCCAGGT<br />
|-<br />
| CBDcex_2AS-Link_compl || 56 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCGCCGACCGTGCAGGGCGTGC<br />
|-<br />
| CBDclos_T7RBS || 73 || CCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGTCAGTTGAATTTTACAACTCTAAC<br />
|-<br />
| CBDclos_2ASlink_compl|| 63 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCTGCAAATCCAAATTCAACATATGTATC<br />
|}<br />
</center><br />
<br />
The listed complementary primers added, besides the Freiburg-suffix, a two amino acid glycine-serine-linker to the end of the CBDs. This is a very short linker, but as GFP-experts and [http://www.ncbi.nlm.nih.gov/pubmed/17394253 publications] described GFP and CBDs are very stable proteins and should cope with a very short linker. The benefit of a short linker is that protease activity is kept minimal.<br />
<br />
The GFP <partinfo>K863121</partinfo> used in the assay was an alternated version of the <partinfo>BBa_I13522</partinfo>. The [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] that were made added a Freiburg-pre- and suffix to the GFP coding sequence and a His-tag to the C-terminus to get it purified for the measurements. This part <partinfo>BBa_K863121</partinfo> (GFP_His) should be easily added to the CBDs and assembled to the fusion-proteins <partinfo>BBa_K863103</partinfo> CBDcex(T7)+GFP_His and <partinfo>BBa_K863113</partinfo> CBDclos(T7)+GFP_His.<br />
<br />
<center><br />
{|class="wikitable"<br />
| GFP_Frei || 54 || TACGGAATTCGCGGCCGCTTCTAGATGGCCGGCATGCGTAAAGGAGAAGAACTT<br />
|-<br />
| GFP_His6_compl || 74 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGTGATGGTGATGGTGATGTTTGTATAGTTCATCCATGCCATGTG<br />
|}<br />
</center><br />
<br />
Since a His-tag was added to the end of the GFP, an alternate version of the <partinfo>BBa_I13522</partinfo> had to be made to compare binding of GFP with and without CBD. Therefore, a forward primer was made, to amplify the whole <partinfo>BBa_I13522</partinfo> with the GFP_His_compl-primer to add the His-tag to the C-terminus.<br />
<br />
<center><br />
{|class="wikitable"<br />
| GFP_FW_SV || 39 || acgtcacctgcgtgtagctCGTAAAGGAGAAGAACTTTT<br />
|}<br />
</center><br />
Due to bad cleavage efficiency at the ''Pst''I restriction-site in nearly all PCR-products the cloning of the CBDs ([http://partsregistry.org/Part:BBa_K863102 CBDcex(T7)] and [http://partsregistry.org/Part:BBa_K863112 CBDclos(T7)]) and especially the insertion of [http://partsregistry.org/Part:BBa_K863121 GFP_His] to the CBDs took a lot more time as expected. This was due to the fact that no additional bases were added to the 5<nowiki>'</nowiki> termini of the designed primers, thereby greatly reducing cleavage efficiency. When the problem was discovered and protocols adjusted or primers extended, cloning got a lot quicker and more successful.<br />
<br />
As the project went on the T7-constructs did not seem to work. One suspected reason was that a stop codon (TAA) that was accidentally introduced between the RBS and ATG could be the reason. To solve the problem a change to a constitutive promoter (<partinfo>BBa_J61101</partinfo>) was made using the Freiburg-assembly. Therefore Freiburg forward primers for the CBDs were made.<br />
<center><br />
{|class="wikitable"<br />
| CBDcex_Freiburg-Prefix|| 54 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCGGTCCGGCCGGGTGCCAGGTG<br />
|-<br />
| CBDclos_Freiburg-Prefix || 57 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCTCATCAATGTCAGTTGAATTTTAC<br />
|}<br />
</center><br />
<br />
The primers arrived just a few days before wiki freeze (Europe). Switching to the constitutive promoter had no obvious effect (no green colonies or culture), neither had changing the expression strain from ''E. coli'' KRX to ''E. coli'' BL21 for the T7-construct.<br />
<br />
==Since Regionals==<br />
<br />
After Amsterdam two approaches were made. One changing the order of the fused proteins and one altering the linker between CBD and the GFP. Both started simultaneously. [[File:Bielefeld2012_S3N10linker.jpg|500px|thumb|right|'''Figure 10:''' PCR-product of BBa_K863104 with S3N10-primers]]<br />
One reason for the problems could be the too short space in between the two proteins, resulting in CBD and GFP hampering each other from folding correctly. To test and solve this, a very long linker with three serines followed by ten asparagines should be assembled in the already existing parts via a blunt end cloning.<br />
<center><br />
{|class="wikitable"<br />
| S3N10_Cex_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCCGACCGTGCAGGGCGTGC<br />
|-<br />
| S3N10_Clos_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCTGCCGCCGACCGTGCAGG<br />
|-<br />
| S3N10_GFP || 40 || CAATAACAATAACAACAACCGTAAAGGAGAAGAACTTTTC<br />
|}<br />
</center><br />
While the PCR worked properly, ligation of the linearized new plasmid was not successful and no transformed colonies could be found in two attempts. A reason for this could be insufficient phosphorylation of the PCR product.<br />
Because already Freiburg pre- and suffix primers for the CBDs were at hand the order of the fusion proteins could easily been changed, when a Freiburg suffix primer for the GFP would be available, so it was ordered.<br />
<center><br />
{|class="wikitable"<br />
| GFP_Freiburg_compl || 61 || ACGTCTGCAGCGGCCGCTACTAGTATTAACCGGTTTTGTATAGTTCATCCATGCCATGTGT<br />
|}<br />
</center><br />
When changing the fusing proteins to GFP N-terminal and CBD C-terminal an additional single GFP was cloned in a plasmid behind a J61101 RBS to see the expression of the J23100/J61101 promoter/RBS and to have a corresponding protein for the assay as a negative control. The result was the same as before, no green colonies. The colony PCRs and digestions showed the right bands, but no construct and even the single GFP was expressed correctly. Sequencing later showed that a deletion of one of the first few bases of the ORF caused a frame shift. At this point in time it seemed as if the promoter/RBS did not work properly.<br />
So in spite of continuing working as planed on the linker between GFP and the CBDs, the efforts now focused on the usage of promoter and RBS. In the last week of lab work it was tried to assemble GFP with a CBD behind the strong B0034 RBS, followed by cutting this piece out with ''Xba''I and ''Pst''I and ligate this insert via a standard suffix insertion with the J23100 promoter. After some unsuccessful attempts ''Age''I ran empty and could not be ordered in time. A last quick-shot with a PCR product of an old (but correct) assembly (CBDcex-GFP) and a single GFP_Freiburg went well in adding it to the RBS but did not show green glowing colonies when fused to the promoter.<br />
<br />
== Literature ==<br />
Kavoosi ''et al.'' (2007) Strategy for selecting and characterizing linker peptides for CBM9-tagged fusion proteins expressed in Escherichia coli. ''Biotechnol Bioeng.'' Oct 15;98(3):599-610.<br />
<br />
Urbanowicz ''et al.'' (2007) A tomato endo-beta-1,4-glucanase, SlCel9C1, represents a distinct subclass with a new family of carbohydrate binding modules (CBM49). ''J Biol Chem.'' Apr 20;282(16):12066-74. Epub 2007 Feb 23.<br />
<br />
Sugimoto ''et al.'' (2012) Cellulose affinity purification of fusion proteins tagged with fungal family 1 cellulose-binding domain. ''Protein Expr Purif.'' Apr;82(2):290-6. Epub 2012 Jan 28.<br />
<br />
Hong ''et al.'' (2008) Bioseparation of recombinant cellulose-binding module-proteins by affinity adsorption on an ultra-high-capacity cellulosic adsorbent. ''Anal Chim Acta.'' Jul 28;621(2):193-9. Epub 2008 May 27.<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/cbcTeam:Bielefeld-Germany/Results/cbc2012-10-27T03:48:32Z<p>Fougee: /* The Binding Assay */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Cellulose Binding Domain <br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
</html><br />
__TOC__<br />
<br />
<br />
==Introduction==<br />
<div style="text-align:justify;"><br />
In the field of cheap protein-extraction, cellulose binding domains (CBD) have made themselves a name. A lot of publications are available providing capture of a protein from the cell-lysate with a CBD-tag as a cheap purification strategy. Also enhanced segregation with CBD-tagged proteins have been observed. In this project the idea is different, the binding of our self-produced proteins to cellulose via a protein-domain-tag is taking advantage of the binding capacity of binding domains not only for purification reasons (it is still a great benefit), but also as an immobilization procedure for our laccases for later application.<br />
<br />
[[Image:Bielefeld2012 Osaka3.jpg|500px|thumb|right|'''Figure 1:''' Graphical sequence-alignment of <partinfo>K392014</partinfo> and the [http://www.ncbi.nlm.nih.gov/nuccore/AB041993 ''xyn10A'' gene of ''C.josui'']]]<br />
To make a purification and immobilization-tag out of a protein domain, there are a lot of decisions and characterizations to do.<br />
<br />
Starting with the choice of the binding domain, the first limitation is accessibility. The first place to look at is of course the [http://partsregistry.org Partsregistry]. A promising Cellulose binding motif of the ''C. josui'' ''xyn10A'' gene (<partinfo>BBa_K392014</partinfo>) was found and ordered for the project right from the spot. After some research concerning the sequence of that BioBrick, it turned out that the part is not the CBD of the Xylanase as it should be, but the glycosyl hydrolase domain of the protein (Figure 1). This result made the part useless for the project ([http://partsregistry.org/Part:BBa_K392014:Experience complete review]) and it was the only binding domain in the [http://partsregistry.org Partsregistry] that fitted to the project.<br />
<br />
Accessible organisms were searched via NCBI for binding-domains, -proteins and -motifs and work groups were asked if they could help out. The results of the database research were only two chitin/carbohydrate binding modules within the ''Bacillus halodurans'' genome (that strain was ordered for its laccase <partinfo>BBa_K863020</partinfo>). One is in the [http://www.ncbi.nlm.nih.gov/nucleotide/289656506?report=genbank&log$=nuclalign&blast_rank=1&RID=0JPT9WMS01N Cochin chitinase gene] and the other in a [http://www.ncbi.nlm.nih.gov/protein/BAB05022.1 chitin binding protein].<br />
<br />
[[Image:Bielefeld2012_p714.jpg|200px|thumb|left|'''Figure 2:''' Plasmid-map of p714 with CBDcex; Origin: Fermentation group of Bielefeld University]][[Image:Bielefeld2012_p570.jpg|220px|thumb|left|'''Figure 3:''' Plasmid-map of p570 with CBDclos; Origin: Fermentation group of Bielefeld University]]<br />
<br />
Meanwhile the Fermentation group of our university offered the use of two plasmids (p570 & p671), containing cellulose binding domains. The cellulose binding domain of the [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase gene] (CBDcex) and the cellulose binding domain of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (''cbpA'')] (CBDclos). The decision was made to use these two domains. Staying within the cellulose binding domain-family and leave other protein domains like carbohydrate binding domains aside would keep the results comparable. For example, changing to a different binding material would change the binding capacities of both domains in the same way. Also both are bacterial CBDs and no post-translational modification and glycosylation had to be dealt with.<br />
<br />
To get to know more about these two domains, their properties and their proteins, the NCBI databases were consulted. [http://blast.ncbi.nlm.nih.gov/ BLAST] was used to identify the cellulose binding domains and ExPASy-tools were used for further analyses.<br />
<br><br><br />
<br />
[[Image:Bielefeld2012_pfam00553.jpg|150px|thumb|left|'''Figure 5:''' Predicted structure of the CBM_2-family made with Cn3D]]<br />
[[Image:Bielefeld2012_cfimiexo.jpg|450px|thumb|right|'''Figure 6:''' Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase]]]<br />
<br />
The CBD of the ''Cellulomonas fimi'' ATCC 484 exoglucanase gene (Figure 6) is a 100 amino acid long domain, close to the C-terminal ending of the protein with a theoretical pI of 8.07 and a molecular weight of 10.3 kDa. It is classified to be stable and belongs to the Cellulose Binding Modul family 2 (pfam00553/cl02709; Figure 5). Two tryptophane residues are involved in cellulose binding in this family which is only found in bacteria. Also, a CBM49 carbohydrate binding domain is found within the protein domain, where [http://www.ncbi.nlm.nih.gov/pubmed/17322304?dopt=Abstract binding studies] have shown, that it binds to crystalline cellulose, which could be a possible target for immobilization.<br />
<br />
[[Image:Bielefeld2012_ccellubp.jpg|450px|thumb|left|'''Figure 7:''' Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein (Cbp A)]]]<br />
[[Image:Bielefeld2012_pfam00942.jpg|150px|thumb|right|'''Figure 8:''' Predicted structure of the CBM_3-family made with Cn3D]]<br />
<br />
The CBD of the [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (''cbpA'')] on the other hand is a N-terminal domain with 92 amino acids, theoretical pI of 4.56 and is also classified as stable. It belongs to the Cellulose Binding Module family 3 (pfam00942/cl03026; Figure 8) and is part of a very large cellulose binding protein with four other carbohydrate binding modules and a lot of docking interfaces for the proteins in its amino acid sequence (Figure 7).<br />
<br />
==The Binding Assay==<br />
<br />
[[image:Bielefeld2012_GFP.jpg|300px|thumb|right|'''Figure 9:''' ''Aequorea victoria'' green fluorescent protein in action]]<br />
To measure the capacity and strength of the bonding between the cellulose binding domains and different types of cellulose many different assays have been made. One of the simplest and most often used is the fusion of the CBD to a reporter-protein, especially [http://www.ncbi.nlm.nih.gov/pubmed/22305911a green or red fluorescent protein (GFP/RFP)] is very common. The place of the CBD is measured through the fluorescence of the fused GFP and quantification can easily been done.<br />
<br />
[http://www.ncbi.nlm.nih.gov/pubmed/18573384 Protocol]:<br />
* Harvest the ''E coli''-cells producing the fusion-protein of CBD and GFP and centifuge 10 minutes at top speed.<br />
* Re-suspend the cell-pellet in 50 mM Tris-HCl-Buffer (pH 8.0).<br />
* Break down cells via sonication.<br />
* Centrifuge at top speed for 20 minutes to get rid of the cell-debris. <br />
* Take the supernatant and measure the emission at 511 nm (excitation at 501 nm) (<partinfo>E0040</partinfo>)<br />
* Mix a definite volume of lysate with a definite volume or mass of e.g. crystalline cellulose (CC) or reactivated amorphous cellulose (RAC)<br />
* Wait 15 (RAC) to 30 (CC) minutes <br />
* Take supernatant and measure the emission at 511 nm again. <br />
* The difference between the first an the second measurement is the relative quantity of what has bound to the cellulose.<br />
<br />
==Cloning of the Cellulose Binding Domains==<br />
<br />
The cloning of the CBDs should fit to the cloning of our laccases, so the BioBricks were designed with a T7-promoter and the B0034 RBS to have a similar method of cultivation. After investigating the restriction-sites it was found, that at least for the characterization of the CBDs a quick in-frame assembly of the CBDs and a GFP would be possible, because neither the CBDs nor the GFP (<partinfo>I13522</partinfo>) of the Partsregistry inherits a ''Age''I- or ''Ngo''MIV-site, which makes Freiburg-assembly possible. To do so, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] for the constructs <partinfo>BBa_K863101</partinfo> (CBDcex(T7)), carrying the CBDcex domain from the ''C. fimi'' exoglucanase and <partinfo>BBa_K863111</partinfo> (CBDclos(T7)), carrying the CBDclos domain from the ''C.cellulovorans'' binding protein were designed. The protein-BLAST of the two CBDs gave an exact picture of which bases belong to the binding domains and which do not. To be sure not to disturb the folding anyway 6 to 12 bases up and downstream of the domains as conserved sequences were kept. Even if the [http://partsregistry.org/Part:BBa_K863101 CBDcex]is an C-terminal domain both domains were made N-terminal, so the BioBricks can carry all regulatory parts and the linked protein can easily be exchanged. This would also be nice for other people using this part.<br />
<br />
<center><br />
{|class="wikitable"<br />
| CBDcex_T7RBS|| 80 || TGAATTCGCGGCCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGGGT<br />CCGGCCGGGTGCCAGGT<br />
|-<br />
| CBDcex_2AS-Link_compl || 56 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCGCCGACCGTGCAGGGCGTGC<br />
|-<br />
| CBDclos_T7RBS || 73 || CCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGTCAGTTGAATTTTACAACTCTAAC<br />
|-<br />
| CBDclos_2ASlink_compl|| 63 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCTGCAAATCCAAATTCAACATATGTATC<br />
|}<br />
</center><br />
<br />
The listed complementary primers added, besides the Freiburg-suffix, a two amino acid glycine-serine-linker to the end of the CBDs. This is a very short linker, but as GFP-experts and [http://www.ncbi.nlm.nih.gov/pubmed/17394253 publications] described GFP and CBDs are very stable proteins and should cope with a very short linker. The benefit of a short linker is that protease activity is kept minimal.<br />
<br />
The GFP <partinfo>K863121</partinfo> used in the assay was an alternated version of the <partinfo>BBa_I13522</partinfo>. The [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] that were made added a Freiburg-pre- and suffix to the GFP coding sequence and a His-tag to the C-terminus to get it purified for the measurements. This part <partinfo>BBa_K863121</partinfo> (GFP_His) should be easily added to the CBDs and assembled to the fusion-proteins <partinfo>BBa_K863103</partinfo> CBDcex(T7)+GFP_His and <partinfo>BBa_K863113</partinfo> CBDclos(T7)+GFP_His.<br />
<br />
<center><br />
{|class="wikitable"<br />
| GFP_Frei || 54 || TACGGAATTCGCGGCCGCTTCTAGATGGCCGGCATGCGTAAAGGAGAAGAACTT<br />
|-<br />
| GFP_His6_compl || 74 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGTGATGGTGATGGTGATGTTTGTATAGTTCATCCATGCCATGTG<br />
|}<br />
</center><br />
<br />
Since a His-tag was added to the end of the GFP, an alternate version of the <partinfo>BBa_I13522</partinfo> had to be made to compare binding of GFP with and without CBD. Therefore, a forward primer was made, to amplify the whole <partinfo>BBa_I13522</partinfo> with the GFP_His_compl-primer to add the His-tag to the C-terminus.<br />
<br />
<center><br />
{|class="wikitable"<br />
| GFP_FW_SV || 39 || acgtcacctgcgtgtagctCGTAAAGGAGAAGAACTTTT<br />
|}<br />
</center><br />
Due to bad cleavage efficiency at the ''Pst''I restriction-site in nearly all PCR-products the cloning of the CBDs ([http://partsregistry.org/Part:BBa_K863102 CBDcex(T7)] and [http://partsregistry.org/Part:BBa_K863112 CBDclos(T7)]) and especially the insertion of [http://partsregistry.org/Part:BBa_K863121 GFP_His] to the CBDs took a lot more time as expected. This was due to the fact that no additional bases were added to the 5<nowiki>'</nowiki> termini of the designed primers, thereby greatly reducing cleavage efficiency. When the problem was discovered and protocols adjusted or primers extended, cloning got a lot quicker and more successful.<br />
<br />
As the project went on the T7-constructs did not seem to work. One suspected reason was that a stop codon (TAA) that was accidentally introduced between the RBS and ATG could be the reason. To solve the problem a change to a constitutive promoter (<partinfo>BBa_J61101</partinfo>) was made using the Freiburg-assembly. Therefore Freiburg forward primers for the CBDs were made.<br />
<center><br />
{|class="wikitable"<br />
| CBDcex_Freiburg-Prefix|| 54 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCGGTCCGGCCGGGTGCCAGGTG<br />
|-<br />
| CBDclos_Freiburg-Prefix || 57 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCTCATCAATGTCAGTTGAATTTTAC<br />
|}<br />
</center><br />
<br />
The primers arrived just a few days before wiki freeze (Europe). Switching to the constitutive promoter had no obvious effect (no green colonies or culture), neither had changing the expression strain from ''E. coli'' KRX to ''E. coli'' BL21 for the T7-construct.<br />
<br />
==Since Regionals==<br />
<br />
After Amsterdam two approaches were made. One changing the order of the fused proteins and one altering the linker between CBD and the GFP. Both started simultaneously. [[File:Bielefeld2012_S3N10linker.jpg|500px|thumb|right|PCR-product of BBa_K863104 with S3N10-primers]]<br />
One reason for the problems could be the too short space in between the two proteins, resulting in CBD and GFP hampering each other from folding correctly. To test and solve this, a very long linker with three serines followed by ten asparagines should be assembled in the already existing parts via a blunt end cloning.<br />
<center><br />
{|class="wikitable"<br />
| S3N10_Cex_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCCGACCGTGCAGGGCGTGC<br />
|-<br />
| S3N10_Clos_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCTGCCGCCGACCGTGCAGG<br />
|-<br />
| S3N10_GFP || 40 || CAATAACAATAACAACAACCGTAAAGGAGAAGAACTTTTC<br />
|}<br />
</center><br />
While the PCR worked properly, ligation of the linearized new plasmid was not successful and no transformed colonies could be found in two attempts. A reason for this could be insufficient phosphorylation of the PCR product.<br />
Because already Freiburg pre- and suffix primers for the CBDs were at hand the order of the fusion proteins could easily been changed, when a Freiburg suffix primer for the GFP would be available, so it was ordered.<br />
<center><br />
{|class="wikitable"<br />
| GFP_Freiburg_compl || 61 || ACGTCTGCAGCGGCCGCTACTAGTATTAACCGGTTTTGTATAGTTCATCCATGCCATGTGT<br />
|}<br />
</center><br />
When changing the fusing proteins to GFP N-terminal and CBD C-terminal an additional single GFP was cloned in a plasmid behind a J61101 RBS to see the expression of the J23100/J61101 promoter/RBS and to have a corresponding protein for the assay as a negative control. The result was the same as before, no green colonies. The colony PCRs and digestions showed the right bands, but no construct and even the single GFP was expressed correctly. Sequencing later showed that a deletion of one of the first few bases of the ORF caused a frame shift. At this point in time it seemed as if the promoter/RBS did not work properly.<br />
So in spite of continuing working as planed on the linker between GFP and the CBDs, the efforts now focused on the usage of promoter and RBS. In the last week of lab work it was tried to assemble GFP with a CBD behind the strong B0034 RBS, followed by cutting this piece out with ''Xba''I and ''Pst''I and ligate this insert via a standard suffix insertion with the J23100 promoter. After some unsuccessful attempts ''Age''I ran empty and could not be ordered in time. A last quick-shot with a PCR product of an old (but correct) assembly (CBDcex-GFP) and a single GFP_Freiburg went well in adding it to the RBS but did not show green glowing colonies when fused to the promoter.<br />
<br />
== Literature ==<br />
Kavoosi ''et al.'' (2007) Strategy for selecting and characterizing linker peptides for CBM9-tagged fusion proteins expressed in Escherichia coli. ''Biotechnol Bioeng.'' Oct 15;98(3):599-610.<br />
<br />
Urbanowicz ''et al.'' (2007) A tomato endo-beta-1,4-glucanase, SlCel9C1, represents a distinct subclass with a new family of carbohydrate binding modules (CBM49). ''J Biol Chem.'' Apr 20;282(16):12066-74. Epub 2007 Feb 23.<br />
<br />
Sugimoto ''et al.'' (2012) Cellulose affinity purification of fusion proteins tagged with fungal family 1 cellulose-binding domain. ''Protein Expr Purif.'' Apr;82(2):290-6. Epub 2012 Jan 28.<br />
<br />
Hong ''et al.'' (2008) Bioseparation of recombinant cellulose-binding module-proteins by affinity adsorption on an ultra-high-capacity cellulosic adsorbent. ''Anal Chim Acta.'' Jul 28;621(2):193-9. Epub 2008 May 27.<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/cbcTeam:Bielefeld-Germany/Results/cbc2012-10-27T03:47:30Z<p>Fougee: /* Introduction */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Cellulose Binding Domain <br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
</html><br />
__TOC__<br />
<br />
<br />
==Introduction==<br />
<div style="text-align:justify;"><br />
In the field of cheap protein-extraction, cellulose binding domains (CBD) have made themselves a name. A lot of publications are available providing capture of a protein from the cell-lysate with a CBD-tag as a cheap purification strategy. Also enhanced segregation with CBD-tagged proteins have been observed. In this project the idea is different, the binding of our self-produced proteins to cellulose via a protein-domain-tag is taking advantage of the binding capacity of binding domains not only for purification reasons (it is still a great benefit), but also as an immobilization procedure for our laccases for later application.<br />
<br />
[[Image:Bielefeld2012 Osaka3.jpg|500px|thumb|right|'''Figure 1:''' Graphical sequence-alignment of <partinfo>K392014</partinfo> and the [http://www.ncbi.nlm.nih.gov/nuccore/AB041993 ''xyn10A'' gene of ''C.josui'']]]<br />
To make a purification and immobilization-tag out of a protein domain, there are a lot of decisions and characterizations to do.<br />
<br />
Starting with the choice of the binding domain, the first limitation is accessibility. The first place to look at is of course the [http://partsregistry.org Partsregistry]. A promising Cellulose binding motif of the ''C. josui'' ''xyn10A'' gene (<partinfo>BBa_K392014</partinfo>) was found and ordered for the project right from the spot. After some research concerning the sequence of that BioBrick, it turned out that the part is not the CBD of the Xylanase as it should be, but the glycosyl hydrolase domain of the protein (Figure 1). This result made the part useless for the project ([http://partsregistry.org/Part:BBa_K392014:Experience complete review]) and it was the only binding domain in the [http://partsregistry.org Partsregistry] that fitted to the project.<br />
<br />
Accessible organisms were searched via NCBI for binding-domains, -proteins and -motifs and work groups were asked if they could help out. The results of the database research were only two chitin/carbohydrate binding modules within the ''Bacillus halodurans'' genome (that strain was ordered for its laccase <partinfo>BBa_K863020</partinfo>). One is in the [http://www.ncbi.nlm.nih.gov/nucleotide/289656506?report=genbank&log$=nuclalign&blast_rank=1&RID=0JPT9WMS01N Cochin chitinase gene] and the other in a [http://www.ncbi.nlm.nih.gov/protein/BAB05022.1 chitin binding protein].<br />
<br />
[[Image:Bielefeld2012_p714.jpg|200px|thumb|left|'''Figure 2:''' Plasmid-map of p714 with CBDcex; Origin: Fermentation group of Bielefeld University]][[Image:Bielefeld2012_p570.jpg|220px|thumb|left|'''Figure 3:''' Plasmid-map of p570 with CBDclos; Origin: Fermentation group of Bielefeld University]]<br />
<br />
Meanwhile the Fermentation group of our university offered the use of two plasmids (p570 & p671), containing cellulose binding domains. The cellulose binding domain of the [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase gene] (CBDcex) and the cellulose binding domain of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (''cbpA'')] (CBDclos). The decision was made to use these two domains. Staying within the cellulose binding domain-family and leave other protein domains like carbohydrate binding domains aside would keep the results comparable. For example, changing to a different binding material would change the binding capacities of both domains in the same way. Also both are bacterial CBDs and no post-translational modification and glycosylation had to be dealt with.<br />
<br />
To get to know more about these two domains, their properties and their proteins, the NCBI databases were consulted. [http://blast.ncbi.nlm.nih.gov/ BLAST] was used to identify the cellulose binding domains and ExPASy-tools were used for further analyses.<br />
<br><br><br />
<br />
[[Image:Bielefeld2012_pfam00553.jpg|150px|thumb|left|'''Figure 5:''' Predicted structure of the CBM_2-family made with Cn3D]]<br />
[[Image:Bielefeld2012_cfimiexo.jpg|450px|thumb|right|'''Figure 6:''' Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase]]]<br />
<br />
The CBD of the ''Cellulomonas fimi'' ATCC 484 exoglucanase gene (Figure 6) is a 100 amino acid long domain, close to the C-terminal ending of the protein with a theoretical pI of 8.07 and a molecular weight of 10.3 kDa. It is classified to be stable and belongs to the Cellulose Binding Modul family 2 (pfam00553/cl02709; Figure 5). Two tryptophane residues are involved in cellulose binding in this family which is only found in bacteria. Also, a CBM49 carbohydrate binding domain is found within the protein domain, where [http://www.ncbi.nlm.nih.gov/pubmed/17322304?dopt=Abstract binding studies] have shown, that it binds to crystalline cellulose, which could be a possible target for immobilization.<br />
<br />
[[Image:Bielefeld2012_ccellubp.jpg|450px|thumb|left|'''Figure 7:''' Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein (Cbp A)]]]<br />
[[Image:Bielefeld2012_pfam00942.jpg|150px|thumb|right|'''Figure 8:''' Predicted structure of the CBM_3-family made with Cn3D]]<br />
<br />
The CBD of the [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (''cbpA'')] on the other hand is a N-terminal domain with 92 amino acids, theoretical pI of 4.56 and is also classified as stable. It belongs to the Cellulose Binding Module family 3 (pfam00942/cl03026; Figure 8) and is part of a very large cellulose binding protein with four other carbohydrate binding modules and a lot of docking interfaces for the proteins in its amino acid sequence (Figure 7).<br />
<br />
==The Binding Assay==<br />
<br />
[[image:Bielefeld2012_GFP.jpg|300px|thumb|right|''Aequorea victoria'' green fluorescent protein in action]]<br />
To measure the capacity and strength of the bonding between the cellulose binding domains and different types of cellulose many different assays have been made. One of the simplest and most often used is the fusion of the CBD to a reporter-protein, especially [http://www.ncbi.nlm.nih.gov/pubmed/22305911a green or red fluorescent protein (GFP/RFP)] is very common. The place of the CBD is measured through the fluorescence of the fused GFP and quantification can easily been done.<br />
<br />
[http://www.ncbi.nlm.nih.gov/pubmed/18573384 Protocol]:<br />
* Harvest the ''E coli''-cells producing the fusion-protein of CBD and GFP and centifuge 10 minutes at top speed.<br />
* Re-suspend the cell-pellet in 50 mM Tris-HCl-Buffer (pH 8.0).<br />
* Break down cells via sonication.<br />
* Centrifuge at top speed for 20 minutes to get rid of the cell-debris. <br />
* Take the supernatant and measure the emission at 511 nm (excitation at 501 nm) (<partinfo>E0040</partinfo>)<br />
* Mix a definite volume of lysate with a definite volume or mass of e.g. crystalline cellulose (CC) or reactivated amorphous cellulose (RAC)<br />
* Wait 15 (RAC) to 30 (CC) minutes <br />
* Take supernatant and measure the emission at 511 nm again. <br />
* The difference between the first an the second measurement is the relative quantity of what has bound to the cellulose.<br />
<br />
==Cloning of the Cellulose Binding Domains==<br />
<br />
The cloning of the CBDs should fit to the cloning of our laccases, so the BioBricks were designed with a T7-promoter and the B0034 RBS to have a similar method of cultivation. After investigating the restriction-sites it was found, that at least for the characterization of the CBDs a quick in-frame assembly of the CBDs and a GFP would be possible, because neither the CBDs nor the GFP (<partinfo>I13522</partinfo>) of the Partsregistry inherits a ''Age''I- or ''Ngo''MIV-site, which makes Freiburg-assembly possible. To do so, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] for the constructs <partinfo>BBa_K863101</partinfo> (CBDcex(T7)), carrying the CBDcex domain from the ''C. fimi'' exoglucanase and <partinfo>BBa_K863111</partinfo> (CBDclos(T7)), carrying the CBDclos domain from the ''C.cellulovorans'' binding protein were designed. The protein-BLAST of the two CBDs gave an exact picture of which bases belong to the binding domains and which do not. To be sure not to disturb the folding anyway 6 to 12 bases up and downstream of the domains as conserved sequences were kept. Even if the [http://partsregistry.org/Part:BBa_K863101 CBDcex]is an C-terminal domain both domains were made N-terminal, so the BioBricks can carry all regulatory parts and the linked protein can easily be exchanged. This would also be nice for other people using this part.<br />
<br />
<center><br />
{|class="wikitable"<br />
| CBDcex_T7RBS|| 80 || TGAATTCGCGGCCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGGGT<br />CCGGCCGGGTGCCAGGT<br />
|-<br />
| CBDcex_2AS-Link_compl || 56 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCGCCGACCGTGCAGGGCGTGC<br />
|-<br />
| CBDclos_T7RBS || 73 || CCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGTCAGTTGAATTTTACAACTCTAAC<br />
|-<br />
| CBDclos_2ASlink_compl|| 63 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCTGCAAATCCAAATTCAACATATGTATC<br />
|}<br />
</center><br />
<br />
The listed complementary primers added, besides the Freiburg-suffix, a two amino acid glycine-serine-linker to the end of the CBDs. This is a very short linker, but as GFP-experts and [http://www.ncbi.nlm.nih.gov/pubmed/17394253 publications] described GFP and CBDs are very stable proteins and should cope with a very short linker. The benefit of a short linker is that protease activity is kept minimal.<br />
<br />
The GFP <partinfo>K863121</partinfo> used in the assay was an alternated version of the <partinfo>BBa_I13522</partinfo>. The [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] that were made added a Freiburg-pre- and suffix to the GFP coding sequence and a His-tag to the C-terminus to get it purified for the measurements. This part <partinfo>BBa_K863121</partinfo> (GFP_His) should be easily added to the CBDs and assembled to the fusion-proteins <partinfo>BBa_K863103</partinfo> CBDcex(T7)+GFP_His and <partinfo>BBa_K863113</partinfo> CBDclos(T7)+GFP_His.<br />
<br />
<center><br />
{|class="wikitable"<br />
| GFP_Frei || 54 || TACGGAATTCGCGGCCGCTTCTAGATGGCCGGCATGCGTAAAGGAGAAGAACTT<br />
|-<br />
| GFP_His6_compl || 74 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGTGATGGTGATGGTGATGTTTGTATAGTTCATCCATGCCATGTG<br />
|}<br />
</center><br />
<br />
Since a His-tag was added to the end of the GFP, an alternate version of the <partinfo>BBa_I13522</partinfo> had to be made to compare binding of GFP with and without CBD. Therefore, a forward primer was made, to amplify the whole <partinfo>BBa_I13522</partinfo> with the GFP_His_compl-primer to add the His-tag to the C-terminus.<br />
<br />
<center><br />
{|class="wikitable"<br />
| GFP_FW_SV || 39 || acgtcacctgcgtgtagctCGTAAAGGAGAAGAACTTTT<br />
|}<br />
</center><br />
Due to bad cleavage efficiency at the ''Pst''I restriction-site in nearly all PCR-products the cloning of the CBDs ([http://partsregistry.org/Part:BBa_K863102 CBDcex(T7)] and [http://partsregistry.org/Part:BBa_K863112 CBDclos(T7)]) and especially the insertion of [http://partsregistry.org/Part:BBa_K863121 GFP_His] to the CBDs took a lot more time as expected. This was due to the fact that no additional bases were added to the 5<nowiki>'</nowiki> termini of the designed primers, thereby greatly reducing cleavage efficiency. When the problem was discovered and protocols adjusted or primers extended, cloning got a lot quicker and more successful.<br />
<br />
As the project went on the T7-constructs did not seem to work. One suspected reason was that a stop codon (TAA) that was accidentally introduced between the RBS and ATG could be the reason. To solve the problem a change to a constitutive promoter (<partinfo>BBa_J61101</partinfo>) was made using the Freiburg-assembly. Therefore Freiburg forward primers for the CBDs were made.<br />
<center><br />
{|class="wikitable"<br />
| CBDcex_Freiburg-Prefix|| 54 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCGGTCCGGCCGGGTGCCAGGTG<br />
|-<br />
| CBDclos_Freiburg-Prefix || 57 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCTCATCAATGTCAGTTGAATTTTAC<br />
|}<br />
</center><br />
<br />
The primers arrived just a few days before wiki freeze (Europe). Switching to the constitutive promoter had no obvious effect (no green colonies or culture), neither had changing the expression strain from ''E. coli'' KRX to ''E. coli'' BL21 for the T7-construct.<br />
<br />
==Since Regionals==<br />
<br />
After Amsterdam two approaches were made. One changing the order of the fused proteins and one altering the linker between CBD and the GFP. Both started simultaneously. [[File:Bielefeld2012_S3N10linker.jpg|500px|thumb|right|PCR-product of BBa_K863104 with S3N10-primers]]<br />
One reason for the problems could be the too short space in between the two proteins, resulting in CBD and GFP hampering each other from folding correctly. To test and solve this, a very long linker with three serines followed by ten asparagines should be assembled in the already existing parts via a blunt end cloning.<br />
<center><br />
{|class="wikitable"<br />
| S3N10_Cex_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCCGACCGTGCAGGGCGTGC<br />
|-<br />
| S3N10_Clos_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCTGCCGCCGACCGTGCAGG<br />
|-<br />
| S3N10_GFP || 40 || CAATAACAATAACAACAACCGTAAAGGAGAAGAACTTTTC<br />
|}<br />
</center><br />
While the PCR worked properly, ligation of the linearized new plasmid was not successful and no transformed colonies could be found in two attempts. A reason for this could be insufficient phosphorylation of the PCR product.<br />
Because already Freiburg pre- and suffix primers for the CBDs were at hand the order of the fusion proteins could easily been changed, when a Freiburg suffix primer for the GFP would be available, so it was ordered.<br />
<center><br />
{|class="wikitable"<br />
| GFP_Freiburg_compl || 61 || ACGTCTGCAGCGGCCGCTACTAGTATTAACCGGTTTTGTATAGTTCATCCATGCCATGTGT<br />
|}<br />
</center><br />
When changing the fusing proteins to GFP N-terminal and CBD C-terminal an additional single GFP was cloned in a plasmid behind a J61101 RBS to see the expression of the J23100/J61101 promoter/RBS and to have a corresponding protein for the assay as a negative control. The result was the same as before, no green colonies. The colony PCRs and digestions showed the right bands, but no construct and even the single GFP was expressed correctly. Sequencing later showed that a deletion of one of the first few bases of the ORF caused a frame shift. At this point in time it seemed as if the promoter/RBS did not work properly.<br />
So in spite of continuing working as planed on the linker between GFP and the CBDs, the efforts now focused on the usage of promoter and RBS. In the last week of lab work it was tried to assemble GFP with a CBD behind the strong B0034 RBS, followed by cutting this piece out with ''Xba''I and ''Pst''I and ligate this insert via a standard suffix insertion with the J23100 promoter. After some unsuccessful attempts ''Age''I ran empty and could not be ordered in time. A last quick-shot with a PCR product of an old (but correct) assembly (CBDcex-GFP) and a single GFP_Freiburg went well in adding it to the RBS but did not show green glowing colonies when fused to the promoter.<br />
<br />
== Literature ==<br />
Kavoosi ''et al.'' (2007) Strategy for selecting and characterizing linker peptides for CBM9-tagged fusion proteins expressed in Escherichia coli. ''Biotechnol Bioeng.'' Oct 15;98(3):599-610.<br />
<br />
Urbanowicz ''et al.'' (2007) A tomato endo-beta-1,4-glucanase, SlCel9C1, represents a distinct subclass with a new family of carbohydrate binding modules (CBM49). ''J Biol Chem.'' Apr 20;282(16):12066-74. Epub 2007 Feb 23.<br />
<br />
Sugimoto ''et al.'' (2012) Cellulose affinity purification of fusion proteins tagged with fungal family 1 cellulose-binding domain. ''Protein Expr Purif.'' Apr;82(2):290-6. Epub 2012 Jan 28.<br />
<br />
Hong ''et al.'' (2008) Bioseparation of recombinant cellulose-binding module-proteins by affinity adsorption on an ultra-high-capacity cellulosic adsorbent. ''Anal Chim Acta.'' Jul 28;621(2):193-9. Epub 2008 May 27.<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/cbcTeam:Bielefeld-Germany/Results/cbc2012-10-27T03:45:19Z<p>Fougee: /* Introduction */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Cellulose Binding Domain <br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
</html><br />
__TOC__<br />
<br />
<br />
==Introduction==<br />
<div style="text-align:justify;"><br />
In the field of cheap protein-extraction, cellulose binding domains (CBD) have made themselves a name. A lot of publications are available providing capture of a protein from the cell-lysate with a CBD-tag as a cheap purification strategy. Also enhanced segregation with CBD-tagged proteins have been observed. In this project the idea is different, the binding of our self-produced proteins to cellulose via a protein-domain-tag is taking advantage of the binding capacity of binding domains not only for purification reasons (it is still a great benefit), but also as an immobilization procedure for our laccases for later application.<br />
<br />
[[Image:Bielefeld2012 Osaka3.jpg|500px|thumb|right|'''Figure 1:''' Graphical sequence-alignment of <partinfo>K392014</partinfo> and the [http://www.ncbi.nlm.nih.gov/nuccore/AB041993 ''xyn10A'' gene of ''C.josui'']]]<br />
To make a purification and immobilization-tag out of a protein domain, there are a lot of decisions and characterizations to do.<br />
<br />
Starting with the choice of the binding domain, the first limitation is accessibility. The first place to look at is of course the [http://partsregistry.org Partsregistry]. A promising Cellulose binding motif of the ''C. josui'' ''xyn10A'' gene (<partinfo>BBa_K392014</partinfo>) was found and ordered for the project right from the spot. After some research concerning the sequence of that BioBrick, it turned out that the part is not the CBD of the Xylanase as it should be, but the glycosyl hydrolase domain of the protein (Figure 1). This result made the part useless for the project ([http://partsregistry.org/Part:BBa_K392014:Experience complete review]) and it was the only binding domain in the [http://partsregistry.org Partsregistry] that fitted to the project.<br />
<br />
Accessible organisms were searched via NCBI for binding-domains, -proteins and -motifs and work groups were asked if they could help out. The results of the database research were only two chitin/carbohydrate binding modules within the ''Bacillus halodurans'' genome (that strain was ordered for its laccase <partinfo>BBa_K863020</partinfo>). One is in the [http://www.ncbi.nlm.nih.gov/nucleotide/289656506?report=genbank&log$=nuclalign&blast_rank=1&RID=0JPT9WMS01N Cochin chitinase gene] and the other in a [http://www.ncbi.nlm.nih.gov/protein/BAB05022.1 chitin binding protein].<br />
<br />
[[Image:Bielefeld2012_p714.jpg|200px|thumb|left|'''Figure 2:''' Plasmid-map of p714 with CBDcex; Origin: Fermentation group of Bielefeld University]][[Image:Bielefeld2012_p570.jpg|220px|thumb|left|Figure 3: Plasmid-map of p570 with CBDclos; Origin: Fermentation group of Bielefeld University]]<br />
<br />
Meanwhile the Fermentation group of our university offered the use of two plasmids (p570 & p671), containing cellulose binding domains. The cellulose binding domain of the [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase gene] (CBDcex) and the cellulose binding domain of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (''cbpA'')] (CBDclos). The decision was made to use these two domains. Staying within the cellulose binding domain-family and leave other protein domains like carbohydrate binding domains aside would keep the results comparable. For example, changing to a different binding material would change the binding capacities of both domains in the same way. Also both are bacterial CBDs and no post-translational modification and glycosylation had to be dealt with.<br />
<br />
To get to know more about these two domains, their properties and their proteins, the NCBI databases were consulted. [http://blast.ncbi.nlm.nih.gov/ BLAST] was used to identify the cellulose binding domains and ExPASy-tools were used for further analyses.<br />
<br><br><br />
<br />
[[Image:Bielefeld2012_pfam00553.jpg|150px|thumb|left|'''Figure 5:''' Predicted structure of the CBM_2-family made with Cn3D]]<br />
[[Image:Bielefeld2012_cfimiexo.jpg|450px|thumb|right|'''Figure 6:''' Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N ''Cellulomonas fimi'' ATCC 484 exoglucanase]]]<br />
<br />
The CBD of the ''Cellulomonas fimi'' ATCC 484 exoglucanase gene (Figure 6) is a 100 amino acid long domain, close to the C-terminal ending of the protein with a theoretical pI of 8.07 and a molecular weight of 10.3 kDa. It is classified to be stable and belongs to the Cellulose Binding Modul family 2 (pfam00553/cl02709; Figure 5). Two tryptophane residues are involved in cellulose binding in this family which is only found in bacteria. Also, a CBM49 carbohydrate binding domain is found within the protein domain, where [http://www.ncbi.nlm.nih.gov/pubmed/17322304?dopt=Abstract binding studies] have shown, that it binds to crystalline cellulose, which could be a possible target for immobilization.<br />
<br />
[[Image:Bielefeld2012_ccellubp.jpg|450px|thumb|left|'''Figure 7:''' Protein-BLAST of [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein (Cbp A)]]]<br />
[[Image:Bielefeld2012_pfam00942.jpg|150px|thumb|right|'''Figure 8:''' Predicted structure of the CBM_3-family made with Cn3D]]<br />
<br />
The CBD of the [http://www.ncbi.nlm.nih.gov/nuccore/M73817 ''Clostridium cellulovorans'' cellulose binding protein gene (''cbpA'')] on the other hand is a N-terminal domain with 92 amino acids, theoretical pI of 4.56 and is also classified as stable. It belongs to the Cellulose Binding Module family 3 (pfam00942/cl03026; Figure 8) and is part of a very large cellulose binding protein with four other carbohydrate binding modules and a lot of docking interfaces for the proteins in its amino acid sequence (Figure 7).<br />
<br />
==The Binding Assay==<br />
<br />
[[image:Bielefeld2012_GFP.jpg|300px|thumb|right|''Aequorea victoria'' green fluorescent protein in action]]<br />
To measure the capacity and strength of the bonding between the cellulose binding domains and different types of cellulose many different assays have been made. One of the simplest and most often used is the fusion of the CBD to a reporter-protein, especially [http://www.ncbi.nlm.nih.gov/pubmed/22305911a green or red fluorescent protein (GFP/RFP)] is very common. The place of the CBD is measured through the fluorescence of the fused GFP and quantification can easily been done.<br />
<br />
[http://www.ncbi.nlm.nih.gov/pubmed/18573384 Protocol]:<br />
* Harvest the ''E coli''-cells producing the fusion-protein of CBD and GFP and centifuge 10 minutes at top speed.<br />
* Re-suspend the cell-pellet in 50 mM Tris-HCl-Buffer (pH 8.0).<br />
* Break down cells via sonication.<br />
* Centrifuge at top speed for 20 minutes to get rid of the cell-debris. <br />
* Take the supernatant and measure the emission at 511 nm (excitation at 501 nm) (<partinfo>E0040</partinfo>)<br />
* Mix a definite volume of lysate with a definite volume or mass of e.g. crystalline cellulose (CC) or reactivated amorphous cellulose (RAC)<br />
* Wait 15 (RAC) to 30 (CC) minutes <br />
* Take supernatant and measure the emission at 511 nm again. <br />
* The difference between the first an the second measurement is the relative quantity of what has bound to the cellulose.<br />
<br />
==Cloning of the Cellulose Binding Domains==<br />
<br />
The cloning of the CBDs should fit to the cloning of our laccases, so the BioBricks were designed with a T7-promoter and the B0034 RBS to have a similar method of cultivation. After investigating the restriction-sites it was found, that at least for the characterization of the CBDs a quick in-frame assembly of the CBDs and a GFP would be possible, because neither the CBDs nor the GFP (<partinfo>I13522</partinfo>) of the Partsregistry inherits a ''Age''I- or ''Ngo''MIV-site, which makes Freiburg-assembly possible. To do so, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] for the constructs <partinfo>BBa_K863101</partinfo> (CBDcex(T7)), carrying the CBDcex domain from the ''C. fimi'' exoglucanase and <partinfo>BBa_K863111</partinfo> (CBDclos(T7)), carrying the CBDclos domain from the ''C.cellulovorans'' binding protein were designed. The protein-BLAST of the two CBDs gave an exact picture of which bases belong to the binding domains and which do not. To be sure not to disturb the folding anyway 6 to 12 bases up and downstream of the domains as conserved sequences were kept. Even if the [http://partsregistry.org/Part:BBa_K863101 CBDcex]is an C-terminal domain both domains were made N-terminal, so the BioBricks can carry all regulatory parts and the linked protein can easily be exchanged. This would also be nice for other people using this part.<br />
<br />
<center><br />
{|class="wikitable"<br />
| CBDcex_T7RBS|| 80 || TGAATTCGCGGCCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGGGT<br />CCGGCCGGGTGCCAGGT<br />
|-<br />
| CBDcex_2AS-Link_compl || 56 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCGCCGACCGTGCAGGGCGTGC<br />
|-<br />
| CBDclos_T7RBS || 73 || CCGCTTCTAGAGTAATACGACTCACTATAGGGAAAGAGGAGAAATAATGTCAGTTGAATTTTACAACTCTAAC<br />
|-<br />
| CBDclos_2ASlink_compl|| 63 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCTGCAAATCCAAATTCAACATATGTATC<br />
|}<br />
</center><br />
<br />
The listed complementary primers added, besides the Freiburg-suffix, a two amino acid glycine-serine-linker to the end of the CBDs. This is a very short linker, but as GFP-experts and [http://www.ncbi.nlm.nih.gov/pubmed/17394253 publications] described GFP and CBDs are very stable proteins and should cope with a very short linker. The benefit of a short linker is that protease activity is kept minimal.<br />
<br />
The GFP <partinfo>K863121</partinfo> used in the assay was an alternated version of the <partinfo>BBa_I13522</partinfo>. The [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Primers primers] that were made added a Freiburg-pre- and suffix to the GFP coding sequence and a His-tag to the C-terminus to get it purified for the measurements. This part <partinfo>BBa_K863121</partinfo> (GFP_His) should be easily added to the CBDs and assembled to the fusion-proteins <partinfo>BBa_K863103</partinfo> CBDcex(T7)+GFP_His and <partinfo>BBa_K863113</partinfo> CBDclos(T7)+GFP_His.<br />
<br />
<center><br />
{|class="wikitable"<br />
| GFP_Frei || 54 || TACGGAATTCGCGGCCGCTTCTAGATGGCCGGCATGCGTAAAGGAGAAGAACTT<br />
|-<br />
| GFP_His6_compl || 74 || CTGCAGCGGCCGCTACTAGTATTAACCGGTGTGATGGTGATGGTGATGTTTGTATAGTTCATCCATGCCATGTG<br />
|}<br />
</center><br />
<br />
Since a His-tag was added to the end of the GFP, an alternate version of the <partinfo>BBa_I13522</partinfo> had to be made to compare binding of GFP with and without CBD. Therefore, a forward primer was made, to amplify the whole <partinfo>BBa_I13522</partinfo> with the GFP_His_compl-primer to add the His-tag to the C-terminus.<br />
<br />
<center><br />
{|class="wikitable"<br />
| GFP_FW_SV || 39 || acgtcacctgcgtgtagctCGTAAAGGAGAAGAACTTTT<br />
|}<br />
</center><br />
Due to bad cleavage efficiency at the ''Pst''I restriction-site in nearly all PCR-products the cloning of the CBDs ([http://partsregistry.org/Part:BBa_K863102 CBDcex(T7)] and [http://partsregistry.org/Part:BBa_K863112 CBDclos(T7)]) and especially the insertion of [http://partsregistry.org/Part:BBa_K863121 GFP_His] to the CBDs took a lot more time as expected. This was due to the fact that no additional bases were added to the 5<nowiki>'</nowiki> termini of the designed primers, thereby greatly reducing cleavage efficiency. When the problem was discovered and protocols adjusted or primers extended, cloning got a lot quicker and more successful.<br />
<br />
As the project went on the T7-constructs did not seem to work. One suspected reason was that a stop codon (TAA) that was accidentally introduced between the RBS and ATG could be the reason. To solve the problem a change to a constitutive promoter (<partinfo>BBa_J61101</partinfo>) was made using the Freiburg-assembly. Therefore Freiburg forward primers for the CBDs were made.<br />
<center><br />
{|class="wikitable"<br />
| CBDcex_Freiburg-Prefix|| 54 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCGGTCCGGCCGGGTGCCAGGTG<br />
|-<br />
| CBDclos_Freiburg-Prefix || 57 || GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCTCATCAATGTCAGTTGAATTTTAC<br />
|}<br />
</center><br />
<br />
The primers arrived just a few days before wiki freeze (Europe). Switching to the constitutive promoter had no obvious effect (no green colonies or culture), neither had changing the expression strain from ''E. coli'' KRX to ''E. coli'' BL21 for the T7-construct.<br />
<br />
==Since Regionals==<br />
<br />
After Amsterdam two approaches were made. One changing the order of the fused proteins and one altering the linker between CBD and the GFP. Both started simultaneously. [[File:Bielefeld2012_S3N10linker.jpg|500px|thumb|right|PCR-product of BBa_K863104 with S3N10-primers]]<br />
One reason for the problems could be the too short space in between the two proteins, resulting in CBD and GFP hampering each other from folding correctly. To test and solve this, a very long linker with three serines followed by ten asparagines should be assembled in the already existing parts via a blunt end cloning.<br />
<center><br />
{|class="wikitable"<br />
| S3N10_Cex_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCCGACCGTGCAGGGCGTGC<br />
|-<br />
| S3N10_Clos_compl || 40 || TTGTTGTTGTTCGAGCTCGAGCTGCCGCCGACCGTGCAGG<br />
|-<br />
| S3N10_GFP || 40 || CAATAACAATAACAACAACCGTAAAGGAGAAGAACTTTTC<br />
|}<br />
</center><br />
While the PCR worked properly, ligation of the linearized new plasmid was not successful and no transformed colonies could be found in two attempts. A reason for this could be insufficient phosphorylation of the PCR product.<br />
Because already Freiburg pre- and suffix primers for the CBDs were at hand the order of the fusion proteins could easily been changed, when a Freiburg suffix primer for the GFP would be available, so it was ordered.<br />
<center><br />
{|class="wikitable"<br />
| GFP_Freiburg_compl || 61 || ACGTCTGCAGCGGCCGCTACTAGTATTAACCGGTTTTGTATAGTTCATCCATGCCATGTGT<br />
|}<br />
</center><br />
When changing the fusing proteins to GFP N-terminal and CBD C-terminal an additional single GFP was cloned in a plasmid behind a J61101 RBS to see the expression of the J23100/J61101 promoter/RBS and to have a corresponding protein for the assay as a negative control. The result was the same as before, no green colonies. The colony PCRs and digestions showed the right bands, but no construct and even the single GFP was expressed correctly. Sequencing later showed that a deletion of one of the first few bases of the ORF caused a frame shift. At this point in time it seemed as if the promoter/RBS did not work properly.<br />
So in spite of continuing working as planed on the linker between GFP and the CBDs, the efforts now focused on the usage of promoter and RBS. In the last week of lab work it was tried to assemble GFP with a CBD behind the strong B0034 RBS, followed by cutting this piece out with ''Xba''I and ''Pst''I and ligate this insert via a standard suffix insertion with the J23100 promoter. After some unsuccessful attempts ''Age''I ran empty and could not be ordered in time. A last quick-shot with a PCR product of an old (but correct) assembly (CBDcex-GFP) and a single GFP_Freiburg went well in adding it to the RBS but did not show green glowing colonies when fused to the promoter.<br />
<br />
== Literature ==<br />
Kavoosi ''et al.'' (2007) Strategy for selecting and characterizing linker peptides for CBM9-tagged fusion proteins expressed in Escherichia coli. ''Biotechnol Bioeng.'' Oct 15;98(3):599-610.<br />
<br />
Urbanowicz ''et al.'' (2007) A tomato endo-beta-1,4-glucanase, SlCel9C1, represents a distinct subclass with a new family of carbohydrate binding modules (CBM49). ''J Biol Chem.'' Apr 20;282(16):12066-74. Epub 2007 Feb 23.<br />
<br />
Sugimoto ''et al.'' (2012) Cellulose affinity purification of fusion proteins tagged with fungal family 1 cellulose-binding domain. ''Protein Expr Purif.'' Apr;82(2):290-6. Epub 2012 Jan 28.<br />
<br />
Hong ''et al.'' (2008) Bioseparation of recombinant cellulose-binding module-proteins by affinity adsorption on an ultra-high-capacity cellulosic adsorbent. ''Anal Chim Acta.'' Jul 28;621(2):193-9. Epub 2008 May 27.<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/substrateTeam:Bielefeld-Germany/Results/substrate2012-10-27T03:41:19Z<p>Fougee: /* HPLC analysis of polycylic aromatic hydrocarbons */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Substrate Analysis<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
__TOC__<br />
<br />
== Introduction ==<br />
To investigate the degradation of different substrates with laccases several experiments were performed. For the measurements the four produced bacterial laccases (BHAL, ECOL, TTHL and BPUL) were used. The reactions were measured before and after an incubation with the laccases via high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry. The HPLC was used particularly for analysis of degradation rates after defined time points. With these results it is possible to compare the different laccases in respect to their degradation feasibilities.<br />
To detect degradation products of estradiol and ethinyl estradiol after laccase treatment different analysis via LC-MS and LC-MS-MS were done. We identified two compounds for both, estradiol and ethinyl estradiol, which are probable degradation products after laccase treatment.<br />
<br />
=Degradation measurements with high performance liquid chromatography=<br />
==Dilution series of different estrogens==<br />
<br />
[[File:Bielefeld2012_EthinylEstradiol.jpg|400px|thumb|right|'''Figure 1:''' The calibration curve of ethinyl estradiol as an example. The concentrations were measured between 0.1 µg mL <sup>-1</sup> and 3 µg mL <sup>-1</sup>.]]<br />
<br />
At first dilution series of all different substrates were measured. It was possible to measure calibration curves for estradiol and ethinyl estradiol but not for estrone. This was probably caused by its bad solubility. <br />
The retention time for estradiol is 4.4 minutes and for ethinyl estradiol 4.9 minutes. For all estrogens the same extinction and emission values could be used: Ex<sub>230</sub>, Em<sub>310</sub>.<br />
<br style="clear: both" /><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Degradation of estrogens==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3:''' Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added. The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
=Spectrofluorophotometer Analysis=<br />
<div style="text-align:justify;"><br />
We analyzed the degradation of our substrates with a spectrofluorophotometer. As you can see in the figures below the ethinyl estradiol and estradiol are degraded over night. Figure 4 shows the ethinyl estradiol without laccase treatment, Figure 5 shows that no more ethinyl estradiol can be detected in the sample after the degradation and new peaks appear which might represent possible degradation products. In Figure 6 you can see the estradiol control without laccases. Like ethinyl estradiol theestradiol peak is reduced after the degradation and new peaks appear indicating that those are new degradation products.<br />
[[File:Bielefeld2012-ethinylestradiol-withoutLaccase-spectrofluorophotometer.JPG|thumb|350px|left|'''Figure 4:''' Ethinyl estradiol control without laccases. Ethinyl estradiol was measured in spectrofluorophotometer without laccase treatment to have a control.]] [[File:Bielefeld2012-Ethinylestradiol-verdau-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 5:''' Ethinyl estradiol degradation (with TVEL0). The ethinyl estradiol peak disappeared and some new peaks, probable degradation products, occurred.]]<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012-estradiol-control-spectroflurophotometer.JPG|thumb|350px|left|'''Figure 6:''' Estradiol control without laccases.]]<br />
[[File:Bielefeld2012-estradiol-degradation-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 7:''' Degradation (with TVEL0) of estradiol. It is shown that some estradiol is left but probable degradation products appeared.]]<br />
<br style="clear: both" /><br />
<br />
=Liquid chromatography–mass spectrometry=<br />
=== Dilution series ===<br />
Our substrates are soluble in methanol. We set the standards to a concentration of 1 mg mL<sup>-1</sup>. The detection limit for the LC-MS was evaluated at a concentration of 10 µg L<sup>-1</sup> for the substrates estrone and estradiol. The same limit of detection was used for ethinyl estradiol and anthracene. We only used those four substrates. For all LC-MS sample preparations we used the ''T. versicolor'' laccases. The dilution series was prepared in methanol and 50 % acetonitril-water (v/v).<br />
<br />
[[File:Bielefeld2012-calibrationcurve-Anthracen.jpg|thumb|400px|left|'''Figure 8:''' Anthracene calibration curve. ]]<br />
[[File:Bielefeld2012-Estrone-calibrationcurve.JPG|thumb|400px|right|'''Figure 9:''' Estrone calibration curve.]]<br />
<br style="clear: both" /><br />
<br />
=== Degradation results ===<br />
The TVEL0 was able to degrade the synthetic estradiol (Fig. 10) and probably anthracene (Fig. 12). The ethinyl estradiol control showed that it is stable in the used media (Fig. 11). Anthracene disintegrates in the Britton Robinsoon Buffer. But it could be observed, that there is less anthracene measurable with the LC-MS. The results indicate, that the laccase is able to degrade anthracene (Fig. 13). Estrone (Fig. 14) and estradiol (Fig. 15) were degraded as well. Using estrone it could not be identify any degradation products. The reason for this could be that the products are not detectable with LC-MS or with the applied methods. Peaks in the degradation of estradiol have been shown but we were not able to identify them. It could be degradation products. In the following figures the results of the LC-MS measurements are presented. <br />
[[File:Bielefeld2012-Ethinylestradiol-degradation-LCMS.JPG|thumb|left|350px|'''Figure 10:''' Ethinyl estradiol + TVEL0 measured by LC-MS. It is shown that the over night sample has only half of the substrate left.]] <br />
[[File:Bielefeld2012-Anthracen-degradation-LCMS.JPG|thumb|right|350px|'''Figure 12:''' Anthracene + TVEL0. In the over night sample there are no detectable amounts of anthracene left.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Anthracen-standart1.JPG|right|thumb|350px|'''Figure 13:''' The negative control for anthracene without laccases. It is shown the concentration of anthracene decreases. This is caused by the Britton Robinson Buffer.]]<br />
[[File:Bielefeld2012-Ethinylestradiol-standart100.JPG|thumb|left|350px|'''Figure 11:''' Our ethinyl estradiol negative control without laccase. Variation on the peaks is probably caused by a pipetting mistake.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Estrone-degradation-LCMS.JPG|thumb|left|350px|'''Figure 14:''' Estrone + TVEL0. The peaks shows that estrone is degraded but after incubation over night it is still estrone left.]]<br />
[[File:Bielefeld2012-Estradiol-degradation-LCMS.JPG|thumb|right|350px|'''Figure 15:''' Estradiol degradation analyses with mass-spectrometry. On the X-axis the retention time is listed. The Y-axis shows the mass/charge ratio. From white to red the intensity of the measured samples is presented. On the figure above you can see the t<sub>0</sub> estradiol while the figure below shows the degradation. The analytes retended in the first minute are the media soillings. Since we know that the retention time of estradiol is on min 5 we could see that over night no more estradiol is left and some other peaks appear which are probably degradation products]]<br />
<br style="clear: both" /> <br />
We also tried to measure the degradation using mass-spectrometry. Since quantification via mass-spectrometry is difficult regarding the ionization of the analytes, we quantified our substrates by UV-light. Nevertheless, mass spectrometry enables identification of possible degradation products. We analyzed estradiol degradation in detail (Fig. 15), resulting in the detection of possible chemical compounds generated during the (enzymatic) degradation.<br />
<br style="clear: both" /><br />
<br />
=== Further analysis (after Regionals Amsterdam) ===<br />
Since we have seen some possible degradation products, we used more estradiol, ethinyl estradiol (250µg L<sup> -1 </sup> compare to 50µg L<sup> -1 </sup>) and more laccase (0,35U compare to 0,1U) for the reaction to the LC-MS measurement. We found out that after the laccase treatment two new peaks appeared in both the estradiol and ethinyl estradiol. A check against databases could not identify those components so we did an MS-MS on component A respectivly on component C. Since component B is fewer in concentration then component A, we could not find out anything about it (Fig. 16 and Fig. 17). To note the chemical formulares are M+H values. For the real chemical formula you have to deduct this H. <br />
[[File:Bielefeld2012-Estradiol-MS-measurement.JPG|thumb|350px|left|'''Figure 16:''' Mass spectromerty measurement of estradiol. On the X-axis you can see the Time in minutes and on the Y-axis the relative intensity. You can see two new peaks component A and B after laccase treatment. Component A was taken for MS-MS]]<br />
[[File:Bielefeld2012-EthinylEstradiol-MS-measurement.JPG|thumb|350px|right|'''Figure 17:''' Mass spectromerty measurement of ethinyl estradiol. On the X-axis you can see the time in minutes and on the Y-axis the relative intensity. You can see two new peaks component C and D after laccase treatment. Component C was taken for MS-MS]]<br />
<br style="clear: both" /><br />
<br />
The tandem mass spectrometry results showed two peaks in every measurement for possible degradation products. Compared to the native estradiol the component A peak embodies a molecule with two hydrogen atoms less than the native, the same does component C for ethinly estradiol. These peaks were discussed in a short chat with Prof. Dr. Dietmar Kuck, an organic chemist with a lot experience in mass spectrometry. This conversation led to two plausible models for the degradation. The first was a reaction at the hydroxy group of the five-ring of the estradiol (Fig. 18), oxidizing it to a ketone (resulting in estrone as the degradation product). This idea seemed improbable, because ethinyl estradiol cannot be oxidized at that position, but its degradation product also had two hydrogen less than the native (it is impossible to oxidize the hydroxy group of the five-ring to a ketone without losing the ethinyl group or breaking the ring (Fig. 19)). The second model was that the laccase radicalizes the hydroxy group of the phenolic group of the estradiol and ethinyl estradiol, as described in literature, building a phenoxy radical in the first step. In the second step hydrogen is split off on the tertiary carbon in para position finally leading to a quinone like structure (Figure 19). Without knowing the mechanism behind this reaction, this seems the most probable model of the degradation.<br />
<br />
[[File:Bielefeld2012-estradiol-MS-kuck-suggest.JPG|thumb|350px|left|'''Figure 18:''' First possible structure of the degradation product (component A) after laccase treatment. The secondary alcohol is oxidized to a ketone and the product corresponds to estrone. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
[[File:Bielefeld2012-EE2-MSMS-suggestion-Kuck.JPG|thumb|350px|right|'''Figure 19:''' Suggested chemical structure of the oxidized ethinyl estradiol. The phenolic part of the molecule has changed in a quinone like structure. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
<br style="clear: both" /> <br />
The second peaks in the chromatograms (component B and D) embody molecules with two oxygen more and two hydrogen less than the native. We postulate that this might be a transition state where O<sub>2</sub> is radically added to the phenolic ring in otho- and meta-position. To that point, there is no data to consolidate this adoption. Component B and D were also fragmented in the tandem mass spectrometry for further analysis, but the resulting peaks could not be differed from the background noise.<br />
<br style="clear: both" /><br />
<br />
= Further substrate analysis via HPLC =<br />
== HPLC analysis of polycylic aromatic hydrocarbons ==<br />
The results of our negative control measurements of polycyclic aromatic hydrocarbons showed that the PAHs decayed without laccase treatment after one hour in Britton Robinson (BR)-buffer. This is shown in Figure 20. <br>The next step was to check which substances in the reaction approach may cause the decay. Therefore naphthalene was dissolved in methanol (which is the solvent for the substrate and used for stopping the reaction), acetonitrile (which could be used as alternative solvent) and BR-buffer with and without ABTS. The results are shown in Figure 21. Using pure methanol and acetonitrile naphthalene is not decayed. In BR-buffer with and without ABTS the decay is nearly completed after one hour treatment. So BR-buffer seems a bad choice to test the degradation of naphtalene under laccase treatment. <br />
[[File:Bielefeld2012_PAH.png|400px|thumb|left|''' Figure 20:''' Decay of the PAHs naphthalene, acenaphthene and phenantrene in BR-buffer at 30 °C after one hour. The initial concentration was 1 µg mL <sup>-1</sup> for all PAHs. After one hour nearly all PAHs decayed completely. (n=2)]]<br />
[[File:Bielefeld2012_Naphthalene.png|400px|thumb|right|'''Figure 21:''' Naphthalene decay in four different approaches at 30&nbsp;°C after one hour. Dissolved in methanol, dissolved in acetonitrile, with BR-buffer and with BR-buffer together with ABTS. (n=2)]]<br />
<br style="clear: both" /><br />
<br />
== HPLC analysis of analgesics ==<br />
Another class of substrates we wanted to test were analgesics. The three analgesic substrates have different optimal extinction and emission values. Every analgesic had to be tested alone. With diclofenac the extinction and emission values were not found. Therefore the substrate was analyzed with the spectrofluorophotometer but this also showed no clear peak for diclofenac and made it therefore not measurable. Additional, difficulties occurred with ibuprofen. Instead of one single peak we found two and they didn't correlate with the used concentrations.<br />
<br style="clear: both" /><br />
<br />
= Outlook =<br />
The HPLC results showed that ECOL, BPUL, TTHL and BHAL are able to degrade estradiol in the presence and absence of ABTS. Ethinyl estradiol is not degraded by the bacterial laccases. Just TTHL showed little degradation activities on ethinyl estradiol in presence of ABTS.<br />
Due to time reasons and the decay of PAHs in Britton Robinson buffer, the analyses of the PAHs and the analgesics with the HPLC and the LC-MS methods could not been carried out. It would be interesting to analyze the produced laccases with the PAHs and analgesics. <br />
Degradation products were found after treatment of estradiol and ethinyl estradiol with TVEL0 with LC-MS. The next step would be to analyze the possible degradation of PAHs, analgesics and estrone and detect degradation products after treatment with the produced bacterial laccases and TVEL5 from ''Trametes versicolor''.<br />
<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/substrateTeam:Bielefeld-Germany/Results/substrate2012-10-27T03:40:42Z<p>Fougee: /* Further analysis (after Regionals Amsterdam) */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Substrate Analysis<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
__TOC__<br />
<br />
== Introduction ==<br />
To investigate the degradation of different substrates with laccases several experiments were performed. For the measurements the four produced bacterial laccases (BHAL, ECOL, TTHL and BPUL) were used. The reactions were measured before and after an incubation with the laccases via high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry. The HPLC was used particularly for analysis of degradation rates after defined time points. With these results it is possible to compare the different laccases in respect to their degradation feasibilities.<br />
To detect degradation products of estradiol and ethinyl estradiol after laccase treatment different analysis via LC-MS and LC-MS-MS were done. We identified two compounds for both, estradiol and ethinyl estradiol, which are probable degradation products after laccase treatment.<br />
<br />
=Degradation measurements with high performance liquid chromatography=<br />
==Dilution series of different estrogens==<br />
<br />
[[File:Bielefeld2012_EthinylEstradiol.jpg|400px|thumb|right|'''Figure 1:''' The calibration curve of ethinyl estradiol as an example. The concentrations were measured between 0.1 µg mL <sup>-1</sup> and 3 µg mL <sup>-1</sup>.]]<br />
<br />
At first dilution series of all different substrates were measured. It was possible to measure calibration curves for estradiol and ethinyl estradiol but not for estrone. This was probably caused by its bad solubility. <br />
The retention time for estradiol is 4.4 minutes and for ethinyl estradiol 4.9 minutes. For all estrogens the same extinction and emission values could be used: Ex<sub>230</sub>, Em<sub>310</sub>.<br />
<br style="clear: both" /><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Degradation of estrogens==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3:''' Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added. The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
=Spectrofluorophotometer Analysis=<br />
<div style="text-align:justify;"><br />
We analyzed the degradation of our substrates with a spectrofluorophotometer. As you can see in the figures below the ethinyl estradiol and estradiol are degraded over night. Figure 4 shows the ethinyl estradiol without laccase treatment, Figure 5 shows that no more ethinyl estradiol can be detected in the sample after the degradation and new peaks appear which might represent possible degradation products. In Figure 6 you can see the estradiol control without laccases. Like ethinyl estradiol theestradiol peak is reduced after the degradation and new peaks appear indicating that those are new degradation products.<br />
[[File:Bielefeld2012-ethinylestradiol-withoutLaccase-spectrofluorophotometer.JPG|thumb|350px|left|'''Figure 4:''' Ethinyl estradiol control without laccases. Ethinyl estradiol was measured in spectrofluorophotometer without laccase treatment to have a control.]] [[File:Bielefeld2012-Ethinylestradiol-verdau-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 5:''' Ethinyl estradiol degradation (with TVEL0). The ethinyl estradiol peak disappeared and some new peaks, probable degradation products, occurred.]]<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012-estradiol-control-spectroflurophotometer.JPG|thumb|350px|left|'''Figure 6:''' Estradiol control without laccases.]]<br />
[[File:Bielefeld2012-estradiol-degradation-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 7:''' Degradation (with TVEL0) of estradiol. It is shown that some estradiol is left but probable degradation products appeared.]]<br />
<br style="clear: both" /><br />
<br />
=Liquid chromatography–mass spectrometry=<br />
=== Dilution series ===<br />
Our substrates are soluble in methanol. We set the standards to a concentration of 1 mg mL<sup>-1</sup>. The detection limit for the LC-MS was evaluated at a concentration of 10 µg L<sup>-1</sup> for the substrates estrone and estradiol. The same limit of detection was used for ethinyl estradiol and anthracene. We only used those four substrates. For all LC-MS sample preparations we used the ''T. versicolor'' laccases. The dilution series was prepared in methanol and 50 % acetonitril-water (v/v).<br />
<br />
[[File:Bielefeld2012-calibrationcurve-Anthracen.jpg|thumb|400px|left|'''Figure 8:''' Anthracene calibration curve. ]]<br />
[[File:Bielefeld2012-Estrone-calibrationcurve.JPG|thumb|400px|right|'''Figure 9:''' Estrone calibration curve.]]<br />
<br style="clear: both" /><br />
<br />
=== Degradation results ===<br />
The TVEL0 was able to degrade the synthetic estradiol (Fig. 10) and probably anthracene (Fig. 12). The ethinyl estradiol control showed that it is stable in the used media (Fig. 11). Anthracene disintegrates in the Britton Robinsoon Buffer. But it could be observed, that there is less anthracene measurable with the LC-MS. The results indicate, that the laccase is able to degrade anthracene (Fig. 13). Estrone (Fig. 14) and estradiol (Fig. 15) were degraded as well. Using estrone it could not be identify any degradation products. The reason for this could be that the products are not detectable with LC-MS or with the applied methods. Peaks in the degradation of estradiol have been shown but we were not able to identify them. It could be degradation products. In the following figures the results of the LC-MS measurements are presented. <br />
[[File:Bielefeld2012-Ethinylestradiol-degradation-LCMS.JPG|thumb|left|350px|'''Figure 10:''' Ethinyl estradiol + TVEL0 measured by LC-MS. It is shown that the over night sample has only half of the substrate left.]] <br />
[[File:Bielefeld2012-Anthracen-degradation-LCMS.JPG|thumb|right|350px|'''Figure 12:''' Anthracene + TVEL0. In the over night sample there are no detectable amounts of anthracene left.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Anthracen-standart1.JPG|right|thumb|350px|'''Figure 13:''' The negative control for anthracene without laccases. It is shown the concentration of anthracene decreases. This is caused by the Britton Robinson Buffer.]]<br />
[[File:Bielefeld2012-Ethinylestradiol-standart100.JPG|thumb|left|350px|'''Figure 11:''' Our ethinyl estradiol negative control without laccase. Variation on the peaks is probably caused by a pipetting mistake.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Estrone-degradation-LCMS.JPG|thumb|left|350px|'''Figure 14:''' Estrone + TVEL0. The peaks shows that estrone is degraded but after incubation over night it is still estrone left.]]<br />
[[File:Bielefeld2012-Estradiol-degradation-LCMS.JPG|thumb|right|350px|'''Figure 15:''' Estradiol degradation analyses with mass-spectrometry. On the X-axis the retention time is listed. The Y-axis shows the mass/charge ratio. From white to red the intensity of the measured samples is presented. On the figure above you can see the t<sub>0</sub> estradiol while the figure below shows the degradation. The analytes retended in the first minute are the media soillings. Since we know that the retention time of estradiol is on min 5 we could see that over night no more estradiol is left and some other peaks appear which are probably degradation products]]<br />
<br style="clear: both" /> <br />
We also tried to measure the degradation using mass-spectrometry. Since quantification via mass-spectrometry is difficult regarding the ionization of the analytes, we quantified our substrates by UV-light. Nevertheless, mass spectrometry enables identification of possible degradation products. We analyzed estradiol degradation in detail (Fig. 15), resulting in the detection of possible chemical compounds generated during the (enzymatic) degradation.<br />
<br style="clear: both" /><br />
<br />
=== Further analysis (after Regionals Amsterdam) ===<br />
Since we have seen some possible degradation products, we used more estradiol, ethinyl estradiol (250µg L<sup> -1 </sup> compare to 50µg L<sup> -1 </sup>) and more laccase (0,35U compare to 0,1U) for the reaction to the LC-MS measurement. We found out that after the laccase treatment two new peaks appeared in both the estradiol and ethinyl estradiol. A check against databases could not identify those components so we did an MS-MS on component A respectivly on component C. Since component B is fewer in concentration then component A, we could not find out anything about it (Fig. 16 and Fig. 17). To note the chemical formulares are M+H values. For the real chemical formula you have to deduct this H. <br />
[[File:Bielefeld2012-Estradiol-MS-measurement.JPG|thumb|350px|left|'''Figure 16:''' Mass spectromerty measurement of estradiol. On the X-axis you can see the Time in minutes and on the Y-axis the relative intensity. You can see two new peaks component A and B after laccase treatment. Component A was taken for MS-MS]]<br />
[[File:Bielefeld2012-EthinylEstradiol-MS-measurement.JPG|thumb|350px|right|'''Figure 17:''' Mass spectromerty measurement of ethinyl estradiol. On the X-axis you can see the time in minutes and on the Y-axis the relative intensity. You can see two new peaks component C and D after laccase treatment. Component C was taken for MS-MS]]<br />
<br style="clear: both" /><br />
<br />
The tandem mass spectrometry results showed two peaks in every measurement for possible degradation products. Compared to the native estradiol the component A peak embodies a molecule with two hydrogen atoms less than the native, the same does component C for ethinly estradiol. These peaks were discussed in a short chat with Prof. Dr. Dietmar Kuck, an organic chemist with a lot experience in mass spectrometry. This conversation led to two plausible models for the degradation. The first was a reaction at the hydroxy group of the five-ring of the estradiol (Fig. 18), oxidizing it to a ketone (resulting in estrone as the degradation product). This idea seemed improbable, because ethinyl estradiol cannot be oxidized at that position, but its degradation product also had two hydrogen less than the native (it is impossible to oxidize the hydroxy group of the five-ring to a ketone without losing the ethinyl group or breaking the ring (Fig. 19)). The second model was that the laccase radicalizes the hydroxy group of the phenolic group of the estradiol and ethinyl estradiol, as described in literature, building a phenoxy radical in the first step. In the second step hydrogen is split off on the tertiary carbon in para position finally leading to a quinone like structure (Figure 19). Without knowing the mechanism behind this reaction, this seems the most probable model of the degradation.<br />
<br />
[[File:Bielefeld2012-estradiol-MS-kuck-suggest.JPG|thumb|350px|left|'''Figure 18:''' First possible structure of the degradation product (component A) after laccase treatment. The secondary alcohol is oxidized to a ketone and the product corresponds to estrone. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
[[File:Bielefeld2012-EE2-MSMS-suggestion-Kuck.JPG|thumb|350px|right|'''Figure 19:''' Suggested chemical structure of the oxidized ethinyl estradiol. The phenolic part of the molecule has changed in a quinone like structure. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
<br style="clear: both" /> <br />
The second peaks in the chromatograms (component B and D) embody molecules with two oxygen more and two hydrogen less than the native. We postulate that this might be a transition state where O<sub>2</sub> is radically added to the phenolic ring in otho- and meta-position. To that point, there is no data to consolidate this adoption. Component B and D were also fragmented in the tandem mass spectrometry for further analysis, but the resulting peaks could not be differed from the background noise.<br />
<br style="clear: both" /><br />
<br />
= Further substrate analysis via HPLC =<br />
== HPLC analysis of polycylic aromatic hydrocarbons ==<br />
The results of our negative control measurements of polycyclic aromatic hydrocarbons showed that the PAHs decayed without laccase treatment after one hour in Britton Robinson (BR)-buffer. This is shown in Figure 20. <br>The next step was to check which substances in the reaction approach may cause the decay. Therefore naphthalene was dissolved in methanol (which is the solvent for the substrate and used for stopping the reaction), acetonitrile (which could be used as alternative solvent) and BR-buffer with and without ABTS. The results are shown in Figure 21. Using pure methanol and acetonitrile naphthalene is not decayed. In BR-buffer with and without ABTS the decay is nearly completed after one hour treatment. So BR-buffer seems a bad choice to test the degradation of naphtalene under laccase treatment. <br />
[[File:Bielefeld2012_PAH.png|400px|thumb|left|''' Figure 20: Decay of the PAHs naphthalene, acenaphthene and phenantrene in BR-buffer at 30 °C after one hour.''' The initial concentration was 1 µg mL <sup>-1</sup> for all PAHs. After one hour nearly all PAHs decayed completely. (n=2)]]<br />
[[File:Bielefeld2012_Naphthalene.png|400px|thumb|right|'''Figure 21: Naphthalene decay in four different approaches at 30&nbsp;°C after one hour.''' Dissolved in methanol, dissolved in acetonitrile, with BR-buffer and with BR-buffer together with ABTS. (n=2)]]<br />
<br style="clear: both" /><br />
<br />
== HPLC analysis of analgesics ==<br />
Another class of substrates we wanted to test were analgesics. The three analgesic substrates have different optimal extinction and emission values. Every analgesic had to be tested alone. With diclofenac the extinction and emission values were not found. Therefore the substrate was analyzed with the spectrofluorophotometer but this also showed no clear peak for diclofenac and made it therefore not measurable. Additional, difficulties occurred with ibuprofen. Instead of one single peak we found two and they didn't correlate with the used concentrations.<br />
<br style="clear: both" /><br />
<br />
= Outlook =<br />
The HPLC results showed that ECOL, BPUL, TTHL and BHAL are able to degrade estradiol in the presence and absence of ABTS. Ethinyl estradiol is not degraded by the bacterial laccases. Just TTHL showed little degradation activities on ethinyl estradiol in presence of ABTS.<br />
Due to time reasons and the decay of PAHs in Britton Robinson buffer, the analyses of the PAHs and the analgesics with the HPLC and the LC-MS methods could not been carried out. It would be interesting to analyze the produced laccases with the PAHs and analgesics. <br />
Degradation products were found after treatment of estradiol and ethinyl estradiol with TVEL0 with LC-MS. The next step would be to analyze the possible degradation of PAHs, analgesics and estrone and detect degradation products after treatment with the produced bacterial laccases and TVEL5 from ''Trametes versicolor''.<br />
<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/substrateTeam:Bielefeld-Germany/Results/substrate2012-10-27T03:39:22Z<p>Fougee: /* Further analysis (after Regionals Amsterdam) */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Substrate Analysis<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
__TOC__<br />
<br />
== Introduction ==<br />
To investigate the degradation of different substrates with laccases several experiments were performed. For the measurements the four produced bacterial laccases (BHAL, ECOL, TTHL and BPUL) were used. The reactions were measured before and after an incubation with the laccases via high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry. The HPLC was used particularly for analysis of degradation rates after defined time points. With these results it is possible to compare the different laccases in respect to their degradation feasibilities.<br />
To detect degradation products of estradiol and ethinyl estradiol after laccase treatment different analysis via LC-MS and LC-MS-MS were done. We identified two compounds for both, estradiol and ethinyl estradiol, which are probable degradation products after laccase treatment.<br />
<br />
=Degradation measurements with high performance liquid chromatography=<br />
==Dilution series of different estrogens==<br />
<br />
[[File:Bielefeld2012_EthinylEstradiol.jpg|400px|thumb|right|'''Figure 1:''' The calibration curve of ethinyl estradiol as an example. The concentrations were measured between 0.1 µg mL <sup>-1</sup> and 3 µg mL <sup>-1</sup>.]]<br />
<br />
At first dilution series of all different substrates were measured. It was possible to measure calibration curves for estradiol and ethinyl estradiol but not for estrone. This was probably caused by its bad solubility. <br />
The retention time for estradiol is 4.4 minutes and for ethinyl estradiol 4.9 minutes. For all estrogens the same extinction and emission values could be used: Ex<sub>230</sub>, Em<sub>310</sub>.<br />
<br style="clear: both" /><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Degradation of estrogens==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3:''' Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added. The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
=Spectrofluorophotometer Analysis=<br />
<div style="text-align:justify;"><br />
We analyzed the degradation of our substrates with a spectrofluorophotometer. As you can see in the figures below the ethinyl estradiol and estradiol are degraded over night. Figure 4 shows the ethinyl estradiol without laccase treatment, Figure 5 shows that no more ethinyl estradiol can be detected in the sample after the degradation and new peaks appear which might represent possible degradation products. In Figure 6 you can see the estradiol control without laccases. Like ethinyl estradiol theestradiol peak is reduced after the degradation and new peaks appear indicating that those are new degradation products.<br />
[[File:Bielefeld2012-ethinylestradiol-withoutLaccase-spectrofluorophotometer.JPG|thumb|350px|left|'''Figure 4:''' Ethinyl estradiol control without laccases. Ethinyl estradiol was measured in spectrofluorophotometer without laccase treatment to have a control.]] [[File:Bielefeld2012-Ethinylestradiol-verdau-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 5:''' Ethinyl estradiol degradation (with TVEL0). The ethinyl estradiol peak disappeared and some new peaks, probable degradation products, occurred.]]<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012-estradiol-control-spectroflurophotometer.JPG|thumb|350px|left|'''Figure 6:''' Estradiol control without laccases.]]<br />
[[File:Bielefeld2012-estradiol-degradation-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 7:''' Degradation (with TVEL0) of estradiol. It is shown that some estradiol is left but probable degradation products appeared.]]<br />
<br style="clear: both" /><br />
<br />
=Liquid chromatography–mass spectrometry=<br />
=== Dilution series ===<br />
Our substrates are soluble in methanol. We set the standards to a concentration of 1 mg mL<sup>-1</sup>. The detection limit for the LC-MS was evaluated at a concentration of 10 µg L<sup>-1</sup> for the substrates estrone and estradiol. The same limit of detection was used for ethinyl estradiol and anthracene. We only used those four substrates. For all LC-MS sample preparations we used the ''T. versicolor'' laccases. The dilution series was prepared in methanol and 50 % acetonitril-water (v/v).<br />
<br />
[[File:Bielefeld2012-calibrationcurve-Anthracen.jpg|thumb|400px|left|'''Figure 8:''' Anthracene calibration curve. ]]<br />
[[File:Bielefeld2012-Estrone-calibrationcurve.JPG|thumb|400px|right|'''Figure 9:''' Estrone calibration curve.]]<br />
<br style="clear: both" /><br />
<br />
=== Degradation results ===<br />
The TVEL0 was able to degrade the synthetic estradiol (Fig. 10) and probably anthracene (Fig. 12). The ethinyl estradiol control showed that it is stable in the used media (Fig. 11). Anthracene disintegrates in the Britton Robinsoon Buffer. But it could be observed, that there is less anthracene measurable with the LC-MS. The results indicate, that the laccase is able to degrade anthracene (Fig. 13). Estrone (Fig. 14) and estradiol (Fig. 15) were degraded as well. Using estrone it could not be identify any degradation products. The reason for this could be that the products are not detectable with LC-MS or with the applied methods. Peaks in the degradation of estradiol have been shown but we were not able to identify them. It could be degradation products. In the following figures the results of the LC-MS measurements are presented. <br />
[[File:Bielefeld2012-Ethinylestradiol-degradation-LCMS.JPG|thumb|left|350px|'''Figure 10:''' Ethinyl estradiol + TVEL0 measured by LC-MS. It is shown that the over night sample has only half of the substrate left.]] <br />
[[File:Bielefeld2012-Anthracen-degradation-LCMS.JPG|thumb|right|350px|'''Figure 12:''' Anthracene + TVEL0. In the over night sample there are no detectable amounts of anthracene left.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Anthracen-standart1.JPG|right|thumb|350px|'''Figure 13:''' The negative control for anthracene without laccases. It is shown the concentration of anthracene decreases. This is caused by the Britton Robinson Buffer.]]<br />
[[File:Bielefeld2012-Ethinylestradiol-standart100.JPG|thumb|left|350px|'''Figure 11:''' Our ethinyl estradiol negative control without laccase. Variation on the peaks is probably caused by a pipetting mistake.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Estrone-degradation-LCMS.JPG|thumb|left|350px|'''Figure 14:''' Estrone + TVEL0. The peaks shows that estrone is degraded but after incubation over night it is still estrone left.]]<br />
[[File:Bielefeld2012-Estradiol-degradation-LCMS.JPG|thumb|right|350px|'''Figure 15:''' Estradiol degradation analyses with mass-spectrometry. On the X-axis the retention time is listed. The Y-axis shows the mass/charge ratio. From white to red the intensity of the measured samples is presented. On the figure above you can see the t<sub>0</sub> estradiol while the figure below shows the degradation. The analytes retended in the first minute are the media soillings. Since we know that the retention time of estradiol is on min 5 we could see that over night no more estradiol is left and some other peaks appear which are probably degradation products]]<br />
<br style="clear: both" /> <br />
We also tried to measure the degradation using mass-spectrometry. Since quantification via mass-spectrometry is difficult regarding the ionization of the analytes, we quantified our substrates by UV-light. Nevertheless, mass spectrometry enables identification of possible degradation products. We analyzed estradiol degradation in detail (Fig. 15), resulting in the detection of possible chemical compounds generated during the (enzymatic) degradation.<br />
<br style="clear: both" /><br />
<br />
=== Further analysis (after Regionals Amsterdam) ===<br />
Since we have seen some possible degradation products, we used more estradiol, ethinyl estradiol (250µg L<sup> -1 </sup> compare to 50µg L<sup> -1 </sup>) and more laccase (0,35U compare to 0,1U) for the reaction to the LC-MS measurement. We found out that after the laccase treatment two new peaks appeared in both the estradiol and ethinyl estradiol. A check against databases could not identify those components so we did an MS-MS on component A respectivly on component C. Since component B is fewer in concentration then component A, we could not find out anything about it (Fig. 16 and Fig. 17). To note the chemical formulares are M+H values. For the real chemical formula you have to deduct this H. <br />
[[File:Bielefeld2012-Estradiol-MS-measurement.JPG|thumb|350px|left|'''Figure 16:''' Mass spectromerty measurement of estradiol. On the X-axis you can see the Time in minutes and on the Y-axis the relative intensity. You can see two new peaks component A and B after laccase treatment. Component A was taken for MS-MS]]<br />
[[File:Bielefeld2012-EthinylEstradiol-MS-measurement.JPG|thumb|350px|right|'''Figure 17:''' Mass spectromerty measurement of ethinyl estradiol. On the X-axis you can see the time in minutes and on the Y-axis the relative intensity. You can see two new peaks component C and D after laccase treatment. Component C was taken for MS-MS]]<br />
<br style="clear: both" /><br />
<br />
The tandem mass spectrometry results showed two peaks in every measurement for possible degradation products. Compared to the native estradiol the component A peak embodies a molecule with two hydrogen atoms less than the native, the same does component C for ethinly estradiol. These peaks were discussed in a short chat with Prof. Dr. Dietmar Kuck, an organic chemist with a lot experience in mass spectrometry. This conversation led to two plausible models for the degradation. The first was a reaction at the hydroxy group of the five-ring of the estradiol (Fig. 18), oxidizing it to a ketone (resulting in estrone as the degradation product). This idea seemed improbable, because ethinyl estradiol cannot be oxidized at that position, but its degradation product also had two hydrogen less than the native (it is impossible to oxidize the hydroxy group of the five-ring to a ketone without losing the ethinyl group or breaking the ring (Fig. 19)). The second model was that the laccase radicalizes the hydroxy group of the phenolic group of the estradiol and ethinyl estradiol, as described in literature, building a phenoxy radical in the first step. In the second step hydrogen is split off on the tertiary carbon in para position finally leading to a quinone like structure (Figure 19). Without knowing the mechanism behind this reaction, this seems the most probable model of the degradation.<br />
<br />
[[File:Bielefeld2012-estradiol-MS-kuck-suggest.JPG|thumb|350px|left|'''Figure 18:''' First possible structure of the degradation product (component A) after laccase treatment. The secondary alcohol is oxidized to a ketone and the product corresponds to estrone. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
[[File:Bielefeld2012-EE2-MSMS-suggestion-Kuck.JPG|thumb|350px|right|'''Figure 19:''' Suggested chemical structure of the oxidized ethinyl estradiol. The phenolic part of the molecule has changed in a quinone like structure. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
<br style="clear: both" /> <br />
The second peaks in the chromatograms (component B and D) embody molecules with two oxygen more and two hydrogen less than the native. We postulate that this might be a transition state where O2 is radically added to the phenolic ring in otho- and meta-position. To that point, there is no data to consolidate this adoption. Component B and D were also fragmented in the tandem mass spectrometry for further analysis, but the resulting peaks could not be differed from the background noise.<br />
<br style="clear: both" /><br />
<br />
= Further substrate analysis via HPLC =<br />
== HPLC analysis of polycylic aromatic hydrocarbons ==<br />
The results of our negative control measurements of polycyclic aromatic hydrocarbons showed that the PAHs decayed without laccase treatment after one hour in Britton Robinson (BR)-buffer. This is shown in Figure 20. <br>The next step was to check which substances in the reaction approach may cause the decay. Therefore naphthalene was dissolved in methanol (which is the solvent for the substrate and used for stopping the reaction), acetonitrile (which could be used as alternative solvent) and BR-buffer with and without ABTS. The results are shown in Figure 21. Using pure methanol and acetonitrile naphthalene is not decayed. In BR-buffer with and without ABTS the decay is nearly completed after one hour treatment. So BR-buffer seems a bad choice to test the degradation of naphtalene under laccase treatment. <br />
[[File:Bielefeld2012_PAH.png|400px|thumb|left|''' Figure 20: Decay of the PAHs naphthalene, acenaphthene and phenantrene in BR-buffer at 30 °C after one hour.''' The initial concentration was 1 µg mL <sup>-1</sup> for all PAHs. After one hour nearly all PAHs decayed completely. (n=2)]]<br />
[[File:Bielefeld2012_Naphthalene.png|400px|thumb|right|'''Figure 21: Naphthalene decay in four different approaches at 30&nbsp;°C after one hour.''' Dissolved in methanol, dissolved in acetonitrile, with BR-buffer and with BR-buffer together with ABTS. (n=2)]]<br />
<br style="clear: both" /><br />
<br />
== HPLC analysis of analgesics ==<br />
Another class of substrates we wanted to test were analgesics. The three analgesic substrates have different optimal extinction and emission values. Every analgesic had to be tested alone. With diclofenac the extinction and emission values were not found. Therefore the substrate was analyzed with the spectrofluorophotometer but this also showed no clear peak for diclofenac and made it therefore not measurable. Additional, difficulties occurred with ibuprofen. Instead of one single peak we found two and they didn't correlate with the used concentrations.<br />
<br style="clear: both" /><br />
<br />
= Outlook =<br />
The HPLC results showed that ECOL, BPUL, TTHL and BHAL are able to degrade estradiol in the presence and absence of ABTS. Ethinyl estradiol is not degraded by the bacterial laccases. Just TTHL showed little degradation activities on ethinyl estradiol in presence of ABTS.<br />
Due to time reasons and the decay of PAHs in Britton Robinson buffer, the analyses of the PAHs and the analgesics with the HPLC and the LC-MS methods could not been carried out. It would be interesting to analyze the produced laccases with the PAHs and analgesics. <br />
Degradation products were found after treatment of estradiol and ethinyl estradiol with TVEL0 with LC-MS. The next step would be to analyze the possible degradation of PAHs, analgesics and estrone and detect degradation products after treatment with the produced bacterial laccases and TVEL5 from ''Trametes versicolor''.<br />
<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/substrateTeam:Bielefeld-Germany/Results/substrate2012-10-27T03:37:59Z<p>Fougee: /* Degradation results */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Substrate Analysis<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
__TOC__<br />
<br />
== Introduction ==<br />
To investigate the degradation of different substrates with laccases several experiments were performed. For the measurements the four produced bacterial laccases (BHAL, ECOL, TTHL and BPUL) were used. The reactions were measured before and after an incubation with the laccases via high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry. The HPLC was used particularly for analysis of degradation rates after defined time points. With these results it is possible to compare the different laccases in respect to their degradation feasibilities.<br />
To detect degradation products of estradiol and ethinyl estradiol after laccase treatment different analysis via LC-MS and LC-MS-MS were done. We identified two compounds for both, estradiol and ethinyl estradiol, which are probable degradation products after laccase treatment.<br />
<br />
=Degradation measurements with high performance liquid chromatography=<br />
==Dilution series of different estrogens==<br />
<br />
[[File:Bielefeld2012_EthinylEstradiol.jpg|400px|thumb|right|'''Figure 1:''' The calibration curve of ethinyl estradiol as an example. The concentrations were measured between 0.1 µg mL <sup>-1</sup> and 3 µg mL <sup>-1</sup>.]]<br />
<br />
At first dilution series of all different substrates were measured. It was possible to measure calibration curves for estradiol and ethinyl estradiol but not for estrone. This was probably caused by its bad solubility. <br />
The retention time for estradiol is 4.4 minutes and for ethinyl estradiol 4.9 minutes. For all estrogens the same extinction and emission values could be used: Ex<sub>230</sub>, Em<sub>310</sub>.<br />
<br style="clear: both" /><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Degradation of estrogens==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3:''' Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added. The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
=Spectrofluorophotometer Analysis=<br />
<div style="text-align:justify;"><br />
We analyzed the degradation of our substrates with a spectrofluorophotometer. As you can see in the figures below the ethinyl estradiol and estradiol are degraded over night. Figure 4 shows the ethinyl estradiol without laccase treatment, Figure 5 shows that no more ethinyl estradiol can be detected in the sample after the degradation and new peaks appear which might represent possible degradation products. In Figure 6 you can see the estradiol control without laccases. Like ethinyl estradiol theestradiol peak is reduced after the degradation and new peaks appear indicating that those are new degradation products.<br />
[[File:Bielefeld2012-ethinylestradiol-withoutLaccase-spectrofluorophotometer.JPG|thumb|350px|left|'''Figure 4:''' Ethinyl estradiol control without laccases. Ethinyl estradiol was measured in spectrofluorophotometer without laccase treatment to have a control.]] [[File:Bielefeld2012-Ethinylestradiol-verdau-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 5:''' Ethinyl estradiol degradation (with TVEL0). The ethinyl estradiol peak disappeared and some new peaks, probable degradation products, occurred.]]<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012-estradiol-control-spectroflurophotometer.JPG|thumb|350px|left|'''Figure 6:''' Estradiol control without laccases.]]<br />
[[File:Bielefeld2012-estradiol-degradation-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 7:''' Degradation (with TVEL0) of estradiol. It is shown that some estradiol is left but probable degradation products appeared.]]<br />
<br style="clear: both" /><br />
<br />
=Liquid chromatography–mass spectrometry=<br />
=== Dilution series ===<br />
Our substrates are soluble in methanol. We set the standards to a concentration of 1 mg mL<sup>-1</sup>. The detection limit for the LC-MS was evaluated at a concentration of 10 µg L<sup>-1</sup> for the substrates estrone and estradiol. The same limit of detection was used for ethinyl estradiol and anthracene. We only used those four substrates. For all LC-MS sample preparations we used the ''T. versicolor'' laccases. The dilution series was prepared in methanol and 50 % acetonitril-water (v/v).<br />
<br />
[[File:Bielefeld2012-calibrationcurve-Anthracen.jpg|thumb|400px|left|'''Figure 8:''' Anthracene calibration curve. ]]<br />
[[File:Bielefeld2012-Estrone-calibrationcurve.JPG|thumb|400px|right|'''Figure 9:''' Estrone calibration curve.]]<br />
<br style="clear: both" /><br />
<br />
=== Degradation results ===<br />
The TVEL0 was able to degrade the synthetic estradiol (Fig. 10) and probably anthracene (Fig. 12). The ethinyl estradiol control showed that it is stable in the used media (Fig. 11). Anthracene disintegrates in the Britton Robinsoon Buffer. But it could be observed, that there is less anthracene measurable with the LC-MS. The results indicate, that the laccase is able to degrade anthracene (Fig. 13). Estrone (Fig. 14) and estradiol (Fig. 15) were degraded as well. Using estrone it could not be identify any degradation products. The reason for this could be that the products are not detectable with LC-MS or with the applied methods. Peaks in the degradation of estradiol have been shown but we were not able to identify them. It could be degradation products. In the following figures the results of the LC-MS measurements are presented. <br />
[[File:Bielefeld2012-Ethinylestradiol-degradation-LCMS.JPG|thumb|left|350px|'''Figure 10:''' Ethinyl estradiol + TVEL0 measured by LC-MS. It is shown that the over night sample has only half of the substrate left.]] <br />
[[File:Bielefeld2012-Anthracen-degradation-LCMS.JPG|thumb|right|350px|'''Figure 12:''' Anthracene + TVEL0. In the over night sample there are no detectable amounts of anthracene left.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Anthracen-standart1.JPG|right|thumb|350px|'''Figure 13:''' The negative control for anthracene without laccases. It is shown the concentration of anthracene decreases. This is caused by the Britton Robinson Buffer.]]<br />
[[File:Bielefeld2012-Ethinylestradiol-standart100.JPG|thumb|left|350px|'''Figure 11:''' Our ethinyl estradiol negative control without laccase. Variation on the peaks is probably caused by a pipetting mistake.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Estrone-degradation-LCMS.JPG|thumb|left|350px|'''Figure 14:''' Estrone + TVEL0. The peaks shows that estrone is degraded but after incubation over night it is still estrone left.]]<br />
[[File:Bielefeld2012-Estradiol-degradation-LCMS.JPG|thumb|right|350px|'''Figure 15:''' Estradiol degradation analyses with mass-spectrometry. On the X-axis the retention time is listed. The Y-axis shows the mass/charge ratio. From white to red the intensity of the measured samples is presented. On the figure above you can see the t<sub>0</sub> estradiol while the figure below shows the degradation. The analytes retended in the first minute are the media soillings. Since we know that the retention time of estradiol is on min 5 we could see that over night no more estradiol is left and some other peaks appear which are probably degradation products]]<br />
<br style="clear: both" /> <br />
We also tried to measure the degradation using mass-spectrometry. Since quantification via mass-spectrometry is difficult regarding the ionization of the analytes, we quantified our substrates by UV-light. Nevertheless, mass spectrometry enables identification of possible degradation products. We analyzed estradiol degradation in detail (Fig. 15), resulting in the detection of possible chemical compounds generated during the (enzymatic) degradation.<br />
<br style="clear: both" /><br />
<br />
=== Further analysis (after Regionals Amsterdam) ===<br />
Since we have seen some possible degradation products, we used more estradiol, ethinyl estradiol (250µg L<sup> -1 </sup> compare to 50µg L<sup> -1 </sup>) and more laccase (0,35U compare to 0,1U) for the reaction to the LC-MS measurement. We found out that after the laccase treatment two new peaks appeared in both the estradiol and ethinyl estradiol. A check against databases could not identify those components so we did an MS-MS on component A respectivly on component C. Since component B is fewer in concentration then component A, we could not find out anything about it (Fig. 16 and Fig. 17). To note the chemical formulares are M+H values. For the real chemical formula you have to deduct this H. <br />
[[File:Bielefeld2012-Estradiol-MS-measurement.JPG|thumb|350px|left|'''Figure 16: Mass spectromerty measurement of estradiol.''' On the X-axis you can see the Time in minutes and on the Y-axis the relative intensity. You can see two new peaks component A and B after laccase treatment. Component A was taken for MS-MS]]<br />
[[File:Bielefeld2012-EthinylEstradiol-MS-measurement.JPG|thumb|350px|right|'''Figure 17: Mass spectromerty measurement of ethinyl estradiol.''' On the X-axis you can see the time in minutes and on the Y-axis the relative intensity. You can see two new peaks component C and D after laccase treatment. Component C was taken for MS-MS]]<br />
<br style="clear: both" /><br />
<br />
The tandem mass spectrometry results showed two peaks in every measurement for possible degradation products. Compared to the native estradiol the component A peak embodies a molecule with two hydrogen atoms less than the native, the same does component C for ethinly estradiol. These peaks were discussed in a short chat with Prof. Dr. Dietmar Kuck, an organic chemist with a lot experience in mass spectrometry. This conversation led to two plausible models for the degradation. The first was a reaction at the hydroxy group of the five-ring of the estradiol (Fig. 18), oxidizing it to a ketone (resulting in estrone as the degradation product). This idea seemed improbable, because ethinyl estradiol cannot be oxidized at that position, but its degradation product also had two hydrogen less than the native (it is impossible to oxidize the hydroxy group of the five-ring to a ketone without losing the ethinyl group or breaking the ring (Fig. 19)). The second model was that the laccase radicalizes the hydroxy group of the phenolic group of the estradiol and ethinyl estradiol, as described in literature, building a phenoxy radical in the first step. In the second step hydrogen is split off on the tertiary carbon in para position finally leading to a quinone like structure (Figure 19). Without knowing the mechanism behind this reaction, this seems the most probable model of the degradation.<br />
<br />
[[File:Bielefeld2012-estradiol-MS-kuck-suggest.JPG|thumb|350px|left|'''Figure 18: First possible structure of the degradation product (component A) after laccase treatment.''' The secondary alcohol is oxidized to a ketone and the product corresponds to estrone. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
[[File:Bielefeld2012-EE2-MSMS-suggestion-Kuck.JPG|thumb|350px|right|'''Figure 19: Suggested chemical structure of the oxidized ethinyl estradiol.''' The phenolic part of the molecule has changed in a quinone like structure. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
<br style="clear: both" /> <br />
The second peaks in the chromatograms (component B and D) embody molecules with two oxygen more and two hydrogen less than the native. We postulate that this might be a transition state where O2 is radically added to the phenolic ring in otho- and meta-position. To that point, there is no data to consolidate this adoption. Component B and D were also fragmented in the tandem mass spectrometry for further analysis, but the resulting peaks could not be differed from the background noise.<br />
<br style="clear: both" /><br />
<br />
= Further substrate analysis via HPLC =<br />
== HPLC analysis of polycylic aromatic hydrocarbons ==<br />
The results of our negative control measurements of polycyclic aromatic hydrocarbons showed that the PAHs decayed without laccase treatment after one hour in Britton Robinson (BR)-buffer. This is shown in Figure 20. <br>The next step was to check which substances in the reaction approach may cause the decay. Therefore naphthalene was dissolved in methanol (which is the solvent for the substrate and used for stopping the reaction), acetonitrile (which could be used as alternative solvent) and BR-buffer with and without ABTS. The results are shown in Figure 21. Using pure methanol and acetonitrile naphthalene is not decayed. In BR-buffer with and without ABTS the decay is nearly completed after one hour treatment. So BR-buffer seems a bad choice to test the degradation of naphtalene under laccase treatment. <br />
[[File:Bielefeld2012_PAH.png|400px|thumb|left|''' Figure 20: Decay of the PAHs naphthalene, acenaphthene and phenantrene in BR-buffer at 30 °C after one hour.''' The initial concentration was 1 µg mL <sup>-1</sup> for all PAHs. After one hour nearly all PAHs decayed completely. (n=2)]]<br />
[[File:Bielefeld2012_Naphthalene.png|400px|thumb|right|'''Figure 21: Naphthalene decay in four different approaches at 30&nbsp;°C after one hour.''' Dissolved in methanol, dissolved in acetonitrile, with BR-buffer and with BR-buffer together with ABTS. (n=2)]]<br />
<br style="clear: both" /><br />
<br />
== HPLC analysis of analgesics ==<br />
Another class of substrates we wanted to test were analgesics. The three analgesic substrates have different optimal extinction and emission values. Every analgesic had to be tested alone. With diclofenac the extinction and emission values were not found. Therefore the substrate was analyzed with the spectrofluorophotometer but this also showed no clear peak for diclofenac and made it therefore not measurable. Additional, difficulties occurred with ibuprofen. Instead of one single peak we found two and they didn't correlate with the used concentrations.<br />
<br style="clear: both" /><br />
<br />
= Outlook =<br />
The HPLC results showed that ECOL, BPUL, TTHL and BHAL are able to degrade estradiol in the presence and absence of ABTS. Ethinyl estradiol is not degraded by the bacterial laccases. Just TTHL showed little degradation activities on ethinyl estradiol in presence of ABTS.<br />
Due to time reasons and the decay of PAHs in Britton Robinson buffer, the analyses of the PAHs and the analgesics with the HPLC and the LC-MS methods could not been carried out. It would be interesting to analyze the produced laccases with the PAHs and analgesics. <br />
Degradation products were found after treatment of estradiol and ethinyl estradiol with TVEL0 with LC-MS. The next step would be to analyze the possible degradation of PAHs, analgesics and estrone and detect degradation products after treatment with the produced bacterial laccases and TVEL5 from ''Trametes versicolor''.<br />
<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/substrateTeam:Bielefeld-Germany/Results/substrate2012-10-27T03:36:27Z<p>Fougee: /* Dilution series */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Substrate Analysis<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
__TOC__<br />
<br />
== Introduction ==<br />
To investigate the degradation of different substrates with laccases several experiments were performed. For the measurements the four produced bacterial laccases (BHAL, ECOL, TTHL and BPUL) were used. The reactions were measured before and after an incubation with the laccases via high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry. The HPLC was used particularly for analysis of degradation rates after defined time points. With these results it is possible to compare the different laccases in respect to their degradation feasibilities.<br />
To detect degradation products of estradiol and ethinyl estradiol after laccase treatment different analysis via LC-MS and LC-MS-MS were done. We identified two compounds for both, estradiol and ethinyl estradiol, which are probable degradation products after laccase treatment.<br />
<br />
=Degradation measurements with high performance liquid chromatography=<br />
==Dilution series of different estrogens==<br />
<br />
[[File:Bielefeld2012_EthinylEstradiol.jpg|400px|thumb|right|'''Figure 1:''' The calibration curve of ethinyl estradiol as an example. The concentrations were measured between 0.1 µg mL <sup>-1</sup> and 3 µg mL <sup>-1</sup>.]]<br />
<br />
At first dilution series of all different substrates were measured. It was possible to measure calibration curves for estradiol and ethinyl estradiol but not for estrone. This was probably caused by its bad solubility. <br />
The retention time for estradiol is 4.4 minutes and for ethinyl estradiol 4.9 minutes. For all estrogens the same extinction and emission values could be used: Ex<sub>230</sub>, Em<sub>310</sub>.<br />
<br style="clear: both" /><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Degradation of estrogens==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3:''' Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added. The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
=Spectrofluorophotometer Analysis=<br />
<div style="text-align:justify;"><br />
We analyzed the degradation of our substrates with a spectrofluorophotometer. As you can see in the figures below the ethinyl estradiol and estradiol are degraded over night. Figure 4 shows the ethinyl estradiol without laccase treatment, Figure 5 shows that no more ethinyl estradiol can be detected in the sample after the degradation and new peaks appear which might represent possible degradation products. In Figure 6 you can see the estradiol control without laccases. Like ethinyl estradiol theestradiol peak is reduced after the degradation and new peaks appear indicating that those are new degradation products.<br />
[[File:Bielefeld2012-ethinylestradiol-withoutLaccase-spectrofluorophotometer.JPG|thumb|350px|left|'''Figure 4:''' Ethinyl estradiol control without laccases. Ethinyl estradiol was measured in spectrofluorophotometer without laccase treatment to have a control.]] [[File:Bielefeld2012-Ethinylestradiol-verdau-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 5:''' Ethinyl estradiol degradation (with TVEL0). The ethinyl estradiol peak disappeared and some new peaks, probable degradation products, occurred.]]<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012-estradiol-control-spectroflurophotometer.JPG|thumb|350px|left|'''Figure 6:''' Estradiol control without laccases.]]<br />
[[File:Bielefeld2012-estradiol-degradation-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 7:''' Degradation (with TVEL0) of estradiol. It is shown that some estradiol is left but probable degradation products appeared.]]<br />
<br style="clear: both" /><br />
<br />
=Liquid chromatography–mass spectrometry=<br />
=== Dilution series ===<br />
Our substrates are soluble in methanol. We set the standards to a concentration of 1 mg mL<sup>-1</sup>. The detection limit for the LC-MS was evaluated at a concentration of 10 µg L<sup>-1</sup> for the substrates estrone and estradiol. The same limit of detection was used for ethinyl estradiol and anthracene. We only used those four substrates. For all LC-MS sample preparations we used the ''T. versicolor'' laccases. The dilution series was prepared in methanol and 50 % acetonitril-water (v/v).<br />
<br />
[[File:Bielefeld2012-calibrationcurve-Anthracen.jpg|thumb|400px|left|'''Figure 8:''' Anthracene calibration curve. ]]<br />
[[File:Bielefeld2012-Estrone-calibrationcurve.JPG|thumb|400px|right|'''Figure 9:''' Estrone calibration curve.]]<br />
<br style="clear: both" /><br />
<br />
=== Degradation results ===<br />
The TVEL0 was able to degrade the synthetic estradiol (Fig. 10) and probably anthracene (Fig. 12). The ethinyl estradiol control showed that it is stable in the used media (Fig. 11). Anthracene disintegrates in the Britton Robinsoon Buffer. But it could be observed, that there is less anthracene measurable with the LC-MS. The results indicate, that the laccase is able to degrade anthracene (Fig. 13). Estrone (Fig. 14) and estradiol (Fig. 15) were degraded as well. Using estrone it could not be identify any degradation products. The reason for this could be that the products are not detectable with LC-MS or with the applied methods. Peaks in the degradation of estradiol have been shown but we were not able to identify them. It could be degradation products. In the following figures the results of the LC-MS measurements are presented. <br />
[[File:Bielefeld2012-Ethinylestradiol-degradation-LCMS.JPG|thumb|left|350px|'''Figure 10: Ethinyl estradiol + TVEL0 measured by LC-MS.''' It is shown that the over night sample has only half of the substrate left.]] <br />
[[File:Bielefeld2012-Anthracen-degradation-LCMS.JPG|thumb|right|350px|'''Figure 12: Anthracene + TVEL0.''' In the over night sample there are no detectable amounts of anthracene left.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Anthracen-standart1.JPG|right|thumb|350px|'''Figure 13: The negative control for anthracene without laccases.''' It is shown the concentration of anthracene decreases. This is caused by the Britton Robinson Buffer.]]<br />
[[File:Bielefeld2012-Ethinylestradiol-standart100.JPG|thumb|left|350px|'''Figure 11: Our ethinyl estradiol negative control without laccase.''' Variation on the peaks is probably caused by a pipetting mistake.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Estrone-degradation-LCMS.JPG|thumb|left|350px|'''Figure 14: Estrone + TVEL0.''' The peaks shows that estrone is degraded but after incubation over night it is still estrone left.]]<br />
[[File:Bielefeld2012-Estradiol-degradation-LCMS.JPG|thumb|right|350px|'''Figure 15: Estradiol degradation analyses with mass-spectrometry.''' On the X-axis the retention time is listed. The Y-axis shows the mass/charge ratio. From white to red the intensity of the measured samples is presented. On the figure above you can see the t<sub>0</sub> estradiol while the figure below shows the degradation. The analytes retended in the first minute are the media soillings. Since we know that the retention time of estradiol is on min 5 we could see that over night no more estradiol is left and some other peaks appear which are probably degradation products]]<br />
<br style="clear: both" /> <br />
We also tried to measure the degradation using mass-spectrometry. Since quantification via mass-spectrometry is difficult regarding the ionization of the analytes, we quantified our substrates by UV-light. Nevertheless, mass spectrometry enables identification of possible degradation products. We analyzed estradiol degradation in detail (Fig. 15), resulting in the detection of possible chemical compounds generated during the (enzymatic) degradation.<br />
<br style="clear: both" /><br />
<br />
=== Further analysis (after Regionals Amsterdam) ===<br />
Since we have seen some possible degradation products, we used more estradiol, ethinyl estradiol (250µg L<sup> -1 </sup> compare to 50µg L<sup> -1 </sup>) and more laccase (0,35U compare to 0,1U) for the reaction to the LC-MS measurement. We found out that after the laccase treatment two new peaks appeared in both the estradiol and ethinyl estradiol. A check against databases could not identify those components so we did an MS-MS on component A respectivly on component C. Since component B is fewer in concentration then component A, we could not find out anything about it (Fig. 16 and Fig. 17). To note the chemical formulares are M+H values. For the real chemical formula you have to deduct this H. <br />
[[File:Bielefeld2012-Estradiol-MS-measurement.JPG|thumb|350px|left|'''Figure 16: Mass spectromerty measurement of estradiol.''' On the X-axis you can see the Time in minutes and on the Y-axis the relative intensity. You can see two new peaks component A and B after laccase treatment. Component A was taken for MS-MS]]<br />
[[File:Bielefeld2012-EthinylEstradiol-MS-measurement.JPG|thumb|350px|right|'''Figure 17: Mass spectromerty measurement of ethinyl estradiol.''' On the X-axis you can see the time in minutes and on the Y-axis the relative intensity. You can see two new peaks component C and D after laccase treatment. Component C was taken for MS-MS]]<br />
<br style="clear: both" /><br />
<br />
The tandem mass spectrometry results showed two peaks in every measurement for possible degradation products. Compared to the native estradiol the component A peak embodies a molecule with two hydrogen atoms less than the native, the same does component C for ethinly estradiol. These peaks were discussed in a short chat with Prof. Dr. Dietmar Kuck, an organic chemist with a lot experience in mass spectrometry. This conversation led to two plausible models for the degradation. The first was a reaction at the hydroxy group of the five-ring of the estradiol (Fig. 18), oxidizing it to a ketone (resulting in estrone as the degradation product). This idea seemed improbable, because ethinyl estradiol cannot be oxidized at that position, but its degradation product also had two hydrogen less than the native (it is impossible to oxidize the hydroxy group of the five-ring to a ketone without losing the ethinyl group or breaking the ring (Fig. 19)). The second model was that the laccase radicalizes the hydroxy group of the phenolic group of the estradiol and ethinyl estradiol, as described in literature, building a phenoxy radical in the first step. In the second step hydrogen is split off on the tertiary carbon in para position finally leading to a quinone like structure (Figure 19). Without knowing the mechanism behind this reaction, this seems the most probable model of the degradation.<br />
<br />
[[File:Bielefeld2012-estradiol-MS-kuck-suggest.JPG|thumb|350px|left|'''Figure 18: First possible structure of the degradation product (component A) after laccase treatment.''' The secondary alcohol is oxidized to a ketone and the product corresponds to estrone. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
[[File:Bielefeld2012-EE2-MSMS-suggestion-Kuck.JPG|thumb|350px|right|'''Figure 19: Suggested chemical structure of the oxidized ethinyl estradiol.''' The phenolic part of the molecule has changed in a quinone like structure. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
<br style="clear: both" /> <br />
The second peaks in the chromatograms (component B and D) embody molecules with two oxygen more and two hydrogen less than the native. We postulate that this might be a transition state where O2 is radically added to the phenolic ring in otho- and meta-position. To that point, there is no data to consolidate this adoption. Component B and D were also fragmented in the tandem mass spectrometry for further analysis, but the resulting peaks could not be differed from the background noise.<br />
<br style="clear: both" /><br />
<br />
= Further substrate analysis via HPLC =<br />
== HPLC analysis of polycylic aromatic hydrocarbons ==<br />
The results of our negative control measurements of polycyclic aromatic hydrocarbons showed that the PAHs decayed without laccase treatment after one hour in Britton Robinson (BR)-buffer. This is shown in Figure 20. <br>The next step was to check which substances in the reaction approach may cause the decay. Therefore naphthalene was dissolved in methanol (which is the solvent for the substrate and used for stopping the reaction), acetonitrile (which could be used as alternative solvent) and BR-buffer with and without ABTS. The results are shown in Figure 21. Using pure methanol and acetonitrile naphthalene is not decayed. In BR-buffer with and without ABTS the decay is nearly completed after one hour treatment. So BR-buffer seems a bad choice to test the degradation of naphtalene under laccase treatment. <br />
[[File:Bielefeld2012_PAH.png|400px|thumb|left|''' Figure 20: Decay of the PAHs naphthalene, acenaphthene and phenantrene in BR-buffer at 30 °C after one hour.''' The initial concentration was 1 µg mL <sup>-1</sup> for all PAHs. After one hour nearly all PAHs decayed completely. (n=2)]]<br />
[[File:Bielefeld2012_Naphthalene.png|400px|thumb|right|'''Figure 21: Naphthalene decay in four different approaches at 30&nbsp;°C after one hour.''' Dissolved in methanol, dissolved in acetonitrile, with BR-buffer and with BR-buffer together with ABTS. (n=2)]]<br />
<br style="clear: both" /><br />
<br />
== HPLC analysis of analgesics ==<br />
Another class of substrates we wanted to test were analgesics. The three analgesic substrates have different optimal extinction and emission values. Every analgesic had to be tested alone. With diclofenac the extinction and emission values were not found. Therefore the substrate was analyzed with the spectrofluorophotometer but this also showed no clear peak for diclofenac and made it therefore not measurable. Additional, difficulties occurred with ibuprofen. Instead of one single peak we found two and they didn't correlate with the used concentrations.<br />
<br style="clear: both" /><br />
<br />
= Outlook =<br />
The HPLC results showed that ECOL, BPUL, TTHL and BHAL are able to degrade estradiol in the presence and absence of ABTS. Ethinyl estradiol is not degraded by the bacterial laccases. Just TTHL showed little degradation activities on ethinyl estradiol in presence of ABTS.<br />
Due to time reasons and the decay of PAHs in Britton Robinson buffer, the analyses of the PAHs and the analgesics with the HPLC and the LC-MS methods could not been carried out. It would be interesting to analyze the produced laccases with the PAHs and analgesics. <br />
Degradation products were found after treatment of estradiol and ethinyl estradiol with TVEL0 with LC-MS. The next step would be to analyze the possible degradation of PAHs, analgesics and estrone and detect degradation products after treatment with the produced bacterial laccases and TVEL5 from ''Trametes versicolor''.<br />
<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/substrateTeam:Bielefeld-Germany/Results/substrate2012-10-27T03:35:18Z<p>Fougee: /* Spectrofluorophotometer Analysis */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Substrate Analysis<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
__TOC__<br />
<br />
== Introduction ==<br />
To investigate the degradation of different substrates with laccases several experiments were performed. For the measurements the four produced bacterial laccases (BHAL, ECOL, TTHL and BPUL) were used. The reactions were measured before and after an incubation with the laccases via high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry. The HPLC was used particularly for analysis of degradation rates after defined time points. With these results it is possible to compare the different laccases in respect to their degradation feasibilities.<br />
To detect degradation products of estradiol and ethinyl estradiol after laccase treatment different analysis via LC-MS and LC-MS-MS were done. We identified two compounds for both, estradiol and ethinyl estradiol, which are probable degradation products after laccase treatment.<br />
<br />
=Degradation measurements with high performance liquid chromatography=<br />
==Dilution series of different estrogens==<br />
<br />
[[File:Bielefeld2012_EthinylEstradiol.jpg|400px|thumb|right|'''Figure 1:''' The calibration curve of ethinyl estradiol as an example. The concentrations were measured between 0.1 µg mL <sup>-1</sup> and 3 µg mL <sup>-1</sup>.]]<br />
<br />
At first dilution series of all different substrates were measured. It was possible to measure calibration curves for estradiol and ethinyl estradiol but not for estrone. This was probably caused by its bad solubility. <br />
The retention time for estradiol is 4.4 minutes and for ethinyl estradiol 4.9 minutes. For all estrogens the same extinction and emission values could be used: Ex<sub>230</sub>, Em<sub>310</sub>.<br />
<br style="clear: both" /><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Degradation of estrogens==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3:''' Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added. The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
=Spectrofluorophotometer Analysis=<br />
<div style="text-align:justify;"><br />
We analyzed the degradation of our substrates with a spectrofluorophotometer. As you can see in the figures below the ethinyl estradiol and estradiol are degraded over night. Figure 4 shows the ethinyl estradiol without laccase treatment, Figure 5 shows that no more ethinyl estradiol can be detected in the sample after the degradation and new peaks appear which might represent possible degradation products. In Figure 6 you can see the estradiol control without laccases. Like ethinyl estradiol theestradiol peak is reduced after the degradation and new peaks appear indicating that those are new degradation products.<br />
[[File:Bielefeld2012-ethinylestradiol-withoutLaccase-spectrofluorophotometer.JPG|thumb|350px|left|'''Figure 4:''' Ethinyl estradiol control without laccases. Ethinyl estradiol was measured in spectrofluorophotometer without laccase treatment to have a control.]] [[File:Bielefeld2012-Ethinylestradiol-verdau-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 5:''' Ethinyl estradiol degradation (with TVEL0). The ethinyl estradiol peak disappeared and some new peaks, probable degradation products, occurred.]]<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012-estradiol-control-spectroflurophotometer.JPG|thumb|350px|left|'''Figure 6:''' Estradiol control without laccases.]]<br />
[[File:Bielefeld2012-estradiol-degradation-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 7:''' Degradation (with TVEL0) of estradiol. It is shown that some estradiol is left but probable degradation products appeared.]]<br />
<br style="clear: both" /><br />
<br />
=Liquid chromatography–mass spectrometry=<br />
=== Dilution series ===<br />
Our substrates are soluble in methanol. We set the standards to a concentration of 1 mg mL<sup>-1</sup>. The detection limit for the LC-MS was evaluated at a concentration of 10 µg L<sup>-1</sup> for the substrates estrone and estradiol. The same limit of detection was used for ethinyl estradiol and anthracene. We only used those four substrates. For all LC-MS sample preparations we used the ''T. versicolor'' laccases. The dilution series was prepared in methanol and 50 % acetonitril-water (v/v).<br />
<br />
[[File:Bielefeld2012-calibrationcurve-Anthracen.jpg|thumb|400px|left|'''Figure 8: Anthracene calibration curve.''' ]]<br />
[[File:Bielefeld2012-Estrone-calibrationcurve.JPG|thumb|400px|right|'''Figure 9: Estrone calibration curve.''']]<br />
<br style="clear: both" /><br />
<br />
=== Degradation results ===<br />
The TVEL0 was able to degrade the synthetic estradiol (Fig. 10) and probably anthracene (Fig. 12). The ethinyl estradiol control showed that it is stable in the used media (Fig. 11). Anthracene disintegrates in the Britton Robinsoon Buffer. But it could be observed, that there is less anthracene measurable with the LC-MS. The results indicate, that the laccase is able to degrade anthracene (Fig. 13). Estrone (Fig. 14) and estradiol (Fig. 15) were degraded as well. Using estrone it could not be identify any degradation products. The reason for this could be that the products are not detectable with LC-MS or with the applied methods. Peaks in the degradation of estradiol have been shown but we were not able to identify them. It could be degradation products. In the following figures the results of the LC-MS measurements are presented. <br />
[[File:Bielefeld2012-Ethinylestradiol-degradation-LCMS.JPG|thumb|left|350px|'''Figure 10: Ethinyl estradiol + TVEL0 measured by LC-MS.''' It is shown that the over night sample has only half of the substrate left.]] <br />
[[File:Bielefeld2012-Anthracen-degradation-LCMS.JPG|thumb|right|350px|'''Figure 12: Anthracene + TVEL0.''' In the over night sample there are no detectable amounts of anthracene left.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Anthracen-standart1.JPG|right|thumb|350px|'''Figure 13: The negative control for anthracene without laccases.''' It is shown the concentration of anthracene decreases. This is caused by the Britton Robinson Buffer.]]<br />
[[File:Bielefeld2012-Ethinylestradiol-standart100.JPG|thumb|left|350px|'''Figure 11: Our ethinyl estradiol negative control without laccase.''' Variation on the peaks is probably caused by a pipetting mistake.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Estrone-degradation-LCMS.JPG|thumb|left|350px|'''Figure 14: Estrone + TVEL0.''' The peaks shows that estrone is degraded but after incubation over night it is still estrone left.]]<br />
[[File:Bielefeld2012-Estradiol-degradation-LCMS.JPG|thumb|right|350px|'''Figure 15: Estradiol degradation analyses with mass-spectrometry.''' On the X-axis the retention time is listed. The Y-axis shows the mass/charge ratio. From white to red the intensity of the measured samples is presented. On the figure above you can see the t<sub>0</sub> estradiol while the figure below shows the degradation. The analytes retended in the first minute are the media soillings. Since we know that the retention time of estradiol is on min 5 we could see that over night no more estradiol is left and some other peaks appear which are probably degradation products]]<br />
<br style="clear: both" /> <br />
We also tried to measure the degradation using mass-spectrometry. Since quantification via mass-spectrometry is difficult regarding the ionization of the analytes, we quantified our substrates by UV-light. Nevertheless, mass spectrometry enables identification of possible degradation products. We analyzed estradiol degradation in detail (Fig. 15), resulting in the detection of possible chemical compounds generated during the (enzymatic) degradation.<br />
<br style="clear: both" /><br />
<br />
=== Further analysis (after Regionals Amsterdam) ===<br />
Since we have seen some possible degradation products, we used more estradiol, ethinyl estradiol (250µg L<sup> -1 </sup> compare to 50µg L<sup> -1 </sup>) and more laccase (0,35U compare to 0,1U) for the reaction to the LC-MS measurement. We found out that after the laccase treatment two new peaks appeared in both the estradiol and ethinyl estradiol. A check against databases could not identify those components so we did an MS-MS on component A respectivly on component C. Since component B is fewer in concentration then component A, we could not find out anything about it (Fig. 16 and Fig. 17). To note the chemical formulares are M+H values. For the real chemical formula you have to deduct this H. <br />
[[File:Bielefeld2012-Estradiol-MS-measurement.JPG|thumb|350px|left|'''Figure 16: Mass spectromerty measurement of estradiol.''' On the X-axis you can see the Time in minutes and on the Y-axis the relative intensity. You can see two new peaks component A and B after laccase treatment. Component A was taken for MS-MS]]<br />
[[File:Bielefeld2012-EthinylEstradiol-MS-measurement.JPG|thumb|350px|right|'''Figure 17: Mass spectromerty measurement of ethinyl estradiol.''' On the X-axis you can see the time in minutes and on the Y-axis the relative intensity. You can see two new peaks component C and D after laccase treatment. Component C was taken for MS-MS]]<br />
<br style="clear: both" /><br />
<br />
The tandem mass spectrometry results showed two peaks in every measurement for possible degradation products. Compared to the native estradiol the component A peak embodies a molecule with two hydrogen atoms less than the native, the same does component C for ethinly estradiol. These peaks were discussed in a short chat with Prof. Dr. Dietmar Kuck, an organic chemist with a lot experience in mass spectrometry. This conversation led to two plausible models for the degradation. The first was a reaction at the hydroxy group of the five-ring of the estradiol (Fig. 18), oxidizing it to a ketone (resulting in estrone as the degradation product). This idea seemed improbable, because ethinyl estradiol cannot be oxidized at that position, but its degradation product also had two hydrogen less than the native (it is impossible to oxidize the hydroxy group of the five-ring to a ketone without losing the ethinyl group or breaking the ring (Fig. 19)). The second model was that the laccase radicalizes the hydroxy group of the phenolic group of the estradiol and ethinyl estradiol, as described in literature, building a phenoxy radical in the first step. In the second step hydrogen is split off on the tertiary carbon in para position finally leading to a quinone like structure (Figure 19). Without knowing the mechanism behind this reaction, this seems the most probable model of the degradation.<br />
<br />
[[File:Bielefeld2012-estradiol-MS-kuck-suggest.JPG|thumb|350px|left|'''Figure 18: First possible structure of the degradation product (component A) after laccase treatment.''' The secondary alcohol is oxidized to a ketone and the product corresponds to estrone. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
[[File:Bielefeld2012-EE2-MSMS-suggestion-Kuck.JPG|thumb|350px|right|'''Figure 19: Suggested chemical structure of the oxidized ethinyl estradiol.''' The phenolic part of the molecule has changed in a quinone like structure. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
<br style="clear: both" /> <br />
The second peaks in the chromatograms (component B and D) embody molecules with two oxygen more and two hydrogen less than the native. We postulate that this might be a transition state where O2 is radically added to the phenolic ring in otho- and meta-position. To that point, there is no data to consolidate this adoption. Component B and D were also fragmented in the tandem mass spectrometry for further analysis, but the resulting peaks could not be differed from the background noise.<br />
<br style="clear: both" /><br />
<br />
= Further substrate analysis via HPLC =<br />
== HPLC analysis of polycylic aromatic hydrocarbons ==<br />
The results of our negative control measurements of polycyclic aromatic hydrocarbons showed that the PAHs decayed without laccase treatment after one hour in Britton Robinson (BR)-buffer. This is shown in Figure 20. <br>The next step was to check which substances in the reaction approach may cause the decay. Therefore naphthalene was dissolved in methanol (which is the solvent for the substrate and used for stopping the reaction), acetonitrile (which could be used as alternative solvent) and BR-buffer with and without ABTS. The results are shown in Figure 21. Using pure methanol and acetonitrile naphthalene is not decayed. In BR-buffer with and without ABTS the decay is nearly completed after one hour treatment. So BR-buffer seems a bad choice to test the degradation of naphtalene under laccase treatment. <br />
[[File:Bielefeld2012_PAH.png|400px|thumb|left|''' Figure 20: Decay of the PAHs naphthalene, acenaphthene and phenantrene in BR-buffer at 30 °C after one hour.''' The initial concentration was 1 µg mL <sup>-1</sup> for all PAHs. After one hour nearly all PAHs decayed completely. (n=2)]]<br />
[[File:Bielefeld2012_Naphthalene.png|400px|thumb|right|'''Figure 21: Naphthalene decay in four different approaches at 30&nbsp;°C after one hour.''' Dissolved in methanol, dissolved in acetonitrile, with BR-buffer and with BR-buffer together with ABTS. (n=2)]]<br />
<br style="clear: both" /><br />
<br />
== HPLC analysis of analgesics ==<br />
Another class of substrates we wanted to test were analgesics. The three analgesic substrates have different optimal extinction and emission values. Every analgesic had to be tested alone. With diclofenac the extinction and emission values were not found. Therefore the substrate was analyzed with the spectrofluorophotometer but this also showed no clear peak for diclofenac and made it therefore not measurable. Additional, difficulties occurred with ibuprofen. Instead of one single peak we found two and they didn't correlate with the used concentrations.<br />
<br style="clear: both" /><br />
<br />
= Outlook =<br />
The HPLC results showed that ECOL, BPUL, TTHL and BHAL are able to degrade estradiol in the presence and absence of ABTS. Ethinyl estradiol is not degraded by the bacterial laccases. Just TTHL showed little degradation activities on ethinyl estradiol in presence of ABTS.<br />
Due to time reasons and the decay of PAHs in Britton Robinson buffer, the analyses of the PAHs and the analgesics with the HPLC and the LC-MS methods could not been carried out. It would be interesting to analyze the produced laccases with the PAHs and analgesics. <br />
Degradation products were found after treatment of estradiol and ethinyl estradiol with TVEL0 with LC-MS. The next step would be to analyze the possible degradation of PAHs, analgesics and estrone and detect degradation products after treatment with the produced bacterial laccases and TVEL5 from ''Trametes versicolor''.<br />
<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/substrateTeam:Bielefeld-Germany/Results/substrate2012-10-27T03:34:00Z<p>Fougee: /* Degradation of estrogens */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Substrate Analysis<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
__TOC__<br />
<br />
== Introduction ==<br />
To investigate the degradation of different substrates with laccases several experiments were performed. For the measurements the four produced bacterial laccases (BHAL, ECOL, TTHL and BPUL) were used. The reactions were measured before and after an incubation with the laccases via high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry. The HPLC was used particularly for analysis of degradation rates after defined time points. With these results it is possible to compare the different laccases in respect to their degradation feasibilities.<br />
To detect degradation products of estradiol and ethinyl estradiol after laccase treatment different analysis via LC-MS and LC-MS-MS were done. We identified two compounds for both, estradiol and ethinyl estradiol, which are probable degradation products after laccase treatment.<br />
<br />
=Degradation measurements with high performance liquid chromatography=<br />
==Dilution series of different estrogens==<br />
<br />
[[File:Bielefeld2012_EthinylEstradiol.jpg|400px|thumb|right|'''Figure 1:''' The calibration curve of ethinyl estradiol as an example. The concentrations were measured between 0.1 µg mL <sup>-1</sup> and 3 µg mL <sup>-1</sup>.]]<br />
<br />
At first dilution series of all different substrates were measured. It was possible to measure calibration curves for estradiol and ethinyl estradiol but not for estrone. This was probably caused by its bad solubility. <br />
The retention time for estradiol is 4.4 minutes and for ethinyl estradiol 4.9 minutes. For all estrogens the same extinction and emission values could be used: Ex<sub>230</sub>, Em<sub>310</sub>.<br />
<br style="clear: both" /><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Degradation of estrogens==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3:''' Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added. The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
=Spectrofluorophotometer Analysis=<br />
<div style="text-align:justify;"><br />
We analyzed the degradation of our substrates with a spectrofluorophotometer. As you can see in the figures below the ethinyl estradiol and estradiol are degraded over night. Figure 4 shows the ethinyl estradiol without laccase treatment, Figure 5 shows that no more ethinyl estradiol can be detected in the sample after the degradation and new peaks appear which might represent possible degradation products. In Figure 6 you can see the estradiol control without laccases. Like ethinyl estradiol theestradiol peak is reduced after the degradation and new peaks appear indicating that those are new degradation products.<br />
[[File:Bielefeld2012-ethinylestradiol-withoutLaccase-spectrofluorophotometer.JPG|thumb|350px|left|'''Figure 4: Ethinyl estradiol control without laccases.''' Ethinyl estradiol was measured in spectrofluorophotometer without laccase treatment to have a control.]] [[File:Bielefeld2012-Ethinylestradiol-verdau-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 5: Ethinyl estradiol degradation (with TVEL0)'''. The ethinyl estradiol peak disappeared and some new peaks, probable degradation products, occurred.]]<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012-estradiol-control-spectroflurophotometer.JPG|thumb|350px|left|'''Figure 6: Estradiol control without laccases.''']]<br />
[[File:Bielefeld2012-estradiol-degradation-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 7: Degradation (with TVEL0) of estradiol.''' It is shown that some estradiol is left but probable degradation products appeared.]]<br />
<br style="clear: both" /><br />
<br />
=Liquid chromatography–mass spectrometry=<br />
=== Dilution series ===<br />
Our substrates are soluble in methanol. We set the standards to a concentration of 1 mg mL<sup>-1</sup>. The detection limit for the LC-MS was evaluated at a concentration of 10 µg L<sup>-1</sup> for the substrates estrone and estradiol. The same limit of detection was used for ethinyl estradiol and anthracene. We only used those four substrates. For all LC-MS sample preparations we used the ''T. versicolor'' laccases. The dilution series was prepared in methanol and 50 % acetonitril-water (v/v).<br />
<br />
[[File:Bielefeld2012-calibrationcurve-Anthracen.jpg|thumb|400px|left|'''Figure 8: Anthracene calibration curve.''' ]]<br />
[[File:Bielefeld2012-Estrone-calibrationcurve.JPG|thumb|400px|right|'''Figure 9: Estrone calibration curve.''']]<br />
<br style="clear: both" /><br />
<br />
=== Degradation results ===<br />
The TVEL0 was able to degrade the synthetic estradiol (Fig. 10) and probably anthracene (Fig. 12). The ethinyl estradiol control showed that it is stable in the used media (Fig. 11). Anthracene disintegrates in the Britton Robinsoon Buffer. But it could be observed, that there is less anthracene measurable with the LC-MS. The results indicate, that the laccase is able to degrade anthracene (Fig. 13). Estrone (Fig. 14) and estradiol (Fig. 15) were degraded as well. Using estrone it could not be identify any degradation products. The reason for this could be that the products are not detectable with LC-MS or with the applied methods. Peaks in the degradation of estradiol have been shown but we were not able to identify them. It could be degradation products. In the following figures the results of the LC-MS measurements are presented. <br />
[[File:Bielefeld2012-Ethinylestradiol-degradation-LCMS.JPG|thumb|left|350px|'''Figure 10: Ethinyl estradiol + TVEL0 measured by LC-MS.''' It is shown that the over night sample has only half of the substrate left.]] <br />
[[File:Bielefeld2012-Anthracen-degradation-LCMS.JPG|thumb|right|350px|'''Figure 12: Anthracene + TVEL0.''' In the over night sample there are no detectable amounts of anthracene left.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Anthracen-standart1.JPG|right|thumb|350px|'''Figure 13: The negative control for anthracene without laccases.''' It is shown the concentration of anthracene decreases. This is caused by the Britton Robinson Buffer.]]<br />
[[File:Bielefeld2012-Ethinylestradiol-standart100.JPG|thumb|left|350px|'''Figure 11: Our ethinyl estradiol negative control without laccase.''' Variation on the peaks is probably caused by a pipetting mistake.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Estrone-degradation-LCMS.JPG|thumb|left|350px|'''Figure 14: Estrone + TVEL0.''' The peaks shows that estrone is degraded but after incubation over night it is still estrone left.]]<br />
[[File:Bielefeld2012-Estradiol-degradation-LCMS.JPG|thumb|right|350px|'''Figure 15: Estradiol degradation analyses with mass-spectrometry.''' On the X-axis the retention time is listed. The Y-axis shows the mass/charge ratio. From white to red the intensity of the measured samples is presented. On the figure above you can see the t<sub>0</sub> estradiol while the figure below shows the degradation. The analytes retended in the first minute are the media soillings. Since we know that the retention time of estradiol is on min 5 we could see that over night no more estradiol is left and some other peaks appear which are probably degradation products]]<br />
<br style="clear: both" /> <br />
We also tried to measure the degradation using mass-spectrometry. Since quantification via mass-spectrometry is difficult regarding the ionization of the analytes, we quantified our substrates by UV-light. Nevertheless, mass spectrometry enables identification of possible degradation products. We analyzed estradiol degradation in detail (Fig. 15), resulting in the detection of possible chemical compounds generated during the (enzymatic) degradation.<br />
<br style="clear: both" /><br />
<br />
=== Further analysis (after Regionals Amsterdam) ===<br />
Since we have seen some possible degradation products, we used more estradiol, ethinyl estradiol (250µg L<sup> -1 </sup> compare to 50µg L<sup> -1 </sup>) and more laccase (0,35U compare to 0,1U) for the reaction to the LC-MS measurement. We found out that after the laccase treatment two new peaks appeared in both the estradiol and ethinyl estradiol. A check against databases could not identify those components so we did an MS-MS on component A respectivly on component C. Since component B is fewer in concentration then component A, we could not find out anything about it (Fig. 16 and Fig. 17). To note the chemical formulares are M+H values. For the real chemical formula you have to deduct this H. <br />
[[File:Bielefeld2012-Estradiol-MS-measurement.JPG|thumb|350px|left|'''Figure 16: Mass spectromerty measurement of estradiol.''' On the X-axis you can see the Time in minutes and on the Y-axis the relative intensity. You can see two new peaks component A and B after laccase treatment. Component A was taken for MS-MS]]<br />
[[File:Bielefeld2012-EthinylEstradiol-MS-measurement.JPG|thumb|350px|right|'''Figure 17: Mass spectromerty measurement of ethinyl estradiol.''' On the X-axis you can see the time in minutes and on the Y-axis the relative intensity. You can see two new peaks component C and D after laccase treatment. Component C was taken for MS-MS]]<br />
<br style="clear: both" /><br />
<br />
The tandem mass spectrometry results showed two peaks in every measurement for possible degradation products. Compared to the native estradiol the component A peak embodies a molecule with two hydrogen atoms less than the native, the same does component C for ethinly estradiol. These peaks were discussed in a short chat with Prof. Dr. Dietmar Kuck, an organic chemist with a lot experience in mass spectrometry. This conversation led to two plausible models for the degradation. The first was a reaction at the hydroxy group of the five-ring of the estradiol (Fig. 18), oxidizing it to a ketone (resulting in estrone as the degradation product). This idea seemed improbable, because ethinyl estradiol cannot be oxidized at that position, but its degradation product also had two hydrogen less than the native (it is impossible to oxidize the hydroxy group of the five-ring to a ketone without losing the ethinyl group or breaking the ring (Fig. 19)). The second model was that the laccase radicalizes the hydroxy group of the phenolic group of the estradiol and ethinyl estradiol, as described in literature, building a phenoxy radical in the first step. In the second step hydrogen is split off on the tertiary carbon in para position finally leading to a quinone like structure (Figure 19). Without knowing the mechanism behind this reaction, this seems the most probable model of the degradation.<br />
<br />
[[File:Bielefeld2012-estradiol-MS-kuck-suggest.JPG|thumb|350px|left|'''Figure 18: First possible structure of the degradation product (component A) after laccase treatment.''' The secondary alcohol is oxidized to a ketone and the product corresponds to estrone. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
[[File:Bielefeld2012-EE2-MSMS-suggestion-Kuck.JPG|thumb|350px|right|'''Figure 19: Suggested chemical structure of the oxidized ethinyl estradiol.''' The phenolic part of the molecule has changed in a quinone like structure. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
<br style="clear: both" /> <br />
The second peaks in the chromatograms (component B and D) embody molecules with two oxygen more and two hydrogen less than the native. We postulate that this might be a transition state where O2 is radically added to the phenolic ring in otho- and meta-position. To that point, there is no data to consolidate this adoption. Component B and D were also fragmented in the tandem mass spectrometry for further analysis, but the resulting peaks could not be differed from the background noise.<br />
<br style="clear: both" /><br />
<br />
= Further substrate analysis via HPLC =<br />
== HPLC analysis of polycylic aromatic hydrocarbons ==<br />
The results of our negative control measurements of polycyclic aromatic hydrocarbons showed that the PAHs decayed without laccase treatment after one hour in Britton Robinson (BR)-buffer. This is shown in Figure 20. <br>The next step was to check which substances in the reaction approach may cause the decay. Therefore naphthalene was dissolved in methanol (which is the solvent for the substrate and used for stopping the reaction), acetonitrile (which could be used as alternative solvent) and BR-buffer with and without ABTS. The results are shown in Figure 21. Using pure methanol and acetonitrile naphthalene is not decayed. In BR-buffer with and without ABTS the decay is nearly completed after one hour treatment. So BR-buffer seems a bad choice to test the degradation of naphtalene under laccase treatment. <br />
[[File:Bielefeld2012_PAH.png|400px|thumb|left|''' Figure 20: Decay of the PAHs naphthalene, acenaphthene and phenantrene in BR-buffer at 30 °C after one hour.''' The initial concentration was 1 µg mL <sup>-1</sup> for all PAHs. After one hour nearly all PAHs decayed completely. (n=2)]]<br />
[[File:Bielefeld2012_Naphthalene.png|400px|thumb|right|'''Figure 21: Naphthalene decay in four different approaches at 30&nbsp;°C after one hour.''' Dissolved in methanol, dissolved in acetonitrile, with BR-buffer and with BR-buffer together with ABTS. (n=2)]]<br />
<br style="clear: both" /><br />
<br />
== HPLC analysis of analgesics ==<br />
Another class of substrates we wanted to test were analgesics. The three analgesic substrates have different optimal extinction and emission values. Every analgesic had to be tested alone. With diclofenac the extinction and emission values were not found. Therefore the substrate was analyzed with the spectrofluorophotometer but this also showed no clear peak for diclofenac and made it therefore not measurable. Additional, difficulties occurred with ibuprofen. Instead of one single peak we found two and they didn't correlate with the used concentrations.<br />
<br style="clear: both" /><br />
<br />
= Outlook =<br />
The HPLC results showed that ECOL, BPUL, TTHL and BHAL are able to degrade estradiol in the presence and absence of ABTS. Ethinyl estradiol is not degraded by the bacterial laccases. Just TTHL showed little degradation activities on ethinyl estradiol in presence of ABTS.<br />
Due to time reasons and the decay of PAHs in Britton Robinson buffer, the analyses of the PAHs and the analgesics with the HPLC and the LC-MS methods could not been carried out. It would be interesting to analyze the produced laccases with the PAHs and analgesics. <br />
Degradation products were found after treatment of estradiol and ethinyl estradiol with TVEL0 with LC-MS. The next step would be to analyze the possible degradation of PAHs, analgesics and estrone and detect degradation products after treatment with the produced bacterial laccases and TVEL5 from ''Trametes versicolor''.<br />
<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/substrateTeam:Bielefeld-Germany/Results/substrate2012-10-27T03:33:34Z<p>Fougee: /* Degradation of estrogens */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Substrate Analysis<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
__TOC__<br />
<br />
== Introduction ==<br />
To investigate the degradation of different substrates with laccases several experiments were performed. For the measurements the four produced bacterial laccases (BHAL, ECOL, TTHL and BPUL) were used. The reactions were measured before and after an incubation with the laccases via high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry. The HPLC was used particularly for analysis of degradation rates after defined time points. With these results it is possible to compare the different laccases in respect to their degradation feasibilities.<br />
To detect degradation products of estradiol and ethinyl estradiol after laccase treatment different analysis via LC-MS and LC-MS-MS were done. We identified two compounds for both, estradiol and ethinyl estradiol, which are probable degradation products after laccase treatment.<br />
<br />
=Degradation measurements with high performance liquid chromatography=<br />
==Dilution series of different estrogens==<br />
<br />
[[File:Bielefeld2012_EthinylEstradiol.jpg|400px|thumb|right|'''Figure 1:''' The calibration curve of ethinyl estradiol as an example. The concentrations were measured between 0.1 µg mL <sup>-1</sup> and 3 µg mL <sup>-1</sup>.]]<br />
<br />
At first dilution series of all different substrates were measured. It was possible to measure calibration curves for estradiol and ethinyl estradiol but not for estrone. This was probably caused by its bad solubility. <br />
The retention time for estradiol is 4.4 minutes and for ethinyl estradiol 4.9 minutes. For all estrogens the same extinction and emission values could be used: Ex<sub>230</sub>, Em<sub>310</sub>.<br />
<br style="clear: both" /><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Degradation of estrogens==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
=Spectrofluorophotometer Analysis=<br />
<div style="text-align:justify;"><br />
We analyzed the degradation of our substrates with a spectrofluorophotometer. As you can see in the figures below the ethinyl estradiol and estradiol are degraded over night. Figure 4 shows the ethinyl estradiol without laccase treatment, Figure 5 shows that no more ethinyl estradiol can be detected in the sample after the degradation and new peaks appear which might represent possible degradation products. In Figure 6 you can see the estradiol control without laccases. Like ethinyl estradiol theestradiol peak is reduced after the degradation and new peaks appear indicating that those are new degradation products.<br />
[[File:Bielefeld2012-ethinylestradiol-withoutLaccase-spectrofluorophotometer.JPG|thumb|350px|left|'''Figure 4: Ethinyl estradiol control without laccases.''' Ethinyl estradiol was measured in spectrofluorophotometer without laccase treatment to have a control.]] [[File:Bielefeld2012-Ethinylestradiol-verdau-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 5: Ethinyl estradiol degradation (with TVEL0)'''. The ethinyl estradiol peak disappeared and some new peaks, probable degradation products, occurred.]]<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012-estradiol-control-spectroflurophotometer.JPG|thumb|350px|left|'''Figure 6: Estradiol control without laccases.''']]<br />
[[File:Bielefeld2012-estradiol-degradation-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 7: Degradation (with TVEL0) of estradiol.''' It is shown that some estradiol is left but probable degradation products appeared.]]<br />
<br style="clear: both" /><br />
<br />
=Liquid chromatography–mass spectrometry=<br />
=== Dilution series ===<br />
Our substrates are soluble in methanol. We set the standards to a concentration of 1 mg mL<sup>-1</sup>. The detection limit for the LC-MS was evaluated at a concentration of 10 µg L<sup>-1</sup> for the substrates estrone and estradiol. The same limit of detection was used for ethinyl estradiol and anthracene. We only used those four substrates. For all LC-MS sample preparations we used the ''T. versicolor'' laccases. The dilution series was prepared in methanol and 50 % acetonitril-water (v/v).<br />
<br />
[[File:Bielefeld2012-calibrationcurve-Anthracen.jpg|thumb|400px|left|'''Figure 8: Anthracene calibration curve.''' ]]<br />
[[File:Bielefeld2012-Estrone-calibrationcurve.JPG|thumb|400px|right|'''Figure 9: Estrone calibration curve.''']]<br />
<br style="clear: both" /><br />
<br />
=== Degradation results ===<br />
The TVEL0 was able to degrade the synthetic estradiol (Fig. 10) and probably anthracene (Fig. 12). The ethinyl estradiol control showed that it is stable in the used media (Fig. 11). Anthracene disintegrates in the Britton Robinsoon Buffer. But it could be observed, that there is less anthracene measurable with the LC-MS. The results indicate, that the laccase is able to degrade anthracene (Fig. 13). Estrone (Fig. 14) and estradiol (Fig. 15) were degraded as well. Using estrone it could not be identify any degradation products. The reason for this could be that the products are not detectable with LC-MS or with the applied methods. Peaks in the degradation of estradiol have been shown but we were not able to identify them. It could be degradation products. In the following figures the results of the LC-MS measurements are presented. <br />
[[File:Bielefeld2012-Ethinylestradiol-degradation-LCMS.JPG|thumb|left|350px|'''Figure 10: Ethinyl estradiol + TVEL0 measured by LC-MS.''' It is shown that the over night sample has only half of the substrate left.]] <br />
[[File:Bielefeld2012-Anthracen-degradation-LCMS.JPG|thumb|right|350px|'''Figure 12: Anthracene + TVEL0.''' In the over night sample there are no detectable amounts of anthracene left.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Anthracen-standart1.JPG|right|thumb|350px|'''Figure 13: The negative control for anthracene without laccases.''' It is shown the concentration of anthracene decreases. This is caused by the Britton Robinson Buffer.]]<br />
[[File:Bielefeld2012-Ethinylestradiol-standart100.JPG|thumb|left|350px|'''Figure 11: Our ethinyl estradiol negative control without laccase.''' Variation on the peaks is probably caused by a pipetting mistake.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Estrone-degradation-LCMS.JPG|thumb|left|350px|'''Figure 14: Estrone + TVEL0.''' The peaks shows that estrone is degraded but after incubation over night it is still estrone left.]]<br />
[[File:Bielefeld2012-Estradiol-degradation-LCMS.JPG|thumb|right|350px|'''Figure 15: Estradiol degradation analyses with mass-spectrometry.''' On the X-axis the retention time is listed. The Y-axis shows the mass/charge ratio. From white to red the intensity of the measured samples is presented. On the figure above you can see the t<sub>0</sub> estradiol while the figure below shows the degradation. The analytes retended in the first minute are the media soillings. Since we know that the retention time of estradiol is on min 5 we could see that over night no more estradiol is left and some other peaks appear which are probably degradation products]]<br />
<br style="clear: both" /> <br />
We also tried to measure the degradation using mass-spectrometry. Since quantification via mass-spectrometry is difficult regarding the ionization of the analytes, we quantified our substrates by UV-light. Nevertheless, mass spectrometry enables identification of possible degradation products. We analyzed estradiol degradation in detail (Fig. 15), resulting in the detection of possible chemical compounds generated during the (enzymatic) degradation.<br />
<br style="clear: both" /><br />
<br />
=== Further analysis (after Regionals Amsterdam) ===<br />
Since we have seen some possible degradation products, we used more estradiol, ethinyl estradiol (250µg L<sup> -1 </sup> compare to 50µg L<sup> -1 </sup>) and more laccase (0,35U compare to 0,1U) for the reaction to the LC-MS measurement. We found out that after the laccase treatment two new peaks appeared in both the estradiol and ethinyl estradiol. A check against databases could not identify those components so we did an MS-MS on component A respectivly on component C. Since component B is fewer in concentration then component A, we could not find out anything about it (Fig. 16 and Fig. 17). To note the chemical formulares are M+H values. For the real chemical formula you have to deduct this H. <br />
[[File:Bielefeld2012-Estradiol-MS-measurement.JPG|thumb|350px|left|'''Figure 16: Mass spectromerty measurement of estradiol.''' On the X-axis you can see the Time in minutes and on the Y-axis the relative intensity. You can see two new peaks component A and B after laccase treatment. Component A was taken for MS-MS]]<br />
[[File:Bielefeld2012-EthinylEstradiol-MS-measurement.JPG|thumb|350px|right|'''Figure 17: Mass spectromerty measurement of ethinyl estradiol.''' On the X-axis you can see the time in minutes and on the Y-axis the relative intensity. You can see two new peaks component C and D after laccase treatment. Component C was taken for MS-MS]]<br />
<br style="clear: both" /><br />
<br />
The tandem mass spectrometry results showed two peaks in every measurement for possible degradation products. Compared to the native estradiol the component A peak embodies a molecule with two hydrogen atoms less than the native, the same does component C for ethinly estradiol. These peaks were discussed in a short chat with Prof. Dr. Dietmar Kuck, an organic chemist with a lot experience in mass spectrometry. This conversation led to two plausible models for the degradation. The first was a reaction at the hydroxy group of the five-ring of the estradiol (Fig. 18), oxidizing it to a ketone (resulting in estrone as the degradation product). This idea seemed improbable, because ethinyl estradiol cannot be oxidized at that position, but its degradation product also had two hydrogen less than the native (it is impossible to oxidize the hydroxy group of the five-ring to a ketone without losing the ethinyl group or breaking the ring (Fig. 19)). The second model was that the laccase radicalizes the hydroxy group of the phenolic group of the estradiol and ethinyl estradiol, as described in literature, building a phenoxy radical in the first step. In the second step hydrogen is split off on the tertiary carbon in para position finally leading to a quinone like structure (Figure 19). Without knowing the mechanism behind this reaction, this seems the most probable model of the degradation.<br />
<br />
[[File:Bielefeld2012-estradiol-MS-kuck-suggest.JPG|thumb|350px|left|'''Figure 18: First possible structure of the degradation product (component A) after laccase treatment.''' The secondary alcohol is oxidized to a ketone and the product corresponds to estrone. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
[[File:Bielefeld2012-EE2-MSMS-suggestion-Kuck.JPG|thumb|350px|right|'''Figure 19: Suggested chemical structure of the oxidized ethinyl estradiol.''' The phenolic part of the molecule has changed in a quinone like structure. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
<br style="clear: both" /> <br />
The second peaks in the chromatograms (component B and D) embody molecules with two oxygen more and two hydrogen less than the native. We postulate that this might be a transition state where O2 is radically added to the phenolic ring in otho- and meta-position. To that point, there is no data to consolidate this adoption. Component B and D were also fragmented in the tandem mass spectrometry for further analysis, but the resulting peaks could not be differed from the background noise.<br />
<br style="clear: both" /><br />
<br />
= Further substrate analysis via HPLC =<br />
== HPLC analysis of polycylic aromatic hydrocarbons ==<br />
The results of our negative control measurements of polycyclic aromatic hydrocarbons showed that the PAHs decayed without laccase treatment after one hour in Britton Robinson (BR)-buffer. This is shown in Figure 20. <br>The next step was to check which substances in the reaction approach may cause the decay. Therefore naphthalene was dissolved in methanol (which is the solvent for the substrate and used for stopping the reaction), acetonitrile (which could be used as alternative solvent) and BR-buffer with and without ABTS. The results are shown in Figure 21. Using pure methanol and acetonitrile naphthalene is not decayed. In BR-buffer with and without ABTS the decay is nearly completed after one hour treatment. So BR-buffer seems a bad choice to test the degradation of naphtalene under laccase treatment. <br />
[[File:Bielefeld2012_PAH.png|400px|thumb|left|''' Figure 20: Decay of the PAHs naphthalene, acenaphthene and phenantrene in BR-buffer at 30 °C after one hour.''' The initial concentration was 1 µg mL <sup>-1</sup> for all PAHs. After one hour nearly all PAHs decayed completely. (n=2)]]<br />
[[File:Bielefeld2012_Naphthalene.png|400px|thumb|right|'''Figure 21: Naphthalene decay in four different approaches at 30&nbsp;°C after one hour.''' Dissolved in methanol, dissolved in acetonitrile, with BR-buffer and with BR-buffer together with ABTS. (n=2)]]<br />
<br style="clear: both" /><br />
<br />
== HPLC analysis of analgesics ==<br />
Another class of substrates we wanted to test were analgesics. The three analgesic substrates have different optimal extinction and emission values. Every analgesic had to be tested alone. With diclofenac the extinction and emission values were not found. Therefore the substrate was analyzed with the spectrofluorophotometer but this also showed no clear peak for diclofenac and made it therefore not measurable. Additional, difficulties occurred with ibuprofen. Instead of one single peak we found two and they didn't correlate with the used concentrations.<br />
<br style="clear: both" /><br />
<br />
= Outlook =<br />
The HPLC results showed that ECOL, BPUL, TTHL and BHAL are able to degrade estradiol in the presence and absence of ABTS. Ethinyl estradiol is not degraded by the bacterial laccases. Just TTHL showed little degradation activities on ethinyl estradiol in presence of ABTS.<br />
Due to time reasons and the decay of PAHs in Britton Robinson buffer, the analyses of the PAHs and the analgesics with the HPLC and the LC-MS methods could not been carried out. It would be interesting to analyze the produced laccases with the PAHs and analgesics. <br />
Degradation products were found after treatment of estradiol and ethinyl estradiol with TVEL0 with LC-MS. The next step would be to analyze the possible degradation of PAHs, analgesics and estrone and detect degradation products after treatment with the produced bacterial laccases and TVEL5 from ''Trametes versicolor''.<br />
<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/substrateTeam:Bielefeld-Germany/Results/substrate2012-10-27T03:33:06Z<p>Fougee: /* Dilution series of different estrogens */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Substrate Analysis<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<br />
</html><br />
__TOC__<br />
<br />
== Introduction ==<br />
To investigate the degradation of different substrates with laccases several experiments were performed. For the measurements the four produced bacterial laccases (BHAL, ECOL, TTHL and BPUL) were used. The reactions were measured before and after an incubation with the laccases via high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry. The HPLC was used particularly for analysis of degradation rates after defined time points. With these results it is possible to compare the different laccases in respect to their degradation feasibilities.<br />
To detect degradation products of estradiol and ethinyl estradiol after laccase treatment different analysis via LC-MS and LC-MS-MS were done. We identified two compounds for both, estradiol and ethinyl estradiol, which are probable degradation products after laccase treatment.<br />
<br />
=Degradation measurements with high performance liquid chromatography=<br />
==Dilution series of different estrogens==<br />
<br />
[[File:Bielefeld2012_EthinylEstradiol.jpg|400px|thumb|right|'''Figure 1:''' The calibration curve of ethinyl estradiol as an example. The concentrations were measured between 0.1 µg mL <sup>-1</sup> and 3 µg mL <sup>-1</sup>.]]<br />
<br />
At first dilution series of all different substrates were measured. It was possible to measure calibration curves for estradiol and ethinyl estradiol but not for estrone. This was probably caused by its bad solubility. <br />
The retention time for estradiol is 4.4 minutes and for ethinyl estradiol 4.9 minutes. For all estrogens the same extinction and emission values could be used: Ex<sub>230</sub>, Em<sub>310</sub>.<br />
<br style="clear: both" /><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Degradation of estrogens==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
=Spectrofluorophotometer Analysis=<br />
<div style="text-align:justify;"><br />
We analyzed the degradation of our substrates with a spectrofluorophotometer. As you can see in the figures below the ethinyl estradiol and estradiol are degraded over night. Figure 4 shows the ethinyl estradiol without laccase treatment, Figure 5 shows that no more ethinyl estradiol can be detected in the sample after the degradation and new peaks appear which might represent possible degradation products. In Figure 6 you can see the estradiol control without laccases. Like ethinyl estradiol theestradiol peak is reduced after the degradation and new peaks appear indicating that those are new degradation products.<br />
[[File:Bielefeld2012-ethinylestradiol-withoutLaccase-spectrofluorophotometer.JPG|thumb|350px|left|'''Figure 4: Ethinyl estradiol control without laccases.''' Ethinyl estradiol was measured in spectrofluorophotometer without laccase treatment to have a control.]] [[File:Bielefeld2012-Ethinylestradiol-verdau-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 5: Ethinyl estradiol degradation (with TVEL0)'''. The ethinyl estradiol peak disappeared and some new peaks, probable degradation products, occurred.]]<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012-estradiol-control-spectroflurophotometer.JPG|thumb|350px|left|'''Figure 6: Estradiol control without laccases.''']]<br />
[[File:Bielefeld2012-estradiol-degradation-spectroflurophotometer.JPG|thumb|350px|right|'''Figure 7: Degradation (with TVEL0) of estradiol.''' It is shown that some estradiol is left but probable degradation products appeared.]]<br />
<br style="clear: both" /><br />
<br />
=Liquid chromatography–mass spectrometry=<br />
=== Dilution series ===<br />
Our substrates are soluble in methanol. We set the standards to a concentration of 1 mg mL<sup>-1</sup>. The detection limit for the LC-MS was evaluated at a concentration of 10 µg L<sup>-1</sup> for the substrates estrone and estradiol. The same limit of detection was used for ethinyl estradiol and anthracene. We only used those four substrates. For all LC-MS sample preparations we used the ''T. versicolor'' laccases. The dilution series was prepared in methanol and 50 % acetonitril-water (v/v).<br />
<br />
[[File:Bielefeld2012-calibrationcurve-Anthracen.jpg|thumb|400px|left|'''Figure 8: Anthracene calibration curve.''' ]]<br />
[[File:Bielefeld2012-Estrone-calibrationcurve.JPG|thumb|400px|right|'''Figure 9: Estrone calibration curve.''']]<br />
<br style="clear: both" /><br />
<br />
=== Degradation results ===<br />
The TVEL0 was able to degrade the synthetic estradiol (Fig. 10) and probably anthracene (Fig. 12). The ethinyl estradiol control showed that it is stable in the used media (Fig. 11). Anthracene disintegrates in the Britton Robinsoon Buffer. But it could be observed, that there is less anthracene measurable with the LC-MS. The results indicate, that the laccase is able to degrade anthracene (Fig. 13). Estrone (Fig. 14) and estradiol (Fig. 15) were degraded as well. Using estrone it could not be identify any degradation products. The reason for this could be that the products are not detectable with LC-MS or with the applied methods. Peaks in the degradation of estradiol have been shown but we were not able to identify them. It could be degradation products. In the following figures the results of the LC-MS measurements are presented. <br />
[[File:Bielefeld2012-Ethinylestradiol-degradation-LCMS.JPG|thumb|left|350px|'''Figure 10: Ethinyl estradiol + TVEL0 measured by LC-MS.''' It is shown that the over night sample has only half of the substrate left.]] <br />
[[File:Bielefeld2012-Anthracen-degradation-LCMS.JPG|thumb|right|350px|'''Figure 12: Anthracene + TVEL0.''' In the over night sample there are no detectable amounts of anthracene left.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Anthracen-standart1.JPG|right|thumb|350px|'''Figure 13: The negative control for anthracene without laccases.''' It is shown the concentration of anthracene decreases. This is caused by the Britton Robinson Buffer.]]<br />
[[File:Bielefeld2012-Ethinylestradiol-standart100.JPG|thumb|left|350px|'''Figure 11: Our ethinyl estradiol negative control without laccase.''' Variation on the peaks is probably caused by a pipetting mistake.]] <br style="clear: both" /> <br />
[[File:Bielefeld2012-Estrone-degradation-LCMS.JPG|thumb|left|350px|'''Figure 14: Estrone + TVEL0.''' The peaks shows that estrone is degraded but after incubation over night it is still estrone left.]]<br />
[[File:Bielefeld2012-Estradiol-degradation-LCMS.JPG|thumb|right|350px|'''Figure 15: Estradiol degradation analyses with mass-spectrometry.''' On the X-axis the retention time is listed. The Y-axis shows the mass/charge ratio. From white to red the intensity of the measured samples is presented. On the figure above you can see the t<sub>0</sub> estradiol while the figure below shows the degradation. The analytes retended in the first minute are the media soillings. Since we know that the retention time of estradiol is on min 5 we could see that over night no more estradiol is left and some other peaks appear which are probably degradation products]]<br />
<br style="clear: both" /> <br />
We also tried to measure the degradation using mass-spectrometry. Since quantification via mass-spectrometry is difficult regarding the ionization of the analytes, we quantified our substrates by UV-light. Nevertheless, mass spectrometry enables identification of possible degradation products. We analyzed estradiol degradation in detail (Fig. 15), resulting in the detection of possible chemical compounds generated during the (enzymatic) degradation.<br />
<br style="clear: both" /><br />
<br />
=== Further analysis (after Regionals Amsterdam) ===<br />
Since we have seen some possible degradation products, we used more estradiol, ethinyl estradiol (250µg L<sup> -1 </sup> compare to 50µg L<sup> -1 </sup>) and more laccase (0,35U compare to 0,1U) for the reaction to the LC-MS measurement. We found out that after the laccase treatment two new peaks appeared in both the estradiol and ethinyl estradiol. A check against databases could not identify those components so we did an MS-MS on component A respectivly on component C. Since component B is fewer in concentration then component A, we could not find out anything about it (Fig. 16 and Fig. 17). To note the chemical formulares are M+H values. For the real chemical formula you have to deduct this H. <br />
[[File:Bielefeld2012-Estradiol-MS-measurement.JPG|thumb|350px|left|'''Figure 16: Mass spectromerty measurement of estradiol.''' On the X-axis you can see the Time in minutes and on the Y-axis the relative intensity. You can see two new peaks component A and B after laccase treatment. Component A was taken for MS-MS]]<br />
[[File:Bielefeld2012-EthinylEstradiol-MS-measurement.JPG|thumb|350px|right|'''Figure 17: Mass spectromerty measurement of ethinyl estradiol.''' On the X-axis you can see the time in minutes and on the Y-axis the relative intensity. You can see two new peaks component C and D after laccase treatment. Component C was taken for MS-MS]]<br />
<br style="clear: both" /><br />
<br />
The tandem mass spectrometry results showed two peaks in every measurement for possible degradation products. Compared to the native estradiol the component A peak embodies a molecule with two hydrogen atoms less than the native, the same does component C for ethinly estradiol. These peaks were discussed in a short chat with Prof. Dr. Dietmar Kuck, an organic chemist with a lot experience in mass spectrometry. This conversation led to two plausible models for the degradation. The first was a reaction at the hydroxy group of the five-ring of the estradiol (Fig. 18), oxidizing it to a ketone (resulting in estrone as the degradation product). This idea seemed improbable, because ethinyl estradiol cannot be oxidized at that position, but its degradation product also had two hydrogen less than the native (it is impossible to oxidize the hydroxy group of the five-ring to a ketone without losing the ethinyl group or breaking the ring (Fig. 19)). The second model was that the laccase radicalizes the hydroxy group of the phenolic group of the estradiol and ethinyl estradiol, as described in literature, building a phenoxy radical in the first step. In the second step hydrogen is split off on the tertiary carbon in para position finally leading to a quinone like structure (Figure 19). Without knowing the mechanism behind this reaction, this seems the most probable model of the degradation.<br />
<br />
[[File:Bielefeld2012-estradiol-MS-kuck-suggest.JPG|thumb|350px|left|'''Figure 18: First possible structure of the degradation product (component A) after laccase treatment.''' The secondary alcohol is oxidized to a ketone and the product corresponds to estrone. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
[[File:Bielefeld2012-EE2-MSMS-suggestion-Kuck.JPG|thumb|350px|right|'''Figure 19: Suggested chemical structure of the oxidized ethinyl estradiol.''' The phenolic part of the molecule has changed in a quinone like structure. This structure was designed with ChemBioDraw Ultra 12.0 after discussion with Prof. Kuck on our MS/MS data.]]<br />
<br style="clear: both" /> <br />
The second peaks in the chromatograms (component B and D) embody molecules with two oxygen more and two hydrogen less than the native. We postulate that this might be a transition state where O2 is radically added to the phenolic ring in otho- and meta-position. To that point, there is no data to consolidate this adoption. Component B and D were also fragmented in the tandem mass spectrometry for further analysis, but the resulting peaks could not be differed from the background noise.<br />
<br style="clear: both" /><br />
<br />
= Further substrate analysis via HPLC =<br />
== HPLC analysis of polycylic aromatic hydrocarbons ==<br />
The results of our negative control measurements of polycyclic aromatic hydrocarbons showed that the PAHs decayed without laccase treatment after one hour in Britton Robinson (BR)-buffer. This is shown in Figure 20. <br>The next step was to check which substances in the reaction approach may cause the decay. Therefore naphthalene was dissolved in methanol (which is the solvent for the substrate and used for stopping the reaction), acetonitrile (which could be used as alternative solvent) and BR-buffer with and without ABTS. The results are shown in Figure 21. Using pure methanol and acetonitrile naphthalene is not decayed. In BR-buffer with and without ABTS the decay is nearly completed after one hour treatment. So BR-buffer seems a bad choice to test the degradation of naphtalene under laccase treatment. <br />
[[File:Bielefeld2012_PAH.png|400px|thumb|left|''' Figure 20: Decay of the PAHs naphthalene, acenaphthene and phenantrene in BR-buffer at 30 °C after one hour.''' The initial concentration was 1 µg mL <sup>-1</sup> for all PAHs. After one hour nearly all PAHs decayed completely. (n=2)]]<br />
[[File:Bielefeld2012_Naphthalene.png|400px|thumb|right|'''Figure 21: Naphthalene decay in four different approaches at 30&nbsp;°C after one hour.''' Dissolved in methanol, dissolved in acetonitrile, with BR-buffer and with BR-buffer together with ABTS. (n=2)]]<br />
<br style="clear: both" /><br />
<br />
== HPLC analysis of analgesics ==<br />
Another class of substrates we wanted to test were analgesics. The three analgesic substrates have different optimal extinction and emission values. Every analgesic had to be tested alone. With diclofenac the extinction and emission values were not found. Therefore the substrate was analyzed with the spectrofluorophotometer but this also showed no clear peak for diclofenac and made it therefore not measurable. Additional, difficulties occurred with ibuprofen. Instead of one single peak we found two and they didn't correlate with the used concentrations.<br />
<br style="clear: both" /><br />
<br />
= Outlook =<br />
The HPLC results showed that ECOL, BPUL, TTHL and BHAL are able to degrade estradiol in the presence and absence of ABTS. Ethinyl estradiol is not degraded by the bacterial laccases. Just TTHL showed little degradation activities on ethinyl estradiol in presence of ABTS.<br />
Due to time reasons and the decay of PAHs in Britton Robinson buffer, the analyses of the PAHs and the analgesics with the HPLC and the LC-MS methods could not been carried out. It would be interesting to analyze the produced laccases with the PAHs and analgesics. <br />
Degradation products were found after treatment of estradiol and ethinyl estradiol with TVEL0 with LC-MS. The next step would be to analyze the possible degradation of PAHs, analgesics and estrone and detect degradation products after treatment with the produced bacterial laccases and TVEL5 from ''Trametes versicolor''.<br />
<br />
</div><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/thermoTeam:Bielefeld-Germany/Results/thermo2012-10-27T03:26:01Z<p>Fougee: /* Immobilization */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase LttH from <a href="http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzresources_pi5"> <i>Thermus thermophilus</i> HB27 (ATCC7061)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
Initially some trials of shaking flask cultivations were made with different parameters to identify the best conditions for the production of the His-tagged laccase LttH from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] named TTHL. Due to the absence of enzyme activity of the enzyme in the cell lysate a purification method was established (using Ni-NTA-His tag resin). Using ''E. coli'' KRX containing BioBrick <partinfo>BBa_K863010</partinfo>, TTHL could not be detected by SDS-PAGE (molecular weight of 53&nbsp;kDa) or by activity test. Therefore a new BioBrick <partinfo>BBa_K863012</partinfo> was constructed and expressed in ''E. coli'' Rosetta-Gami&nbsp;2. With this expression system the TTHL could be detected by SDS-PAGE and purified by using a small scale Ni-NTA column. The fractionated samples were tested regarding their activity. TTHL was shown to oxidize ABTS. After measuring activity of TTHL a scale up of the fermentation was successfully implemented up to 6&nbsp;L. A further scale up to 12 L with a optimized medium (HSG) and a labscale Ni-NTA-Purification were implemented to enable additional experiments to characterize TTHL. A total specific enzyme activity of 15 U mg<sup>-1</sup> was determined for TTHL at pH 4 at 25°C with ABTS as a substrate.<br />
<br />
<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivation===<br />
<div style="text-align:justify;"><br />
The first trials to produce the LttH-laccase from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzresources_pi5 ''Thermo thermophilus'' HB27] (named TTHL) were performed in shaking flasks with various volumes (from 100&nbsp;mL up to 1&nbsp;L flasks, with and without baffles) and under different cultivation conditions. The best cultivation condition for <partinfo>BBa_K863010</partinfo> expressed in E. coli was screened by varying the temperature, the chloramphenicol concentration,induction strategy and cultivation time. Furthermore, ''E. coli'' was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> in the medium to provide a sufficient amount of copper, which is needed for bilding the active center. Under the screened conditions no biological active TTHL could be produced. Therefore another BioBrick was constructed and another chassi was chosen. To improve the expression another BioBrick <partinfo>BBa_K863012</partinfo> was used, which has a constitutive promoter instead of the T7 promoter system. Additionally, the strain ''E. coli'' Rosetta-Gami 2 was chosen, because of its ability to translate rare codons. TTHL was then produced under the following conditions: <br />
</div><br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#LB_medium LB-Medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol and 300&nbsp;µg&nbsp;mL<sup>-1</sup> ampicillin<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 24&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask cultivation, but not yet for the bioreactor cultivation.<br />
<br />
===Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863012</partinfo>===<br />
<br />
<br />
<br />
<br />
[[File:Bielefeld2012_TTHL6LFermentation.jpg|450px|thumb|left|'''Figure 1:''' Fermentation of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863012</partinfo> (TTHL) in a Bioengineering NFL22. Conditions: 6&nbsp;L of [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol at 37&nbsp;°C, pH&nbsp;7. Agitation increased when pO<sub>2</sub> was below 30&nbsp;% and OD<sub>600</sub> was measured each hour.]]<br />
<div style="text-align:justify;"><br />
After measuring activity of TTHL we made a scale-up and cultivated ''E.&nbsp;coli'' Rosetta-Gami 2 expressing <partinfo>BBa_K863000</partinfo> in a Bioengineering NFL22 fermenter with a total volume of 6&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were online monitored and are illustrated in Figure 1. No initial lag phase was noticeable. Due to the cell growth the pO<sub>2</sub> decreased,breakdown of the control unit resulted in a drop to 0%. After a cultivation time of 9&nbsp;hours the agitation speed was therefore increased manually up to 500&nbsp;rpm, which resulted in a higher pO<sub>2</sub> value of more than 100&nbsp;% for the rest of the cultivation. During the whole process the OD<sub>600</sub> increased slower compared to the fermentation of ''E.&nbsp;coli'' KRX expressing <partinfo>BBa_K863000</partinfo> or <partinfo>BBa_K863005</partinfo>. The maximal OD<sub>600</sub> was reached after 19 hours cultivation time at which point the cells were harvested.<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
===Purification of TTHL===<br />
<br />
<br />
<p align="justify"><br />
The cells were harvested by centrifugation and resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation high pressure homogenization] and centrifuged. After preparing the cell paste the TTHL could not be purified with the 15&nbsp;mL column, due to a not available column. For this reason a small scale purification (6&nbsp;mL) of the supernatant of the homogenisation was made with a 1&nbsp;mL Ni-NTA-column. <br />
</p><br />
<br />
===SDS-PAGE of purified TTHL===<br />
<div style="text-align:justify;"><br />
[[File:Bielefeld2012_0923.jpg|450px|thumb|left|'''Figure&nbsp;2:''' SDS-PAGE of purified ''E. coli'' Rosetta-Gami&nbsp;2 containing <partinfo>BBa_K863012</partinfo> lysate (fermented in 6 L Bioengineering NFL22). The flow-through, wash and elution fraction 1 to 5 are shown. The arrow marks the TTHL band with a molecular weight of 53&nbsp;kDa.]]<br />
<br />
Figure 2 shows the SDS-PAGE of the purified ''E.&nbsp;coli'' Rosetta-Gami 2 lysates fermented in 6&nbsp;L Bioengineering NFL22 fermenter. Additionally the flow-through, wash and all elution fractions (1 to 5) are shown. TTHL has a molecular weight of 53&nbsp;kDa and the corresponding band is marked with a red arrow. The TTHL band can be found in fractions 1 to 3, but not in the other two elution fractions. Furthermore there are some other non-specific bands, which could not be identified. To improve the purification an 15&nbsp;mL column was implemented.<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: 12 L Fermentation of ''E. coli'' Rosetta Gami 2 with [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 BBa_K863012]===<br />
<br />
[[File:Bielefeld2012_TTHL12L.jpg|450px|thumb|left|'''Figure 3:''' Fermentation of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863012</partinfo> (TTHL) in a Bioengineering NFL22. Conditions: 12&nbsp;L of [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol at 37&nbsp;°C, pH&nbsp;7. Agitation increased when pO<sub>2</sub> was below 50&nbsp;% and OD<sub>600</sub> was measured each hour.]]<br />
<div style="text-align:justify;"><br />
Another scale-up of the fermentation of ''E. coli'' Rosetta-Gami 2 with <partinfo>BBa_K863012</partinfo> was made up to a final working volume of 12 L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined as well as the glycerin concentration. The data are illustrated in Figure 3. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autodinduction medium] was used to produce more biomass. Due to the change of media and to a low amount of cells for inocculation, there was a long lag phase of about 6 hours. During this phase the glycerin concentration is nearly constant. The cells were in an exponential phase between 8 and 18 hours of cultivation, which results in a decrease of gylcerin, of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 18 hours of cultivation the maximal OD<sub>600</sub> of 9.63 was reached and the glycerin was completely consumed. At that time the cells were just entering the stationary phase. No further data for OD<sub>600</sub> were measured. The cells have been harvested after 22 hours of cultivation. In the review, to leave the cells longer in the stationary phase could have been a better procedure concerning the yield.<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
===Since Regionals: Purification of TTHL since Regionals===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer] and mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization]. The cell debris were removed by centrifugation and microfiltration via [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50]. The supernatant of the cell lysate was concentrated with [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50] with 10 kDa and loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazole) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazole) with a length of 80&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazole) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the TTHL elution is shown in Figure 4:<br />
</p><br />
<br />
[[File:Bielefeld2012 TTHL Chromatogramm.jpg|450px|thumb|left|'''Figure 4:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His-tag Purification of TTHL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' Rosetta Gami 2 with <partinfo>BBa_K863012</partinfo>. TTHL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazole) with a maximal UV-detection signal of 123&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
Contrary to our expectations, the chromatogram shows one distinguished peak. This peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 100&nbsp;% (equates to 500&nbsp;mM imidazole) and resulted from the elution of bound protein. Earlier measurements of other bacterial laccases showed that the elution of these laccases begins with a elution buffer concentration of 50&nbsp;% equates to 250&nbsp;mM imidazole. One explanation of this result could be a low concentration of the produced TTHL. Consequently all elution fractions were analyzed by SDS-PAGE to detect TTHL. In the chromatogram no further peaks were detected. The following increasing UV detection signal by increasing concentration of the elution buffer results from the rising imidazole concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 5.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-PAGE of protein purification===<br />
[[File:Bielefeld2012_1019thermo.jpg|300px|thumb|left|'''Figure 5:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 BBa_K863012]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 5 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' Rosetta-Gami 2 culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 BBa_K863012] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged TTHL has a molecular weight of 53 kDa. Apparently the concentration of TTHL is too low to see a band. <br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Activity analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL]==<br />
<br />
===Initial activity tests of purified fractions===<br />
<p align="justify"><br />
There was no activity measurable after cultivation and purification of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BBa_K863022] under the control of a T7 promoter. Activity tests of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] under a constitutive promoter did reveal TTHL laccases capable of oxidizing ABTS. Fractions 1 to 5 of the purification above were rebuffered with deionized H<sub>2</sub>O and incubated with 0.4 mM CuCl<sub>2</sub> for 2 hours. Activity measurements were performed using 140 µL sample, 0.1 mM ABTS and 100 mM sodium acetate buffer (pH 5) to a final volume of 200 µL. The change in optical density at 420 nm was detected, reporting the oxidization of ABTS through laccases. Fractions 1 to 5 show activity (Figure 6). Fraction 2 seems to contain most of TTHL showing the highest activity compared to the other fractions: 40 % of the used ABTS has been oxidized after 2 hours. Based on these results protein concentrations have to be determined and the activity of the TTHL laccase can be characterized in further experiments including pH optimum and activity in regard of temperature shifts.<br />
[[File:Bielefeld2012_17_09_TTHL1.jpg|thumbnail|450px|center|'''Figure 6:''' Activity test of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] fractions resulting from the purification. Reaction setup includes 140 µL fraction sample (CuCl<sub>2</sub> incubated), 0.1 mM ABTS and 100 mM sodium actetate buffer (pH 5) to a final volume of 200 µL. Measurements were done at 25 °C and over a time period of 5 hours. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] shows activity in oxidizing ABTS except fractions 1 seems to have no active [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL]. (n=4)]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
The purificated fractions of the cultivation after the Regional Jamborees in Amsterdam were tested concerning their [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein concentration]. After re-buffering the [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th protein concentration] was determined again and all fraction were incubated with 0.4 mM CuCl<sub>2</sub>. For the initial activity test the protein amount was adjusted for comparison. The fractions were measured in Britton-Robinson buffer at pH 5 with 0.1 mM ABTS. Fraction 50 % 1 showed the highest activity (Fig. 7). Regarding the protein amount of this fraction and the statement, that 90 % of this are TTHL laccase, fraction 50 % 1 contains 4,03 µg mL<sup>-1</sup>. To ensure enough protein for further experiments, the second best fraction, which is fraction 5 % 3 was added to fraction 50 % 1. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. In total, both fraction contain [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_19th/ 4,4 µg mL<sup>-1</sup>].<br />
[[File:Bielefeld2012_new_TTHL_activity.jpg|500px|thumb|center|'''Figure 7''': Activity assay of each purified fraction of the new cultivation with TTHL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] activity depending on different ABTS concentrations===<br />
<br />
In order to find the substrate saturation, laccase activity was measured with ABTS concentrations ranging from 0.1 mM to 8 mM. 616 ng TTHL laccase were used for measurements with ABTS concentrations of 0.1 mM to 5 mM, 308 ng TTHL laccase were used for measurements with ABTS concentrations of 5 mM to 8 mM. Measurements were done in Britton-Robinson buffer (pH 5) at 25 °C for 30 minutes taking the OD<sub>420</sub> every 5 minutes. Comparing the graphs in Figure 8 and Figure 9, the substrate saturation is not reached with 5 mM ABTS. An application of 8 mM shows less oxidized ABTS as measurements with 7 mM ABTS. Further experiments were done with 7 mM ABTS.<br />
<br />
[[File:Bielefeld2012_TTHL_klein_ABTS.jpg|thumb|left|360px|'''Figure 8:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng TTHL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 0.1 mM to 5 mM.]]<br />
[[File:Bielefeld2012_TTHL_hoch.jpg|thumb|right|360px|'''Figure 9:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 308 ng TTHL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5 mM to 8 mM. An ABTS concentration of 7 mM was determined as substrate saturated.]]<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] pH optimum===<br />
<br />
[[File:Bielefeld2012_Thermo_pH_Foto.png|thumb|right|200px|'''Figure 10:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 5 the darkest color has been reached.]]<br />
<br />
The pH of the medium containing the enzyme is very important for its activity. The pH optimum of TTHL is at pH 5. This is the result of activity measurements using Britton-Robinson buffer with differently adjusted pHs. TTHL laccase was re-buffered into H<sub>2</sub>O and incubated with 0.4 mM CuCl<sub>2</sub>. The range from pH 4 to pH 9 was tested under substrate saturation at 25&nbsp;°C for 30 minutes. At pH 5 ABTS gets oxidized the fastest (see Fig. 10 and 11). At higher and lower pHs than pH 5, the activity of TTHL is decreased considerably. The resulting Units mg<sup>-1</sup> support the observed data (see Fig. 12). At pH 5 TTHL shows a specific enzyme activity of ~15 U mg<sup>-1</sup>. The higher the pH, the less U mg-1 can be calculated for TTHL. At pH 4 and 6 the activity is decreased to 42 % and at pH 7 even to 14 % in comparison to pH 5. But still TTHL is active at this pH allowing an application of this laccase in a waste water treatment plant where the average pH is a pH of 6.9. However, a combination with a more effective enzyme should be considered.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_TTHL_pH_new.jpg|thumb|left|360px|'''Figure 11:''' Oxidized ABTS by TTHL laccases at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated TTHL laccase (308 ng), Britton Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH&nbsp;5.]]<br />
[[File:Bielefeld2012_TTHL_pH_Units.jpg|thumb|right|360px|'''Figure 12:''' Calculated specific enzyme activity of TTHL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012 TTHL Temp ABTSox.jpg|left|200px|thumb|'''Figure 13''': Standard activity test for TTHL measured at 10&nbsp;°C and 25&nbsp;°C resulting in a decreased activity at 10&nbsp;°C. As a negative control the impact of 0.4&nbsp;mM CuCl<sub>2</sub> in oxidizing ABTS at 10&nbsp;°C and 25&nbsp;°C were analyzed.]]<br />
[[File:Bielefeld2012 TTHL Temp Units.jpg|right|200px|thumb|'''Figure 14''': Deriving from the obtained values of oxidized ABTS in time at 10&nbsp;°C and 25&nbsp;°C the specific enzyme activity was calculated. For the temperatures a difference of 2&nbsp;U mg<sup>-1</sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of TTHL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests as described above were performed at 10&nbsp;°C and 25&nbsp;°C. The measurements were conducted for 30 minutes. The obtained results reveal an activity decrease of about 35&nbsp;% of TTHL at 10&nbsp;°C in comparison to 25&nbsp;°C (see Fig. 13). The obtained results were used to calculate the specific enzyme activity which was at 13 and 15&nbsp;U mg<sup>-1</sup>, respectively (see Fig. 14). The negative control without TTHL laccase but 0.4 mM CuCl<sub>2</sub> at 10&nbsp;°C and 25&nbsp;°C show a negligible oxidation of ABTS. The low difference observed between the two samples is great news for the possible application in waste water treatment plants.<br />
<br><br><br><br><br><br><br><br><br><br />
<br />
== Immobilization ==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 15''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 15 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 21% of TTHL laccases was still present in the supernatant. This illustrates that TTHL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
<br />
<br />
<br />
[[File:Bielefeld2012-Graphen_Bead_Thermo.jpg|500px|left|thumb|'''Figure 16''': Illustration of ABTS oxidation by TTHL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 16 shows the illustration of ABTS oxidation by TTHL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the very low concentration of purified TTHL.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
/partinfo>. The maximal OD<br />
/div><br />
<br />
===Since Regionals: Purification of TTHL since Regionals===</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:21:40Z<p>Fougee: /* Immobilization */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <a href="http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29"> <i>Escherichia coli</i> BL21 (DE3)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 19:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 19). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 20) or acteonitrile (Figure 21), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 20:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 21:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 22). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 22:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 23). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 24). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 23:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 24:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 25:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 25, Fig. 26 and Fig. 27). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 27). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 26''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 27''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 28:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 29:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 28). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 29). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 30:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 30. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 31: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 31. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 32''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 32 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 33''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In Figure 33, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 34''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 34 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:21:04Z<p>Fougee: /* Immobilization */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <a href="http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29"> <i>Escherichia coli</i> BL21 (DE3)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 19:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 19). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 20) or acteonitrile (Figure 21), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 20:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 21:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 22). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 22:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 23). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 24). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 23:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 24:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 25:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 25, Fig. 26 and Fig. 27). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 27). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 26''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 27''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 28:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 29:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 28). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 29). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 30:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 30. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 31: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 31. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 32''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 32 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 33''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 33, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 34''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 34 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:19:21Z<p>Fougee: /* Substrate Analysis */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <a href="http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29"> <i>Escherichia coli</i> BL21 (DE3)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 19:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 19). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 20) or acteonitrile (Figure 21), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 20:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 21:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 22). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 22:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 23). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 24). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 23:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 24:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 25:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 25, Fig. 26 and Fig. 27). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 27). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 26''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 27''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 28:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 29:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 28). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 29). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 30:''' Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS. In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 30. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 31: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 31. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:17:33Z<p>Fougee: /* Since Regionals: ECOL activity at different temperatures */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <a href="http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29"> <i>Escherichia coli</i> BL21 (DE3)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 19:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 19). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 20) or acteonitrile (Figure 21), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 20:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 21:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 22). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 22:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 23). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 24). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 23:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 24:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 25:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 25, Fig. 26 and Fig. 27). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 27). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 26''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 27''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 28:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 29:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 28). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 29). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:16:26Z<p>Fougee: /* Since Regionals: ECOL pH optimum */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <a href="http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29"> <i>Escherichia coli</i> BL21 (DE3)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 19:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 19). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 20) or acteonitrile (Figure 21), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 20:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 21:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 22). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 22:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 23). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 24). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 23:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 24:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 25:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 25, Fig. 26 and Fig. 27). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 27). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 26''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 27''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:15:50Z<p>Fougee: /* Since Regionals: ECOL pH optimum */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <a href="http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29"> <i>Escherichia coli</i> BL21 (DE3)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 19:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 19). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 20) or acteonitrile (Figure 21), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 20:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 21:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 22). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 22:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 23). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 24). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 23:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 24:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 25:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 25, Fig. 26 and Fig. 27). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 26''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 27''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:14:47Z<p>Fougee: /* Since Regionals: ECOL activity depending on different ABTS concentrations */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <a href="http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29"> <i>Escherichia coli</i> BL21 (DE3)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 19:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 19). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 20) or acteonitrile (Figure 21), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 20:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 21:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 22). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 22:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 23). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 24). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 23:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 24:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:13:36Z<p>Fougee: /* Since Regionals: Initial activity tests of purified fractions */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <a href="http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29"> <i>Escherichia coli</i> BL21 (DE3)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 19:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 19). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 20) or acteonitrile (Figure 21), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 20:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 21:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 22). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 22:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:12:49Z<p>Fougee: /* Impact of MeOH and acetonitrile on ECOL */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <a href="http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29"> <i>Escherichia coli</i> BL21 (DE3)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 19:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 19). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 20) or acteonitrile (Figure 21), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 20:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 21:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:11:34Z<p>Fougee: /* ECOL activity depending on different ABTS concentrations */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from [http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29 <i>Escherichia coli</i> BL21 (DE3)]<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 19:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 19). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:10:37Z<p>Fougee: /* ECOL activity at different temperatures */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from [http://openwetware.org/wiki/E._coli_genotypes#BL21.28DE3.29 <i>Escherichia coli</i> BL21 (DE3)]<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 18:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 18). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:09:06Z<p>Fougee: /* ECOL CuCl2 concentration */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 16). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 17). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T03:03:09Z<p>Fougee: /* ECOL CuCl2 concentration */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 16). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 17). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 18). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 16:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 17:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T02:59:50Z<p>Fougee: /* ECOL pH optimum */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
''Note: The experimental setup for the pH acticity assay was not well chosen. The buffering capacity of sodium acetate buffer is restricted to a smaller pH range than used in this experiment. The activity assay was optimized after the Regionals in Amsterdam to ensure correct measurements and values.''<br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 13. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 14 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 15 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 13:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 14:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 15:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 13). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 12). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 14). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 13:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 14:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T02:53:41Z<p>Fougee: /* Initial activity tests of purified fractions */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 12). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 12:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 10. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 11 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 12 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 10:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 11:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 13). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 12). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 14). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 13:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 14:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T02:44:19Z<p>Fougee: /* MALDI-TOF Analysis of ECOL */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10:''' The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.]][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11:''' Part of MALDI-TOF Evaluation]]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 9). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 9:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 10. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 11 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 12 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 10:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 11:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 13). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 12). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 14). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 13:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 14:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T02:43:23Z<p>Fougee: /* MALDI-TOF Analysis of ECOL */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 10 and 11 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 10: The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.''']][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 11: Part of MALDI-TOF Evaluation''']]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 9). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 9:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 10. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 11 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 12 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 10:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 11:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 13). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 12). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 14). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 13:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 14:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T02:42:28Z<p>Fougee: /* Since Regionals: SDS-Page of protein purification */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 9:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 9 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 7 and 8 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 7: The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.''']][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 8: Part of MALDI-TOF Evaluation''']]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 9). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 9:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 10. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 11 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 12 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 10:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 11:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 13). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 12). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 14). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 13:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 14:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T02:41:53Z<p>Fougee: /* Since Regionals: SDS-Page of protein purification */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 10:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 10 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 7 and 8 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 7: The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.''']][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 8: Part of MALDI-TOF Evaluation''']]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 9). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 9:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 10. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 11 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 12 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 10:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 11:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 13). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 12). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 14). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 13:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 14:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T02:41:02Z<p>Fougee: /* Since Regionals: Purification of ECOL */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 8 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 8.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 8:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 9.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 3:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 3 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 7 and 8 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 7: The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.''']][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 8: Part of MALDI-TOF Evaluation''']]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 9). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 9:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 10. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 11 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 12 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 10:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 11:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 13). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 12). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 14). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 13:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 14:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T02:38:42Z<p>Fougee: /* Purification of ECOL */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 3.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 3:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 3 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 7 and 8 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 7: The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.''']][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 8: Part of MALDI-TOF Evaluation''']]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 9). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 9:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 10. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 11 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 12 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 10:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 11:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 13). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 12). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 14). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 13:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 14:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T02:37:04Z<p>Fougee: /* 6&nbsp;L Fermentation of E. coli KRX with BBa_K863005 */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized further<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile. A total specific enzyme activity of 5,5 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;4. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 3.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 3:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 3 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 7 and 8 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 7: The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.''']][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 8: Part of MALDI-TOF Evaluation''']]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 9). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 9:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 10. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 11 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 12 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 10:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 11:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 13). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 12). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 14). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 13:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 14:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/pumiTeam:Bielefeld-Germany/Results/pumi2012-10-27T02:04:16Z<p>Fougee: /* Since Regionals: SDS-PAGE of protein purification */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CotA from <a href="http://www.dsmz.de/catalogues/details/culture/DSM-27.html"> <i>Bacillus pumilus</i> DSM 27 ( ATCC7061)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with different parameters to define the best conditions for production of the His tagged CotA from [http://www.dsmz.de/catalogues/details/culture/DSM-27.html ''Bacillus pumilus'' DSM 27 ( ATCC7061)] named BPUL. Due to inactivity of the enzyme in the cell lysate a purification method was established (using Ni-NTA-Histag resin and Syringe or ÄKTA method). The purified BPUL could be detected by SDS-PAGE (molecular weight of 58.6&nbsp;kDa) as well as by MALDI-TOF. To improve the purification strategies the length of the linear elution gradient was increased up to 200 mL . The fractionated samples were also tested concerning their activity and revealed high activity. Optimal conditions for activity were identified. After measuring activity of BPUL a successful scale up was made up to 3&nbsp;L and also up to 6&nbsp;L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium (HSG) was implemented to enable additional experiments to characterize BPUL. With this a total specific enzyme activity of ~40 U mg<sup>-1</sup> was determined for ECOL at pH 5 at 25°C with ABTS as a substrate. Additional scale up experiments will be important for further real world applications.<br />
<br />
<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivation===<br />
<div style="text-align:justify;"><br />
The first trials to produce the CotA-laccase from [http://www.dsmz.de/catalogues/details/culture/DSM-27.html ''Bacillus pumilus'' DSM 27] (ATCC7061, named BPUL) were performed in shaking flasks with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during the screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), the concentration of chloramphenicol (20 to 170&nbsp;µg&nbsp;mL<sup>-1</sup>), induction strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction with 0,1&nbsp;% rhamnose) and cultivation time (6 to 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub>, to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments the best conditions for expression of BPUL were identified(see below). The addition of CuCl<sub>2</sub> did not increase activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> ===<br />
<br />
[[File:Bielefeld2012_BPUL3LFermentation.jpg|450px|thumb|left|'''Figure 1:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (BPUL) in a [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Biostat_B_Bioreactor_.283_L.29_by_Braun Braun Biostat&nbsp;B], scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<p align="justify"><br />
<br />
After the measurement of BPUL activity we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> in a[https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Biostat_B_Bioreactor_.283_L.29_by_Braun Braun Biostat&nbsp;B] fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. We got a long lag phase of 2&nbsp;hours due to a relatively old preculture. The cell growth caused a decrease in pO<sub>2</sub> and after 3&nbsp;hours the value fell below 50&nbsp;%, so that the agitation speed increased automatically. After 8.5&nbsp;hours the deceleration phase started and therefore the agitation speed was decreased. The maximal OD<sub>600</sub> of 3.53 was reached after 10&nbsp;hours, which means a decrease in comparison to the fermentation of ''E.&nbsp;coli'' KRX under the same conditions (OD<sub>600,max</sub> =4.86 after 8.5&nbsp;hours, time shift due to long lag phase). The cells were harvested after 11&nbsp;hours.<br />
</p><br />
<br style="clear: both" /><br />
<br />
=== Purification of BPUL ===<br />
<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the lysed cell paste was loaded on the Ni-NTA-column (15&nbsp;mL Ni-NTA resin) with a flowrate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed with 10&nbsp;column&nbsp;volumes (CV) Ni-NTA-equilibrationbuffer. The bound proteins were eluted by an increasing Ni-NTA-elutionbuffer gradient from 0&nbsp;% to 100&nbsp;% with a total volume of 100&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak.A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the BPUL-elution is shown in Figure 2:<br />
</p><br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BPUL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution from FLPC Ni-NTA-His tag purification of BPUL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>. BPUL was eluted between a process volume of 460&nbsp;mL to 480&nbsp;mL with a maximal UV-detection signal of 69 mAU]]<br />
<br />
<p align="justify"><br />
The chromatogram shows a remarkable widespread peak between the process volume of 460&nbsp;mL to 480&nbsp;mL with the highest UV-detection signal of 69 mAU, which can be explained by the elution of bound proteins. The corresponding fractions were analyzed by SDS-PAGE analysis. During the elution, a steady increase of the UV-signal caused by the increasing imidazol concentration during the elution gradient. Between the process volume of 550 and 580&nbsp;mL there are several peaks (up to a UV-detection-signal of 980&nbsp;mAU) detectable. These results are caused by an accidental detachment in front of the UV-detector. Just to be on the safe side, the corresponding fractions were analyzed by SDS-PAGE analysis. The corresponding SDS-PAGE is shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of purified BPUL===<br />
<div style="text-align:justify;"><br />
[[File:Bielefeld2012_0906.jpg|height={50px}|weight={400px}|thumb|left|'''Figure 3:''' SDS-PAGE of purified ''E. coli'' KRX lysate containing <partinfo>BBa_K863000</partinfo> (fermented in a 3 L Biostat Braun B fermenter). The flow-through, wash and the elution fractions 7 and 8 are shown. The arrow marks the BPUL band with a molecular weight of 58.6 kDa.]]<br />
<br />
Figure 3 shows the purified ECOL including flow-through, wash and the elution fractions 7 and 8. These two fractions were chosen due to a high peak in the chromatogram. BPUL has a molecular weight of 58.6 kDA and was marked with a red arrow. The band appears in both fractions. There are also some other non-specific bands, which could not be identified. To improve the purification the elution gradient length should be longer and slower the next time.<br />
<br />
The appearing bands were analyzed by MALDI-TOF and could be identified as CotA (BPUL).<br />
<br style="clear: both" /><br />
</div><br />
<br />
===6&nbsp;L Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>===<br />
<br />
[[File:Bielefeld2012_BPUL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (BPUL) in aBioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> measured every hour. ]]<br />
<br />
<p align="justify"><br />
Another scale-up for ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL22. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 4. There was no noticeable lag phase. Agitation speed was increased up to 425&nbsp;rpm after one hour due to problems caused by the control panel. The pO<sub>2</sub> decreased until a cultivation time of 4.75&nbsp;hours. The increasing pO<sub>2</sub> level indicates the beginning of the deceleration phase. There is no visible break in cell growth caused by an induction of protein expression. A maximal OD<sub>600</sub> of 3.68 was reached after 8&nbsp;hours of cultivation, which is similar to the 3&nbsp;L fermentation (OD<sub>600</sub> = 3.58 after 10 hours, time shift due to long lag phase). The cells were harvested after 12&nbsp;hours.<br />
<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of BPUL===<br />
<br />
<p align="justify"><br />
The harvested cells were prepared in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the lysed cell paste was loaded on the Ni-NTA-column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed with 5&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer]. The bound proteins were eluted by an increasing elutionbuffer gradient from 0&nbsp;% (equates to 20&nbsp;mM imidazol) to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 200&nbsp;mL. This strategy was chosen to improve the purification by a slower increase of [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer] concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the BPUL elution is shown in Figure 5.<br />
</p><br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BPUL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA-Histag Purification of BPUL produced by 6&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>. BPUL was eluted between a process volume of 832&nbsp;mL and 900&nbsp;mL with a maximal UV-detection signal of 115&nbsp;mAU.]]<br />
<br />
<p align="justify"><br />
The chromatogram shows a peak at the beginning of the elution. This can be explained by pressure fluctuations upon starting the elution procedure. In between the processing volumes of 832&nbsp;mL and 900&nbsp;mL there is remarkable widespread peak with a UV-detection signal of 115&nbsp;mAU. This peak corresponds to an elution of bound proteins at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] concentration between 10&nbsp;% and 20&nbsp;% (equates to 50-100&nbsp;mM imidazol). The corresponding fractions were analyzed by SDS-PAGE. The ensuing upwards trend of the UV-signal is caused by the increasing imidazol concentration during the elution gradient. Towards the end of the elution procedure there is a constant UV-detection signal, which shows, that most of the bound proteins was already eluted. Just to be on the safe side, all fractions were analyzed by SDS-PAGE to detect BPUL. The SDS-PAGE is shown in Figure 6.<br />
<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of purified BPUL===<br />
<div style="text-align:justify;"><br />
[[File:Bielefeld2012 0914.jpg|450px|thumb|left|'''Figure 6:''' SDS-PAGE of purified ''E.&nbsp;coli'' with <partinfo>BBa_K863000</partinfo> lysate (fermented in a Bioengineering NFL22 fermenter, 6 L). The flow-through, wash and elution fraction 1 to 9 are shown. The arrow marks the BPUL band with a molecular weight of 58.6 kDa. ]]<br />
<br />
In Figure 6 the SDS-PAGE of the Ni-NTA purification of the lysed ''E. coli'' KRX culture containing <partinfo>BBa_K863000</partinfo> is illustrated. It shows the flow-through, wash and elution fractions 1 to 9. The His-tagged BPUL has a molecular weight of 58.6 kDA and was marked with a red arrow. The band appears in all fractions from 2 to 9 with varying strength, the strongest ones in fractions 7 to 9. There are also some other non-specific bands, which could not be identified. Therefore the purification method could moreover be improved.<br />
In summary, the scale up was successful, improving protein production and purification method once again. <br />
<br />
Furthermore the bands were analyzed by MALDI-TOF and identified as CotA (BPUL). <br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> ===<br />
<br />
<br />
[[File:Bielefeld2012_BPUL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (BPUL) in an Bioengineering NFL 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> was fermented in a Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
At the beginning of the cultivation, the cells were in lag phase, in which they adapt to the medium. During their growth the cells consumed glycerin as well as O<sub>2</sub>, which leads to an increase of agitation speed to hold a minimal pO<sub>2</sub> of 50 %. After 11 hours, the glycerin was completely consumed and the pO<sub>2</sub> increased up to 100 %, which indicates that the cells entered the stationary phase. The maximal OD<sub>600</sub> of 12.6 was reached after 12 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br style="clear: both" /><br />
<br />
=== Since Regionals: Purification of BPUL ===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 70&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 100&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. Unfortunately, the data of this procedure are not available due to a computer crash after the purification step. All Fractions were analysed to detect BPUL.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-PAGE of protein purification===<br />
[[File:Bielefeld2012_1019pumi.jpg|300px|thumb|left|'''Figure 8:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BBa_K863000]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 8 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BBa_K863000] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BPUL has a molecular weight of 58.6 kDa. BPUL could not be attributed exactly to any band. There are some other non-specific bands, wich could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of BPUL===<br />
<br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. <br />
The in silico- tryspinated created peptide mass fingerprints were compared with the measured masses gotten from the MALDI. With a sequence coverage of 21,9% BPUL was identified. <br />
In Figure 7 and 8 the chromatogram of the peptide mass fingerprint and the single masses are shown. <br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_BPumi_.png|thumb|400px|left|center|'''Figure 7:''' MALDI-TOF spectrum]] [[File:Bielefeld2012_Massenspektrometrische_Auswertung_BPumi.png|400px|thumb|right|'''Figure 8:''' MALDI-TOF spectrum results of the analysis]]<br />
<br style="clear: both" /><br />
<br />
==Activity analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL]==<br />
<br />
<br />
===Initial activity tests of purified fractions===<br />
<br />
<p align="justify"><br />
Initial tests were done with elution fractions 1 to 4 to determine the activity of the purified [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase. The fractions were rebuffered into deionized H<sub>2</sub>O using [http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 0.1 mM ABTS and 100 mM sodium acetate buffer (pH 5) to a final volume of 200 µL and the absorption was measured at 420 nm to detect oxidization over a time period of 5 hours at 25°C. Each fraction did show contained active laccase able to oxidize ABTS (see Figure 9). After 15 minutes, saturation was observed with ~60 µM oxidized ABTS. After 5 hours ~5 µM ABTS got reduced again. This behavior has been observed in the activity plot of the positive control [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase seems is reversible. Additionally, protein concentrations of each fraction were identified using the Bradford protocol. The four tested fractions showed approximately the same amount of protein after rebuffering, namely 0.5 mg mL<sup>-1</sup>. Fraction 4, containing the most protein and also most of active laccase was chosen for subsequent activity tests of BPUL. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between TVEL0 measurements and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] measurements.<br />
</p><br />
<br />
[[File:Bielefeld2012_Party_Pumi_bestimmung2.jpg|thumbnail|600px|center|'''Figure 9:''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase activity measured in 0.1 mM ABTS and 100 mM sodium acetate buffer (pH 5) to a final volume of 200 µL at 25°C over a time period of 3.5 hours. Each tested fraction reveals activity reaching the saturation after 15 minutes with ~60 µM ABTS<sub>ox</sub> after 0.4 mM CuCl<sub>2</sub> incubation. (n=4)]]<br />
<br style="clear: both" /><br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] pH optimum===<br />
<br />
<p align="justify"><br />
<br />
To determine at which pH the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase has its optimum in activity, a gradient of sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity was tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 11. A distinct pH optimum can be seen at pH 5. The saturation is reached after 3 hours with 50% oxidization of ABTS through the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase at pH 5 (55 µM oxidized ABTS). The other tested pHs only led to a oxidation of 18% of added ABTS. Figure 12 represents the negative control showing the oxidation of ABTS through 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The highest increase in oxidized ABTS can be seen at a pH of 5. After 5 hours 15% ABTS are oxidized only through CuCl<sub>2</sub>. Nevertheless this result does not have an impact on the reactivity of the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase at pH 5, which is still the optimal pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
[[File:Bielefeld2012_PH_Pumi1.jpg|thumbnail|500px|center|'''Figure 11:''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase activity measured in 100 mM sodium acetate buffer with a range of different pHs from pH 1 to pH 9, 0.1 mM ABTS to a final volume of 200 µL at 25°C over a time period of 5 hours. Before the measurements samples were incubated with CuCl<sub>2</sub>. The optimal pH for [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity Tests using 0.04 mM CuCl<sub>2</sub> H<sub>2</sub>O instead of Laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In regard to our project an optimal pH of 5 is a helpful result. Since waste water in waste water treatment plants has a average pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary.<br />
<br style="clear: both" /><br />
</p><br />
<br />
<br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] CuCl<sub>2</sub> concentration===<br />
<p align="justify"><br />
Another test of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase. 0.03 mg mL<sup>-1</sup> of protein were incubated with different CuCl<sub>2</sub> concentrations ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, 0.1 mM ABTS and 100 mM sodium actetate buffer (pH 5) to a final volume of 200 µL. The reactivity was measured at 420 nm, 25°C and over a time period of 5 hours. As expected the saturation takes place after 3 hours (see Figure 12). The differences in the activity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccases incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase is observed after incubation with 0.6 mM CuCl<sub>2</sub> (52% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 48% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase reactivity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> without applying laccase to detect the oxidization of ABTS through copper (see Figure 13). The more CuCl<sub>2</sub> was present, the more ABTS was oxidzied after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012_Pumi_Cu1.jpg|thumbnail|500px|center|'''Figure 12:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] incubated in different CuCl<sub>2</sub> concentrations. Without CuCl<sub>2</sub> incubation the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase shows half of the activit as after CuCl<sub>2</sub> incubation. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leas to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 13:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of Laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzyme. Still it is expensive to be reliant on CuCl<sub>2</sub> and a potential risk using heavy metals for waste water purifcation.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012_BPUL_Temp.jpg|thumbnail|450px|left|'''Figure 14:''' Standard activity test for [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<p align="justify"><br />
To investigate the activity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] at lower temperatures, activity tests as described above were performed at 10°C and 25°C. A small decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C (see Fig. 14). After 3.5 hours when samples at 25°C reached the saturation samples at 10°C had not, but nonetheless the difference is minimal. After 3 hours 5% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase but 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
A a decrease in the reactivity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase was expected. The observed small reduction in enzyme activity is excellent news for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity depending on different ABTS concentrations===<br />
<br />
[[File:Bielefeld2012_BPUL_ABTS.jpg|thumbnail|450px|left|'''Figure 15:''' Analysis of ABTS oxidation by [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccases incubated in 0.4 CuCl<sub>2</sub> tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<p align="justify"><br />
Furthermore, [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated, the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 15). Especially using 16 µL showed an increase in the activity until 1 hour (reaching 50 µM ABTS<sub>ox</sub>), but the amount of oxidized ABTS decreased afterward.<br />
<br style="clear: both" /><br />
</p><br />
<br />
<br />
<br />
===Impact of MeOH and acteonitrile on [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL]===<br />
<p align="justify"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccases had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase, different amounts of MeOH (Figure 16) or acteonitrile (Figure 17), 0.1 mM ABTS and 100 mM sodium actetate buffer to a final volume of 200 µL. The observed reactivity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] in regard of oxidizing ABTS did not reveal a huge decrease. The less MeOH or acetonitrile was used, the higher was the amount of oxidized ABTS after 3 hours. An application of 16 µL MeOH or acetonitrile led to a decrease of maximal 10% oxidized ABTS compared to 2 µL MeOH or acetonitrile. Negative controls are shown in [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Impact_of_MeOH_and_acteonitrile_on_ECOL Figure 17 and 18] of the ECOL laccase. MeOH and acetonitril are able to oxidize ABTS. After 5 hours at 25°C ~15 µM ABTS get oxidized through MeOH or acetonitrile, but samples with [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase show a distinct higher activity of 50 µM ABTS<sub>ox</sub>.<br />
[[File:Bielefeld2012_Pumi_MeOH1.jpg|thumbnail|500px|center|'''Figure 16:''' Standard [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012_Pumi_acetonitrile1.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]</p><br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<p align="justify"><br />
After the Regional Jamboree in Amsterdam further BPUL was produced. The most comprising fractions of the purification were analyzed for [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] (10/16), re-buffered into deionized H<sub>2</sub>O and incubated in 0.4 mM CuCl<sub>2</sub>. Again, the [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Wednesday_October_17th/ protein content] (10/17) of each fraction was determined because of the loss of proteins through re-buffering. Initial activity tests were done in Britton-Robinson buffer with 0.1 mM ABTS. The protein content of each fraction was adjusted for comparison of the resulting activity (see '''Fig. 18''').<br />
[[File:Bielefeld2012_new_BPUL_acitivity.jpg|500px|thumb|center|'''Figure 18:''' Activity assay of each purified fraction of recent produced BPUL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction was adjusted. The measurement was done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
Fraction 50% 2 showed the highest activity. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. The saturation was reached at ~1 h. For comparison it was stated that this fraction contains 90 % laccase and therefore the BPUL concentration is 25,1 µg mL<sup>-1</sup>.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity depending on different ABTS concentrations===<br />
<p align="justify"><br />
In order to find the substrate saturation, laccase activity was measured with ABTS concentrations ranging from 0.1 mM to 8 mM. 616 ng BPUL were used for measurements with ABTS concentrations of 0.1 mM to 5 mM, 308 ng BPUL were used for measurements with ABTS concentrations of 5 mM to 8 mM. Measurements were done in Britton-Robinson buffer (pH 5) at 25 °C for 30 minutes taking the OD<sub>420</sub> every 5 minutes. Comparing the graphs in Figure 19 and Figure 20, both show a comprising substrate saturation with 5 mM ABTS. Higher concentrations of ABTS than 5 mM did not show any other effects on the activity of BPUL. For all following BPUL activity measurements after the Regional Jamborees in Amsterdam a concentration of 5 mM ABTS was applied.<br />
[[File:Bielefeld2012_BPUL_klein_ABTS.jpg|thumb|left|360px|'''Figure 19:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng BPUL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 0.1 mM to 5 mM.]]<br />
[[File:Bielefeld2012_BPUL_hoch.jpg|thumb|right|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 308 ng BPUL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5 mM to 8 mM. An ABTS concentration of 5 mM was determined as substrate saturation.]]<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] pH optimum===<br />
<br />
[[File:Bielefeld2012_Pumi_pH_Foto.png|thumb|right|200px|'''Figure 21:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 5 and pH 4 the darkest colour has been reached.]]<br />
The pH of the medium containing the enzyme is of high importance for its activity. The pH optima of BPUL are pH 4 and pH 5. This is the result of activity measurements using Britton-Robinson buffer with differently adjusted pHs. BPUL was re-buffered into H<sub>2</sub>O and incubated with 0.4 mM CuCl<sub>2</sub>. The range from pH 4 to pH 9 was tested under substrate saturation at 25 °C for 30 minutes. At pH 4 and pH 5 ABTS got oxidized the fastest (see Fig. 21 and Fig. 22). At higher pHs than pH 5, the activity of BPUL was decreased considerably. The resulting Units mg<sup>-1</sup> support the observed data (see Fig. 23). At pH 4 and pH 5 BPUL showed a specific enzyme activity of ~37 U mg<sup>-1</sup>. The higher the pH, the less U mg<sup>-1</sup> could be calculated for BPUL. At pH 7 1/3 of the activity decreased, but still BPUL was active at this pH allowing an application of this laccase in a waste water treatment plant where the average pH is a pH of 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BPUL_pH_new.jpg|thumb|left|360px|'''Figure 22:''' Oxidized ABTS by BPUL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated BPUL laccase (308 ng), Britton Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The highest amount of oxidized ABTS was detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012_BPUL_pH_Units.jpg|thumb|right|360px|'''Figure 23:''' Calculated specific enzyme activity of BPUL at different pH conditions. The highest specific enzyme activity for ABTS was under pH 4 and pH 5 conditions. The higher the pH, the less ABTS got oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012 BPUL Temp ABTSox.jpg|left|200px|thumb|'''Figure 24:''' Standard activity test for BPUL measured at 10 °C and 25 °C resulting in a comparable activity at the tested temperatures. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 BPUL Temp Units.jpg|right|200px|thumb|'''Figure 25:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures only a difference of 1 U mg<sup>-1</sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
To investigate the activity of BPUL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The obtained results reveal a comparable activity of BPUL at high and low temperatures (see Fig. 24). The measurements were conducted for 30 minutes until saturation initiated. Both samples reached saturation after 15-20 minutes. The obtained results were used to calculate the specific enzyme activity which was in both cases at about 37 U mg<sup>-1</sup> (see Fig. 25). The negative control without BPUL laccase but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The observed activity at both conditions was good news for the possible application in waste water treatment plants where the temperature differs from 8.1 °C to 20.8 °C.<br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
== Immobilization ==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 3% of BPUL laccases was still present in the supernatant. This illustrates that BPUL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
<br />
<br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_bpumi.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of BPUL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of BPUL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of BPUL in the supernatant is compared to the activity of nontreated BPUL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_BPUL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by BPUL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by BPUL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the very high activity of BPUL, which could not be measured properly.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/haloTeam:Bielefeld-Germany/Results/halo2012-10-27T02:01:48Z<p>Fougee: /* Since Regionals: SDS-Page of protein purification */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase Lbh1 from <a href="http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5"> <i>Bacillus halodurans</i> C-125 </a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with various parameters to identify the best conditions for production of the His tagged laccase Lbh1 from [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] named BHAL. Due to inactivity of the enzyme in the cell lysate a purification method was established (using Ni-NTA-Histag resin). BHAL could not be detected by SDS-PAGE (theoretical molecular weight of 56&nbsp;kDa) or activity test by using the BioBrick <partinfo>BBa_K863020</partinfo> and ''E. coli'' KRX as expression system. Due to this results the new BioBrick <partinfo>BBa_K863022</partinfo> was constructed and expressed ''E. coli'' Rossetta-Gami&nbsp;2. With this expression system the laccase could be produced and analysed via SDS-PAGE. A small scale Ni-NTA-column was used to purify the laccase. The fractionated samples were tested regarding their activity with ABTS and showed ability in oxidizing ABTS. A scale up to 12 L with a optimized medium (HSG) and a labscale Ni-NTA-Purification were implemented to enable additional experiments to characterize BHAL. <br />
<br />
<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Cultivation===<br />
<div style="text-align:justify;"> <br />
The first trials to produce the Lbh1 - laccase from ''Bacillus halodurans'' (named BHAL) were performed in shaking flasks with various flask designs (from 100 mL to 1 L flasks, with and without baffles) and under several conditions. The varied parameters in our screening experiments were temperature (27 °C, 30 °C and 37 °C), concentration of chloramphenicol (20 - 170 µg mL<sup>-1</sup>), induction strategy (autoinduction and manual induction with 0,1 % rhamnose) and cultivation time (6 to 24 h). Furthermore cultivation was performed with and without addition of 0.25 mM CuCl<html><sub>2</sub></html> to provide a sufficient amount of copper, which is needed for the active center of the laccase. ''E.coli'' KRX was not able to produce active BHAL under the tested conditions, therefore another chassis was chosen. For further cultivations ''E. coli'' Rosetta-Gami 2 was transformed with BBa_K863012, because of its ability to translate rare codons. Finally BHAL was produced under the following conditions:<br />
</div><br />
* flask design: shaking flask without baffles <br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#LB_medium LB-Medium] <br />
* antibiotics: 60 µg mL<sup>-1</sup> chloramphenicol and 300 µg mL<sup>-1</sup> ampicillin <br />
* temperature: 37 °C <br />
* cultivation time: 24 h<br />
<br />
===Purification===<br />
<br />
<div style="text-align:justify;"> <br />
The cells were harvested and resuspended in Ni-NTA-equilibration buffer, mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Sonication sonification] and centrifuged. After preparing the cell paste the BHAL laccase could not be purified with the 15 mL Ni-NTA column, because the column was not available. For this reason a small scale purification (6 mL) of the supernatant of the lysate was performed with a 1 mL [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Syringe_method Ni-NTA column]. The elution was collected in 1 mL fractions.<br />
</div><br />
<br />
===SDS-PAGE===<br />
<br />
<div style="text-align:justify;"> [[File:Bielefeld2012_0913.jpg|450px|thumb|left|'''Figure 1:''' SDS-PAGE of purified lysate derived from a flask cultivation of ''E. coli'' Rosetta-Gami 2 carrying <partinfo>BBa_K863022</partinfo>. Lanes 2 to 7 show the flow-through, the wash and the elution fractions 1 to 4. BHAL has a molecular weight of 56 kDa and is marked with an arrow.]]<br />
<br />
In figure 1 the different fractions of the purified cell lysate of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo> are shown in a SDS-PAGE. BHAL has a molecular weight of 56 kDa. In lane 5, which corresponds to the elution fraction 2, a faint band of 56 kDa is visible. Therefore the fractions were further analysed by activity test and MALDI-TOF.<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: 12L Fermentation of ''E. coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo>===<br />
<br />
[[File:Bielefeld2012_BHAL12L.jpg|450px|thumb|left|'''Figure 2:''' Fermentation of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo> (BHAL) in a Bioengineering NFL22. Conditions: 12&nbsp;L of [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg mL <sup> -1 </sup> chloramphenicol at 37&nbsp;°C, pH&nbsp;7. Agitation increased when pO<sub>2</sub> was below 50&nbsp;% and OD<sub>600</sub> was measured each hour. The glycerin concentration was measured on important points of the cultivation with [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#Carbon_source_measurement_with_HPLC HPLC].]]<br />
<div style="text-align:justify;"><br />
After measuring the BHAL activity a scale-up was performed and ''E. coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo> was cultivated in a Bioengineering NFL 22 fermenter with a total volume of 12 L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined as well as the glycerin concentration. The data are illustrated in Figure 2. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autodinduction medium] was used to produce more biomass. Due to the change of media and to a low amount of cells for inoculation there was a long lag phase of nearly 10 hours. During this phase the glycerin concentration was approximately constant. The following cell growth caused a decrease of glycerin concentration and of pO<sub>2</sub>. After 11 hours the value fell below 50 %, so that the agitation speed increased automatically. After 21 hours the deceleration phase started and therefore the agitation speed decreased. The maximal OD<sub>600</sub> of 9.9 was reached after 22 hours, when the cells entered the stationary phase. The glycerin was completely consumed. The cells were harvested at this time. It might have been better to cultivate a few hours longer.<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
===Since Regionals: Purification of BHAL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer] and mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization]. The cell debris were removed by centrifugation and microfiltration via [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50]. The supernatant of the cell lysate was concentrated with [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50] with 10 kDa and loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 80&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 80&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 90&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the BHAL elution is shown in Figure 5:<br />
</p><br />
<br />
[[File:Bielefeld2012_BHAL_Chromatogramm.jpg|450px|thumb|left|'''Figure 3:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His-tag Purification of BHAL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' Rosetta Gami 2 with <partinfo>BBa_K863022</partinfo>. BHAL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 123&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a Ni-NTA-equilibration buffer concentration of 5 % (equates to 25 mM imidazol) and resulted from the elution of weakly bound proteins. Contrary to our expectations, the chromatogram shows the second distinguished peak. This peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 100&nbsp;% (equates to 500&nbsp;mM imidazol) and resulted from the elution of bound protein. Earlier measurements of other bacterial laccases showed that the elution of these laccases begins with a elution buffer concentration of 50&nbsp;%(equates to 250&nbsp;mM imidazol). One explanation of this result could be a low concentration of the produced BHAL. Consequently all elution fractions were analyzed by SDS-PAGE to detect BHAL. In the chromatogram no further peaks were detected. The following increasing UV detection signal by increasing concentration of the eltutionbuffer results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 4.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-PAGE of protein purification===<br />
[[File:Bielefeld2012_1019halo.jpg|300px|thumb|left|'''Figure 4:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BBa_K863022]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 4 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' Rosetta-Gami 2 culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BBa_K863022] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The His-tagged BHAL has a molecular weight of 56 kDa. Apparently the concentration of BHAL is too low to see a band. <br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL]==<br />
<p align="justify"><br />
<br />
===Initial activity tests of purified fractions===<br />
<br />
The resulting fractions of the cultivation and purification of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] (fraction 1 to 5) were analysed with activity tests. After rebuffering into deionized H<sub>2</sub>O and incubation with 0.4 mM CuCl<sub>2</sub> for 2 hours, the samples were measured with 140&nbsp;µL sample, 0.1 mM ABTS, 100 mM sodium acetate buffer to a final volume of 200 µL. The change in optical density was measured at 420 nm, reporting the oxidation of ABTS for 5 hours at 25°C. An increase in ABTS<sub>ox</sub> can be seen (Figure 4), indicating produced [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] laccase in each fraction. Fraction 2 shows the highest amount of ABTS<sub>ox</sub> (55%) reaching saturation after 3 hours. Similar to [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase, [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] is capable to reach saturation after 3 hours with approximately oxidizing 55% of the supplied ABTS. Therefore [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] is going to be characterized further.<br />
[[File:Bielefeld2012_17_09_BHAL1.jpg|thumbnail|center|500px|'''Figure 4''': Activity test of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] fractions after purification. Reaction setup includes 140 µL fraction sample (CuCl2 incubated), 0.1 mM ABTS and 100 mM sodium actetate buffer (pH 5) to a final volume of 200 µL. Measurements were done at 25°C and over a time period of 5 hours. Each fraction shows activity, especially fraction 2, which therefore contains most [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] laccase. (n=4)]]<br />
<br />
<br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Different fractions of the purification of a new cultivation since the Regional Jamborees in Amsterdam were tested regarding their activity of the produced BHAL. Before and after re-buffering the protein concentration was determined. The initial activity tests were done in Britton-Robinson buffer (pH 5) with 0.1 mM ABTS at 25 °C. The protein amount was adjusted in each sample for a comparison. One distinct fraction showed the highest activity: fraction 5% 3 (Fig. 5). The contained laccase amount was calculated by assuming that the most active fraction contains 90 % laccase. This leads to a BHAL concentration of 10,9 ng mL<sup>-1</sup>.<br />
[[File:Bielefeld2012_new_BHAL_activity.jpg|500px|thumb|center|'''Figure 5:''' Activity assay of each purified fraction of recent produced BHAL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction had been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] activity depending on different ABTS concentrations===<br />
<br />
To be able to calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. This allows the comparison of Units mg<sup>-1</sup> with other laccase activities and data found in literature. For this purpose ABTS concentrations ranging from 0.1 mM to 8 mM were applied in an experimental setup containing Britton-Robinson buffer (pH) and a temperature of 25 °C. For measurements with 0.1 mM to 5 mM ABTS 616 ng BHAL were used (Fig. 6). For measurements with 5 mM to 8 mM ABTS only 308 ng BHAL were applied (Fig. 7). Applying less than 7 mM ABTS a static increase in oxidized ABTS was given. Measurements with 8 mM ABTS showed a slower increase in oxidized ABTS as with 7 mM ABTS (Fig. 7). This may be due to a substrate toxication. The most compromising ABTS concentration was 7 mM with the highest increase in oxidized ABTS. Therefore a substrate saturation was reached with 7 mM ABTS.<br />
[[File:Bielefeld2012_BHAL_klein_ABTS.jpg|thumb|left|360px|'''Figure 6:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng BHAL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 0.1 mM to 5 mM.]]<br />
[[File:Bielefeld2012_BHAL_ABTS_hoch.jpg|thumb|right|360px|'''Figure 7:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 308 ng BHAL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5 mM to 8 mM. An ABTS concentration of 7 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] pH optimum===<br />
<br />
[[File:Bielefeld2012_Halo_pH_Foto.png|thumb|right|200px|'''Figure 8:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color, the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour was detected.]]<br />
To determine the optimal experimental setup for BHAL activity measurements, the best pH had to be determined. Using Britton-Robinson buffer pHs between pH 4 and pH 9 had been adjusted. 308 ng BHAL per well had been tested under these pH conditions using 7 mM ABTS. The CuCl<sub>2</sub> incubated and therefor activated BHAL showed a high activity at pH 4 and pH 5, where most of ABTS was oxidized (compared to Fig. 8 and 9). The calculated specific enzyme activity of BHAL showed high activity at both mentioned pHs (Fig. 10). While BHAL had an activity of ~8 U mg<sup>-1</sup> at pH 4 and pH 5, the enzyme activity decreased at higher pHs. At a pH of 6 only 1/3 of enzyme activity could be detected compared to the activity at pH 4 and pH 5. While still active at pH 7, the BHAL is not as suitable as thought for an application at a waste water treatment plant because of its high activity in acidic environments.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BHAL_pH_new.jpg|thumb|360px|left|'''Figure 9:''' Oxidized ABTS by BHAL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated BHAL (308 ng), Britton Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The highest amount of oxidzed ABTS could be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012_BHAL_pH_Units.jpg|thumb|360px|right|'''Figure 10:''' Calculated specific enzyme activity of BHAL at different pH conditions. The highest specific enzyme activity for ABTS was under pH 4 and pH 5 conditions. The higher the pH, the less ABTS got oxidzed. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012 BHAL Temp ABTSox.jpg|left|200px|thumb|'''Figure 11:''' Standard activity test for BHAL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 BHAL Temp Units.jpg|right|200px|thumb|'''Figure 12:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 3 U mg<sup>-1</sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
To investigate the activity of BHAL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results revealed a lower activity of BHAL at 10 °C in comparison to 25 °C (see Fig. 11). The obtained results were used to calculate the specific enzyme activity which was at 4.2 and 7.2 U mg<sup>-1</sup>, respectively (see Figure 12). The negative control without BHAL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C showed a negligible oxidation of ABTS. The activity of BHAL was increased to about 60 % at 10 °C but nevertheless the observed activity at both conditions was great news for the possible application in waste water treatment plants.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
==Substrate Analysis==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis ==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br style="clear: both" /><br />
<br />
<br />
== Immobilization ==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 21% of BHAL laccases was still present in the supernatant. This illustrates that BHAL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
<br />
<br />
<br />
[[File:Bielefeld2012-Graphen_Bead_Halo.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by BHAL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by BHAL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the very low concentration of purified BHAL.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
/div><br />
/p></div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/pumiTeam:Bielefeld-Germany/Results/pumi2012-10-27T01:59:14Z<p>Fougee: /* Since Regionals: SDS-Page of protein purification */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CotA from <a href="http://www.dsmz.de/catalogues/details/culture/DSM-27.html"> <i>Bacillus pumilus</i> DSM 27 ( ATCC7061)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with different parameters to define the best conditions for production of the His tagged CotA from [http://www.dsmz.de/catalogues/details/culture/DSM-27.html ''Bacillus pumilus'' DSM 27 ( ATCC7061)] named BPUL. Due to inactivity of the enzyme in the cell lysate a purification method was established (using Ni-NTA-Histag resin and Syringe or ÄKTA method). The purified BPUL could be detected by SDS-PAGE (molecular weight of 58.6&nbsp;kDa) as well as by MALDI-TOF. To improve the purification strategies the length of the linear elution gradient was increased up to 200 mL . The fractionated samples were also tested concerning their activity and revealed high activity. Optimal conditions for activity were identified. After measuring activity of BPUL a successful scale up was made up to 3&nbsp;L and also up to 6&nbsp;L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium (HSG) was implemented to enable additional experiments to characterize BPUL. Additional scale up experiments will be important for further real world applications.<br />
<br />
<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivation===<br />
<div style="text-align:justify;"><br />
The first trials to produce the CotA-laccase from [http://www.dsmz.de/catalogues/details/culture/DSM-27.html ''Bacillus pumilus'' DSM 27] (ATCC7061, named BPUL) were performed in shaking flasks with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during the screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), the concentration of chloramphenicol (20 to 170&nbsp;µg&nbsp;mL<sup>-1</sup>), induction strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction with 0,1&nbsp;% rhamnose) and cultivation time (6 to 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub>, to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments the best conditions for expression of BPUL were identified(see below). The addition of CuCl<sub>2</sub> did not increase activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> ===<br />
<br />
[[File:Bielefeld2012_BPUL3LFermentation.jpg|450px|thumb|left|'''Figure 1:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (BPUL) in a [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Biostat_B_Bioreactor_.283_L.29_by_Braun Braun Biostat&nbsp;B], scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<p align="justify"><br />
<br />
After the measurement of BPUL activity we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> in a[https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Biostat_B_Bioreactor_.283_L.29_by_Braun Braun Biostat&nbsp;B] fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. We got a long lag phase of 2&nbsp;hours due to a relatively old preculture. The cell growth caused a decrease in pO<sub>2</sub> and after 3&nbsp;hours the value fell below 50&nbsp;%, so that the agitation speed increased automatically. After 8.5&nbsp;hours the deceleration phase started and therefore the agitation speed was decreased. The maximal OD<sub>600</sub> of 3.53 was reached after 10&nbsp;hours, which means a decrease in comparison to the fermentation of ''E.&nbsp;coli'' KRX under the same conditions (OD<sub>600,max</sub> =4.86 after 8.5&nbsp;hours, time shift due to long lag phase). The cells were harvested after 11&nbsp;hours.<br />
</p><br />
<br style="clear: both" /><br />
<br />
=== Purification of BPUL ===<br />
<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the lysed cell paste was loaded on the Ni-NTA-column (15&nbsp;mL Ni-NTA resin) with a flowrate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed with 10&nbsp;column&nbsp;volumes (CV) Ni-NTA-equilibrationbuffer. The bound proteins were eluted by an increasing Ni-NTA-elutionbuffer gradient from 0&nbsp;% to 100&nbsp;% with a total volume of 100&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak.A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the BPUL-elution is shown in Figure 2:<br />
</p><br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BPUL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution from FLPC Ni-NTA-His tag purification of BPUL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>. BPUL was eluted between a process volume of 460&nbsp;mL to 480&nbsp;mL with a maximal UV-detection signal of 69 mAU]]<br />
<br />
<p align="justify"><br />
The chromatogram shows a remarkable widespread peak between the process volume of 460&nbsp;mL to 480&nbsp;mL with the highest UV-detection signal of 69 mAU, which can be explained by the elution of bound proteins. The corresponding fractions were analyzed by SDS-PAGE analysis. During the elution, a steady increase of the UV-signal caused by the increasing imidazol concentration during the elution gradient. Between the process volume of 550 and 580&nbsp;mL there are several peaks (up to a UV-detection-signal of 980&nbsp;mAU) detectable. These results are caused by an accidental detachment in front of the UV-detector. Just to be on the safe side, the corresponding fractions were analyzed by SDS-PAGE analysis. The corresponding SDS-PAGE is shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of purified BPUL===<br />
<div style="text-align:justify;"><br />
[[File:Bielefeld2012_0906.jpg|height={50px}|weight={400px}|thumb|left|'''Figure 3:''' SDS-PAGE of purified ''E. coli'' KRX lysate containing <partinfo>BBa_K863000</partinfo> (fermented in a 3 L Biostat Braun B fermenter). The flow-through, wash and the elution fractions 7 and 8 are shown. The arrow marks the BPUL band with a molecular weight of 58.6 kDa.]]<br />
<br />
Figure 3 shows the purified ECOL including flow-through, wash and the elution fractions 7 and 8. These two fractions were chosen due to a high peak in the chromatogram. BPUL has a molecular weight of 58.6 kDA and was marked with a red arrow. The band appears in both fractions. There are also some other non-specific bands, which could not be identified. To improve the purification the elution gradient length should be longer and slower the next time.<br />
<br />
The appearing bands were analyzed by MALDI-TOF and could be identified as CotA (BPUL).<br />
<br style="clear: both" /><br />
</div><br />
<br />
===6&nbsp;L Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>===<br />
<br />
[[File:Bielefeld2012_BPUL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (BPUL) in aBioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> measured every hour. ]]<br />
<br />
<p align="justify"><br />
Another scale-up for ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL22. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 4. There was no noticeable lag phase. Agitation speed was increased up to 425&nbsp;rpm after one hour due to problems caused by the control panel. The pO<sub>2</sub> decreased until a cultivation time of 4.75&nbsp;hours. The increasing pO<sub>2</sub> level indicates the beginning of the deceleration phase. There is no visible break in cell growth caused by an induction of protein expression. A maximal OD<sub>600</sub> of 3.68 was reached after 8&nbsp;hours of cultivation, which is similar to the 3&nbsp;L fermentation (OD<sub>600</sub> = 3.58 after 10 hours, time shift due to long lag phase). The cells were harvested after 12&nbsp;hours.<br />
<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of BPUL===<br />
<br />
<p align="justify"><br />
The harvested cells were prepared in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the lysed cell paste was loaded on the Ni-NTA-column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed with 5&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer]. The bound proteins were eluted by an increasing elutionbuffer gradient from 0&nbsp;% (equates to 20&nbsp;mM imidazol) to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 200&nbsp;mL. This strategy was chosen to improve the purification by a slower increase of [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer] concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the BPUL elution is shown in Figure 5.<br />
</p><br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BPUL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA-Histag Purification of BPUL produced by 6&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>. BPUL was eluted between a process volume of 832&nbsp;mL and 900&nbsp;mL with a maximal UV-detection signal of 115&nbsp;mAU.]]<br />
<br />
<p align="justify"><br />
The chromatogram shows a peak at the beginning of the elution. This can be explained by pressure fluctuations upon starting the elution procedure. In between the processing volumes of 832&nbsp;mL and 900&nbsp;mL there is remarkable widespread peak with a UV-detection signal of 115&nbsp;mAU. This peak corresponds to an elution of bound proteins at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] concentration between 10&nbsp;% and 20&nbsp;% (equates to 50-100&nbsp;mM imidazol). The corresponding fractions were analyzed by SDS-PAGE. The ensuing upwards trend of the UV-signal is caused by the increasing imidazol concentration during the elution gradient. Towards the end of the elution procedure there is a constant UV-detection signal, which shows, that most of the bound proteins was already eluted. Just to be on the safe side, all fractions were analyzed by SDS-PAGE to detect BPUL. The SDS-PAGE is shown in Figure 6.<br />
<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of purified BPUL===<br />
<div style="text-align:justify;"><br />
[[File:Bielefeld2012 0914.jpg|450px|thumb|left|'''Figure 6:''' SDS-PAGE of purified ''E.&nbsp;coli'' with <partinfo>BBa_K863000</partinfo> lysate (fermented in a Bioengineering NFL22 fermenter, 6 L). The flow-through, wash and elution fraction 1 to 9 are shown. The arrow marks the BPUL band with a molecular weight of 58.6 kDa. ]]<br />
<br />
In Figure 6 the SDS-PAGE of the Ni-NTA purification of the lysed ''E. coli'' KRX culture containing <partinfo>BBa_K863000</partinfo> is illustrated. It shows the flow-through, wash and elution fractions 1 to 9. The His-tagged BPUL has a molecular weight of 58.6 kDA and was marked with a red arrow. The band appears in all fractions from 2 to 9 with varying strength, the strongest ones in fractions 7 to 9. There are also some other non-specific bands, which could not be identified. Therefore the purification method could moreover be improved.<br />
In summary, the scale up was successful, improving protein production and purification method once again. <br />
<br />
Furthermore the bands were analyzed by MALDI-TOF and identified as CotA (BPUL). <br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> ===<br />
<br />
<br />
[[File:Bielefeld2012_BPUL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (BPUL) in an Bioengineering NFL 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> was fermented in a Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
At the beginning of the cultivation, the cells were in lag phase, in which they adapt to the medium. During their growth the cells consumed glycerin as well as O<sub>2</sub>, which leads to an increase of agitation speed to hold a minimal pO<sub>2</sub> of 50 %. After 11 hours, the glycerin was completely consumed and the pO<sub>2</sub> increased up to 100 %, which indicates that the cells entered the stationary phase. The maximal OD<sub>600</sub> of 12.6 was reached after 12 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br style="clear: both" /><br />
<br />
=== Since Regionals: Purification of BPUL ===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 70&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 100&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. Unfortunately, the data of this procedure are not available due to a computer crash after the purification step. All Fractions were analysed to detect BPUL.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-PAGE of protein purification===<br />
[[File:Bielefeld2012_1019pumi.jpg|300px|thumb|left|'''Figure 8:''' SDS-PAGE of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BBa_K863000]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 8 the SDS-PAGE of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BBa_K863000] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The HIS-tagged BPUL has a molecular weight of 58.6 kDa. BPUL could not be attributed exactly to any band. There are some other non-specific bands, wich could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of BPUL===<br />
<br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. <br />
The in silico- tryspinated created peptide mass fingerprints were compared with the measured masses gotten from the MALDI. With a sequence coverage of 21,9% BPUL was identified. <br />
In Figure 7 and 8 the chromatogram of the peptide mass fingerprint and the single masses are shown. <br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_BPumi_.png|thumb|400px|left|center|'''Figure 7:''' MALDI-TOF spectrum]] [[File:Bielefeld2012_Massenspektrometrische_Auswertung_BPumi.png|400px|thumb|right|'''Figure 8:''' MALDI-TOF spectrum results of the analysis]]<br />
<br style="clear: both" /><br />
<br />
==Activity analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL]==<br />
<br />
<br />
===Initial activity tests of purified fractions===<br />
<br />
<p align="justify"><br />
Initial tests were done with elution fractions 1 to 4 to determine the activity of the purified [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase. The fractions were rebuffered into deionized H<sub>2</sub>O using [http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 0.1 mM ABTS and 100 mM sodium acetate buffer (pH 5) to a final volume of 200 µL and the absorption was measured at 420 nm to detect oxidization over a time period of 5 hours at 25°C. Each fraction did show contained active laccase able to oxidize ABTS (see Figure 9). After 15 minutes, saturation was observed with ~60 µM oxidized ABTS. After 5 hours ~5 µM ABTS got reduced again. This behavior has been observed in the activity plot of the positive control [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase seems is reversible. Additionally, protein concentrations of each fraction were identified using the Bradford protocol. The four tested fractions showed approximately the same amount of protein after rebuffering, namely 0.5 mg mL<sup>-1</sup>. Fraction 4, containing the most protein and also most of active laccase was chosen for subsequent activity tests of BPUL. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between TVEL0 measurements and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] measurements.<br />
</p><br />
<br />
[[File:Bielefeld2012_Party_Pumi_bestimmung2.jpg|thumbnail|600px|center|'''Figure 9:''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase activity measured in 0.1 mM ABTS and 100 mM sodium acetate buffer (pH 5) to a final volume of 200 µL at 25°C over a time period of 3.5 hours. Each tested fraction reveals activity reaching the saturation after 15 minutes with ~60 µM ABTS<sub>ox</sub> after 0.4 mM CuCl<sub>2</sub> incubation. (n=4)]]<br />
<br style="clear: both" /><br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] pH optimum===<br />
<br />
<p align="justify"><br />
<br />
To determine at which pH the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase has its optimum in activity, a gradient of sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity was tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 11. A distinct pH optimum can be seen at pH 5. The saturation is reached after 3 hours with 50% oxidization of ABTS through the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase at pH 5 (55 µM oxidized ABTS). The other tested pHs only led to a oxidation of 18% of added ABTS. Figure 12 represents the negative control showing the oxidation of ABTS through 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The highest increase in oxidized ABTS can be seen at a pH of 5. After 5 hours 15% ABTS are oxidized only through CuCl<sub>2</sub>. Nevertheless this result does not have an impact on the reactivity of the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase at pH 5, which is still the optimal pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
[[File:Bielefeld2012_PH_Pumi1.jpg|thumbnail|500px|center|'''Figure 11:''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase activity measured in 100 mM sodium acetate buffer with a range of different pHs from pH 1 to pH 9, 0.1 mM ABTS to a final volume of 200 µL at 25°C over a time period of 5 hours. Before the measurements samples were incubated with CuCl<sub>2</sub>. The optimal pH for [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity Tests using 0.04 mM CuCl<sub>2</sub> H<sub>2</sub>O instead of Laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In regard to our project an optimal pH of 5 is a helpful result. Since waste water in waste water treatment plants has a average pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary.<br />
<br style="clear: both" /><br />
</p><br />
<br />
<br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] CuCl<sub>2</sub> concentration===<br />
<p align="justify"><br />
Another test of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase. 0.03 mg mL<sup>-1</sup> of protein were incubated with different CuCl<sub>2</sub> concentrations ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, 0.1 mM ABTS and 100 mM sodium actetate buffer (pH 5) to a final volume of 200 µL. The reactivity was measured at 420 nm, 25°C and over a time period of 5 hours. As expected the saturation takes place after 3 hours (see Figure 12). The differences in the activity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccases incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase is observed after incubation with 0.6 mM CuCl<sub>2</sub> (52% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 48% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase reactivity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> without applying laccase to detect the oxidization of ABTS through copper (see Figure 13). The more CuCl<sub>2</sub> was present, the more ABTS was oxidzied after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012_Pumi_Cu1.jpg|thumbnail|500px|center|'''Figure 12:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] incubated in different CuCl<sub>2</sub> concentrations. Without CuCl<sub>2</sub> incubation the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase shows half of the activit as after CuCl<sub>2</sub> incubation. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leas to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 13:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of Laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzyme. Still it is expensive to be reliant on CuCl<sub>2</sub> and a potential risk using heavy metals for waste water purifcation.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012_BPUL_Temp.jpg|thumbnail|450px|left|'''Figure 14:''' Standard activity test for [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<p align="justify"><br />
To investigate the activity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] at lower temperatures, activity tests as described above were performed at 10°C and 25°C. A small decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C (see Fig. 14). After 3.5 hours when samples at 25°C reached the saturation samples at 10°C had not, but nonetheless the difference is minimal. After 3 hours 5% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase but 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
A a decrease in the reactivity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase was expected. The observed small reduction in enzyme activity is excellent news for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity depending on different ABTS concentrations===<br />
<br />
[[File:Bielefeld2012_BPUL_ABTS.jpg|thumbnail|450px|left|'''Figure 15:''' Analysis of ABTS oxidation by [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccases incubated in 0.4 CuCl<sub>2</sub> tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<p align="justify"><br />
Furthermore, [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated, the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 15). Especially using 16 µL showed an increase in the activity until 1 hour (reaching 50 µM ABTS<sub>ox</sub>), but the amount of oxidized ABTS decreased afterward.<br />
<br style="clear: both" /><br />
</p><br />
<br />
<br />
<br />
===Impact of MeOH and acteonitrile on [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL]===<br />
<p align="justify"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccases had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase, different amounts of MeOH (Figure 16) or acteonitrile (Figure 17), 0.1 mM ABTS and 100 mM sodium actetate buffer to a final volume of 200 µL. The observed reactivity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] in regard of oxidizing ABTS did not reveal a huge decrease. The less MeOH or acetonitrile was used, the higher was the amount of oxidized ABTS after 3 hours. An application of 16 µL MeOH or acetonitrile led to a decrease of maximal 10% oxidized ABTS compared to 2 µL MeOH or acetonitrile. Negative controls are shown in [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Impact_of_MeOH_and_acteonitrile_on_ECOL Figure 17 and 18] of the ECOL laccase. MeOH and acetonitril are able to oxidize ABTS. After 5 hours at 25°C ~15 µM ABTS get oxidized through MeOH or acetonitrile, but samples with [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase show a distinct higher activity of 50 µM ABTS<sub>ox</sub>.<br />
[[File:Bielefeld2012_Pumi_MeOH1.jpg|thumbnail|500px|center|'''Figure 16:''' Standard [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012_Pumi_acetonitrile1.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]</p><br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<p align="justify"><br />
After the Regional Jamboree in Amsterdam further BPUL was produced. The most comprising fractions of the purification were analyzed for [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] (10/16), re-buffered into deionized H<sub>2</sub>O and incubated in 0.4 mM CuCl<sub>2</sub>. Again, the [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Wednesday_October_17th/ protein content] (10/17) of each fraction was determined because of the loss of proteins through re-buffering. Initial activity tests were done in Britton-Robinson buffer with 0.1 mM ABTS. The protein content of each fraction was adjusted for comparison of the resulting activity (see '''Fig. 18''').<br />
[[File:Bielefeld2012_new_BPUL_acitivity.jpg|500px|thumb|center|'''Figure 18:''' Activity assay of each purified fraction of recent produced BPUL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction was adjusted. The measurement was done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
Fraction 50% 2 showed the highest activity. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. The saturation was reached at ~1 h. For comparison it was stated that this fraction contains 90 % laccase and therefore the BPUL concentration is 25,1 µg mL<sup>-1</sup>.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity depending on different ABTS concentrations===<br />
<p align="justify"><br />
In order to find the substrate saturation, laccase activity was measured with ABTS concentrations ranging from 0.1 mM to 8 mM. 616 ng BPUL were used for measurements with ABTS concentrations of 0.1 mM to 5 mM, 308 ng BPUL were used for measurements with ABTS concentrations of 5 mM to 8 mM. Measurements were done in Britton-Robinson buffer (pH 5) at 25 °C for 30 minutes taking the OD<sub>420</sub> every 5 minutes. Comparing the graphs in Figure 19 and Figure 20, both show a comprising substrate saturation with 5 mM ABTS. Higher concentrations of ABTS than 5 mM did not show any other effects on the activity of BPUL. For all following BPUL activity measurements after the Regional Jamborees in Amsterdam a concentration of 5 mM ABTS was applied.<br />
[[File:Bielefeld2012_BPUL_klein_ABTS.jpg|thumb|left|360px|'''Figure 19:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng BPUL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 0.1 mM to 5 mM.]]<br />
[[File:Bielefeld2012_BPUL_hoch.jpg|thumb|right|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 308 ng BPUL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5 mM to 8 mM. An ABTS concentration of 5 mM was determined as substrate saturation.]]<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] pH optimum===<br />
<br />
[[File:Bielefeld2012_Pumi_pH_Foto.png|thumb|right|200px|'''Figure 21:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 5 and pH 4 the darkest colour has been reached.]]<br />
The pH of the medium containing the enzyme is of high importance for its activity. The pH optima of BPUL are pH 4 and pH 5. This is the result of activity measurements using Britton-Robinson buffer with differently adjusted pHs. BPUL was re-buffered into H<sub>2</sub>O and incubated with 0.4 mM CuCl<sub>2</sub>. The range from pH 4 to pH 9 was tested under substrate saturation at 25 °C for 30 minutes. At pH 4 and pH 5 ABTS got oxidized the fastest (see Fig. 21 and Fig. 22). At higher pHs than pH 5, the activity of BPUL was decreased considerably. The resulting Units mg<sup>-1</sup> support the observed data (see Fig. 23). At pH 4 and pH 5 BPUL showed a specific enzyme activity of ~37 U mg<sup>-1</sup>. The higher the pH, the less U mg<sup>-1</sup> could be calculated for BPUL. At pH 7 1/3 of the activity decreased, but still BPUL was active at this pH allowing an application of this laccase in a waste water treatment plant where the average pH is a pH of 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BPUL_pH_new.jpg|thumb|left|360px|'''Figure 22:''' Oxidized ABTS by BPUL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated BPUL laccase (308 ng), Britton Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The highest amount of oxidized ABTS was detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012_BPUL_pH_Units.jpg|thumb|right|360px|'''Figure 23:''' Calculated specific enzyme activity of BPUL at different pH conditions. The highest specific enzyme activity for ABTS was under pH 4 and pH 5 conditions. The higher the pH, the less ABTS got oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012 BPUL Temp ABTSox.jpg|left|200px|thumb|'''Figure 24:''' Standard activity test for BPUL measured at 10 °C and 25 °C resulting in a comparable activity at the tested temperatures. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 BPUL Temp Units.jpg|right|200px|thumb|'''Figure 25:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures only a difference of 1 U mg<sup>-1</sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
To investigate the activity of BPUL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The obtained results reveal a comparable activity of BPUL at high and low temperatures (see Fig. 24). The measurements were conducted for 30 minutes until saturation initiated. Both samples reached saturation after 15-20 minutes. The obtained results were used to calculate the specific enzyme activity which was in both cases at about 37 U mg<sup>-1</sup> (see Fig. 25). The negative control without BPUL laccase but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The observed activity at both conditions was good news for the possible application in waste water treatment plants where the temperature differs from 8.1 °C to 20.8 °C.<br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
== Immobilization ==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 3% of BPUL laccases was still present in the supernatant. This illustrates that BPUL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
<br />
<br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_bpumi.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of BPUL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of BPUL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of BPUL in the supernatant is compared to the activity of nontreated BPUL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_BPUL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by BPUL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by BPUL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the very high activity of BPUL, which could not be measured properly.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/coliTeam:Bielefeld-Germany/Results/coli2012-10-27T01:55:21Z<p>Fougee: /* Since Regionals: SDS-Page of protein purification */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CueO from <i>Escherichia coli</i> BL21 (DE3)<br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with changing parameters to identify the best conditions for <br />
the production of the laccase CueO from E. coli BL21 (DE3) named ECOL fused to a His tag. Because of no measured activity <br />
in the cell lysate a purification method was established (using Ni-NTA His tag resin and Syringe or ÄKTA method). The purified <br />
ECOL could be identified by SDS-PAGE (molecular weight of 53.4 kDa) as well as by MALDI-TOF. The fractionated samples were also <br />
tested concerning their activity. A maximal activity of 55% was reached, measured in ABTS<sub>ox</sub> [µM]. After measuring activity of ECOL a scale up was made up to <br />
3 L and then also up to 6 L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium was implemented to enable additional experiments to characterize ECOL. Additional scale up experiments will be important for further application. The enzyme was characterized<br />
regarding its temperature and pH optimum and concerning the influence of different concentrations of CuCl<sub>2</sub>, ABTS, MeOH and acetonitrile.<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivations===<br />
<div style="text-align:justify;"><br />
The first trials to produce ECOL were produced in shaking flask with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during our screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), concentrations of chloramphenicol (20-170&nbsp;µg&nbsp;mL<sup>-1</sup>), various induction strategies ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction) and cultivation time (6 - 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments we identified the best conditions under which ECOL was expressed. The addition of CuCl<sub>2</sub> did not increase the activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL3LFermentation.jpg|450px|thumb|left|'''Figure 1''': Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Infors Labfors Bioreactor, scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<br />
<p align="justify"><br />
After the positive measurement of activity of ECOL we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> in an Infors Labfors fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. The exponential phase started after 1.5&nbsp;hours of cultivation. The cell growth caused a decrease in pO<sub>2</sub>. After 2&nbsp;hours of cultivation the agitation speed increased up to 629&nbsp;rmp (5.9&nbsp;hours) to hold the minimal pO<sub>2</sub> level of 50&nbsp;%. Then, after 4&nbsp;hours there was a break in cell growth due to induction of protein expression. The maximal OD<sub>600</sub> of 2.78 was reached after 5&nbsp;hours. In comparison to ''E.&nbsp;coli'' KRX (OD<sub>600,max</sub> =4.86 after 8.5 hours) and to ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (OD<sub>600,max</sub> =3.53 after 10 hours, time shift due to long lag phase) the OD<sub>600 max</sub> is lower. In the following hours, the OD<sub>600</sub> and the agitation speed decreased and the pO<sub>2</sub> increased, which indicates the death phase of the cells. This is caused by the cell toxicity of ECOL (reference: [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU final report]). Hence, cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 60&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) with a length of 40&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag Purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 292&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. There were no further peaks detectable. The following increasing UV detection signal results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of ECOL purification===<br />
<br />
[[File:Bielefeld2012_SDS_ECOL3L.jpg|450px|thumb|left|'''Figure 3:''' SDS-Pages of purified ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] lysate (fermented in 3&nbsp;L an Infors Labfors fermenter). The flow-through and elution fraction 2-9 are shown. The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<p align="justify"><br />
In Figure 3 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture (''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]) is shown including the flow-through and the fractions 2 to 9. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear in fractions 6 and 7. These were the first two fractions (each 10 mL) eluted with 50 % Ni-NTA elution buffer (equates to 250 mM imidazol), in which the distinguished peak appeared. <br />
<br />
These bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL). In contrast, the second, faint band with a lower molecular weight could not be identified.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===6&nbsp;L Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in a Bioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> taken every hour.]]<br />
<br />
<br />
<p align="justify"><br />
Another scale-up of the fermentation of E.&nbsp;coli KRX with <partinfo>BBa_K863005</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure&nbsp;3. There was no noticeable lag phase and the cells immediately began to grow. The cells were in an exponential phase between 2 and 4&nbsp;hours of cultivation, which results in a decrease of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 4&nbsp;hours of cultivation the maximal OD<sub>600</sub> of 2.76 was reached, which is comparable to the 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. Due to induction of protein expression there is a break in cell growth. The death phase started, which is indicated by an increasing pO<sub>2</sub> and a decreasing OD<sub>600</sub>. This demonstrates the cytotoxicity of the laccase for ''E. coli'', which was reported by the [http://www.dbu.de/OPAC/ab/DBU-Abschlussbericht-AZ-13191.pdf DBU]. In comparison to the fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> under the same conditions (OD<sub>600,max</sub>= 3.53), the OD<sub>600,max</sub> was lower. Cells were harvested after 12&nbsp;hours.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed by 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- elution buffer] gradient from 0&nbsp;% to 100&nbsp;% with a length of 200&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is shown [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure&nbsp;5:<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA His tag purification of ECOL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted between a process volume 670&nbsp;mL to 750&nbsp;mL with a maximal UV-detection signal of 189&nbsp;mAU.]]<br />
<br />
<br />
<p align="justify"><br />
After washing the column with 10 CV [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elution buffer] the elution process was started. At a process volume of 670&nbsp;mL to 750&nbsp;mL the chromatogram shows a remarkable widespread peak (UV-detection signal 189&nbsp;mAU) caused by the elution of a high amount of proteins. The run of the curve show a fronting. This can be explained by the elution of weakly bound proteins, which elutes at low imidazol concentrations. A better result could be achieved with a step elution strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#Purification_of_ECOL see purification of the 3 L Fermentation above]). To detect ECOL the corresponding fractions were analyzed by SDS-PAGE.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGES of ECOL purification===<br />
<br />
[[File:Bielefeld2012_coli0910.jpg|450px|thumb|left|'''Figure 6:''' SDS-Pages of lysed ''E.&nbsp;coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (fermented in a 6&nbsp;L Bioengineering NFL22) after purification. The flow-through, wash and the elution fraction 1 to 15 are shown (except from fraction 11/12). The arrow marks the ECOL band with a molecular weight of 53.4&nbsp;kDa.]]<br />
<br />
<p align="justify"> <br />
In Figure 6 the SDS-PAGE of the Ni-NTA His tag purification of the lysed culture ''E.&nbsp;coli'' KRX containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] (6&nbsp;L fermentation) including the flow-through, wash and the fractions 1 to 15 (except from fraction 11/12) is shown. The red arrow indicates the band of ECOL with a molecular weight of 53.4&nbsp;kDa, which appears in all fractions. The strongest bands appear from fractions 3 and 8 with a decreasing amount of other non-specific bands. In summary, the scale up was successful, improving protein production and purification once again.<br />
<br />
Furthermore the bands were analyzed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#MALDI MALDI-TOF] and identified as CueO (ECOL).<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E. coli'' KRX with <partinfo>BBa_K863005</partinfo>===<br />
<br />
[[File:Bielefeld2012_ECOL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> (ECOL) in an Bioengineering NLF 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo> was fermented in an Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
For adaption to the medium, there was a lag phase of one hour. Between the 3 and 8 hours of cultivation the cells were in the exponential phase. During this phase the cells consumed O<sub>2</sub>, so that the agitation speed was increased automatically, as well as glycerin. After 11 hours of cultivation the pO<sub>2</sub> increased, the glycerin was completely consumed and the cells were in the stationary phase. The maximal OD<sub>600</sub> of 11.1 was reached after 15 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Purification of ECOL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 40&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a volume of 80&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a volume of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the ECOL elution is shown in Figure 2.<br />
</p><br />
<br />
[[File:Bielefeld2012_ECOL_Chromatogramm_12L.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His tag purification of ECOL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863005</partinfo>. ECOL was eluted at a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 292&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 5&nbsp;% (equates to 25&nbsp;mM imidazol) and resulted from the elution of weakly bound proteins. After increasing the Ni-NTA elution buffer concentration to 50&nbsp;% (equates to 250&nbsp;mM imidazol), an UV-detection signal peak of 140&nbsp;mAU was measured. The area of this peak indicates that a high amount of protein was eluted. In addition, a second peak right behind the first peak can be detected. At this point it is not clear which peak contains our product and which peak is caused by impurities. The corresponding fractions were analyzed by SDS-PAGE to detect ECOL. A last peak can be detected after increasing the elution buffer concentration to 100&nbsp;% (equates to 500&nbsp;mM imidazol). This peak could be explained by impurities which were strongly bound on the Ni-NTA-resin. All corresponding fractions with an UV-signal were analyzed by SDS-PAGES. The Results are shown in Figure 3.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019coli.jpg|300px|thumb|left|'''Figure 3:''' SDS-Page of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 3 the SDS-Page of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 BBa_K863005] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The HIS-tagged BPUL has a molecular weight of 53.4 kDa. The red arrow shows ECOL. Unfortunately it could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of ECOL===<br />
<br />
<p align="justify"> <br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. The ''E. coli'' laccase P36649 was identified with a mascot-score of 108 with an automatic run. In Figure 7 and 8 the chromatogram of the peptide mass fingerprint and the single masses are shown with a sequence coverage of 26,1 %. It can be assumed that the isolated protein is ECOL. <br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_Ecoli.png|thumb|left|400px|'''Figure 7: The MALDI-TOF-MS (matrix assisted laser desorption ionization time-of-flight mass spectrometry) spectrum.''']][[File:Bielefeld2012_Massenspektrometrische_Ecoli_Auswertung.png|thumb|right|400px|'''Figure 8: Part of MALDI-TOF Evaluation''']]<br />
<br />
<br style="clear: both" /><br />
</p><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863005 ECOL]==<br />
<p align="justify"><br />
<br />
=== Initial activity tests of purified fractions ===<br />
<div style="text-align:justify;"><br />
Initial tests were done with elution fractions 2, 3, 6, 7 and 8 to determine the activity of the purified <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. The fractions were rebuffered into <br />
deionized H<sub>2</sub>O using <br />
[http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] <br />
and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 100 mM sodium acetate buffer <br />
(pH 5), and 198 deionized H<sub>2</sub>O and 0.1 mM ABTS and the absorption was measured at 420 nm to detect oxidization over a time <br />
period of 12 hours at 25°C. Each fraction contained active laccase able to oxidize ABTS (see Figure 9). After 1 hour saturation was observed with ~52 µM oxidized ABTS. After 12 hours ~10 µM ABTS got reduced again, if referred to fraction 6. This behavior has been observed<br />
in the activity plot of[https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase is reversible. Additionally protein concentrations of each fraction were identified using the <br />
Bradford protocol. The tested fractions showed different amounts of protein after rebuffering, <br />
ranging from 0.2 to 0.6 mg mL<sup>-1</sup>. Fraction 7, containing the most protein and also most of active laccase was chosen for subsequent activity <br />
tests of [http://partsregistry.org/Part:BBa_K863005 ECOL]. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between <br />
TVEL0 measurements and [http://partsregistry.org/Part:BBa_K863005 ECOL] measurements.<br />
</div><br />
<br />
[[File:Bielefeld2012 ColiActivity.jpg|thumbnail|600px|center|'''Figure 9:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate <br />
buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL at 25 °C over a time period of 12 hours. Each tested fraction <br />
reveals activity reaching saturation after 2.5 to 4 hours with a maximum of ~52 µM ABTS<sub>ox</sub> (fraction 7). (n=4)]]<br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
<div style="text-align:justify;"><br />
<br />
To determine at which pH the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase has its optimum in activity, a gradient of <br />
sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/Part:BBa_K863005 ECOL] activity was <br />
tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 10. A distinct pH <br />
optimum can be seen at pH 5. Saturation is reached after 2.5 hours with 53% oxidization of ABTS by the <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5 (53 µM oxidized ABTS). The other tested pHs only led to a oxidation <br />
of up to 17% of added ABTS, respectively. Figure 11 shows the results of the analog experiments with laccase that was not incubated with <br />
CuCl<sub>2</sub> before the activity measurements. Again, a pH optimum at pH 5 can be determined with 24 µM ABTS (24%) oxidized by<br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] after 8 hours under these conditions. <br />
<br />
Figure 12 represents the negative control showing the oxidization of ABTS by 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The greatest increase in oxidized ABTS can be <br />
seen at a pH of 5: after 5 hours 15% ABTS is oxidized by CuCl<sub>2</sub> alone. Nevertheless this result does not have an impact <br />
on the activity of the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase at pH 5, which is still the optimal <br />
pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
<br />
[[File:Bielefeld2012 E.colipHmitCuOX.jpg|thumbnail|500px|center|'''Figure 10:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012 E.colipHohneCuOX.jpg|thumbnail|500px|center|'''Figure 11:''' <br />
[http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity measured in 100 mM sodium acetate buffer with a <br />
range of different pHs from pH 1 to pH 9, 0.1 mM ABTS, to a final volume of 200 µL at 25°C over a time period of 12 hours. <br />
The tested enzymes were not incubated with CuCl<sub>2</sub> before activity measurements.<br />
The optimal pH for [http://partsregistry.org/Part:BBa_K863005 ECOL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity test using 0.04 mM <br />
CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized by CuCl<sub>2</sub>.]]<br />
With regard to our project knowledge of the optimal pH is useful. Since waste water in waste water treatment plants has an average <br />
pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary for optimal laccase activity.<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] CuCl<sub>2</sub> concentration ===<br />
<br />
<div style="text-align:justify;"><br />
Another test of [http://partsregistry.org/Part:BBa_K863005 ECOL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase. 0.03 mg mL<sup>-1</sup> protein were incubated with different CuCl<sub>2</sub> concentration ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, in 100 mM sodium actetate buffer (pH 5), 0.1 mM ABTS, to a final volume of 200 µL. The activity was measured at 420 nm, 25°C and over a time period of 10 hours. As expected the saturation takes place after 5 hours (see Figure 13). The differences in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase is observed after incubation with 0.4 mM CuCl<sub>2</sub> (42% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 41% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase activity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. Without any CuCl<sub>2</sub> application [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase show less activity in oxidizing ABTS (see Figure 12). This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> but no laccase was added to detect the oxidization of ABTS through copper (see Figure 14). The more CuCl<sub>2</sub> was present, the more ABTS was oxidized after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012 ColicoppergradientOX.jpg|thumbnail|500px|center|'''Figure 13:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/Part:BBa_K863005 ECOL] incubated in different CuCl<sub>2</sub> concentrations. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leads to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 14:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzymes. This reduces the cost factor for the needed CuCl<sub>2</sub> to incubate the laccases before application. <br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures ===<br />
<br />
[[File:Bielefeld2012 10und25GradOX.jpg|thumbnail|450px|left|'''Figure 15:''' Standard activity test for [http://partsregistry.org/Part:BBa_K863005 ECOL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<div style="text-align:justify;"><br />
To investigate the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] at lower temperatures activity tests as described above were done at 10°C and 25°C (Figure 15). A significant decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C. While the activity at 10 °C is reduced, final saturation levels are still comparable: after 3,5 hours, only 2% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase and only 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
Although a decrease in the activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase was expected the observed reduction in enzyme activity is problematic for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C. A more cryo tolerant enzyme would be preferable.<br />
</div><br />
<br style="clear: both" /><br />
<br />
=== [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations ===<br />
<br />
<br />
[[File:Bielefeld2012 ColiABTSGradientOX.jpg|thumbnail|450px|left|'''Figure 16:''' Analysis of ABTS oxidation by [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<div style="text-align:justify;"><br />
Furthermore [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 16). The results of the measurements of the samples tested with 16 µL could not be detected longer than 1.5 h because the values were higher than the detection spectrum of the device used ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Tecan_Infinite_Microplate_Reader TecanReader]). <br />
<br style="clear: both" /><br />
</div><br />
<br />
=== Impact of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] ===<br />
<br />
<div style="text-align:justify;"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/Part:BBa_K863005 ECOL] laccase, 100 mM sodium acetate buffer, different amounts of MeOH (Figure 17) or acteonitrile (Figure 18), 0.1 mM ABTS, to a final volume of 200 µL. The activity of [http://partsregistry.org/Part:BBa_K863005 ECOL] was found to be increased in presence of low concentrations (1 % v/v) of either MeOH or acetonitrile resulting in an higher amount of oxidized ABTS after 5 hours. Increasing concentrations of either substance decrease this positive effect, resulting in a significantly decreased laccase activity in presence of 8 % (v/v) MeOH. These results indicate that for further measurements in substrate analytics it is recommended not to use high concentrations of MeOH or acetonitrile to ensure the functionality of [http://partsregistry.org/Part:BBa_K863005 ECOL].<br />
[[File:Bielefeld2012 420ColiMeOHOX.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012 420ColiAcetoOX.jpg|thumbnail|500px|center|'''Figure 18:''' Standard [http://partsregistry.org/Part:BBa_K863005 ECOL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Another cultivation of ECOL has been done after the Regional Jamboree in Amsterdam. The fractions of the purifictaion were analyzed further on [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] and re-buffered subsequently into deionized H<sub>2</sub>O. To determine the protein content afterwards because of loss of proteins through re-buffering, another [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th/ protein concentration measurement] has been done. The re-buffered fractions have been incubated with 0.4 mM CuCl<sub>2</sub> to gain higher activity of the laccases, because they are copper-dependent. Standard activity tests were done with all ECOL fractions with adjusted protein content for comparison. The experimental setup included the ECOL fractions, Britton-Robinson buffer (pH 5) and 0.1 mM ABTS. Measurements were done at 25 °C. Resulting, one fraction showed very high activity in comparison to the other fractions (see Fig. 19). This fraction, fraction 50% 2, oxidized up to 23 µM ABTS after 5 hours. The first number of the sample indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. This fraction was set as containing 90 % ECOL laccase of the whole protein content. Therefore a ECOL concentration of 63,9 µg mL<sup>-1</sup> was gained. This fraction was analyzed further on pH optimum, temperature dependency and ABTS saturation.<br />
<br />
[[File:Bielefeld2012_new_ECOL_activity.jpg|500px|thumb|center|'''Figure 19:''' Activity assay of each purified fraction of the cultivation with ECOL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity depending on different ABTS concentrations===<br />
<br />
To calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. With this the comparison of Units mg<sup>-1</sup> with other laccase activities and the literature is possible. To find the optimal substrate saturation ABTS concentrations ranging from 0.1&nbsp;mM to 8&nbsp;mM were applied in an experimental setup containing Britton-Robinson buffer (pH 5) and temperature conditions of 25&nbsp;°C. For measurements with 0.1&nbsp;mM to 5 mM ABTS, 616 ng BHAL laccase were used (see Fig. 20). For measurements with 5 mM to 8&nbsp;mM ABTS only 308 ng BHAL laccase were applied (see Fig. 21). The amount of oxidized ABTS increased according to the increase of ABTS concentration. To make sure that the substrate saturation is given, 9 mM ABTS have been used in further tests.<br />
[[File:Bielefeld2012_ECOL_klein_ABTS.jpg|thumb|left|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng ECOL laccase in Britton-Robinson buffer (pH 5) at 25&nbsp;°C. ABTS concentrations ranged from 0.1&nbsp;mM to 5&nbsp;mM.]]<br />
[[File:Bielefeld2012_ECOL_hoch.jpg|thumb|right|360px|'''Figure 21:''' Activity assay to determine the substrate saturation with ABTS as substrate. Measurements were done with 308 ng ECOL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5&nbsp;mM to 8&nbsp;mM. An ABTS concentration of 8 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] pH optimum ===<br />
<br />
[[File:Bielefeld2012_Coli_pH_Foto.png|thumb|right|200px|'''Figure 22:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour has been reached.]]<br />
Activity assay measurements for ECOL laccases were done to find the optimal pH for further analysis. Britton-Robinson buffer, adjusted to pHs ranging from pH 4 to pH 9, was used with 9 mM ABTS to detect the change in OD<sub>420</sub>. The measurements were done with 308 ng ECOL laccase for each sample. The highest activity was reached when measured in Britton-Robinson buffer at pH 4 and pH 5 (see Fig. 22, Fig. 23 and Fig. 24). More than 5 U mg<sup>-1</sup> of specific enzyme activity have calculated for these pHs (see Fig. 24). When testing the activity under basic conditions, the enzyme activity decreases. At pH 7 about 1 U mg<sup>-1</sup> was determined. This makes an application of the ECOL not feasible since the water in the waste water treatment plants is in average of pH 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_ECOL_pH_new.jpg|thumb|left|360px|'''Figure 23''': Oxidized ABTS by ECOL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated ECOL (308 ng), Britton-Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012 ECOL pH Units.jpg|thumb|right|360px|'''Figure 24''': Calculated specific enzyme activity of ECOL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 4 and pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/Part:BBa_K863005 ECOL] activity at different temperatures===<br />
<br />
[[File:Bielefed_ECOL_Temp_ABTSox.jpg|left|200px|thumb|'''Fig. 25:''' Standard activity test for ECOL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl2 in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 ECOL Temp Units.jpg|right|200px|thumb|'''Fig. 26:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 9 U/mg<sup>-1 </sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of ECOL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results reveal a lower activity of ECOL at 10 °C in comparison to 25 °C (see Fig. 25). The received values were used to calculate the specific enzyme activity which was between 1 and 12 U mg<sup>-1 </sup>, respectively (see Fig. 26). The negative control without ECOL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The activity of ECOL is decreased to about 90% at 10 °C. An application of ECOL at warm temperatures is therefore possible but during the cold seasons a more cryo stable enzyme would be preferable.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
==Immobilization==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 1% of ECOL laccases was still present in the supernatant. This illustrates that ECOL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_ecoli.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of ECOL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of ECOL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of ECOL in the supernatant is compared to the activity of nontreated ECOL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_ECOL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by ECOL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the measuring methods.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/pumiTeam:Bielefeld-Germany/Results/pumi2012-10-27T01:54:11Z<p>Fougee: /* Since Regionals: SDS-Page of protein purification */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase CotA from <a href="http://www.dsmz.de/catalogues/details/culture/DSM-27.html"> <i>Bacillus pumilus</i> DSM 27 ( ATCC7061)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with different parameters to define the best conditions for production of the His tagged CotA from [http://www.dsmz.de/catalogues/details/culture/DSM-27.html ''Bacillus pumilus'' DSM 27 ( ATCC7061)] named BPUL. Due to inactivity of the enzyme in the cell lysate a purification method was established (using Ni-NTA-Histag resin and Syringe or ÄKTA method). The purified BPUL could be detected by SDS-PAGE (molecular weight of 58.6&nbsp;kDa) as well as by MALDI-TOF. To improve the purification strategies the length of the linear elution gradient was increased up to 200 mL . The fractionated samples were also tested concerning their activity and revealed high activity. Optimal conditions for activity were identified. After measuring activity of BPUL a successful scale up was made up to 3&nbsp;L and also up to 6&nbsp;L that enables an intense screening afterwards. A further scale up to 12 L with a optimized medium (HSG) was implemented to enable additional experiments to characterize BPUL. Additional scale up experiments will be important for further real world applications.<br />
<br />
<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivation===<br />
<div style="text-align:justify;"><br />
The first trials to produce the CotA-laccase from [http://www.dsmz.de/catalogues/details/culture/DSM-27.html ''Bacillus pumilus'' DSM 27] (ATCC7061, named BPUL) were performed in shaking flasks with various designs (from 100&nbsp;mL<sup>-1</sup> to 1&nbsp;L flasks, with and without baffles) and under different conditions. The parameters tested during the screening experiments were temperature (27&nbsp;°C,30&nbsp;°C and 37&nbsp;°C), the concentration of chloramphenicol (20 to 170&nbsp;µg&nbsp;mL<sup>-1</sup>), induction strategy ([https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction] and manual induction with 0,1&nbsp;% rhamnose) and cultivation time (6 to 24&nbsp;h). Furthermore it was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub>, to provide a sufficient amount of copper, which is needed for the active center of the laccase. Based on the screening experiments the best conditions for expression of BPUL were identified(see below). The addition of CuCl<sub>2</sub> did not increase activity, so it was omitted.<br />
<br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 12&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask and bioreactor cultivation.<br />
<br />
</div><br />
<br />
===3&nbsp;L Fermentation ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> ===<br />
<br />
[[File:Bielefeld2012_BPUL3LFermentation.jpg|450px|thumb|left|'''Figure 1:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (BPUL) in a [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Biostat_B_Bioreactor_.283_L.29_by_Braun Braun Biostat&nbsp;B], scale: 3&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every 30&nbsp;minutes.]]<br />
<p align="justify"><br />
<br />
After the measurement of BPUL activity we made a scale-up and fermented ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> in a[https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Biostat_B_Bioreactor_.283_L.29_by_Braun Braun Biostat&nbsp;B] fermenter with a total volume of 3&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 1. We got a long lag phase of 2&nbsp;hours due to a relatively old preculture. The cell growth caused a decrease in pO<sub>2</sub> and after 3&nbsp;hours the value fell below 50&nbsp;%, so that the agitation speed increased automatically. After 8.5&nbsp;hours the deceleration phase started and therefore the agitation speed was decreased. The maximal OD<sub>600</sub> of 3.53 was reached after 10&nbsp;hours, which means a decrease in comparison to the fermentation of ''E.&nbsp;coli'' KRX under the same conditions (OD<sub>600,max</sub> =4.86 after 8.5&nbsp;hours, time shift due to long lag phase). The cells were harvested after 11&nbsp;hours.<br />
</p><br />
<br style="clear: both" /><br />
<br />
=== Purification of BPUL ===<br />
<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the lysed cell paste was loaded on the Ni-NTA-column (15&nbsp;mL Ni-NTA resin) with a flowrate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed with 10&nbsp;column&nbsp;volumes (CV) Ni-NTA-equilibrationbuffer. The bound proteins were eluted by an increasing Ni-NTA-elutionbuffer gradient from 0&nbsp;% to 100&nbsp;% with a total volume of 100&nbsp;mL and the elution was collected in 10&nbsp;mL fractions. In Figure 2 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak.A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the BPUL-elution is shown in Figure 2:<br />
</p><br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BPUL3LChromatogramm.jpg|450px|thumb|left|'''Figure 2:''' Chromatogram of wash and elution from FLPC Ni-NTA-His tag purification of BPUL produced by 3&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>. BPUL was eluted between a process volume of 460&nbsp;mL to 480&nbsp;mL with a maximal UV-detection signal of 69 mAU]]<br />
<br />
<p align="justify"><br />
The chromatogram shows a remarkable widespread peak between the process volume of 460&nbsp;mL to 480&nbsp;mL with the highest UV-detection signal of 69 mAU, which can be explained by the elution of bound proteins. The corresponding fractions were analyzed by SDS-PAGE analysis. During the elution, a steady increase of the UV-signal caused by the increasing imidazol concentration during the elution gradient. Between the process volume of 550 and 580&nbsp;mL there are several peaks (up to a UV-detection-signal of 980&nbsp;mAU) detectable. These results are caused by an accidental detachment in front of the UV-detector. Just to be on the safe side, the corresponding fractions were analyzed by SDS-PAGE analysis. The corresponding SDS-PAGE is shown in Figure 3.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of purified BPUL===<br />
<div style="text-align:justify;"><br />
[[File:Bielefeld2012_0906.jpg|height={50px}|weight={400px}|thumb|left|'''Figure 3:''' SDS-PAGE of purified ''E. coli'' KRX lysate containing <partinfo>BBa_K863000</partinfo> (fermented in a 3 L Biostat Braun B fermenter). The flow-through, wash and the elution fractions 7 and 8 are shown. The arrow marks the BPUL band with a molecular weight of 58.6 kDa.]]<br />
<br />
Figure 3 shows the purified ECOL including flow-through, wash and the elution fractions 7 and 8. These two fractions were chosen due to a high peak in the chromatogram. BPUL has a molecular weight of 58.6 kDA and was marked with a red arrow. The band appears in both fractions. There are also some other non-specific bands, which could not be identified. To improve the purification the elution gradient length should be longer and slower the next time.<br />
<br />
The appearing bands were analyzed by MALDI-TOF and could be identified as CotA (BPUL).<br />
<br style="clear: both" /><br />
</div><br />
<br />
===6&nbsp;L Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>===<br />
<br />
[[File:Bielefeld2012_BPUL6LFermentation.jpg|450px|thumb|left|'''Figure 4:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (BPUL) in aBioengineering NFL22 fermenter, scale: 6&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation increased when pO<sub>2</sub> was below 30&nbsp;%, OD<sub>600</sub> measured every hour. ]]<br />
<br />
<p align="justify"><br />
Another scale-up for ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> was made up to a final working volume of 6&nbsp;L in a Bioengineering NFL22. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and illustrated in Figure 4. There was no noticeable lag phase. Agitation speed was increased up to 425&nbsp;rpm after one hour due to problems caused by the control panel. The pO<sub>2</sub> decreased until a cultivation time of 4.75&nbsp;hours. The increasing pO<sub>2</sub> level indicates the beginning of the deceleration phase. There is no visible break in cell growth caused by an induction of protein expression. A maximal OD<sub>600</sub> of 3.68 was reached after 8&nbsp;hours of cultivation, which is similar to the 3&nbsp;L fermentation (OD<sub>600</sub> = 3.58 after 10 hours, time shift due to long lag phase). The cells were harvested after 12&nbsp;hours.<br />
<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Purification of BPUL===<br />
<br />
<p align="justify"><br />
The harvested cells were prepared in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation. The supernatant of the lysed cell paste was loaded on the Ni-NTA-column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. The column was washed with 5&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer]. The bound proteins were eluted by an increasing elutionbuffer gradient from 0&nbsp;% (equates to 20&nbsp;mM imidazol) to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 200&nbsp;mL. This strategy was chosen to improve the purification by a slower increase of [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-elutionbuffer] concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 5 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the BPUL elution is shown in Figure 5.<br />
</p><br />
<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BPUL6LChromatogramm.jpg|450px|thumb|left|'''Figure 5:''' Chromatogram of wash and elution from FLPC Ni-NTA-Histag Purification of BPUL produced by 6&nbsp;L fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo>. BPUL was eluted between a process volume of 832&nbsp;mL and 900&nbsp;mL with a maximal UV-detection signal of 115&nbsp;mAU.]]<br />
<br />
<p align="justify"><br />
The chromatogram shows a peak at the beginning of the elution. This can be explained by pressure fluctuations upon starting the elution procedure. In between the processing volumes of 832&nbsp;mL and 900&nbsp;mL there is remarkable widespread peak with a UV-detection signal of 115&nbsp;mAU. This peak corresponds to an elution of bound proteins at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] concentration between 10&nbsp;% and 20&nbsp;% (equates to 50-100&nbsp;mM imidazol). The corresponding fractions were analyzed by SDS-PAGE. The ensuing upwards trend of the UV-signal is caused by the increasing imidazol concentration during the elution gradient. Towards the end of the elution procedure there is a constant UV-detection signal, which shows, that most of the bound proteins was already eluted. Just to be on the safe side, all fractions were analyzed by SDS-PAGE to detect BPUL. The SDS-PAGE is shown in Figure 6.<br />
<br />
</p><br />
<br style="clear: both" /><br />
<br />
===SDS-PAGE of purified BPUL===<br />
<div style="text-align:justify;"><br />
[[File:Bielefeld2012 0914.jpg|450px|thumb|left|'''Figure 6:''' SDS-PAGE of purified ''E.&nbsp;coli'' with <partinfo>BBa_K863000</partinfo> lysate (fermented in a Bioengineering NFL22 fermenter, 6 L). The flow-through, wash and elution fraction 1 to 9 are shown. The arrow marks the BPUL band with a molecular weight of 58.6 kDa. ]]<br />
<br />
In Figure 6 the SDS-PAGE of the Ni-NTA purification of the lysed ''E. coli'' KRX culture containing <partinfo>BBa_K863000</partinfo> is illustrated. It shows the flow-through, wash and elution fractions 1 to 9. The His-tagged BPUL has a molecular weight of 58.6 kDA and was marked with a red arrow. The band appears in all fractions from 2 to 9 with varying strength, the strongest ones in fractions 7 to 9. There are also some other non-specific bands, which could not be identified. Therefore the purification method could moreover be improved.<br />
In summary, the scale up was successful, improving protein production and purification method once again. <br />
<br />
Furthermore the bands were analyzed by MALDI-TOF and identified as CotA (BPUL). <br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: 12&nbsp;L Fermentation ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> ===<br />
<br />
<br />
[[File:Bielefeld2012_BPUL_Fermentation_12L.jpg|450px|thumb|left|'''Figure 7:''' Fermentation of ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> (BPUL) in an Bioengineering NFL 22, scale: 12&nbsp;L, [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol, 37&nbsp;°C, pH&nbsp;7, agitation on cascade to hold pO<sub>2</sub> at 50&nbsp;%, OD<sub>600</sub> measured every hour.]]<br />
<br />
<p align="justify"><br />
Finally another scale-up was made and ''E.&nbsp;coli'' KRX with <partinfo>BBa_K863000</partinfo> was fermented in a Bioengineering NLF 22 fermenter with a total volume of 12&nbsp;L to produce a high amount of the enzyme for further characterizations. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] was used to get a higher biomass. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined and the glycerin concentration of the samples analyzed. The data are illustrated in Figure 7.<br />
At the beginning of the cultivation, the cells were in lag phase, in which they adapt to the medium. During their growth the cells consumed glycerin as well as O<sub>2</sub>, which leads to an increase of agitation speed to hold a minimal pO<sub>2</sub> of 50 %. After 11 hours, the glycerin was completely consumed and the pO<sub>2</sub> increased up to 100 %, which indicates that the cells entered the stationary phase. The maximal OD<sub>600</sub> of 12.6 was reached after 12 hours of cultivation. The cells were harvested after 19 hours of cultivation.<br />
<br />
</p><br />
<br />
<br />
<br style="clear: both" /><br />
<br style="clear: both" /><br />
<br />
=== Since Regionals: Purification of BPUL ===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization] and cell debris were removed by centrifugation, microfiltration as well as diafiltration to concentrate the protein concentration in the cell lysate solution. This solution of the cell lysate was loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 70&nbsp;mL, to 80&nbsp;% (equates to 400&nbsp;mM imidazol) and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 100&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. Unfortunately, the data of this procedure are not available due to a computer crash after the purification step. All Fractions were analysed to detect BPUL.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019pumi.jpg|300px|thumb|left|'''Figure 8:''' SDS-Page of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BBa_K863000]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 8 the SDS-Page of the Ni-NTA purification of the lysed ''E.coli'' KRX culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BBa_K863000] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The HIS-tagged BPUL has a molecular weight of 58.6 kDa. BPUL could not be attributed exactly to any band. There are some other non-specific bands, wich could not be identified because the MALDI was broken-down for the last two weeks.<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===MALDI-TOF Analysis of BPUL===<br />
<br />
The ''E. coli'' laccase was identified using the following software<br />
*FlexControl<br />
*Flexanalysis and<br />
*Biotools<br />
from Brunker Daltronics. <br />
The in silico- tryspinated created peptide mass fingerprints were compared with the measured masses gotten from the MALDI. With a sequence coverage of 21,9% BPUL was identified. <br />
In Figure 7 and 8 the chromatogram of the peptide mass fingerprint and the single masses are shown. <br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_Massemspektroskopie_BPumi_.png|thumb|400px|left|center|'''Figure 7:''' MALDI-TOF spectrum]] [[File:Bielefeld2012_Massenspektrometrische_Auswertung_BPumi.png|400px|thumb|right|'''Figure 8:''' MALDI-TOF spectrum results of the analysis]]<br />
<br style="clear: both" /><br />
<br />
==Activity analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL]==<br />
<br />
<br />
===Initial activity tests of purified fractions===<br />
<br />
<p align="justify"><br />
Initial tests were done with elution fractions 1 to 4 to determine the activity of the purified [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase. The fractions were rebuffered into deionized H<sub>2</sub>O using [http://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Supelco/Product_Information_Sheet/4774.pdf HiTrap Desalting Columns] and incubated with 0.4 mM CuCl<sub>2</sub>. The reaction setup included 140 µL of a elution fraction, 0.1 mM ABTS and 100 mM sodium acetate buffer (pH 5) to a final volume of 200 µL and the absorption was measured at 420 nm to detect oxidization over a time period of 5 hours at 25°C. Each fraction did show contained active laccase able to oxidize ABTS (see Figure 9). After 15 minutes, saturation was observed with ~60 µM oxidized ABTS. After 5 hours ~5 µM ABTS got reduced again. This behavior has been observed in the activity plot of the positive control [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0] before, indicating, that the oxidation catalyzed by this laccase seems is reversible. Additionally, protein concentrations of each fraction were identified using the Bradford protocol. The four tested fractions showed approximately the same amount of protein after rebuffering, namely 0.5 mg mL<sup>-1</sup>. Fraction 4, containing the most protein and also most of active laccase was chosen for subsequent activity tests of BPUL. The protein concentration was reduced to 0.03 mg mL<sup>-1</sup> for each measured sample to allow a comparison between TVEL0 measurements and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] measurements.<br />
</p><br />
<br />
[[File:Bielefeld2012_Party_Pumi_bestimmung2.jpg|thumbnail|600px|center|'''Figure 9:''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase activity measured in 0.1 mM ABTS and 100 mM sodium acetate buffer (pH 5) to a final volume of 200 µL at 25°C over a time period of 3.5 hours. Each tested fraction reveals activity reaching the saturation after 15 minutes with ~60 µM ABTS<sub>ox</sub> after 0.4 mM CuCl<sub>2</sub> incubation. (n=4)]]<br />
<br style="clear: both" /><br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] pH optimum===<br />
<br />
<p align="justify"><br />
<br />
To determine at which pH the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase has its optimum in activity, a gradient of sodium acetate buffer pHs was prepared. Starting with pH 1 to pH 9 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity was tested using the described conditions above and 0.03 mg mL<sup>-1</sup> protein. The results are shown in Figure 11. A distinct pH optimum can be seen at pH 5. The saturation is reached after 3 hours with 50% oxidization of ABTS through the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase at pH 5 (55 µM oxidized ABTS). The other tested pHs only led to a oxidation of 18% of added ABTS. Figure 12 represents the negative control showing the oxidation of ABTS through 0.4 mM CuCl<sub>2</sub> at the chosen pHs. The highest increase in oxidized ABTS can be seen at a pH of 5. After 5 hours 15% ABTS are oxidized only through CuCl<sub>2</sub>. Nevertheless this result does not have an impact on the reactivity of the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase at pH 5, which is still the optimal pH. Therefore it has the same pH optimum as [https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#7 TVEL0].<br />
[[File:Bielefeld2012_PH_Pumi1.jpg|thumbnail|500px|center|'''Figure 11:''' [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase activity measured in 100 mM sodium acetate buffer with a range of different pHs from pH 1 to pH 9, 0.1 mM ABTS to a final volume of 200 µL at 25°C over a time period of 5 hours. Before the measurements samples were incubated with CuCl<sub>2</sub>. The optimal pH for [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] is pH 5 with the most ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_PH_neg_control1.jpg|thumbnail|500px|center|'''Figure 12:''' Negative control for pH activity Tests using 0.04 mM CuCl<sub>2</sub> H<sub>2</sub>O instead of Laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In regard to our project an optimal pH of 5 is a helpful result. Since waste water in waste water treatment plants has a average pH of 6.9 it has to be kept in mind, that a adjustment of the pH is necessary.<br />
<br style="clear: both" /><br />
</p><br />
<br />
<br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] CuCl<sub>2</sub> concentration===<br />
<p align="justify"><br />
Another test of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] was done to survey the best CuCl<sub>2</sub> concentration for the activity of the purified [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase. 0.03 mg mL<sup>-1</sup> of protein were incubated with different CuCl<sub>2</sub> concentrations ranging from 0 to 0.7 mM CuCl<sub>2</sub>. Activity tests were performed with the incubated samples, 0.1 mM ABTS and 100 mM sodium actetate buffer (pH 5) to a final volume of 200 µL. The reactivity was measured at 420 nm, 25°C and over a time period of 5 hours. As expected the saturation takes place after 3 hours (see Figure 12). The differences in the activity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccases incubated in different CuCl<sub>2</sub> differ minimal. The highest activity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase is observed after incubation with 0.6 mM CuCl<sub>2</sub> (52% of added ABTS). With a higher concentration of 0.7 mM CuCl<sub>2</sub> the activity seems to be reduced (only 48% ABTS got oxidized). This leads to the assumption that CuCl<sub>2</sub> supports the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase reactivity but concentrations exceeding this value of CuCl<sub>2</sub> may have a negative impact on the ability of oxidizing ABTS. This fits the expectations as laccases are copper reliant enzymes and gain their activity through the incorporation of copper. Additionally negative controls were done using the tested concentrations of CuCl<sub>2</sub> without applying laccase to detect the oxidization of ABTS through copper (see Figure 13). The more CuCl<sub>2</sub> was present, the more ABTS was oxidzied after 5 hours. Still the maximal change accounts only for ~6% oxidized ABTS after 5 hours.<br />
[[File:Bielefeld2012_Pumi_Cu1.jpg|thumbnail|500px|center|'''Figure 12:''' Activity measurement using 0.1 mM ABTS of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] incubated in different CuCl<sub>2</sub> concentrations. Without CuCl<sub>2</sub> incubation the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase shows half of the activit as after CuCl<sub>2</sub> incubation. Incubation with 0.1 mM CuCl<sub>2</sub> or higher concentrations leas to an increase in ABTS<sub>ox</sub>.]]<br />
[[File:Bielefeld2012_Pumi_Cu_NegControl1.jpg|thumbnail|500px|center|'''Figure 13:''' Negative control for CuCl<sub>2</sub> activity Tests using different concentrations of CuCl<sub>2</sub> H<sub>2</sub>O instead of Laccase to determine the potential of ABTS getting oxidized through CuCl<sub>2</sub>.]]<br />
In relation to apply the laccase in waste water treatment plants it is beneficial knowing, that small amounts of CuCl<sub>2</sub> are enough to activate the enzyme. Still it is expensive to be reliant on CuCl<sub>2</sub> and a potential risk using heavy metals for waste water purifcation.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012_BPUL_Temp.jpg|thumbnail|450px|left|'''Figure 14:''' Standard activity test for [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] measured at 10°C and 25°C resulting in a decreased activity at 10°C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10°C were analyzed.]]<br />
<p align="justify"><br />
To investigate the activity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] at lower temperatures, activity tests as described above were performed at 10°C and 25°C. A small decrease in the activity can be observed upon reducing the temperature from 25°C to 10°C (see Fig. 14). After 3.5 hours when samples at 25°C reached the saturation samples at 10°C had not, but nonetheless the difference is minimal. After 3 hours 5% difference in oxidized ABTS is observable. The negative control without the [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase but 0.4 mM CuCl<sub>2</sub> at 10°C shows a negligible oxidation of ABTS.<br />
A a decrease in the reactivity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase was expected. The observed small reduction in enzyme activity is excellent news for the possible application in waste water treatment plants where the temperature differs from 8.1°C to 20.8°C.<br />
<br style="clear: both" /><br />
</p><br />
<br />
===[http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity depending on different ABTS concentrations===<br />
<br />
[[File:Bielefeld2012_BPUL_ABTS.jpg|thumbnail|450px|left|'''Figure 15:''' Analysis of ABTS oxidation by [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccases incubated in 0.4 CuCl<sub>2</sub> tested with different amounts of ABTS. The higher the amount of ABTS the more oxidized ABTS can be detected.]]<br />
<p align="justify"><br />
Furthermore, [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase were tested using different amounts of ABTS to calculate K<sub>M</sub> and K<sub>cat</sub> values. The same measurement setup as described above was used only with different amounts of ABTS. As anticipated, the amount of oxidized ABTS increased in dependence of the amount of ABTS used (Figure 15). Especially using 16 µL showed an increase in the activity until 1 hour (reaching 50 µM ABTS<sub>ox</sub>), but the amount of oxidized ABTS decreased afterward.<br />
<br style="clear: both" /><br />
</p><br />
<br />
<br />
<br />
===Impact of MeOH and acteonitrile on [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL]===<br />
<p align="justify"><br />
For substrate analytic tests the influence of MeOH and acetonitrile on [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccases had to be determined, because substrates have to be dissolved in these reagents. The experiment setup included 0.03 mg mL<sup>-1</sup> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase, different amounts of MeOH (Figure 16) or acteonitrile (Figure 17), 0.1 mM ABTS and 100 mM sodium actetate buffer to a final volume of 200 µL. The observed reactivity of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] in regard of oxidizing ABTS did not reveal a huge decrease. The less MeOH or acetonitrile was used, the higher was the amount of oxidized ABTS after 3 hours. An application of 16 µL MeOH or acetonitrile led to a decrease of maximal 10% oxidized ABTS compared to 2 µL MeOH or acetonitrile. Negative controls are shown in [https://2012.igem.org/Team:Bielefeld-Germany/Results/coli#Impact_of_MeOH_and_acteonitrile_on_ECOL Figure 17 and 18] of the ECOL laccase. MeOH and acetonitril are able to oxidize ABTS. After 5 hours at 25°C ~15 µM ABTS get oxidized through MeOH or acetonitrile, but samples with [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase show a distinct higher activity of 50 µM ABTS<sub>ox</sub>.<br />
[[File:Bielefeld2012_Pumi_MeOH1.jpg|thumbnail|500px|center|'''Figure 16:''' Standard [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity test applying different amounts of MeOH. No considerable impact on the activity can be detected.]]<br />
[[File:Bielefeld2012_Pumi_acetonitrile1.jpg|thumbnail|500px|center|'''Figure 17:''' Standard [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity test applying different amounts of acetonitrile. No considerable impact on the activity can be detected.]]</p><br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<p align="justify"><br />
After the Regional Jamboree in Amsterdam further BPUL was produced. The most comprising fractions of the purification were analyzed for [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein content] (10/16), re-buffered into deionized H<sub>2</sub>O and incubated in 0.4 mM CuCl<sub>2</sub>. Again, the [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Wednesday_October_17th/ protein content] (10/17) of each fraction was determined because of the loss of proteins through re-buffering. Initial activity tests were done in Britton-Robinson buffer with 0.1 mM ABTS. The protein content of each fraction was adjusted for comparison of the resulting activity (see '''Fig. 18''').<br />
[[File:Bielefeld2012_new_BPUL_acitivity.jpg|500px|thumb|center|'''Figure 18:''' Activity assay of each purified fraction of recent produced BPUL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction was adjusted. The measurement was done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
Fraction 50% 2 showed the highest activity. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution. The saturation was reached at ~1 h. For comparison it was stated that this fraction contains 90 % laccase and therefore the BPUL concentration is 25,1 µg mL<sup>-1</sup>.<br />
</p><br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity depending on different ABTS concentrations===<br />
<p align="justify"><br />
In order to find the substrate saturation, laccase activity was measured with ABTS concentrations ranging from 0.1 mM to 8 mM. 616 ng BPUL were used for measurements with ABTS concentrations of 0.1 mM to 5 mM, 308 ng BPUL were used for measurements with ABTS concentrations of 5 mM to 8 mM. Measurements were done in Britton-Robinson buffer (pH 5) at 25 °C for 30 minutes taking the OD<sub>420</sub> every 5 minutes. Comparing the graphs in Figure 19 and Figure 20, both show a comprising substrate saturation with 5 mM ABTS. Higher concentrations of ABTS than 5 mM did not show any other effects on the activity of BPUL. For all following BPUL activity measurements after the Regional Jamborees in Amsterdam a concentration of 5 mM ABTS was applied.<br />
[[File:Bielefeld2012_BPUL_klein_ABTS.jpg|thumb|left|360px|'''Figure 19:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng BPUL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 0.1 mM to 5 mM.]]<br />
[[File:Bielefeld2012_BPUL_hoch.jpg|thumb|right|360px|'''Figure 20:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 308 ng BPUL in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5 mM to 8 mM. An ABTS concentration of 5 mM was determined as substrate saturation.]]<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] pH optimum===<br />
<br />
[[File:Bielefeld2012_Pumi_pH_Foto.png|thumb|right|200px|'''Figure 21:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 5 and pH 4 the darkest colour has been reached.]]<br />
The pH of the medium containing the enzyme is of high importance for its activity. The pH optima of BPUL are pH 4 and pH 5. This is the result of activity measurements using Britton-Robinson buffer with differently adjusted pHs. BPUL was re-buffered into H<sub>2</sub>O and incubated with 0.4 mM CuCl<sub>2</sub>. The range from pH 4 to pH 9 was tested under substrate saturation at 25 °C for 30 minutes. At pH 4 and pH 5 ABTS got oxidized the fastest (see Fig. 21 and Fig. 22). At higher pHs than pH 5, the activity of BPUL was decreased considerably. The resulting Units mg<sup>-1</sup> support the observed data (see Fig. 23). At pH 4 and pH 5 BPUL showed a specific enzyme activity of ~37 U mg<sup>-1</sup>. The higher the pH, the less U mg<sup>-1</sup> could be calculated for BPUL. At pH 7 1/3 of the activity decreased, but still BPUL was active at this pH allowing an application of this laccase in a waste water treatment plant where the average pH is a pH of 6.9.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BPUL_pH_new.jpg|thumb|left|360px|'''Figure 22:''' Oxidized ABTS by BPUL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated BPUL laccase (308 ng), Britton Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The highest amount of oxidized ABTS was detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012_BPUL_pH_Units.jpg|thumb|right|360px|'''Figure 23:''' Calculated specific enzyme activity of BPUL at different pH conditions. The highest specific enzyme activity for ABTS was under pH 4 and pH 5 conditions. The higher the pH, the less ABTS got oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br style="clear: both" /><br />
</p><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012 BPUL Temp ABTSox.jpg|left|200px|thumb|'''Figure 24:''' Standard activity test for BPUL measured at 10 °C and 25 °C resulting in a comparable activity at the tested temperatures. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 BPUL Temp Units.jpg|right|200px|thumb|'''Figure 25:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures only a difference of 1 U mg<sup>-1</sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
To investigate the activity of BPUL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The obtained results reveal a comparable activity of BPUL at high and low temperatures (see Fig. 24). The measurements were conducted for 30 minutes until saturation initiated. Both samples reached saturation after 15-20 minutes. The obtained results were used to calculate the specific enzyme activity which was in both cases at about 37 U mg<sup>-1</sup> (see Fig. 25). The negative control without BPUL laccase but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C show a negligible oxidation of ABTS. The observed activity at both conditions was good news for the possible application in waste water treatment plants where the temperature differs from 8.1 °C to 20.8 °C.<br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
== Immobilization ==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 3% of BPUL laccases was still present in the supernatant. This illustrates that BPUL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
<br />
<br />
<br style="clear: both" /> <br />
[[File:Bielefeld2012_bpumi.jpg|500px|left|thumb|'''Figure 21''': Enzymatic activity of BPUL supernatant compared to the activity of nontreated laccases, measured using 0.1 mM ABTS at 25°C over a time period of 12hours. The results show a dramatic decrease of BPUL in the Supernatant.]]<br />
<br />
<div style="text-align:justify;"><br />
In figure 21, the enzymatic activity of BPUL in the supernatant is compared to the activity of nontreated BPUL. Although an activity can already be detected in the supernatant, this activity is low compared to the original.<br />
<br style="clear: both" /> <br />
</div><br />
[[File:Bielefeld2012-Graphen_Bead_BPUL.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by BPUL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by BPUL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the very high activity of BPUL, which could not be measured properly.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}</div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/haloTeam:Bielefeld-Germany/Results/halo2012-10-27T01:52:55Z<p>Fougee: /* Since Regionals: SDS-Page of protein purification */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase Lbh1 from <a href="http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5"> <i>Bacillus halodurans</i> C-125 </a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with various parameters to identify the best conditions for production of the His tagged laccase Lbh1 from [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] named BHAL. Due to inactivity of the enzyme in the cell lysate a purification method was established (using Ni-NTA-Histag resin). BHAL could not be detected by SDS-PAGE (theoretical molecular weight of 56&nbsp;kDa) or activity test by using the BioBrick <partinfo>BBa_K863020</partinfo> and ''E. coli'' KRX as expression system. Due to this results the new BioBrick <partinfo>BBa_K863022</partinfo> was constructed and expressed ''E. coli'' Rossetta-Gami&nbsp;2. With this expression system the laccase could be produced and analysed via SDS-PAGE. A small scale Ni-NTA-column was used to purify the laccase. The fractionated samples were tested regarding their activity with ABTS and showed ability in oxidizing ABTS. A scale up to 12 L with a optimized medium (HSG) and a labscale Ni-NTA-Purification were implemented to enable additional experiments to characterize BHAL. <br />
<br />
<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Cultivation===<br />
<div style="text-align:justify;"> <br />
The first trials to produce the Lbh1 - laccase from ''Bacillus halodurans'' (named BHAL) were performed in shaking flasks with various flask designs (from 100 mL to 1 L flasks, with and without baffles) and under several conditions. The varied parameters in our screening experiments were temperature (27 °C, 30 °C and 37 °C), concentration of chloramphenicol (20 - 170 µg mL<sup>-1</sup>), induction strategy (autoinduction and manual induction with 0,1 % rhamnose) and cultivation time (6 to 24 h). Furthermore cultivation was performed with and without addition of 0.25 mM CuCl<html><sub>2</sub></html> to provide a sufficient amount of copper, which is needed for the active center of the laccase. ''E.coli'' KRX was not able to produce active BHAL under the tested conditions, therefore another chassis was chosen. For further cultivations ''E. coli'' Rosetta-Gami 2 was transformed with BBa_K863012, because of its ability to translate rare codons. Finally BHAL was produced under the following conditions:<br />
</div><br />
* flask design: shaking flask without baffles <br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#LB_medium LB-Medium] <br />
* antibiotics: 60 µg mL<sup>-1</sup> chloramphenicol and 300 µg mL<sup>-1</sup> ampicillin <br />
* temperature: 37 °C <br />
* cultivation time: 24 h<br />
<br />
===Purification===<br />
<br />
<div style="text-align:justify;"> <br />
The cells were harvested and resuspended in Ni-NTA-equilibration buffer, mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Sonication sonification] and centrifuged. After preparing the cell paste the BHAL laccase could not be purified with the 15 mL Ni-NTA column, because the column was not available. For this reason a small scale purification (6 mL) of the supernatant of the lysate was performed with a 1 mL [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Syringe_method Ni-NTA column]. The elution was collected in 1 mL fractions.<br />
</div><br />
<br />
===SDS-PAGE===<br />
<br />
<div style="text-align:justify;"> [[File:Bielefeld2012_0913.jpg|450px|thumb|left|'''Figure 1:''' SDS-PAGE of purified lysate derived from a flask cultivation of ''E. coli'' Rosetta-Gami 2 carrying <partinfo>BBa_K863022</partinfo>. Lanes 2 to 7 show the flow-through, the wash and the elution fractions 1 to 4. BHAL has a molecular weight of 56 kDa and is marked with an arrow.]]<br />
<br />
In figure 1 the different fractions of the purified cell lysate of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo> are shown in a SDS-PAGE. BHAL has a molecular weight of 56 kDa. In lane 5, which corresponds to the elution fraction 2, a faint band of 56 kDa is visible. Therefore the fractions were further analysed by activity test and MALDI-TOF.<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: 12L Fermentation of ''E. coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo>===<br />
<br />
[[File:Bielefeld2012_BHAL12L.jpg|450px|thumb|left|'''Figure 2:''' Fermentation of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo> (BHAL) in a Bioengineering NFL22. Conditions: 12&nbsp;L of [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg mL <sup> -1 </sup> chloramphenicol at 37&nbsp;°C, pH&nbsp;7. Agitation increased when pO<sub>2</sub> was below 50&nbsp;% and OD<sub>600</sub> was measured each hour. The glycerin concentration was measured on important points of the cultivation with [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#Carbon_source_measurement_with_HPLC HPLC].]]<br />
<div style="text-align:justify;"><br />
After measuring the BHAL activity a scale-up was performed and ''E. coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo> was cultivated in a Bioengineering NFL 22 fermenter with a total volume of 12 L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined as well as the glycerin concentration. The data are illustrated in Figure 2. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autodinduction medium] was used to produce more biomass. Due to the change of media and to a low amount of cells for inoculation there was a long lag phase of nearly 10 hours. During this phase the glycerin concentration was approximately constant. The following cell growth caused a decrease of glycerin concentration and of pO<sub>2</sub>. After 11 hours the value fell below 50 %, so that the agitation speed increased automatically. After 21 hours the deceleration phase started and therefore the agitation speed decreased. The maximal OD<sub>600</sub> of 9.9 was reached after 22 hours, when the cells entered the stationary phase. The glycerin was completely consumed. The cells were harvested at this time. It might have been better to cultivate a few hours longer.<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
===Since Regionals: Purification of BHAL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer] and mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization]. The cell debris were removed by centrifugation and microfiltration via [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50]. The supernatant of the cell lysate was concentrated with [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50] with 10 kDa and loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 80&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 80&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 90&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the BHAL elution is shown in Figure 5:<br />
</p><br />
<br />
[[File:Bielefeld2012_BHAL_Chromatogramm.jpg|450px|thumb|left|'''Figure 3:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His-tag Purification of BHAL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' Rosetta Gami 2 with <partinfo>BBa_K863022</partinfo>. BHAL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 123&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a Ni-NTA-equilibration buffer concentration of 5 % (equates to 25 mM imidazol) and resulted from the elution of weakly bound proteins. Contrary to our expectations, the chromatogram shows the second distinguished peak. This peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 100&nbsp;% (equates to 500&nbsp;mM imidazol) and resulted from the elution of bound protein. Earlier measurements of other bacterial laccases showed that the elution of these laccases begins with a elution buffer concentration of 50&nbsp;%(equates to 250&nbsp;mM imidazol). One explanation of this result could be a low concentration of the produced BHAL. Consequently all elution fractions were analyzed by SDS-PAGE to detect BHAL. In the chromatogram no further peaks were detected. The following increasing UV detection signal by increasing concentration of the eltutionbuffer results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 4.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019halo.jpg|300px|thumb|left|'''Figure 4:''' SDS-Page of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BBa_K863022]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 4 the SDS-Page of the Ni-NTA purification of the lysed ''E.coli'' Rosetta-Gami 2 culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BBa_K863022] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The HIS-tagged BHAL has a molecular weight of 56 kDa. Apparently the concentration of BHAL is too low to see a band. <br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL]==<br />
<p align="justify"><br />
<br />
===Initial activity tests of purified fractions===<br />
<br />
The resulting fractions of the cultivation and purification of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] (fraction 1 to 5) were analysed with activity tests. After rebuffering into deionized H<sub>2</sub>O and incubation with 0.4 mM CuCl<sub>2</sub> for 2 hours, the samples were measured with 140&nbsp;µL sample, 0.1 mM ABTS, 100 mM sodium acetate buffer to a final volume of 200 µL. The change in optical density was measured at 420 nm, reporting the oxidation of ABTS for 5 hours at 25°C. An increase in ABTS<sub>ox</sub> can be seen (Figure 4), indicating produced [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] laccase in each fraction. Fraction 2 shows the highest amount of ABTS<sub>ox</sub> (55%) reaching saturation after 3 hours. Similar to [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase, [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] is capable to reach saturation after 3 hours with approximately oxidizing 55% of the supplied ABTS. Therefore [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] is going to be characterized further.<br />
[[File:Bielefeld2012_17_09_BHAL1.jpg|thumbnail|center|500px|'''Figure 4''': Activity test of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] fractions after purification. Reaction setup includes 140 µL fraction sample (CuCl2 incubated), 0.1 mM ABTS and 100 mM sodium actetate buffer (pH 5) to a final volume of 200 µL. Measurements were done at 25°C and over a time period of 5 hours. Each fraction shows activity, especially fraction 2, which therefore contains most [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] laccase. (n=4)]]<br />
<br />
<br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Different fractions of the purification of a new cultivation since the Regional Jamborees in Amsterdam were tested regarding their activity of the produced BHAL. Before and after re-buffering the protein concentration was determined. The initial activity tests were done in Britton-Robinson buffer (pH 5) with 0.1 mM ABTS at 25 °C. The protein amount was adjusted in each sample for a comparison. One distinct fraction showed the highest activity: fraction 5% 3 (Fig. 5). The contained laccase amount was calculated by assuming that the most active fraction contains 90 % laccase. This leads to a BHAL concentration of 10,9 ng mL<sup>-1</sup>.<br />
[[File:Bielefeld2012_new_BHAL_activity.jpg|500px|thumb|center|'''Figure 5:''' Activity assay of each purified fraction of recent produced BHAL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction had been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] activity depending on different ABTS concentrations===<br />
<br />
To be able to calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. This allows the comparison of Units mg<sup>-1</sup> with other laccase activities and data found in literature. For this purpose ABTS concentrations ranging from 0.1 mM to 8 mM were applied in an experimental setup containing Britton-Robinson buffer (pH) and a temperature of 25 °C. For measurements with 0.1 mM to 5 mM ABTS 616 ng BHAL were used (Fig. 6). For measurements with 5 mM to 8 mM ABTS only 308 ng BHAL were applied (Fig. 7). Applying less than 7 mM ABTS a static increase in oxidized ABTS was given. Measurements with 8 mM ABTS showed a slower increase in oxidized ABTS as with 7 mM ABTS (Fig. 7). This may be due to a substrate toxication. The most compromising ABTS concentration was 7 mM with the highest increase in oxidized ABTS. Therefore a substrate saturation was reached with 7 mM ABTS.<br />
[[File:Bielefeld2012_BHAL_klein_ABTS.jpg|thumb|left|360px|'''Figure 6:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng BHAL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 0.1 mM to 5 mM.]]<br />
[[File:Bielefeld2012_BHAL_ABTS_hoch.jpg|thumb|right|360px|'''Figure 7:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 308 ng BHAL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5 mM to 8 mM. An ABTS concentration of 7 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] pH optimum===<br />
<br />
[[File:Bielefeld2012_Halo_pH_Foto.png|thumb|right|200px|'''Figure 8:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color, the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour was detected.]]<br />
To determine the optimal experimental setup for BHAL activity measurements, the best pH had to be determined. Using Britton-Robinson buffer pHs between pH 4 and pH 9 had been adjusted. 308 ng BHAL per well had been tested under these pH conditions using 7 mM ABTS. The CuCl<sub>2</sub> incubated and therefor activated BHAL showed a high activity at pH 4 and pH 5, where most of ABTS was oxidized (compared to Fig. 8 and 9). The calculated specific enzyme activity of BHAL showed high activity at both mentioned pHs (Fig. 10). While BHAL had an activity of ~8 U mg<sup>-1</sup> at pH 4 and pH 5, the enzyme activity decreased at higher pHs. At a pH of 6 only 1/3 of enzyme activity could be detected compared to the activity at pH 4 and pH 5. While still active at pH 7, the BHAL is not as suitable as thought for an application at a waste water treatment plant because of its high activity in acidic environments.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BHAL_pH_new.jpg|thumb|360px|left|'''Figure 9:''' Oxidized ABTS by BHAL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated BHAL (308 ng), Britton Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The highest amount of oxidzed ABTS could be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012_BHAL_pH_Units.jpg|thumb|360px|right|'''Figure 10:''' Calculated specific enzyme activity of BHAL at different pH conditions. The highest specific enzyme activity for ABTS was under pH 4 and pH 5 conditions. The higher the pH, the less ABTS got oxidzed. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012 BHAL Temp ABTSox.jpg|left|200px|thumb|'''Figure 11:''' Standard activity test for BHAL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 BHAL Temp Units.jpg|right|200px|thumb|'''Figure 12:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 3 U mg<sup>-1</sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
To investigate the activity of BHAL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results revealed a lower activity of BHAL at 10 °C in comparison to 25 °C (see Fig. 11). The obtained results were used to calculate the specific enzyme activity which was at 4.2 and 7.2 U mg<sup>-1</sup>, respectively (see Figure 12). The negative control without BHAL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C showed a negligible oxidation of ABTS. The activity of BHAL was increased to about 60 % at 10 °C but nevertheless the observed activity at both conditions was great news for the possible application in waste water treatment plants.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
==Substrate Analysis==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis ==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br style="clear: both" /><br />
<br />
<br />
== Immobilization ==<br />
<br />
<br />
[[File:Bielefeld2012-Immobilized_proteins.jpg|500px|left|thumb|'''Figure 20''': The percentage of laccases immobilized to CPC-Beads. 99 % of ECOL, 97 % of BPUL and 79 % of BHAL and TTHL laccases were bound to the beads.]]<br />
<br />
<div style="text-align:justify;"><br />
Figure 20 shows the percentage of laccases bound after incubation with CPC-beads, relative to the original concentration. The concentration of laccases in the supernatant after incubation was measured using Roti®-Nanoquant. The results showed that only 21% of BHAL laccases was still present in the supernatant. This illustrates that BPUL was successfully immobilized on the CPC-beads.<br />
</div><br />
<br style="clear: both" /> <br />
<br />
<br />
<br />
[[File:Bielefeld2012-Graphen_Bead_Halo.jpg|500px|left|thumb|'''Figure 22''': Illustration of ABTS oxidation by BHAL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity.]]<br />
<div style="text-align:justify;"><br />
Figure 22 shows the illustration of ABTS oxidation by BHAL with time compared to the negative control. The increase in ABTS oxidized proves laccase activity even if a direct comparison with the original and not immobilized laccase solution was not possible due to the very low concentration of purified BHAL.<br />
<br style="clear: both" /> <br />
</div><br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
/div><br />
/p></div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/thermoTeam:Bielefeld-Germany/Results/thermo2012-10-27T01:51:24Z<p>Fougee: /* Since Regionals: SDS-Page of protein purification */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase LttH from <a href="http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzresources_pi5"> <i>Thermus thermophilus</i> HB27 (ATCC7061)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
Initially some trials of shaking flask cultivations were made with different parameters to identify the best conditions for the production of the His-tagged laccase LttH from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] named TTHL. Due to the absence of enzyme activity of the enzyme in the cell lysate a purification method was established (using Ni-NTA-His tag resin). Using ''E. coli'' KRX containing BioBrick <partinfo>BBa_K863010</partinfo>, TTHL could not be detected by SDS-PAGE (molecular weight of 53&nbsp;kDa) or by activity test. Therefore a new BioBrick <partinfo>BBa_K863012</partinfo> was constructed and expressed in ''E. coli'' Rosetta-Gami&nbsp;2. With this expression system the TTHL could be detected by SDS-PAGE and purified by using a small scale Ni-NTA column. The fractionated samples were tested regarding their activity. TTHL was shown to oxidize ABTS. After measuring activity of TTHL a scale up of the fermentation was successfully implemented up to 6&nbsp;L. A further scale up to 12 L with a optimized medium (HSG) and a labscale Ni-NTA-Purification were implemented to enable additional experiments to characterize TTHL.<br />
<br />
<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivation===<br />
<div style="text-align:justify;"><br />
The first trials to produce the LttH-laccase from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzresources_pi5 ''Thermo thermophilus'' HB27] (named TTHL) were performed in shaking flasks with various volumes (from 100&nbsp;mL up to 1&nbsp;L flasks, with and without baffles) and under different cultivation conditions. The best cultivation condition for <partinfo>BBa_K863010</partinfo> expressed in E. coli was screened by varying the temperature, the chloramphenicol concentration,induction strategy and cultivation time. Furthermore, ''E. coli'' was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> in the medium to provide a sufficient amount of copper, which is needed for bilding the active center. Under the screened conditions no biological active TTHL could be produced. Therefore another BioBrick was constructed and another chassi was chosen. To improve the expression another BioBrick <partinfo>BBa_K863012</partinfo> was used, which has a constitutive promoter instead of the T7 promoter system. Additionally, the strain ''E. coli'' Rosetta-Gami 2 was chosen, because of its ability to translate rare codons. TTHL was then produced under the following conditions: <br />
</div><br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#LB_medium LB-Medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol and 300&nbsp;µg&nbsp;mL<sup>-1</sup> ampicillin<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 24&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask cultivation, but not yet for the bioreactor cultivation.<br />
<br />
===Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863012</partinfo>===<br />
<br />
<br />
<br />
<br />
[[File:Bielefeld2012_TTHL6LFermentation.jpg|450px|thumb|left|'''Figure 1:''' Fermentation of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863012</partinfo> (TTHL) in a Bioengineering NFL22. Conditions: 6&nbsp;L of [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol at 37&nbsp;°C, pH&nbsp;7. Agitation increased when pO<sub>2</sub> was below 30&nbsp;% and OD<sub>600</sub> was measured each hour.]]<br />
<div style="text-align:justify;"><br />
After measuring activity of TTHL we made a scale-up and cultivated ''E.&nbsp;coli'' Rosetta-Gami 2 expressing <partinfo>BBa_K863000</partinfo> in a Bioengineering NFL22 fermenter with a total volume of 6&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were online monitored and are illustrated in Figure 1. No initial lag phase was noticeable. Due to the cell growth the pO<sub>2</sub> decreased,breakdown of the control unit resulted in a drop to 0%. After a cultivation time of 9&nbsp;hours the agitation speed was therefore increased manually up to 500&nbsp;rpm, which resulted in a higher pO<sub>2</sub> value of more than 100&nbsp;% for the rest of the cultivation. During the whole process the OD<sub>600</sub> increased slower compared to the fermentation of ''E.&nbsp;coli'' KRX expressing <partinfo>BBa_K863000</partinfo> or <partinfo>BBa_K863005</partinfo>. The maximal OD<sub>600</sub> was reached after 19 hours cultivation time at which point the cells were harvested.<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
===Purification of TTHL===<br />
<br />
<br />
<p align="justify"><br />
The cells were harvested by centrifugation and resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation high pressure homogenization] and centrifuged. After preparing the cell paste the TTHL could not be purified with the 15&nbsp;mL column, due to a not available column. For this reason a small scale purification (6&nbsp;mL) of the supernatant of the homogenisation was made with a 1&nbsp;mL Ni-NTA-column. <br />
</p><br />
<br />
===SDS-PAGE of purified TTHL===<br />
<div style="text-align:justify;"><br />
[[File:Bielefeld2012_0923.jpg|450px|thumb|left|'''Figure&nbsp;2:''' SDS-PAGE of purified ''E. coli'' Rosetta-Gami&nbsp;2 containing <partinfo>BBa_K863012</partinfo> lysate (fermented in 6 L Bioengineering NFL22). The flow-through, wash and elution fraction 1 to 5 are shown. The arrow marks the TTHL band with a molecular weight of 53&nbsp;kDa.]]<br />
<br />
Figure 2 shows the SDS-PAGE of the purified ''E.&nbsp;coli'' Rosetta-Gami 2 lysates fermented in 6&nbsp;L Bioengineering NFL22 fermenter. Additionally the flow-through, wash and all elution fractions (1 to 5) are shown. TTHL has a molecular weight of 53&nbsp;kDa and the corresponding band is marked with a red arrow. The TTHL band can be found in fractions 1 to 3, but not in the other two elution fractions. Furthermore there are some other non-specific bands, which could not be identified. To improve the purification an 15&nbsp;mL column was implemented.<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: 12 L Fermentation of ''E. coli'' Rosetta Gami 2 with [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 BBa_K863012]===<br />
<br />
[[File:Bielefeld2012_TTHL12L.jpg|450px|thumb|left|'''Figure 3:''' Fermentation of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863012</partinfo> (TTHL) in a Bioengineering NFL22. Conditions: 12&nbsp;L of [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol at 37&nbsp;°C, pH&nbsp;7. Agitation increased when pO<sub>2</sub> was below 50&nbsp;% and OD<sub>600</sub> was measured each hour.]]<br />
<div style="text-align:justify;"><br />
Another scale-up of the fermentation of ''E. coli'' Rosetta-Gami 2 with <partinfo>BBa_K863012</partinfo> was made up to a final working volume of 12 L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined as well as the glycerin concentration. The data are illustrated in Figure 3. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autodinduction medium] was used to produce more biomass. Due to the change of media and to a low amount of cells for inocculation, there was a long lag phase of about 6 hours. During this phase the glycerin concentration is nearly constant. The cells were in an exponential phase between 8 and 18 hours of cultivation, which results in a decrease of gylcerin, of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 18 hours of cultivation the maximal OD<sub>600</sub> of 9.63 was reached and the glycerin was completely consumed. At that time the cells were just entering the stationary phase. No further data for OD<sub>600</sub> were measured. The cells have been harvested after 22 hours of cultivation. In the review, to leave the cells longer in the stationary phase could have been a better procedure concerning the yield.<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
===Since Regionals: Purification of TTHL since Regionals===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer] and mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization]. The cell debris were removed by centrifugation and microfiltration via [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50]. The supernatant of the cell lysate was concentrated with [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50] with 10 kDa and loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazole) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazole) with a length of 80&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazole) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the TTHL elution is shown in Figure 4:<br />
</p><br />
<br />
[[File:Bielefeld2012 TTHL Chromatogramm.jpg|450px|thumb|left|'''Figure 4:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His-tag Purification of TTHL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' Rosetta Gami 2 with <partinfo>BBa_K863012</partinfo>. TTHL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazole) with a maximal UV-detection signal of 123&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
Contrary to our expectations, the chromatogram shows one distinguished peak. This peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 100&nbsp;% (equates to 500&nbsp;mM imidazole) and resulted from the elution of bound protein. Earlier measurements of other bacterial laccases showed that the elution of these laccases begins with a elution buffer concentration of 50&nbsp;% equates to 250&nbsp;mM imidazole. One explanation of this result could be a low concentration of the produced TTHL. Consequently all elution fractions were analyzed by SDS-PAGE to detect TTHL. In the chromatogram no further peaks were detected. The following increasing UV detection signal by increasing concentration of the elution buffer results from the rising imidazole concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 5.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019thermo.jpg|300px|thumb|left|'''Figure 5:''' SDS-Page of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 BBa_K863012]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 5 the SDS-Page of the Ni-NTA purification of the lysed ''E.coli'' Rosetta-Gami 2 culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 BBa_K863012] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The HIS-tagged TTHL has a molecular weight of 53 kDa. Apparently the concentration of TTHL is too low to see a band. <br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Activity analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL]==<br />
<br />
===Initial activity tests of purified fractions===<br />
<p align="justify"><br />
There was no activity measurable after cultivation and purification of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BBa_K863022] under the control of a T7 promoter. Activity tests of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] under a constitutive promoter did reveal TTHL laccases capable of oxidizing ABTS. Fractions 1 to 5 of the purification above were rebuffered with deionized H<sub>2</sub>O and incubated with 0.4 mM CuCl<sub>2</sub> for 2 hours. Activity measurements were performed using 140 µL sample, 0.1 mM ABTS and 100 mM sodium acetate buffer (pH 5) to a final volume of 200 µL. The change in optical density at 420 nm was detected, reporting the oxidization of ABTS through laccases. Fractions 1 to 5 show activity (Figure 6). Fraction 2 seems to contain most of TTHL showing the highest activity compared to the other fractions: 40 % of the used ABTS has been oxidized after 2 hours. Based on these results protein concentrations have to be determined and the activity of the TTHL laccase can be characterized in further experiments including pH optimum and activity in regard of temperature shifts.<br />
[[File:Bielefeld2012_17_09_TTHL1.jpg|thumbnail|450px|center|'''Figure 6:''' Activity test of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] fractions resulting from the purification. Reaction setup includes 140 µL fraction sample (CuCl<sub>2</sub> incubated), 0.1 mM ABTS and 100 mM sodium actetate buffer (pH 5) to a final volume of 200 µL. Measurements were done at 25 °C and over a time period of 5 hours. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] shows activity in oxidizing ABTS except fractions 1 seems to have no active [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL]. (n=4)]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
The purificated fractions of the cultivation after the Regional Jamborees in Amsterdam were tested concerning their [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein concentration]. After re-buffering the [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th protein concentration] was determined again and all fraction were incubated with 0.4 mM CuCl<sub>2</sub>. For the initial activity test the protein amount was adjusted for comparison. The fractions were measured in Britton-Robinson buffer at pH 5 with 0.1 mM ABTS. Fraction 50 % 1 showed the highest activity (Fig. 7). Regarding the protein amount of this fraction and the statement, that 90 % of this are TTHL laccase, fraction 50 % 1 contains 4,03 µg mL<sup>-1</sup>. To ensure enough protein for further experiments, the second best fraction, which is fraction 5 % 3 was added to fraction 50 % 1. In total, both fraction contain [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_19th/ 4,4 µg mL<sup>-1</sup>].<br />
[[File:Bielefeld2012_new_TTHL_activity.jpg|500px|thumb|center|'''Figure 7''': Activity assay of each purified fraction of the new cultivation with TTHL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] activity depending on different ABTS concentrations===<br />
<br />
In order to find the substrate saturation, laccase activity was measured with ABTS concentrations ranging from 0.1 mM to 8 mM. 616 ng TTHL laccase were used for measurements with ABTS concentrations of 0.1 mM to 5 mM, 308 ng TTHL laccase were used for measurements with ABTS concentrations of 5 mM to 8 mM. Measurements were done in Britton-Robinson buffer (pH 5) at 25 °C for 30 minutes taking the OD<sub>420</sub> every 5 minutes. Comparing the graphs in Figure 8 and Figure 9, the substrate saturation is not reached with 5 mM ABTS. An application of 8 mM shows less oxidized ABTS as measurements with 7 mM ABTS. Further experiments were done with 7 mM ABTS.<br />
<br />
[[File:Bielefeld2012_TTHL_klein_ABTS.jpg|thumb|left|360px|'''Figure 8:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng TTHL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 0.1 mM to 5 mM.]]<br />
[[File:Bielefeld2012_TTHL_hoch.jpg|thumb|right|360px|'''Figure 9:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 308 ng TTHL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5 mM to 8 mM. An ABTS concentration of 7 mM was determined as substrate saturated.]]<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] pH optimum===<br />
<br />
[[File:Bielefeld2012_Thermo_pH_Foto.png|thumb|right|200px|'''Figure 10:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 5 the darkest color has been reached.]]<br />
<br />
The pH of the medium containing the enzyme is very important for its activity. The pH optimum of TTHL is at pH 5. This is the result of activity measurements using Britton-Robinson buffer with differently adjusted pHs. TTHL laccase was re-buffered into H<sub>2</sub>O and incubated with 0.4 mM CuCl<sub>2</sub>. The range from pH 4 to pH 9 was tested under substrate saturation at 25&nbsp;°C for 30 minutes. At pH 5 ABTS gets oxidized the fastest (see Fig. 10). At higher and lower pHs than pH 5, the activity of TTHL is decreased considerably. The resulting Units mg<sup>-1</sup> support the observed data (see Fig. 12). At pH 5 TTHL shows a specific enzyme activity of ~15 U mg<sup>-1</sup>. The higher the pH, the less U mg-1 can be calculated for TTHL. At pH 4 and 6 the activity is decreased to 42 % and at pH 7 even to 14 % in comparison to pH 5. But still TTHL is active at this pH allowing an application of this laccase in a waste water treatment plant where the average pH is a pH of 6.9. However, a combination with a more effective enzyme should be considered.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_TTHL_pH_new.jpg|thumb|left|360px|'''Figure 11:''' Oxidized ABTS by TTHL laccases at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated TTHL laccase (308 ng), Britton Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH&nbsp;5.]]<br />
[[File:Bielefeld2012_TTHL_pH_Units.jpg|thumb|right|360px|'''Figure 12:''' Calculated specific enzyme activity of TTHL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012 TTHL Temp ABTSox.jpg|left|200px|thumb|'''Figure 13''': Standard activity test for TTHL measured at 10&nbsp;°C and 25&nbsp;°C resulting in a decreased activity at 10&nbsp;°C. As a negative control the impact of 0.4&nbsp;mM CuCl<sub>2</sub> in oxidizing ABTS at 10&nbsp;°C and 25&nbsp;°C were analyzed.]]<br />
[[File:Bielefeld2012 TTHL Temp Units.jpg|right|200px|thumb|'''Figure 14''': Deriving from the obtained values of oxidized ABTS in time at 10&nbsp;°C and 25&nbsp;°C the specific enzyme activity was calculated. For the temperatures a difference of 2&nbsp;U mg<sup>-1</sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of TTHL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests as described above were performed at 10&nbsp;°C and 25&nbsp;°C. The measurements were conducted for 30 minutes. The obtained results reveal an activity decrease of about 35&nbsp;% of TTHL at 10&nbsp;°C in comparison to 25&nbsp;°C (see Fig. 13). The obtained results were used to calculate the specific enzyme activity which was at 13 and 15&nbsp;U mg<sup>-1</sup>, respectively (see Fig. 14). The negative control without TTHL laccase but 0.4 mM CuCl<sub>2</sub> at 10&nbsp;°C and 25&nbsp;°C show a negligible oxidation of ABTS. The low difference observed between the two samples is great news for the possible application in waste water treatment plants.<br />
<br><br><br><br><br><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
/partinfo>. The maximal OD</div>Fougeehttp://2012.igem.org/File:Bielefeld2012_1019thermo.jpgFile:Bielefeld2012 1019thermo.jpg2012-10-27T01:50:28Z<p>Fougee: </p>
<hr />
<div></div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/thermoTeam:Bielefeld-Germany/Results/thermo2012-10-27T01:49:31Z<p>Fougee: /* Since Regionals: SDS-Page of protein purification */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase LttH from <a href="http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzresources_pi5"> <i>Thermus thermophilus</i> HB27 (ATCC7061)</a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
Initially some trials of shaking flask cultivations were made with different parameters to identify the best conditions for the production of the His-tagged laccase LttH from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzreso ''Thermus thermophilus'' HB27] named TTHL. Due to the absence of enzyme activity of the enzyme in the cell lysate a purification method was established (using Ni-NTA-His tag resin). Using ''E. coli'' KRX containing BioBrick <partinfo>BBa_K863010</partinfo>, TTHL could not be detected by SDS-PAGE (molecular weight of 53&nbsp;kDa) or by activity test. Therefore a new BioBrick <partinfo>BBa_K863012</partinfo> was constructed and expressed in ''E. coli'' Rosetta-Gami&nbsp;2. With this expression system the TTHL could be detected by SDS-PAGE and purified by using a small scale Ni-NTA column. The fractionated samples were tested regarding their activity. TTHL was shown to oxidize ABTS. After measuring activity of TTHL a scale up of the fermentation was successfully implemented up to 6&nbsp;L. A further scale up to 12 L with a optimized medium (HSG) and a labscale Ni-NTA-Purification were implemented to enable additional experiments to characterize TTHL.<br />
<br />
<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Shaking Flask Cultivation===<br />
<div style="text-align:justify;"><br />
The first trials to produce the LttH-laccase from [http://www.dsmz.de/catalogues/details/culture/DSM-7039.html?tx_dsmzresources_pi5 ''Thermo thermophilus'' HB27] (named TTHL) were performed in shaking flasks with various volumes (from 100&nbsp;mL up to 1&nbsp;L flasks, with and without baffles) and under different cultivation conditions. The best cultivation condition for <partinfo>BBa_K863010</partinfo> expressed in E. coli was screened by varying the temperature, the chloramphenicol concentration,induction strategy and cultivation time. Furthermore, ''E. coli'' was cultivated with and without 0.25&nbsp;mM CuCl<sub>2</sub> in the medium to provide a sufficient amount of copper, which is needed for bilding the active center. Under the screened conditions no biological active TTHL could be produced. Therefore another BioBrick was constructed and another chassi was chosen. To improve the expression another BioBrick <partinfo>BBa_K863012</partinfo> was used, which has a constitutive promoter instead of the T7 promoter system. Additionally, the strain ''E. coli'' Rosetta-Gami 2 was chosen, because of its ability to translate rare codons. TTHL was then produced under the following conditions: <br />
</div><br />
* flask design: shaking flask without baffles<br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#LB_medium LB-Medium]<br />
* antibiotics: 60&nbsp;µg&nbsp;mL<sup>-1</sup> chloramphenicol and 300&nbsp;µg&nbsp;mL<sup>-1</sup> ampicillin<br />
* temperature: 37&nbsp;°C<br />
* cultivation time: 24&nbsp;h<br />
<br />
The reproducibility of the measured data and results were investigated for the shaking flask cultivation, but not yet for the bioreactor cultivation.<br />
<br />
===Fermentation of ''E. coli'' KRX with <partinfo>BBa_K863012</partinfo>===<br />
<br />
<br />
<br />
<br />
[[File:Bielefeld2012_TTHL6LFermentation.jpg|450px|thumb|left|'''Figure 1:''' Fermentation of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863012</partinfo> (TTHL) in a Bioengineering NFL22. Conditions: 6&nbsp;L of [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60&nbsp;µg/mL chloramphenicol at 37&nbsp;°C, pH&nbsp;7. Agitation increased when pO<sub>2</sub> was below 30&nbsp;% and OD<sub>600</sub> was measured each hour.]]<br />
<div style="text-align:justify;"><br />
After measuring activity of TTHL we made a scale-up and cultivated ''E.&nbsp;coli'' Rosetta-Gami 2 expressing <partinfo>BBa_K863000</partinfo> in a Bioengineering NFL22 fermenter with a total volume of 6&nbsp;L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were online monitored and are illustrated in Figure 1. No initial lag phase was noticeable. Due to the cell growth the pO<sub>2</sub> decreased,breakdown of the control unit resulted in a drop to 0%. After a cultivation time of 9&nbsp;hours the agitation speed was therefore increased manually up to 500&nbsp;rpm, which resulted in a higher pO<sub>2</sub> value of more than 100&nbsp;% for the rest of the cultivation. During the whole process the OD<sub>600</sub> increased slower compared to the fermentation of ''E.&nbsp;coli'' KRX expressing <partinfo>BBa_K863000</partinfo> or <partinfo>BBa_K863005</partinfo>. The maximal OD<sub>600</sub> was reached after 19 hours cultivation time at which point the cells were harvested.<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
===Purification of TTHL===<br />
<br />
<br />
<p align="justify"><br />
The cells were harvested by centrifugation and resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibrationbuffer], mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation high pressure homogenization] and centrifuged. After preparing the cell paste the TTHL could not be purified with the 15&nbsp;mL column, due to a not available column. For this reason a small scale purification (6&nbsp;mL) of the supernatant of the homogenisation was made with a 1&nbsp;mL Ni-NTA-column. <br />
</p><br />
<br />
===SDS-PAGE of purified TTHL===<br />
<div style="text-align:justify;"><br />
[[File:Bielefeld2012_0923.jpg|450px|thumb|left|'''Figure&nbsp;2:''' SDS-PAGE of purified ''E. coli'' Rosetta-Gami&nbsp;2 containing <partinfo>BBa_K863012</partinfo> lysate (fermented in 6 L Bioengineering NFL22). The flow-through, wash and elution fraction 1 to 5 are shown. The arrow marks the TTHL band with a molecular weight of 53&nbsp;kDa.]]<br />
<br />
Figure 2 shows the SDS-PAGE of the purified ''E.&nbsp;coli'' Rosetta-Gami 2 lysates fermented in 6&nbsp;L Bioengineering NFL22 fermenter. Additionally the flow-through, wash and all elution fractions (1 to 5) are shown. TTHL has a molecular weight of 53&nbsp;kDa and the corresponding band is marked with a red arrow. The TTHL band can be found in fractions 1 to 3, but not in the other two elution fractions. Furthermore there are some other non-specific bands, which could not be identified. To improve the purification an 15&nbsp;mL column was implemented.<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: 12 L Fermentation of ''E. coli'' Rosetta Gami 2 with [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 BBa_K863012]===<br />
<br />
[[File:Bielefeld2012_TTHL12L.jpg|450px|thumb|left|'''Figure 3:''' Fermentation of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863012</partinfo> (TTHL) in a Bioengineering NFL22. Conditions: 12&nbsp;L of [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg/mL chloramphenicol at 37&nbsp;°C, pH&nbsp;7. Agitation increased when pO<sub>2</sub> was below 50&nbsp;% and OD<sub>600</sub> was measured each hour.]]<br />
<div style="text-align:justify;"><br />
Another scale-up of the fermentation of ''E. coli'' Rosetta-Gami 2 with <partinfo>BBa_K863012</partinfo> was made up to a final working volume of 12 L in a Bioengineering NFL 22 fermenter. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined as well as the glycerin concentration. The data are illustrated in Figure 3. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autodinduction medium] was used to produce more biomass. Due to the change of media and to a low amount of cells for inocculation, there was a long lag phase of about 6 hours. During this phase the glycerin concentration is nearly constant. The cells were in an exponential phase between 8 and 18 hours of cultivation, which results in a decrease of gylcerin, of pO<sub>2</sub> value and therefore in an increase of agitation speed. After 18 hours of cultivation the maximal OD<sub>600</sub> of 9.63 was reached and the glycerin was completely consumed. At that time the cells were just entering the stationary phase. No further data for OD<sub>600</sub> were measured. The cells have been harvested after 22 hours of cultivation. In the review, to leave the cells longer in the stationary phase could have been a better procedure concerning the yield.<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
===Since Regionals: Purification of TTHL since Regionals===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA- equilibration buffer] and mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization]. The cell debris were removed by centrifugation and microfiltration via [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50]. The supernatant of the cell lysate was concentrated with [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50] with 10 kDa and loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazole) with a length of 50&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazole) with a length of 80&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazole) with a length of 80&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In Figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the TTHL elution is shown in Figure 4:<br />
</p><br />
<br />
[[File:Bielefeld2012 TTHL Chromatogramm.jpg|450px|thumb|left|'''Figure 4:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His-tag Purification of TTHL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' Rosetta Gami 2 with <partinfo>BBa_K863012</partinfo>. TTHL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazole) with a maximal UV-detection signal of 123&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
Contrary to our expectations, the chromatogram shows one distinguished peak. This peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 100&nbsp;% (equates to 500&nbsp;mM imidazole) and resulted from the elution of bound protein. Earlier measurements of other bacterial laccases showed that the elution of these laccases begins with a elution buffer concentration of 50&nbsp;% equates to 250&nbsp;mM imidazole. One explanation of this result could be a low concentration of the produced TTHL. Consequently all elution fractions were analyzed by SDS-PAGE to detect TTHL. In the chromatogram no further peaks were detected. The following increasing UV detection signal by increasing concentration of the elution buffer results from the rising imidazole concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 5.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019thermo.jpg|300px|thumb|left|'''Figure 1:''' SDS-Page of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 BBa_K863012]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 1 the SDS-Page of the Ni-NTA purification of the lysed ''E.coli'' Rosetta-Gami 2 culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 BBa_K863012] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The HIS-tagged TTHL has a molecular weight of 53 kDa. Apparently the concentration of TTHL is too low to see a band. <br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Activity analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL]==<br />
<br />
===Initial activity tests of purified fractions===<br />
<p align="justify"><br />
There was no activity measurable after cultivation and purification of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BBa_K863022] under the control of a T7 promoter. Activity tests of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] under a constitutive promoter did reveal TTHL laccases capable of oxidizing ABTS. Fractions 1 to 5 of the purification above were rebuffered with deionized H<sub>2</sub>O and incubated with 0.4 mM CuCl<sub>2</sub> for 2 hours. Activity measurements were performed using 140 µL sample, 0.1 mM ABTS and 100 mM sodium acetate buffer (pH 5) to a final volume of 200 µL. The change in optical density at 420 nm was detected, reporting the oxidization of ABTS through laccases. Fractions 1 to 5 show activity (Figure 6). Fraction 2 seems to contain most of TTHL showing the highest activity compared to the other fractions: 40 % of the used ABTS has been oxidized after 2 hours. Based on these results protein concentrations have to be determined and the activity of the TTHL laccase can be characterized in further experiments including pH optimum and activity in regard of temperature shifts.<br />
[[File:Bielefeld2012_17_09_TTHL1.jpg|thumbnail|450px|center|'''Figure 6:''' Activity test of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] fractions resulting from the purification. Reaction setup includes 140 µL fraction sample (CuCl<sub>2</sub> incubated), 0.1 mM ABTS and 100 mM sodium actetate buffer (pH 5) to a final volume of 200 µL. Measurements were done at 25 °C and over a time period of 5 hours. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] shows activity in oxidizing ABTS except fractions 1 seems to have no active [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL]. (n=4)]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
The purificated fractions of the cultivation after the Regional Jamborees in Amsterdam were tested concerning their [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_16th/ protein concentration]. After re-buffering the [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_17th protein concentration] was determined again and all fraction were incubated with 0.4 mM CuCl<sub>2</sub>. For the initial activity test the protein amount was adjusted for comparison. The fractions were measured in Britton-Robinson buffer at pH 5 with 0.1 mM ABTS. Fraction 50 % 1 showed the highest activity (Fig. 7). Regarding the protein amount of this fraction and the statement, that 90 % of this are TTHL laccase, fraction 50 % 1 contains 4,03 µg mL<sup>-1</sup>. To ensure enough protein for further experiments, the second best fraction, which is fraction 5 % 3 was added to fraction 50 % 1. In total, both fraction contain [https://2012.igem.org/Team:Bielefeld-Germany/Amsterdam/Labjournal#Tuesday_October_19th/ 4,4 µg mL<sup>-1</sup>].<br />
[[File:Bielefeld2012_new_TTHL_activity.jpg|500px|thumb|center|'''Figure 7''': Activity assay of each purified fraction of the new cultivation with TTHL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction has been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] activity depending on different ABTS concentrations===<br />
<br />
In order to find the substrate saturation, laccase activity was measured with ABTS concentrations ranging from 0.1 mM to 8 mM. 616 ng TTHL laccase were used for measurements with ABTS concentrations of 0.1 mM to 5 mM, 308 ng TTHL laccase were used for measurements with ABTS concentrations of 5 mM to 8 mM. Measurements were done in Britton-Robinson buffer (pH 5) at 25 °C for 30 minutes taking the OD<sub>420</sub> every 5 minutes. Comparing the graphs in Figure 8 and Figure 9, the substrate saturation is not reached with 5 mM ABTS. An application of 8 mM shows less oxidized ABTS as measurements with 7 mM ABTS. Further experiments were done with 7 mM ABTS.<br />
<br />
[[File:Bielefeld2012_TTHL_klein_ABTS.jpg|thumb|left|360px|'''Figure 8:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng TTHL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 0.1 mM to 5 mM.]]<br />
[[File:Bielefeld2012_TTHL_hoch.jpg|thumb|right|360px|'''Figure 9:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 308 ng TTHL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5 mM to 8 mM. An ABTS concentration of 7 mM was determined as substrate saturated.]]<br />
<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] pH optimum===<br />
<br />
[[File:Bielefeld2012_Thermo_pH_Foto.png|thumb|right|200px|'''Figure 10:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color the more ABTS got oxidized. At pH 5 the darkest color has been reached.]]<br />
<br />
The pH of the medium containing the enzyme is very important for its activity. The pH optimum of TTHL is at pH 5. This is the result of activity measurements using Britton-Robinson buffer with differently adjusted pHs. TTHL laccase was re-buffered into H<sub>2</sub>O and incubated with 0.4 mM CuCl<sub>2</sub>. The range from pH 4 to pH 9 was tested under substrate saturation at 25&nbsp;°C for 30 minutes. At pH 5 ABTS gets oxidized the fastest (see Fig. 10). At higher and lower pHs than pH 5, the activity of TTHL is decreased considerably. The resulting Units mg<sup>-1</sup> support the observed data (see Fig. 12). At pH 5 TTHL shows a specific enzyme activity of ~15 U mg<sup>-1</sup>. The higher the pH, the less U mg-1 can be calculated for TTHL. At pH 4 and 6 the activity is decreased to 42 % and at pH 7 even to 14 % in comparison to pH 5. But still TTHL is active at this pH allowing an application of this laccase in a waste water treatment plant where the average pH is a pH of 6.9. However, a combination with a more effective enzyme should be considered.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_TTHL_pH_new.jpg|thumb|left|360px|'''Figure 11:''' Oxidized ABTS by TTHL laccases at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated TTHL laccase (308 ng), Britton Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidized ABTS can be detected at pH&nbsp;5.]]<br />
[[File:Bielefeld2012_TTHL_pH_Units.jpg|thumb|right|360px|'''Figure 12:''' Calculated specific enzyme activity of TTHL at different pH conditions. The highest specific enzyme activity for ABTS is under pH 5 conditions. The higher the pH, the less ABTS gets oxidized. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863012 TTHL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012 TTHL Temp ABTSox.jpg|left|200px|thumb|'''Figure 13''': Standard activity test for TTHL measured at 10&nbsp;°C and 25&nbsp;°C resulting in a decreased activity at 10&nbsp;°C. As a negative control the impact of 0.4&nbsp;mM CuCl<sub>2</sub> in oxidizing ABTS at 10&nbsp;°C and 25&nbsp;°C were analyzed.]]<br />
[[File:Bielefeld2012 TTHL Temp Units.jpg|right|200px|thumb|'''Figure 14''': Deriving from the obtained values of oxidized ABTS in time at 10&nbsp;°C and 25&nbsp;°C the specific enzyme activity was calculated. For the temperatures a difference of 2&nbsp;U mg<sup>-1</sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br />
To investigate the activity of TTHL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests as described above were performed at 10&nbsp;°C and 25&nbsp;°C. The measurements were conducted for 30 minutes. The obtained results reveal an activity decrease of about 35&nbsp;% of TTHL at 10&nbsp;°C in comparison to 25&nbsp;°C (see Fig. 13). The obtained results were used to calculate the specific enzyme activity which was at 13 and 15&nbsp;U mg<sup>-1</sup>, respectively (see Fig. 14). The negative control without TTHL laccase but 0.4 mM CuCl<sub>2</sub> at 10&nbsp;°C and 25&nbsp;°C show a negligible oxidation of ABTS. The low difference observed between the two samples is great news for the possible application in waste water treatment plants.<br />
<br><br><br><br><br><br />
<br />
<br />
<br style="clear: both" /><br />
<br />
<br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
/partinfo>. The maximal OD</div>Fougeehttp://2012.igem.org/File:Bielefeld2012_1019halo.jpgFile:Bielefeld2012 1019halo.jpg2012-10-27T01:45:24Z<p>Fougee: </p>
<hr />
<div></div>Fougeehttp://2012.igem.org/Team:Bielefeld-Germany/Results/haloTeam:Bielefeld-Germany/Results/halo2012-10-27T01:44:09Z<p>Fougee: /* Since Regionals: SDS-Page of protein purification */</p>
<hr />
<div>{{Team:Bielefeld/Head}}<br />
<html><br />
<a href="https://2012.igem.org/Team:Bielefeld-Germany/Results/Summary#3"><img src="http://2012.igem-bielefeld.de/includes/wiki/images/Pfeil_links2.png"></a><br />
<div id=page-title><br />
<span id=page-title-text><br />
Laccase Lbh1 from <a href="http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5"> <i>Bacillus halodurans</i> C-125 </a><br />
</span><br />
</div><br />
<div id="grey_bg"><br />
<br />
<h1>Summary</h1><br />
<br />
<p class="more"> <br />
</html><br />
First some trials of shaking flask cultivations were made with various parameters to identify the best conditions for production of the His tagged laccase Lbh1 from [http://www.dsmz.de/catalogues/details/culture/DSM-18197.html?tx_dsmzresources_pi5 ''Bacillus halodurans'' C-125 ] named BHAL. Due to inactivity of the enzyme in the cell lysate a purification method was established (using Ni-NTA-Histag resin). BHAL could not be detected by SDS-PAGE (theoretical molecular weight of 56&nbsp;kDa) or activity test by using the BioBrick <partinfo>BBa_K863020</partinfo> and ''E. coli'' KRX as expression system. Due to this results the new BioBrick <partinfo>BBa_K863022</partinfo> was constructed and expressed ''E. coli'' Rossetta-Gami&nbsp;2. With this expression system the laccase could be produced and analysed via SDS-PAGE. A small scale Ni-NTA-column was used to purify the laccase. The fractionated samples were tested regarding their activity with ABTS and showed ability in oxidizing ABTS. A scale up to 12 L with a optimized medium (HSG) and a labscale Ni-NTA-Purification were implemented to enable additional experiments to characterize BHAL. <br />
<br />
<br />
<html><br />
</p><br />
</html><br />
__TOC__<br />
<br />
==Cultivation, Purification and SDS-PAGE==<br />
===Cultivation===<br />
<div style="text-align:justify;"> <br />
The first trials to produce the Lbh1 - laccase from ''Bacillus halodurans'' (named BHAL) were performed in shaking flasks with various flask designs (from 100 mL to 1 L flasks, with and without baffles) and under several conditions. The varied parameters in our screening experiments were temperature (27 °C, 30 °C and 37 °C), concentration of chloramphenicol (20 - 170 µg mL<sup>-1</sup>), induction strategy (autoinduction and manual induction with 0,1 % rhamnose) and cultivation time (6 to 24 h). Furthermore cultivation was performed with and without addition of 0.25 mM CuCl<html><sub>2</sub></html> to provide a sufficient amount of copper, which is needed for the active center of the laccase. ''E.coli'' KRX was not able to produce active BHAL under the tested conditions, therefore another chassis was chosen. For further cultivations ''E. coli'' Rosetta-Gami 2 was transformed with BBa_K863012, because of its ability to translate rare codons. Finally BHAL was produced under the following conditions:<br />
</div><br />
* flask design: shaking flask without baffles <br />
* medium: [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#LB_medium LB-Medium] <br />
* antibiotics: 60 µg mL<sup>-1</sup> chloramphenicol and 300 µg mL<sup>-1</sup> ampicillin <br />
* temperature: 37 °C <br />
* cultivation time: 24 h<br />
<br />
===Purification===<br />
<br />
<div style="text-align:justify;"> <br />
The cells were harvested and resuspended in Ni-NTA-equilibration buffer, mechanically lysed by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Sonication sonification] and centrifuged. After preparing the cell paste the BHAL laccase could not be purified with the 15 mL Ni-NTA column, because the column was not available. For this reason a small scale purification (6 mL) of the supernatant of the lysate was performed with a 1 mL [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Syringe_method Ni-NTA column]. The elution was collected in 1 mL fractions.<br />
</div><br />
<br />
===SDS-PAGE===<br />
<br />
<div style="text-align:justify;"> [[File:Bielefeld2012_0913.jpg|450px|thumb|left|'''Figure 1:''' SDS-PAGE of purified lysate derived from a flask cultivation of ''E. coli'' Rosetta-Gami 2 carrying <partinfo>BBa_K863022</partinfo>. Lanes 2 to 7 show the flow-through, the wash and the elution fractions 1 to 4. BHAL has a molecular weight of 56 kDa and is marked with an arrow.]]<br />
<br />
In figure 1 the different fractions of the purified cell lysate of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo> are shown in a SDS-PAGE. BHAL has a molecular weight of 56 kDa. In lane 5, which corresponds to the elution fraction 2, a faint band of 56 kDa is visible. Therefore the fractions were further analysed by activity test and MALDI-TOF.<br />
</div><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: 12L Fermentation of ''E. coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo>===<br />
<br />
[[File:Bielefeld2012_BHAL12L.jpg|450px|thumb|left|'''Figure 2:''' Fermentation of ''E.&nbsp;coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo> (BHAL) in a Bioengineering NFL22. Conditions: 12&nbsp;L of [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autoinduction medium] + 60&nbsp;µg mL <sup> -1 </sup> chloramphenicol at 37&nbsp;°C, pH&nbsp;7. Agitation increased when pO<sub>2</sub> was below 50&nbsp;% and OD<sub>600</sub> was measured each hour. The glycerin concentration was measured on important points of the cultivation with [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#Carbon_source_measurement_with_HPLC HPLC].]]<br />
<div style="text-align:justify;"><br />
After measuring the BHAL activity a scale-up was performed and ''E. coli'' Rosetta-Gami 2 with <partinfo>BBa_K863022</partinfo> was cultivated in a Bioengineering NFL 22 fermenter with a total volume of 12 L. Agitation speed, pO<sub>2</sub> and OD<sub>600</sub> were determined as well as the glycerin concentration. The data are illustrated in Figure 2. This time [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#HSG_Autoinduction_medium HSG autodinduction medium] was used to produce more biomass. Due to the change of media and to a low amount of cells for inoculation there was a long lag phase of nearly 10 hours. During this phase the glycerin concentration was approximately constant. The following cell growth caused a decrease of glycerin concentration and of pO<sub>2</sub>. After 11 hours the value fell below 50 %, so that the agitation speed increased automatically. After 21 hours the deceleration phase started and therefore the agitation speed decreased. The maximal OD<sub>600</sub> of 9.9 was reached after 22 hours, when the cells entered the stationary phase. The glycerin was completely consumed. The cells were harvested at this time. It might have been better to cultivate a few hours longer.<br />
<br />
<br style="clear: both" /><br />
</div><br />
<br />
===Since Regionals: Purification of BHAL===<br />
<br />
<p align="justify"><br />
The harvested cells were resuspended in [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer] and mechanically disrupted by [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Production#Mechanical_lysis_of_the_.28bio-reactor.29_cultivation homogenization]. The cell debris were removed by centrifugation and microfiltration via [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50]. The supernatant of the cell lysate was concentrated with [http://www.millipore.com/catalogue/module/C7493 Millipore Pellicon XL 50] with 10 kDa and loaded on the Ni-NTA column (15&nbsp;mL Ni-NTA resin) with a flow rate of 1&nbsp;mL min<sup>-1</sup> cm<sup>-2</sup>. Then the column was washed with 10&nbsp;column&nbsp;volumes (CV) [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA equilibration buffer]. The bound proteins were eluted by an increasing [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA elution buffer] step elution from 5&nbsp;% (equates to 25&nbsp;mM imidazol) with a length of 80&nbsp;mL, to 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a length of 80&nbsp;mL and finally to 100&nbsp;% (equates to 500&nbsp;mM imidazol) with a length of 90&nbsp;mL. This strategy was chosen to improve the purification caused by a step by step increasing Ni-NTA-elution buffer concentration. The elution was collected in 10&nbsp;mL fractions. In figure 3 only the UV-detection signal of the wash step and the elution are shown, this is because of the high UV-detection signal of the loaded samples and to simplify the illustration of the detected product peak. A typical chromatogram of purified laccases is illustrated [https://static.igem.org/mediawiki/2012/4/49/Bielefeld2012_Chromatogram_examplegrafik.jpg here]. The chromatogram of the BHAL elution is shown in Figure 5:<br />
</p><br />
<br />
[[File:Bielefeld2012_BHAL_Chromatogramm.jpg|450px|thumb|left|'''Figure 3:''' Chromatogram of wash and elution fractions from FLPC Ni-NTA His-tag Purification of BHAL produced by 12&nbsp;L fermentation of ''E.&nbsp;coli'' Rosetta Gami 2 with <partinfo>BBa_K863022</partinfo>. BHAL was eluted by a concentration of 50&nbsp;% (equates to 250&nbsp;mM imidazol) with a maximal UV-detection signal of 123&nbsp;mAU. ]]<br />
<br />
<p align="justify"><br />
The chromatogram shows two distinguished peaks. The first peak was detected at a Ni-NTA-equilibration buffer concentration of 5 % (equates to 25 mM imidazol) and resulted from the elution of weakly bound proteins. Contrary to our expectations, the chromatogram shows the second distinguished peak. This peak was detected at a [https://2012.igem.org/wiki/index.php?title=Team:Bielefeld-Germany/Protocols/Materials#Buffers_for_His-Tag_affinity_chromatography Ni-NTA-equilibration buffer] concentration of 100&nbsp;% (equates to 500&nbsp;mM imidazol) and resulted from the elution of bound protein. Earlier measurements of other bacterial laccases showed that the elution of these laccases begins with a elution buffer concentration of 50&nbsp;%(equates to 250&nbsp;mM imidazol). One explanation of this result could be a low concentration of the produced BHAL. Consequently all elution fractions were analyzed by SDS-PAGE to detect BHAL. In the chromatogram no further peaks were detected. The following increasing UV detection signal by increasing concentration of the eltutionbuffer results from the rising imidazol concentration of the Ni-NTA elution buffer. The corresponding SDS-PAGES are shown in Figure 4.<br />
</p><br />
<br style="clear: both" /><br />
<br />
===Since Regionals: SDS-Page of protein purification===<br />
[[File:Bielefeld2012_1019halo.jpg|300px|thumb|left|'''Figure 1:''' SDS-Page of purification from the 12&nbsp;L fermentations from 10/11 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BBa_K863022]). Purification of the supernatant via microfiltration, diafiltration and Ni-NTA column (step gradient with 5&nbsp;%, 50&nbsp;% and 100&nbsp;% elution buffer).]]<br />
<br />
In Figure 1 the SDS-Page of the Ni-NTA purification of the lysed ''E.coli'' Rosetta-Gami 2 culture containing [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BBa_K863022] is illustrated. It shows the permeate and retentate of microfiltration and diafiltration respectively, several fractions of flow-through, wash and the elutions with different buffer concentrations respectively. The selected samples were taken where peaks were seen in the chromatogram. The HIS-tagged BPUL has a molecular weight of 56 kDa. Apparently the concentration of BHAL is too low to see a band. <br />
<br />
<br />
<br style="clear: both" /><br />
<br />
==Activity Analysis of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL]==<br />
<p align="justify"><br />
<br />
===Initial activity tests of purified fractions===<br />
<br />
The resulting fractions of the cultivation and purification of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] (fraction 1 to 5) were analysed with activity tests. After rebuffering into deionized H<sub>2</sub>O and incubation with 0.4 mM CuCl<sub>2</sub> for 2 hours, the samples were measured with 140&nbsp;µL sample, 0.1 mM ABTS, 100 mM sodium acetate buffer to a final volume of 200 µL. The change in optical density was measured at 420 nm, reporting the oxidation of ABTS for 5 hours at 25°C. An increase in ABTS<sub>ox</sub> can be seen (Figure 4), indicating produced [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] laccase in each fraction. Fraction 2 shows the highest amount of ABTS<sub>ox</sub> (55%) reaching saturation after 3 hours. Similar to [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863000 BPUL] laccase, [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] is capable to reach saturation after 3 hours with approximately oxidizing 55% of the supplied ABTS. Therefore [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] is going to be characterized further.<br />
[[File:Bielefeld2012_17_09_BHAL1.jpg|thumbnail|center|500px|'''Figure 4''': Activity test of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] fractions after purification. Reaction setup includes 140 µL fraction sample (CuCl2 incubated), 0.1 mM ABTS and 100 mM sodium actetate buffer (pH 5) to a final volume of 200 µL. Measurements were done at 25°C and over a time period of 5 hours. Each fraction shows activity, especially fraction 2, which therefore contains most [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] laccase. (n=4)]]<br />
<br />
<br />
<br />
===Since Regionals: Initial activity tests of purified fractions===<br />
<br />
Different fractions of the purification of a new cultivation since the Regional Jamborees in Amsterdam were tested regarding their activity of the produced BHAL. Before and after re-buffering the protein concentration was determined. The initial activity tests were done in Britton-Robinson buffer (pH 5) with 0.1 mM ABTS at 25 °C. The protein amount was adjusted in each sample for a comparison. One distinct fraction showed the highest activity: fraction 5% 3 (Fig. 5). The contained laccase amount was calculated by assuming that the most active fraction contains 90 % laccase. This leads to a BHAL concentration of 10,9 ng mL<sup>-1</sup>.<br />
[[File:Bielefeld2012_new_BHAL_activity.jpg|500px|thumb|center|'''Figure 5:''' Activity assay of each purified fraction of recent produced BHAL. Samples were re-buffered into H<sub>2</sub>O and the protein amount in each fraction had been adjusted. The measurements were done using the [https://2012.igem.org/Team:Bielefeld-Germany/Protocols/Analytics#General_setup_of_enzyme_activity_measurements/ standard activity assay protocol] over night. The first number indicates the percentage of used elution buffer, whereas the second number stands for the fraction number of this elution.]]<br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] activity depending on different ABTS concentrations===<br />
<br />
To be able to calculate the activity in Units mg<sup>-1</sup>, measurements had to be done under substrate saturation. This allows the comparison of Units mg<sup>-1</sup> with other laccase activities and data found in literature. For this purpose ABTS concentrations ranging from 0.1 mM to 8 mM were applied in an experimental setup containing Britton-Robinson buffer (pH) and a temperature of 25 °C. For measurements with 0.1 mM to 5 mM ABTS 616 ng BHAL were used (Fig. 6). For measurements with 5 mM to 8 mM ABTS only 308 ng BHAL were applied (Fig. 7). Applying less than 7 mM ABTS a static increase in oxidized ABTS was given. Measurements with 8 mM ABTS showed a slower increase in oxidized ABTS as with 7 mM ABTS (Fig. 7). This may be due to a substrate toxication. The most compromising ABTS concentration was 7 mM with the highest increase in oxidized ABTS. Therefore a substrate saturation was reached with 7 mM ABTS.<br />
[[File:Bielefeld2012_BHAL_klein_ABTS.jpg|thumb|left|360px|'''Figure 6:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 616 ng BHAL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 0.1 mM to 5 mM.]]<br />
[[File:Bielefeld2012_BHAL_ABTS_hoch.jpg|thumb|right|360px|'''Figure 7:''' Activity assay to determine the substrate saturation with ABTS as a substrate. Measurements were done with 308 ng BHAL laccase in Britton-Robinson buffer (pH 5) at 25 °C. ABTS concentrations ranged from 5 mM to 8 mM. An ABTS concentration of 7 mM was determined as substrate saturated.]]<br />
<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] pH optimum===<br />
<br />
[[File:Bielefeld2012_Halo_pH_Foto.png|thumb|right|200px|'''Figure 6:''' Microtiter plate of the measurements for pH optimum determination. The more intensive the blue color, the more ABTS got oxidized. At pH 4 and pH 5 the darkest colour was detected.]]<br />
To determine the optimal experimental setup for BHAL activity measurements the best pH had to be determined. Using Britton-Robinson buffer pHs between pH 4 and pH 9 had been adjusted. 308 ng BHAL per well had been tested under these pH conditions using 7 mM ABTS. The CuCl<sub>2</sub> incubated and therefor activated BHAL showed a high activity at pH 4 and pH 5, where most of ABTS was oxidized (compared to Fig. 6 and 7). The calculated specific enzyme activity of BHAL showed high activity at both mentioned pHs (Fig. 8). While BHAL had an activity of ~8 U mg<sup>-1</sup> at pH 4 and pH 5, the enzyme activity decreased at higher pHs. At a pH of 6 only 1/3 of enzyme activity could be detected compared to the activity at pH 4 and pH 5. While still active at pH 7, the BHAL is not as suitable as thought for an application at a waste water treatment plant because of its high activity in acidic environments.<br />
<br style="clear: both" /><br />
[[File:Bielefeld2012_BHAL_pH_new.jpg|thumb|360px|left|'''Figure 7:''' Oxidized ABTS by BHAL at different pH adjustments. The experimental setup included CuCl<sub>2</sub> incubated BHAL (308 ng), Britton Robinson buffer adjusted to the tested pHs and 5 mM ABTS. Measurements were done at 25 °C for 30 minutes. The most amount of oxidzed ABTS could be detected at pH 4 and pH 5.]]<br />
[[File:Bielefeld2012_BHAL_pH_Units.jpg|thumb|360px|right|'''Figure 8:''' Calculated specific enzyme activity of BHAL at different pH conditions. The highest specific enzyme activity for ABTS was under pH 4 and pH 5 conditions. The higher the pH, the less ABTS got oxidzed. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
<br style="clear: both" /><br />
<br />
===Since Regionals: [http://partsregistry.org/wiki/index.php?title=Part:BBa_K863022 BHAL] activity at different temperatures===<br />
<br />
[[File:Bielefeld2012 BHAL Temp ABTSox.jpg|left|200px|thumb|'''Figure 9:''' Standard activity test for BHAL measured at 10 °C and 25 °C resulting in a decreased activity at 10 °C. As a negative control the impact of 0.4 mM CuCl<sub>2</sub> in oxidizing ABTS at 10 °C and 25 °C was analyzed.]]<br />
[[File:Bielefeld2012 BHAL Temp Units.jpg|right|200px|thumb|'''Figure 10:''' Deriving from the obtained values of oxidized ABTS in time at 10 °C and 25 °C the specific enzyme activity was calculated. For the temperatures a difference of 3 U mg<sup>-1</sup> could be detected. One unit is defined as the amount of laccase that oxidizes 1 μmol of ABTS substrate per minute.]]<br />
To investigate the activity of BHAL at temperatures that will apply at a waste water treatment plant throughout the year, activity tests were performed at 10 °C and 25 °C as described above. The measurements were conducted for 30 minutes. The obtained results revealed a lower activity of BHAL at 10 °C in comparison to 25 °C (see Fig. 9). The obtained results were used to calculate the specific enzyme activity which was at 4.2 and 7.2 U mg<sup>-1</sup>, respectively (see Figure 10). The negative control without BHAL but 0.4 mM CuCl<sub>2</sub> at 10 °C and 25 °C showed a negligible oxidation of ABTS. The activity of BHAL was increased to about 60 % at 10 °C but nevertheless the observed activity at both conditions was great news for the possible application in waste water treatment plants.<br />
<br><br><br><br><br />
<br style="clear: both" /><br />
<br />
==Substrate Analysis==<br />
<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'') a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br />
== Substrate Analysis ==<br />
[[File:Bielefeld2012_Ohne_ABTS.png|400px|thumb|right|'''Figure 2: Degradation of estradiol (dark green) and ethinyl estradiol (light green) with the different laccases after 5 hours without ABTS.''' In the graph it is shown that the bought laccase TVEL0 which was used as positive control is able to degrade more than 90 percent of the used substrates. None of the bacterial laccases are able to degrade ethinyl estradiol without ABTS but estradiol is degraded in a range from 16&nbsp;%(ECOL) to 55&nbsp;% (TTHL). The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
<br />
The measurements were made to test if the produced laccases were able to degrade different hormones. Therefore the produced laccases were inserted in the same concentrations (3 µg mL<sup>-1</sup>) to the different measurement approaches. To work with the correct pH value (which were measured by the Team Activity Test) Britton Robinson buffer at pH&nbsp;5 was used for all measurements. The initial substrate concentration was 5 µg mL<sup>-1</sup>. The results of the reactions without ABTS are shown in Figure 2. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are indicated. The X-axis displays the different tested laccases. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 30&nbsp;°C. The negative control was the substrate in Britton Robinson buffer and showed no degradation of the substrates. The bought laccase TVEL0 which is used as positive control is able to degrade 94.7&nbsp;% estradiol and 92.7&nbsp;% ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 35.9&nbsp;% of used estradiol after five hours. ECOL was able to degrade 16.8&nbsp;% estradiol. BHAL degraded 30.2&nbsp;% estradiol. The best results were determined with TTHL (laccase from ''Thermus thermophilus''). Here the percentage of degradation amounted 55.4&nbsp;%. <br />
<br />
[[File:Bielefeld2012_Mit_ABTS.png|400px|thumb|left|'''Figure 3: Degradation of estradiol (blue) and ethinyl estradiol (red) with the different laccases after 10 minutes hours with ABTS added.''' The commercial laccase TVEL0 which was used as positive control is able to degrade all of the used substrates. The bacterial laccase BPUL degraded 100 % of ethinyl estradiol and estradiol. ECOL the laccase from ''E. coli'' degraded 6.7&nbsp;% estradiol and none of the used ethinyl estradiol. BHAL degraded 46.9&nbsp;% of estradiol but no ethinyl estradiol. The laccase TTHL from ''Thermus thermophilus'' degraded 29.5&nbsp;% of estradiol and 9.8&nbsp;% ethinyl estradiol. The original concentrations of substrates were 2 µg per approach. (n&nbsp;=&nbsp;4)]]<br />
<br />
The results of the reactions of the laccases with addition of ABTS are shown in Figure 3. The experimental set ups were the same as the reaction approach without ABTS described above. The X-axis displays the different tested laccases. On the Y-axis the percentages of degraded estradiol (blue) and ethinyl estradiol (red) are shown. The degradation was measured at t<sub>0</sub> and after five hours of incubation at 20&nbsp;°C. The negative control showed no degradation of estradiol. 6.8&nbsp;% of ethinyl estradiol was decayed. The positive control TVEL0 is able to degrade 100&nbsp;% estradiol and ethinyl estradiol. The laccase BPUL (from ''Bacillus pumilus'') degraded 46.9&nbsp;% of used estradiol after ten minutes incubation. ECOL was able to degrade 6.7&nbsp;% estradiol. BHAL degraded 46.9&nbsp;% estradiol. With TTHL (laccase from ''Thermus thermophilus'')a degradation 29.5&nbsp;% were determined.<br />
<br style="clear: both" /><br />
<br style="clear: both" /><br />
<br />
</p><br />
<br />
<html><br />
<br />
<br />
<br />
<br />
</div><br />
</html><br />
<br />
{{Team:Bielefeld/Sponsoren}}<br />
/div><br />
/p></div>Fougeehttp://2012.igem.org/File:Bielefeld2012_1019pumi.jpgFile:Bielefeld2012 1019pumi.jpg2012-10-27T01:37:33Z<p>Fougee: </p>
<hr />
<div></div>Fougee